KR102158718B1 - SNP marker for diagnosis of intracranial aneurysm comprising SNP of CUL4A gene - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker composition for diagnosing an intracranial aneurysm, comprising an SNP of the CUL4A gene; a composition for diagnosing an intracranial aneurysm comprising an agent capable of detecting or amplifying the SNP marker; a kit for diagnosing an intracranial aneurysm comprising the composition; and a method of providing information for diagnosing an intracranial aneurysm using the composition and the kit. According to the SNP marker composition for diagnosing an intracranial aneurysm, the composition for diagnosing an intracranial aneurysm, the kit for diagnosing an intracranial aneurysm, and the method for providing information for diagnosing an intracranial aneurysm of the present invention, an SNP on the CUL4A gene can be used as a marker for predicting or diagnosing the risk of developing an intracranial aneurysm in a Korean or Asian population.

Description

SNP marker for diagnosis of cerebral aneurysm including single nucleotide polymorphism of CUL4A gene {SNP marker for diagnosis of intracranial aneurysm comprising SNP of CUL4A gene}

The present invention comprises a CUL4A gene SNP, a cerebral aneurysm diagnosis SNP marker composition, a cerebral aneurysm diagnosis composition comprising an agent capable of detecting or amplifying the SNP marker, a cerebral aneurysm diagnosis kit comprising the composition, and the composition And a method of providing information for diagnosing a cerebral aneurysm using a kit.

A cerebral aneurysm refers to a defect in a part of a cerebral artery and a protruding part. That is, when a part of the cerebral blood vessel is weak, it means that the blood vessel wall is stretched and bulging out in a crimson shape. It has been thought that the cause of cerebral aneurysms is that the vascular wall of the branch of the cerebral artery is congenital weak, but in recent years, it has become important to develop a cerebral aneurysm caused by continuous stress applied to the vascular wall. In addition, smoking, high blood pressure, It has been found that arteriosclerosis and direct aneurysm in two or more cases act as risk factors. Most of the causes of cerebral aneurysm rupture are spontaneous subarachnoid hemorrhage. In the case of a ruptured cerebral aneurysm, computed tomography (CT) and cerebral angiography are used. In the case of a ruptured cerebral aneurysm, magnetic resonance angiography (MRA) is used. However, the above method is not only cumbersome, but also has a problem that it is difficult to predict the prognosis or before the onset of a cerebral aneurysm.

Genome-wide association study (GWAS) refers to a research method that comprehensively explores genetic factors for disease and drug responsiveness, and is the first research method attempted by the Ozaki (2002) group of the Japanese Institute of Physical Science and Chemistry. . With the completion of the HapMap project and the rapid development of microarray technology, full-length genome scanning for gene polymorphism has become a routine task, and hundreds of full-length genome association analyzes GWAS have been successfully performed, related to common diseases such as cardiovascular disease and diabetes. It is leading the discovery of a number of known or novel genetic variants. In addition, these technologies provide a powerful means for the identification of genetic polymorphisms associated with the diagnosis of various diseases.

Accordingly, the present inventors have endeavored to develop a method for efficiently and easily diagnosing the onset of cerebral aneurysms, predicting the risk of onset, and predicting the prognosis. The invention was completed.

Republic of Korea Patent Publication No. 10-2017-0134203

The first aspect of the present application is to provide a SNP marker composition for diagnosing a cerebral aneurysm, including rs74115822, which is a single nucleotide polymorphism (SNP) of the CUL4A (cullin 4A) gene.

A second aspect of the present application is to provide a composition for diagnosing a cerebral aneurysm, including an agent capable of detecting or amplifying rs74115822, which is the SNP of the CUL4A gene.

A third aspect of the present application is to provide a kit for diagnosing a cerebral aneurysm, including a composition for diagnosing a cerebral aneurysm.

A fourth aspect of the present application is to provide a method of providing information for diagnosing a cerebral aneurysm, comprising determining an allele of rs74115822, a SNP of the CUL4A gene, from a biological sample isolated from an individual.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application belong to the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.

The first aspect of the present application provides a SNP marker composition for diagnosing a cerebral aneurysm, including rs74115822, which is a single nucleotide polymorphism (SNP) of the CUL4A (cullin 4A) gene.

The term "SNP (single nucleotide polymorphism)" as used throughout this specification refers to single nucleotide polymorphism. SNP is a common mutation that appears in one of several DNA bases in a single site of a chromosome. It is distributed throughout, thereby causing genetic diversity of individuals In the present application, the “SNP marker” may be named interchangeably with “SNP”.

The term "marker" used throughout the specification of the present application means a biomarker and can detect changes in a living organism, thereby objectively measuring the normal or pathological state of the living organism, and the degree of reaction to a drug.

The term "cerebral aneurysm or brain aneurysm" as used throughout the present specification is also referred to as intracranial aneurysm. IA, and weakening of the wall of a cerebral artery or a cerebral vein is caused by local expansion of blood vessels or balloon expansion. It is a cerebrovascular disease that causes (ballooning). A common location for a cerebral aneurysm is an artery at the base of the brain, known as the Circle of Willis. About 85% of cerebral aneurysms occur in the anterior part of the Willis ring and include the internal carotid arteries and their major branches that supply blood to the anterior and middle parts of the brain. Cerebral aneurysms are classified by size and shape. Small aneurysm has a diameter of less than 15 mm. Larger 　 aneurysms include 　 aneurysms classified as large (15-25 mm), giant (25-50 mm), and super giant (> 50 mm). A saccular aneurysm is an aneurysm with saccular outpouching and is the most common form of cerebral aneurysm. Strawberry-like aneurysms are cystic aneurysms with a strawberry-like neck or stem. Fusiform aneurysm (fusiform aneurysm) is a stemless 　 aneurysm.

According to the exemplary embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm of the present application may diagnose the onset of a cerebral aneurysm, predict the risk of developing a cerebral aneurysm, or predict the prognosis of a cerebral aneurysm, but is not limited thereto.

The term "diagnosis", as used throughout the present specification, means determining whether a cerebral aneurysm has already occurred in a specific individual.

The term "prediction" as used throughout the present specification is to determine whether there is a possibility of developing a cerebral aneurysm in a specific individual, or whether the likelihood of developing a cerebral aneurysm is relatively high compared to a large number of unspecified individuals. it means.

According to one embodiment of the present application, rs74115822, which is the SNP of the CUL4A gene, may include the 26th nucleotide of SEQ ID NO: 6, and the allele of the base of rs74115822 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs74115822 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs74115822 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.80) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

The term "allele" or "allele" as used throughout this specification refers to multiple types of a gene present at the same locus of a homologous chromosome. Alleles are sometimes used to represent 　 polymorphism, for example 　SNP has two or more types, for example, two types of alleles.

According to one embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm is 1) rs75822236, which is a SNP of the GBA (Glucocerebrosidase) gene, 2) rs112859779, which is a SNP of the TCF24 (transcription factor 24) gene, 3) OLFML2A (Olfactomedin Like 2A) The SNP of the gene rs79134766, 4) The SNP of the ARHGAP32 (Rho GTPase Activating Protein 32) gene rs371331393, 5) The SNP of the CD163L1 (CD163 Molecule Like 1) gene rs138525217, 6) The SNP of the LOC102724084 gene rs75861150, 7) LRRC3 ( Leucine rich repeat containing 3) SNP of gene rs116969723, 8) RNF144A (Ring Finger Protein 144A) SNP of rs6741819, 9) FLJ45964 SNP of rs59626274, 10) SPCS3 (Signal Peptidase Complex Subunit 3) SNP of gene rs17688188, 11) LINGO2 (Leucine Rich Repeat And Ig Domain Containing 2) gene SNP rs56942085, and 12) MINK1 (misshapen/Nck-interacting kinase (NIK)-related kinase 1) selected from the group consisting of rs72835045 gene SNP It may be to further include one or more SNPs, but is not limited thereto.

According to the exemplary embodiment of the present application, rs75822236, which is the SNP of the GBA (Glucocerebrosidase) gene, may include the 26th nucleotide of SEQ ID NO: 1, and the allele of the base of rs75822236 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs75822236 is C or the allele of its complementary base is G, it is possible to diagnose the occurrence of a cerebral aneurysm or to predict the risk of the onset at a high level. According to an embodiment of the present application, it was confirmed that rs75822236 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs112859779, which is the SNP of the TCF24 gene, may include the 26th nucleotide of SEQ ID NO: 2, and the allele of the base of rs112859779 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs112859779 is C or the allele of its complementary base is G, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs112859779 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.94) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs79134766, which is the SNP of the OLFML2A gene, may include the 26th nucleotide of SEQ ID NO: 3, and the allele of the base of rs79134766 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs79134766 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs79134766 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.96) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs371331393, which is the SNP of the ARHGAP32 gene, may include the 26th nucleotide of SEQ ID NO: 4, and the allele of the base of rs371331393 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs371331393 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs371331393 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs138525217, which is the SNP of the CD163L1 gene, may include the 26th nucleotide of SEQ ID NO: 5, and the allele of the base of rs138525217 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs138525217 is C or the allele of its complementary base is G, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs138525217 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to the exemplary embodiment of the present application, rs75861150, which is the SNP of the LOC102724084 gene, may include the 26th nucleotide of SEQ ID NO: 7, and the allele of the base of rs75861150 may be T or C. According to an embodiment of the present invention, when the allele of the base of rs75861150 is C or the allele of its complementary base is G, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs75861150 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs116969723, which is the SNP of the LRRC3 gene, may include the 26th nucleotide of SEQ ID NO: 8, and the allele of the base of rs116969723 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs116969723 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing it may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs116969723 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.81) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs6741819, which is the SNP of the RNF144A gene, may include the 26th nucleotide of SEQ ID NO: 9, and the allele of the base of rs6741819 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs6741819 is T or the allele of its complementary base is A, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs6741819 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.72) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm can do.

According to the exemplary embodiment of the present application, rs59626274, which is the SNP of the FLJ45964 gene, may include the 26th nucleotide of SEQ ID NO: 10, and the allele of the base of rs59626274 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs59626274 is T or the allele of its complementary base is A, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs59626274 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.71) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs17688188, which is the SNP of the SPCS3 gene, may include the 26th nucleotide of SEQ ID NO: 11, and the allele of the base of rs17688188 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs17688188 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an exemplary embodiment of the present application, it was confirmed that rs17688188 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.73) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to the exemplary embodiment of the present application, rs56942085, which is the SNP of the LINGO2 gene, may include the 26th nucleotide of SEQ ID NO: 12, and the allele of the base of rs56942085 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs56942085 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs56942085 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.78) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, rs72835045, which is the SNP of the MINK1 gene, may include the 26th nucleotide of SEQ ID NO: 13, and the allele of the base of rs72835045 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs72835045 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs72835045 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.79) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.

According to one embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 205th base (rs2303656) of the sequence of SEQ ID NO: 14 in the LOX (lysyl oxidase) gene, or A complementary polynucleotide, a polynucleotide consisting of 10 or more consecutive bases including the 488th base (rs3900446) of the sequence of SEQ ID NO: 15, or a complementary polynucleotide thereof, the 678th base (rs763497) of the sequence of SEQ ID NO: 15 A polynucleotide composed of 10 or more consecutive bases, or a complementary polynucleotide thereof, and a combination thereof may be additionally included, but are not limited thereto.

According to an embodiment of the present invention, when the allele of the 205th base of SEQ ID NO: 14 is T or the allele of its complementary base is A, the allele of the 205th base of SEQ ID NO: 14 is G or its It can be predicted that the risk of developing a cerebral aneurysm is lower than when the allele of the complementary base is C.

According to an embodiment of the present invention, when the allele of the 488th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, the allele of the 488th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or the development of a cerebral aneurysm can be diagnosed.

According to an embodiment of the present invention, when the allele of the 678th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, the allele of the 678th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or the development of a cerebral aneurysm can be diagnosed.

According to an embodiment of the present invention, the allele of the 488th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, and the allele of the 678th base of SEQ ID NO: 15 is G or its complementary When the allele of the base base is C, the allele of the 488th base of SEQ ID NO: 15 is A or the allele of the complementary base is T, and the allele of the 678th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or the development of a cerebral aneurysm can be diagnosed.

According to one embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 (SRY-box 17) gene. Or it may be to further include a complementary polynucleotide thereof, but is not limited thereto.

According to an embodiment of the present invention, when the allele of the 326th base of SEQ ID NO: 38 is C or the allele of its complementary base is G, the allele of the 326th base of SEQ ID NO: 38 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than when the allele of the complementary base is T.

Genetic information of the SNP contained in the SNP marker composition for diagnosing a cerebral aneurysm according to an embodiment of the present application can be obtained from a known database, for example, GenBank of the National Center for Biotechnology Information (NCBI). And the like, but are not limited thereto.

According to the exemplary embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm may be used to diagnose a cerebral aneurysm in Koreans and Asians, but is not limited thereto.

A second aspect of the present application provides a composition for diagnosing a cerebral aneurysm, including an agent capable of detecting or amplifying rs74115822, which is a SNP of the CUL4A gene. The content overlapping with the first aspect also applies to the composition for diagnosing a cerebral aneurysm of the second aspect.

According to one embodiment of the present application, the composition for diagnosing a cerebral aneurysm comprises 1) rs75822236, which is a SNP of the GBA gene, 2) rs112859779, which is a SNP of the TCF24 gene, 3) rs79134766, which is a SNP of the OLFML2A gene, 4) rs371331393, which is a SNP of the ARHGAP32 gene, 5) rs138525217, a SNP of the CD163L1 gene, 6) rs75861150, a SNP of the LOC102724084 gene, 7) rs116969723, a SNP of the LRRC3 gene, 8) rs6741819, a SNP of the RNF144A gene, 9) rs59626274, a SNP of the FLJ45964 gene, 10) of the SPCS3 gene. It may further include an agent capable of detecting or amplifying one or more SNPs selected from the group consisting of SNPs rs17688188, 11) LINGO2 SNPs rs56942085, and 12) MINK1 SNPs rs72835045, but is limited thereto. It does not become.

As used throughout the specification of the present application, the term "agent capable of detecting SNP" refers to an agent capable of specifically binding and recognizing the SNP marker or SNP contained in the SNP marker composition, or detecting and amplifying the SNP. Means, "an agent capable of amplifying a SNP marker" refers to an agent capable of increasing the number of SNP markers or SNPs contained in the SNP marker composition by repeating replication, for example, including the SNP It may refer to a primer capable of specifically amplifying the polynucleotide or a probe capable of specifically binding, but is not limited thereto.

The primers used for the SNP amplification are under appropriate conditions (e.g., 4 different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) and a template-directed DNA synthesis under an appropriate temperature. It may be a single-stranded oligonucleotide that can serve as a starting point of, and the appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the polynucleotide containing the SNP, but must be sufficiently complementary to hybridize with the polynucleotide containing the SNP.

The term "primer" as used throughout the present specification is a base sequence having a short free 3'hydroxyl group, which can form a base pair with a complementary template, and the template strand copy Refers to a short sequence that functions as a starting point for Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. At this time, PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.

The probe used for SNP detection may refer to a hybridization probe, and refers to an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid. Hybridization conditions should be sufficiently stringent so that only one of the alleles hybridizes to show a significant difference in hybridization strength between alleles. It is preferable that the central region of the probe of the present invention is aligned with the polymorphic region of the polymorphic sequence. Accordingly, a good hybridization difference between different allelic forms can be induced. The probe may be used in a kit such as a microarray or a prediction method for diagnosing cerebral aneurysms by detecting alleles. The probes of interest can be labeled to detect, for example, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Appropriately labeling such a probe is a technique well known in the art, and can be performed through a conventional method.

According to the exemplary embodiment of the present disclosure, the primer or probe may be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, e.g., uncharged linkers (e.g. methyl phosphonate, phosphotriester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).

According to one embodiment of the present application, rs74115822, which is the SNP of the CUL4A gene, may include the 26th nucleotide of SEQ ID NO: 6, and the allele of the base of rs74115822 may be G or A.

According to one embodiment of the present application, the composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 205th base (rs2303656) of the sequence of SEQ ID NO: 14 in the LOX (lysyl oxidase) gene or a complementary thereof. Polynucleotide, a polynucleotide consisting of 10 or more consecutive bases including the 488th base (rs3900446) of the sequence of SEQ ID NO: 15, or a complementary polynucleotide thereof, comprising the 678th base of the sequence of SEQ ID NO: 15 (rs763497) A polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof, and an agent capable of detecting or amplifying a combination thereof may be additionally included, but is not limited thereto.

According to one embodiment of the present application, the composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 (SRY-box 17) gene, or It may further include an agent capable of detecting or amplifying the complementary polynucleotide, but is not limited thereto.

A third aspect of the present application provides a kit for diagnosing a cerebral aneurysm, including the composition for diagnosing a cerebral aneurysm. The content overlapping with the first side and the second side also applies to the second side of the cerebral aneurysm diagnosis kit.

According to one embodiment of the present application, the kit may be a PCR kit, an RT-PCR kit, or a DNA chip kit, but is not limited thereto.

According to one embodiment of the present application, the kit may include SNP, polynucleotide, cDNA, etc. of the present application, as well as other constituent compositions, solutions, or devices suitable for analysis methods.

According to the exemplary embodiment of the present disclosure, the PCT kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform PCR. PCR kits, in addition to the polynucleotides, primers or probes specific for the SNP, test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase. Enzymes such as, DNase, RNAse inhibitor, DEPC-water and sterile water may be included.

According to one embodiment of the present application, the DNA chip kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform a DNA chip, and the DNA chip kit includes a specific polynucleotide, primer, or probe for the 　SNP. It includes a substrate to which it is attached, and the substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.

According to one embodiment of the present application, the RT-PCR kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform RT-PCR, and the RT-PCR kit is each primer specific for the SNP. In addition to test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterilized water, and the like may be included.

A fourth aspect of the present application provides a method of providing information for diagnosing a cerebral aneurysm, comprising determining an allele of rs74115822, a SNP of the CUL4A gene, from a biological sample isolated from an individual. The content overlapping with the first to third aspects also applies to the method of providing information for diagnosing a cerebral aneurysm of the fourth aspect.

According to the exemplary embodiment of the present disclosure, the diagnosis of a cerebral aneurysm of the present application may be diagnosing the onset of a cerebral aneurysm, predicting the risk of developing a cerebral aneurysm, or diagnosing the prognosis of a cerebral aneurysm, but is not limited thereto.

As used throughout the specification, the term "individual" refers to any organism that has or is likely to develop a cerebral aneurysm, and specific examples include mammals including mice, monkeys, cows, pigs, mini pigs, livestock, humans, etc. It may include animals, farmed fish, etc., but is not limited thereto.

As used throughout the specification, the term "sample" refers to a substance derived from an individual who develops or is likely to develop a cerebral aneurysm, and specifically, tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine It may include, but is not limited thereto. In addition, a gene sample may be obtained from these samples, and the gene sample may include a nucleic acid, for example, DNA, mRNA, or cDNA synthesized from mRNA, and as long as the base information of the SNP can be confirmed therefrom, The kind is not limited thereto.

According to the exemplary embodiment of the present disclosure, the individual may be a human, and specifically, may be a Korean or Asian, but is not limited thereto.

According to one embodiment of the present application, in order to perform risk prediction or diagnosis of the individual, further comprising the step of analyzing non-genetic information, wherein the non-genetic information is sex, age, hypertension, diabetes, It may be one or more selected from the group consisting of hyperlipidemia, smoking, family history of aneurysms, biochemical scales, and clinical scales.

According to an exemplary embodiment of the present disclosure, determining the base of the SNP in the information providing method may mean a step of confirming the genotype of the SNP. The step of confirming the genotype of SNP includes sequencing analysis, e.g., sequencing analysis using an automatic sequencing analyzer, pyrosequencing, hybridization by microarray, PCR-RELP (restriction fragment length polymorphism) method, PCR -SSCP (single strand conformation polymorphism) method, PCR-SSO (specific sequence oligonucleotide) method, ASO (allele specific oligonucleotide) hybridization method combining PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF/MS method , Rolling circle amplification (RCA) method, high resolution melting (HRM) method, primer extension method, Southern blot hybridization method, dot hybridization method, and the like. Specifically, the step of determining the base of the SNP in the method for providing information of the present application includes, for example, sequencing a nucleotide sequence containing the SNP site from a nucleic acid isolated from a sample obtained from a subject, and determining the SNP allele. It can be done by checking directly. Sequencing of the nucleotide sequence may be performed through a method known in the art. For example, sequencing of the base sequence is performed using a nucleic acid isolated from a sample obtained from an individual as a template, and performing PCR using a primer capable of amplifying a gene site including each SNP site, and the PCR reaction product It can be accomplished by sequentially performing the step of confirming the sequence by the restriction enzyme cleavage method.

According to one embodiment of the present application, rs74115822, which is the SNP of the CUL4A gene, may include the 26th nucleotide of SEQ ID NO: 6, and when the allele of rs74115822 is G, it is diagnosed as developing a cerebral aneurysm or risk of developing it. It may be to further include the step of predicting to a high level.

According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm is from a biological sample isolated from an individual, 1) rs75822236, which is the SNP of the GBA gene, 2) rs112859779, which is the SNP of the TCF24 gene, 3) the SNP of the OLFML2A gene. Phosphorus rs79134766, 4) rs371331393, a SNP of the ARHGAP32 gene, 5) rs138525217, a SNP of the CD163L1 gene, 6) rs75861150, a SNP of the LOC102724084 gene, 7) rs116969723, 8) rs116969723, a SNP of the LRRC3 gene, 9) rs6741819, a SNP of the RNF144A gene Determining the allele of one or more SNPs selected from the group consisting of rs59626274, 10) SNP of the SPCS3 gene, rs17688188, 11) rs56942085, which is the SNP of the LINGO2 gene, and 12) rs72835045, the SNP of the MINK1 gene. It may be to further include.

According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm includes 1) when the allele of rs75822236, which is the SNP of the GBA gene, is C, 2) when the allele of rs371331393, which is the SNP of the ARHGAP32 gene, is G, 3) If the allele of rs138525217, the SNP of the CD163L1 gene is C, 4) If the allele of the rs56942085, the SNP of the LINGO2 gene, is G, or a combination of two or more of them, it is diagnosed as developing or onset of a cerebral aneurysm. It may be to further include a step of predicting the risk at a high level.

According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm includes 1) when the allele of rs112859779, which is the SNP of the TCF24 gene, is T, 2) when the allele of rs79134766, which is the SNP of the OLFML2A gene, is A, 3) When the allele of rs75861150, the SNP of the LOC102724084 gene is C, 4) When the allele of rs116969723, the SNP of the LRRC3 gene, is A, 5) When the allele of rs6741819, the SNP of the RNF144A gene is T, 6) When the allele of rs59626274, the SNP of the FLJ45964 gene is T, 7) When the allele of rs17688188, the SNP of the SPCS3 gene, is A, 8) When the allele of rs72835045, the SNP of the MINK1 gene is A, or two of them In the case of the combination of the above, it may be to further include a step of diagnosing that a cerebral aneurysm has not occurred or predicting a risk of developing a low level.

According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm is from a biological sample isolated from an individual, the 205th base of the sequence of SEQ ID NO: 14 (rs2303656) in the LOX gene, the 488th of the sequence of SEQ ID NO: 15 The base (rs3900446), the 678th base (rs763497) of the sequence of SEQ ID NO: 15, and the allele of a combination thereof may be further included.

According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm further includes the step of confirming the allele of the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 gene from a biological sample isolated from the individual. It may be included as.

According to one embodiment of the present application, in the method for providing information for diagnosing a cerebral aneurysm, the results of the SNP polymorphism may be statistically processed using a statistical analysis method commonly used in the art, for example, Student t -Student's t-test, Chi-square test, linear regression line analysis, multiple logistic regression analysis, meta-analysis, etc. It can be analyzed using variables such as continuous variables, categorical variables, odds ratio (OR), and 95% confidence interval (CI).

According to the SNP marker composition for diagnosing cerebral aneurysm, the composition for diagnosing cerebral aneurysm, the kit for diagnosing cerebral aneurysm, and the method of providing information for diagnosing a cerebral aneurysm of the present invention, single nucleotide polymorphism (SNP) on the CUL4A gene is used for the onset of cerebral aneurysms in Koreans or Asians. It can be used as a marker for risk prediction or diagnosis.

<1. Development of 13 SNP markers for diagnosis of cerebral aneurysms>
1 is a diagram showing a procedure for diagnosing a cerebral aneurysm using SNP of the GBA gene.
2 is a diagram showing the GWAS results in a Manhattan flute. The red line indicates the significant critical (P-value= 5 x 10-8) of the full-length genome.
3 is a diagram showing a regional plot for the position ± 500 kb of the rs371331393 variant, which is a SNP of the ARHGAP32 gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, diabetes, hyperlipidemia, Smoking and coordinating four major factors) and rs371331393 in association with cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log ₁₀ . The purple rhombus represents the rs371331393 variant showing the most significant association in the present GWAS ( P = 9.3Х10 ^-27 ), and the gray circles represent other SNPs within 500kb of the rs371331393 variant.
4A is a diagram showing a regional plot for the location (± 500kb) of the rs6741819 variant, which is the SNP of the RNF144A gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Rs6741819 in diabetes, hyperlipidemia, smoking, and coordinating four major factors) and cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log ₁₀ . The purple rhombus represents the rs6741819 variant in the present GWAS ( P = 4.0Х10 ^-14 ), and the gray circles represent other SNPs within 500 kb of the rs6741819 variant.
4B is a diagram showing the expression level of the rs6741819 variant in adrenal tissue (n=175) using single-cell eQTL. The X axis represents the genotype and the Y axis represents the rank-normalized gene expression level. The reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
4C is a diagram showing a regional plot for the location (± 500kb) of the rs1052270 variant, the SNP of the TMOD1 gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Diabetes mellitus, hyperlipidemia, smoking, and coordinating the four major factors) show an association of rs1052270 with cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log ₁₀ . The purple rhombus represents the rs1052270 variant in the present GWAS ( P = 4.0Х10 ^-14 ), and the gray circles represent other SNPs within 500 kb of the rs1052270 variant.
4D is a diagram showing the expression level of the rs1052270 variant in testicular tissue (n=225) using single-cell eQTL. The X axis represents the genotype and the Y axis represents the rank-normalized gene expression level. The reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
5A is a diagram showing a regional plot for the location (± 500kb) of the rs6841581 variant, which is the SNP of the EDNRA gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Rs6741819 in diabetes, hyperlipidemia, smoking, and coordinating four major factors) and cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log ₁₀ . The purple rhombus represents the rs6841581 variant in the present GWAS ( P = 4.0Х10 ^-14 ), and the gray circles represent other SNPs within 500 kb of the rs6841581 variant.
5B and C show the esophagus (mucosa) (B) (358 samples, effect size = 0.38, p = 5.2Х10 ^-12 ) and the skin (upper pubic region) not exposed to sunlight using single-cell eQTL ( C) A diagram showing the expression level of the rs6841581 variant in (335 samples, effect size = 0.21, p = 1.2Х10 ^-6 ). The X axis represents the genotype and the Y axis represents the rank-normalized gene expression level. The reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
<2. Cerebral aneurysm diagnosis using SNP of LOX (Lysyl oxidase) gene>
6 shows the results of analysis of the association between cerebral aneurysms and 10 SNPs in Example 4.
7 shows the results of analysis of the haplotype association between cerebral aneurysms and 10 SNPs in Example 4.
<3. Cerebral aneurysm diagnosis using SNP of SOX17 (SRY-box 17) gene>
8 shows the results of analysis of the association between a cerebral aneurysm and four SNPs in Example 4.
9 shows the results of analysis of the association between cerebral aneurysm rupture and four SNPs in Example 4.

Hereinafter, the present application will be described in more detail through examples and experimental examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present application is not limited to these Examples and Experimental Examples.

<1. Development of 13 SNP markers for diagnosis of cerebral aneurysms>

Example 1: Experimental group and control group collection

The cohort for carrying out the present invention was derived from the Chuncheon Sacred Heart Hospital stroke database (2015-2018), and for database collection, patients showing clinical diagnosis and neuroimaging consistent with hemorrhagic or ischemic stroke were recruited, In the GWAS study, patients over 18 years of age with saccular and sporadic cerebral aneurysms were analyzed. In addition, non-cystic aneurysms, such as vertebral, anatomical, traumatic, and infectious aneurysms, and familial aneurysms were excluded.

The control group satisfied the following criteria: 1) Patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, and 2) no neurological disorders such as cerebral arteriovenous malformation, intracranial hemorrhage, or infarction. , 3) no family history of cerebral aneurysm or subarachnoid hemorrhage in close relatives, 4) no Parkinson's or Alzheimer's disease, and 5) over 18 years of age.

In addition, the medical records were reviewed in consideration of various variables such as gender, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, high blood pressure, diabetes, hyperlipidemia, smoking, and family history of aneurysms, and the size and location of aneurysms (anterior circulation Or posterior circulation), and angiographic parameters for number (singular or plural) were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2016-3, 2017-9).

Example 2: Genotyping and sample quality control

Genomic DNA was obtained from peripheral blood of the experimental group and the control group using the HiGene TM Genomic DNA Prep Kit (BIOFACT, Daejeon, Korea). For genotyping of the samples, AxiomTM Asia Precision Medicine Research Array (PMRA) containing 750,000 SNPs based on human genome version 19 (build 37), covering the Southeast Asian population, and containing 50,000 novel markers. ) Kit (Thermo Fisher Scientific, MA, USA) was used. Of the 798,148 variants including small indels, 508,192 variants passed the quality assessment test of the following criteria (genotype call rate = 95%, minor allele frequency (MAF) = 0.01, and Hardy-Weinberg Equilibrium (HWE) p-value = 1Х10 ^-6 ), GWAS was performed using the passed mutation.

Example 3: Statistical Analysis

Descriptive analysis is expressed using the number of subjects (percentages) of individual and categorical variables, and the mean is expressed as standard error. In the present invention, after removing the two missing values, a multivariate symbol having 7 confounding factors (gender, age, hypertension, diabetes, hyperlipemia, smoking and 4 major factors) for 250 cerebral aneurysms and 294 controls. A multivariate logistic analysis was performed, and the analysis was performed using STATA v11.2 (Stata Corp., TX, USA). In addition, full-length genome-related analysis was performed to identify candidate genetic mutations for cerebral aneurysm susceptibility under an additional loci effect model after adjusting the seven confounding factors, and the PLINK 1.9 program ( https://www.cog-genomics). .org/plink/1.9/ ) was used.

In addition, in order to calculate the statistical power for evaluating potential genetic reliability in GWAS, based on the following assumptions, the Genetic Power Calculator ( http://pngu.mgh.harvard.edu/~ purcell/gpc/ ) was used: 5% probability of developing cerebral aneurysm; Odds-ratio (OR) in the additive effect model; D-prime 0.8; A 1:1.18 experimental-control ratio; And a type 1 error rate of 5Х10 ^-8 (full-length significance level).

In addition, in a subsequent analysis, the genetic association between 151 patients with subarachnoid hemorrhage and 99 patients with non-ruptured cerebral aneurysm was evaluated, and to evaluate the genetic effect on the expression level of individual variants that show an association of the full-length genome in GWAS. , Genotype-Tissue Expression (GTEx v7) (https://gtexportal.org/home/) was used to analyze a single tissue expression quantitative trait loci (eQTL). The Manhattan plot and regional association plot are the " qqman " command ( https://cran.r-project.org/web/packages/qqman ) and LocusZoom v1 of the R package v3.4.0, respectively. 3 ( http://locuszoom.org/ ) was used.

Experimental Example 1: Confirmation of specific characteristics of the experimental group and the control group

Patients (experimental group) and control group (non-patient) were classified according to the criteria described in Example 1, and their characteristics are shown in Table 1 below. Specifically, out of 546, 250 were classified as intracranial aneurysm (IA) patients, and the remaining 296 were classified as non-patients (control). There was no statistical difference according to sex, hypertension (HTN), diabetes (Diabetes mellitus, DM), hyperlipidemia, and smoking between the two groups, and the control group was younger than the cerebral aneurysm patients (p <0.001). Among the cerebral aneurysms, 151 (60.4%) and 99 (39.6%) patients with subarachnoid hemorrhage (SAH) and unruptured intracranial aneurysm (UIA) were respectively. In addition, most of the patients with cerebral aneurysms were anterior-circulation aneurysms (n=221, 88.4%), and the anterior circulatory aneurysms were middle cerebral artery (n=71), anterior-circulation aneurysms. communicating artery) or anterior cerebral artery (n=50), internal carotid artery (n=38), and posterior communicating artery (n=53).

* a: The data in the table are expressed as the number of patients (%) and the mean ± standard error.

* b: P values are evaluated in a multivariate logical regression model.

* c: The main elements are estimated by performing main element analysis with 4 clusters.

Experimental Example 2: Full-length genetic association analysis (GWAS) result analysis

The following experiment was performed to discover SNP markers related to the onset of cerebral aneurysm.

First, after adjusting the confounding factors (age, sex, hypertension, diabetes, hyperlipidemia, smoking) and four principal components in the experimental group and control group identified in Experimental Example 1, the whole-length genome-wide association study, GWAS), a total of 315 SNPs (including indels) with a p-value of less than 1Х10 ^-5 were selected (Fig. 2).

Next, among the 315 SNPs, SNPs with a pairwise linkage disequilibrium of less than 0.8 were removed, and a p-value of less than 5 x 10 ^-8 , a genome-wide significance threshold, was removed. A total of 29 SNPs were selected. Details of the selected SNP are shown in Table 2 below.

* L95, lower 95% confidence interval; OR, odds ratio; U95, upper 95% confidence interval.

* a: M/m, major allele type/minor allele type

* b: MAF, minor allele frequency of the experimental group (left) and control group (right)

* c: OR, 95% confidence interval and P-value were estimated from multivariate logical regression analysis after correcting for age, sex, hypertension, diabetes, hyperlipidemia, smoking and four major factors.

* d: Statistical significance (power) of each SNP was estimated using the web-based Genetic Power Calculator ( http://zzz.bwh.harvard.edu/gpc/cc2.html ), and the following parameters were used. : 5% probability of developing cerebral aneurysm, MAF in control group, OR in additive effect model, D-prime 0.8; A 1:1.18 experimental-control ratio (296 control/250 experimental = 1.18), and a type 1 error ratio of 5Х10 ^-8 (full-length significance level).

* e: 1 SNP found in pairwise linkage disequilibrium (LD, r ² <0.8): rs7964241 and rs56168082 ( r ² =0.81); rs2440154 and rs2289668 ( r ² = 1.0)

Specifically, rs371331393 located on ARHGAP32 (11q24.3) showed the most significant association in the formation of a cerebral aneurysm (OR = 43.57, 95% confidence interval 21.84-86.95; p = 9.3Х10 ^-27 ) (Fig. 3) , Rs75822236 SNP located on the GBA gene also showed a significant association in the formation of cerebral aneurysms (OR = 161.46, 95% CI 53.86-483.60; p = 1.1 Х10 ^-19 ), and in the case of the mutation, "T" in the control group. "The allele was rare compared to the "C" allele in patients with cerebral aneurysms (MAF = 0.01 vs 0.33). In addition, the "T" allele in the rs138525217 SNP located on the 3'untranslated region (UTR) of the CD163L1 gene is rare and shows a large effect size (MAF experimental group/control = 0.31/0.01, OR = 75.98; p = 6.2Х10 ^-23 ).

In addition, four additional SNPs [rs75822236 (R535H, GBA , 1q22), rs112859779 (G141S, TCF24 , 8q13.1), rs79134766 (A208T, OLFML2A , 9q33.3), rs3744644 (E639D, SCARF1 , 17p13.3)] and An additional nonsense SNP, rs59626274 (stop-gained, FLJ45964 , 2q37.3), confirmed that there is a potential direct association with the protein encoded on the sequence.

In conclusion, in relation to the onset of cerebral aneurysm, SNPs located on the GBA , TCF24 , OLFML2A , ARHGAP32 , CD163L1 , CUL4A , LOC102724084 , and LRRC3 genes show statistical significance of 0.8 or more, and RNF144A , FLJ45964 SPCS3 , LINGO2 , and MINK1 genes The located SNP has a statistical significance of 0.7 to 0.8, and the 13 SNPs can be used to predict the risk of developing a cerebral aneurysm or to diagnose the onset.

Experimental Example 3: Single-cell eQTL analysis

The following experiment was performed to confirm whether the SNP marker selected in Experimental Example 2 was expressed in tissues.

Specifically, in single-cell eQTL (eQTL) analysis using more than 70 samples obtained from 45 human tissues, 3 SNPs showed significant differences in expression (p <1Х10 ^-5 ). Specifically, rs6741819 ( RNF144A , 2p25.1; p = 4.0Х10 ^-14 ) was down-regulated in adrenal tissue (175 samples, effect size = -0.36, p = 1.5Х10 ^-6 ) (Fig. 4A, B) , rs1052270 ( TMOD1 . 9q22.33; p = 2.7Х10 ^-8 ) was up-regulated in testicular tissues (225 samples, effect size = 0.42, p = 8.6Х10 ^-10 ) (Fig. 4C, D).

In addition, rs6841581 ( EDNRA , 4q31.22; p = 6.5Х10 ^-4 ) is the esophagus (mucous membrane) (358 samples, effect size = 0.38, p = 5.2Х10 ^-12 ) and skin that is not exposed to sunlight (superior pubis). (335 samples, effect size = 0.21, p = 1.2Х10 ^-6 ) was up-regulated in all (Fig. 5).

<2. Cerebral aneurysm diagnosis using SNP of LOX (Lysyl oxidase) gene>

Example 1. Research subject

We recruited 80 patients with cerebral aneurysms, which were radiographically confirmed to have a saccular shape in a single institution, and 80 controls matched with the age and sex of the patients in the patient group. In the cerebral aneurysm, fusiform or anatomical non-cystic aneurysm and traumatic or infectious aneurysm were excluded. The control group consisted of matched patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, excluding other neurological disorders such as arteriovenous malformations, intracranial hemorrhage or infarction. The medical records were reviewed in consideration of various variables such as sex, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, hypertension, diabetes, hyperlipidemia, smoking, and family history of aneurysms. Angiographic parameters for the size, location (anterior or posterior circulation), and number (singular or plural) of aneurysms were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2016-31).

As a result of the review, in the cerebral aneurysm patient group, the number of women was 43 (53.8%), and the average age was 57.1 ± 12.9 years. Symptoms of subarachnoid hemorrhage were found in 41 patients (51.3%). Regarding the aneurysm location, anterior circulatory aneurysm (n = 73, 91.3%) was recorded as follows: internal carotid artery, n = 15; Anterior or anterior cerebral artery, n = 21; Middle cerebral artery, n = 25; And posterior transit artery, n = 12. 75 patients (93.8%) had a single aneurysm, and no patients had a family history of subarachnoid hemorrhage. The incidence of hypertension, diabetes, hyperlipidemia, and smoking was not significantly different between the two groups.

Example 2. Single base polymorphism selection and examination

To investigate the association between single-base polymorphism on the LOX gene and the likelihood of developing a cerebral aneurysm, Japan and China from the LD TAG SNP selection (TagSNP) of SNPinfo (https://snpinfo.niehs.nih.gov/) for alleles. (JPT+CHB) After applying linkage disequilibrium (LD; r ² <0.8) in HapMap database (Phase II), 10 tags located between 5'-upstream and 3'-downstream of the LOX gene SNP was selected (see SEQ ID NO: 14 to SEQ ID NO: 21).

SNP order Sequence number rs2303656 5'-TACGCATGATGTCCTGTGTAGCGAATGTCACAGCGCACAACATTGTTGGTATAGTCAGATTCAGGAACCAGGTAGCTGGGGTTTACACTGACCTGGGCAACACAAAGAGTTCCTCAGTATTTCTTTTTCCATAGGGCTACAATAAGGAAATTGTTAATGAGGACTTAGCTAAATCAAGCAGGGAAGGGATTTTAACTTAAGTAA [G / T] TGGTTAAACTCTGGAGACGTTATGGAAAGAGACTGCATATTTTCCCCTGAAGTTCTTTAAAATAAGACAGATTAGATTAGATTAGATTGTTTATAAATAGTTTGAGGATGTATAATTGCTTCCAATACCATGATTATTTAACATTTGAATCCAGAGAAGAGGGCCTATTGATCTGCAATATCAATATATGATATATTTTCAAAGGTCTTTACCTTTAGGATATAGTTTCCAGGTTTTACATCTGTAATATCAATCCACTGGCAGTCTATGTCTGCACCATAGGTATCATAACAGCCAGG-3 ' 14 rs3900446 ^a and
rs763497 ^b 5'-GAGCATGCAACCTAAATCCCTCATATGCACAGTTCACAATGGGGTTCACGCTCATATGAGAATCTAATGCCATGATTGATCTGACAGGAAGCAAAGCTCAGGTGGTAATGTGAGGAAAGAGGATCTTGGTAAACATGCTATTGTAAGTTTAATGTCTCTACTCCCCTTCCGAGAACCCCATGTCTCCTTACTGGGAAACTTCAAGTCAAATGGTTTTAGGATTTACTGACAGAGGTTACTTGCTAGTATGAATTTGAGAAATTCATGGGAGGTACCTCACCAGGAACCCAAAAAATGGAATTTTTGACGTGGGGAGTGTCTGTAAATACAGATGAAGCTTCACTTGCTGGCCCACTGCTCACCTCCTGCTGTGCAGCCCAGTTCCTAACAGGGATGGTACTGGTCCGTGTCCTGGGGTTTGGGAACCACTGGTTTATTGAAAAGACATTCTGCTGGGTTGGTATGGAGCCCAAGTTATATTTGGGTT [A / G] a CACATTAGGGACTACTTCTTGTGATTTTGAGCCTAAATTATAATAAACTCTAGATATACACACCCTATGCCTATCAGAATAGTAATGAAGGGGTAAATGGCCCCCAACACAAGTGGCAATGGTTTTTGGAATAATACCAAAAGCCAACGAAATGTGATGGAGATTTACTGAAGCTAAGC [A / G] b TTAATTTTGGGGATAGGATGTTCTCGATGTAGGCCTAGATGTATGCAGCATCGTGTAAGGCTATCTATTAAAGAAGTCTAAAAAATTCACTTGTGATATTGAGTCATAAAGTTGGTTTTTAATCCATTCTCAACAGACTCTCAATTT-3 ' 15 rs10040971 5'-TCTAGCTCAGGGCATCAACAAACAGTACAAAAATGAGAGTGCAAATGAATAAATAAATGGAGAATGGATGAATAAATTAAGGAATTATAAAAATTAAGAAAAAACTAATCTGTTTATTTAAGTGCAAATTATTTTAGCTTAAATTATAATGGTGTTCTGGCGGTGGGGGTCGGGGGTTGGTTCTACTATAACCAACTCCACACAATATGGGCCATAAAACCTGCCAGGTTTTCTGTGCTGTGGGCATGTTCAGAAGAATGTATGTGACTCTGTTTTTTCAGTGCTATCCTTTTGCTATCACAGGCTTCATCTATCTCTAA [T] GTTGTGACAACACTTGTAAAGCACAGTCTCTGCTTCTTTATGTAGAAAGTCCTGGGTTTTTGTATCAGGCAGAAATTTCTATTAATTATGAGATTCTAGTATAGCTCTGCTATACCTGTCTGTATGATCCAGTGGCACTGGTGGTTCTCCAGTGACAAAGCAAAGCTGATGAGTGTTGAGTATCATTCCAATGGAAATAGTATTCTCATTGTTGGGAAGGCATAACTCAAGTGGCATATGTAATTATAATCTAGCACCCAGCAACACTTGGGGAGGTAGTGC -3 ' 16 rs17148773 ^a and rs3792801 ^{b 5'-AATAGGCAGAAACTGGACCAAAGCTAATCAATCAAATATTACTGTCTTTAAATGTGACCATAGATCTTCATGTAAGGAAGTGAAAATTCACTTATTCAAATCATAAACTACCAATTTCCAAACAGTAAATTCTGTGAGGAGAAAAAAAAAAACTTACATAGTATCTTATAACTGAAAGAAGCCTCAGAGTCACCTGGTC [C] a GTACATTTTGTTTCAGTGAGGAAAATGAAGGAGAGAGGGTACATTAACAGCACATACCTATTCAACTATTTACTGGGTGGCTTTTACACATCAACAGAATGCTCTTAAATATCTGGCAGGAAAAGCAATCAGTGAACTGATACATGATATGTCTTCAGAGTCACACTCACTGCTGCTTACACAGCCACCAGACTGACCTGATGGCCTTAGGCAAGTTACACTTCCTGCTCAAAAAGCTTCAGCCTCCCACTGCCTCCAGAATAAATTTTAGCCTGCTCTTCAGGGCTGTCTTCCATCTGGCTCAACTTACTTTTCCATCCTTTTTGTCCAACTCGTAACTCCACAAAATT} [C] b ATGCTTTAGCCAAACTAGAAGACTTGTTTTTCCAAACATGCCCTGCAGTTTCCTCCTGCCATGCAAGTTGCCTGTGACGTTGACTTGCCCTGGGCTTCCTTTCCTTAATGCTCCCCGGTGCATTCCCCAGACTTCAAGGCTCAA-3 ' 17 rs10519694 5'-CTACATGAGGGGCTATTATCTCCATTTTATAGATGAGAAAACTAAGGCACACTAAGATCAAATAACTTACCCAAGGGTATCCAGCCTAGTAAGTGGCTAAGCTGGTTTTGAGTTTAGGTAATCAAGGTCCAGAGTCCCTGTTCTTAACTACCCCACTATACTCTCTCTCATACAGTCACTGAAATATGACATATTTTGTTGAAGGGGTAAATGCATGACTAAATTGATGAATGCCACATCACTCCACTTGCTAAAATATTCACATCAATAAGTAAATGAATG [C] CTTCTACAGGCTGGGAGGAGAAAAATATAACAAATACAATCCTTGCTTTTAAGAATGTTATAGTCTAGAGAAGTTTCCTCAGATTGGAGTCTGTAGGTATATTCTTGATTCCATTAGTTCTTCACAAAAAGTTTTAACTTGTATTTTTATTCTAATAGTAATTTAAATTCAAAGTACATGCTAGATTCATTTTAACTCAATACTGCCATTCAATTCTAGCAACCAATATTGCTTTGCTGTTTAAGATCACTTTGGTCACCCAAGAG- 3 ' 18 rs1800449 5'- CCGGGACTGCAAAGCAATGTGAAAAGGAAGCAGGAGGGGCCAGACGCGCGGTTTGCACTGGATTCCAGGGCTGCCACTGCAGGCGCGTGGGGGAGGGATCGGATCTGCGAGGACCGGGGCCCGCCGCGCCCAGGCAGCCACGTCGAGAAGCCACATAGCTGGGGACCAGGTGCACGGGTGCTTCCAGCGGACTTGGGGGTACTTACCGTACTGGAAGTAGCCAGTGCCGTATCCGGGCCGGTACCTGCCCCCAGGTCTGGGCCTTTCATAAGTATCGTAGTAGTTGTAATAAGGGTTGTCGTCAGAGTACTTGTAGGGGTTGTAAGGGTCGTCGCCCACCATGCCGTCCACGCGGCTGGGCGGC [C] GCAGGTTACTGAGCGCAGGAACTTCTCCCGGCGCTGTCTGGTTCTCCGCGCGCGAGGCGCCAGCTTCGCGGGCTCTAGATGTCGAGTAGCCAGCTTGGAACCAGTGACGGGCGGTGGGCCTGGGGCGGCCAGCGGTGACTCCAGATGAGCCGGCCGTCCGCGTTCGCGCCGCGGCGGTGCGGTTGTCGCGGATCAGCAGGATCGGAGTGCGGGGCTGCTGGGCGGAGGCGTTGGCTGCACCAGGGACGGCGGCGCCCGGGTCCCGGCGGCGCTGAGGCTGGTACTGTGAGCCCAGGCTCAGCAAGCTGAACACCTGCCCGTTGTTCTCCCATTGGATCTGC-3 ' 19 rs2956540 5'- GATCTGGGCGGGAGTCAAATTATAATGTCCTTTTACAAATTAGGGTTTCATATGGAAATACTGACATAGATTTTAACTGACACGCATTTTCCAATGATAAAACATGCAAACTGCTTAGTTCAGCACTACTTTAAAAAAATCCATCCAAACAACATCTGACATCAATTATACTGTAGATTTAAATATATATGTGTGGAGAAAGAAATGGTGTCCTTCTGCTCTTATTTGCATTATTAAAAGAGGCAACTTTTTAAAGTGCTTTTAAAGAAACTTATTTTTCCTCCATTTGCTAACC [G] CAACCACTATTCTATTTTCAGCATAAAACAGAAGGAAGGAATGGTTTCACAGGTGAAAAAACAGAGATATCTTTTTTTACAGTTATTTACTAAGCCGGTTAAGGAATACAGAATGGGTGCATATGTTGTCAACCATTCAGACTTTTTCAGAGAGTAAATTTTTGTTCTTCATTGTGGACTGTAACAAGGACCCACACTGACCTGTGATC-3 ' 20 rs3853401 5'- CTACCCTTTGTCACACATGCTAATGAAAAGCTTAGTTGATTTTCACTCTCCTTCATTTCCTCTAAAATCTCTCTGGCTTAGGACTCTGTCAGCTGAAAAACAAACATGTGGCTACCACATTTGGGGACAATACAGTGTTTGCAAGCCCTGCGGGAGATAATCTAGCCACACATTGTGTTCCCTGTTCAATAACAAAACTATTATTCACAAAATTGGAGAAACCATAGTTCCTTTCCACTCAAATCTGAGATGATAATGATGATGACAATAATAATAATAAGCCACGGCTACATCAAGATACAAACAGCTTTTTTTGCTTTGATAAGATCCACAGCTGATTTCACTTTTGACCATGAGATTTTCTTCTC [G] TGAACAATTCTGCAGTATGTGCCATAAGAGAAGGGAAGGAATGTTGCTAATTCTTTTTTTGAGTTTCTAGCCCATCAATATCAAATCTTTAAATGGCAATGTCTGGCCCATTGGCCAAGAAATGAAAGTTGTTGTAATGCTATGTTCCTGGTATTTGTTAAATACATTTATTTTTGTAGGACATTTCACATAAATGGAAAACAGAAAGCCGAAACCATAAAGCAGGGCCTCTGAATTGCAGAAGCCAGAACAGTAATGCCACATTCAAAGCAATCAGGTTCAAGTGTAAATTCTTTTGTTTGAGGCTCAAGAAGCTCATACAAAGCTTG-3 ' 21

For genotyping of 10 tag SNPs, genomic DNA was extracted from peripheral blood of 160 subjects using a HiGene ^TM Genomic DNA preparation kit (BIOFACT, Daejeon, Korea). Ten SNP primers were designed using the Primer-3 v.0.4.0 program (http://bioinfo.ut.ee/primer3-0.4.0/), and the designed primers are shown in Table 4 below.

SNP primer order Sequence number rs2303656 Forward direction
Reverse 5'-CGCATGATGTCCTGTGTAGC-3'
5'-TGGCTGTTATGATACCTATGGTG-3' 22
23 rs3900446, rs763497 Forward direction
Reverse 5'-CATGCAACCTAAATCCCTCAT-3'
5'-TTGAGAGTCTGTTGAGAATGGA-3' 24
25 rs10040971 Forward direction
Reverse 5'-AGCTCAGGGCATCAACAAAC-3'
5'-CTACCTCCCCAAGTGTTGCT-3' 26
27 rs17148773, rs3792801 Forward direction
Reverse 5'-AGGCAGAAACTGGACCAAAG-3'
5'-AGCCTTGAAGTCTGGGGAAT-3' 28
29 rs10519694 Forward direction
Reverse 5'-CATGAGGGGCTATTATCTCCA-3'
5'-TTGGGTGACCAAAGTGATCTT-3' 30
31 rs1800449 Forward direction
Reverse 5'-GGACTGCAAAGCAATGTGAA-3'
5'-GATCCAATGGGAGAACAACG-3' 32
33 rs2956540 Forward direction
Reverse 5'-CTGGGCGGGAGTCAAATTAT-3'
5'-CACAGGTCAGTGTGGGTCCT-3' 34
35 rs3853401 Forward direction
Reverse 5'-CCCTTTGTCACACATGCTAATG-3'
5'-GCTTTGTATGAGCTTCTTGAGC-3' 36
37

Polymerase chain reaction (PCR) was performed using the primers of Table 4 and Solg ^TM 2X Taq PCR Pre-Mix (Solgent, Daejeon, Korea). Preliminary denaturation was performed at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 63°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 5 minutes were performed for 34 cycles. After confirming the fragment amplified by 1.5% agarose gel electrophoresis, and purified with Solg ^TM PCR purification kit (SolGent, Daejeon, Korea), each sequence was analyzed by ABI PRISM 3730XL analyzer (Applied Biosystems, California, USA). Analyzed.

Example 3. Statistical Analysis

The Kruskal-Wallis test was performed to evaluate the difference in non-genetic factors between 80 patients with cerebral aneurysms and 80 controls. Fisher's exact test was performed to estimate the antagonistic relationship between a cerebral aneurysm and 10 SNPs located near or on the LOX gene to estimate the odds ratio (OR).

In a subsequent analysis, the genetic effect of the LOX gene on the formation of a cerebral aneurysm following aneurysm rupture was analyzed. In addition, an omnibus test using haplotype-specific association analysis was performed through asymptotic chi-square statistics, including h-1 degrees of freedom (h is the number of all possible haplotypes in the sliding window depending on the number of SNPs). We tested for significant haplotype association with cerebral aneurysms. In this assay, 10 SNPs were used to exclude haplotype structures with minor haplotype frequencies (MHF) of less than 0.01 of possible combinations.

After testing multiple comparison corrections and implicitly effective p values of 0.01 and 0.001, respectively, in single SNP and haplotype associations, Bonferroni-corrected significant p values were less than 0.005 and less than 2.0 x 10 ^-4 . Applied. Descriptive and univariate analysis was performed by STATA software v.11.2 (Stata Corp., College Station, Texas, USA). To evaluate genotyping call rate (GCR), minor allele frequency (MAF), Hardy Weinberg equilibrium (HWE) p-value, and pairwise LD (LD), Haploview v.4.2 ( https://www.broadinstitute.org /haploview/haploview) was used to perform quality control assays for 10 SNPs. Genotype and haplotype associations were analyzed using the PLINK program v.1.07 (http://zzz.bwh.harvard.edu/plink/).

Example 4. Examination of genetic association between monobasic polymorphism and cerebral aneurysm

All the 10 SNPs selected in Example 2, after quality control assay, had a complete genotype classification rate (GCR), a minor allele frequency (MAF) greater than 0.01, and a Hardy-Weinberg equilibrium (HWE) p value greater than 0.05, Pairwise linkage disequilibrium (LD) was greater than 0.8.

Three of the 10 SNPs (rs2303656, rs3900446, and rs763497) showed a statistically significant association with cerebral aneurysms (p <0.05) (Fig. 6). Two SNPs (rs2303656 and rs3900446) reached Bonferroni-corrected levels of significance (p <0.005). The C allele of rs3900446 showed the most significant and strong association with an increased risk of cerebral aneurysm (OR = 20.15, p = 4.8 Υ 10 ^-5 ). In contrast, the A allele of rs2303656 had a protective effect in cerebral aneurysms, and was not frequently observed in the patient group (p = 8.2 Υ 10 ^-4 ). The G allele of rs763497 was associated with an increased risk of cerebral aneurysm (OR = 2.26, p = 0.009). However, no SNP was associated with rupture of a cerebral aneurysm among 80 patients with a cerebral aneurysm in a later analysis (p> 0.05).

In the omnibus test for haplotype association, 136 out of a total of 247 haplotype structures in 45 sliding windows (SNP sets) showed asymptotic p values of less than 0.05, and 17 haplotypes had an implicit association with cerebral aneurysms. Was seen (asymptotic line p <0.001, Fig. 7). Among the 10 SNP haplotype combinations, the CG combination of rs3900446 and rs763497 was significantly associated in a single SNP analysis (MHF = 0.113, asymptote p = 1.3 Υ 10 ^-5 ).

Although the six SNPs (rs10040971, rs17148773, rs3792801, rs10519694, rs2956540 and rs1800449) were not independently associated in the single SNP analysis, the haplotype structure in which these SNPs were combined with rs2303656, rs3900446 or rs763497 was significant in the haplotype analysis ( 6.5Υ10 ^-4 <p<7.5Υ10 ^-4 ).

<3. Cerebral aneurysm diagnosis using SNP of SOX17 (SRY-box 17) gene>

Example 1. Research subject

In a single institution (Chuncheon Sacred Heart Hospital), 187 patients with a cerebral aneurysm confirmed to have a saccular shape radiologically and 372 controls matched with the age and sex of the patients in the patient group were recruited (the ratio of the patient group and the control group was 1:2). In the cerebral aneurysm, fusiform or anatomical non-cystic aneurysm and traumatic or infectious aneurysm were excluded. The control group consisted of matched patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, excluding other neurological disorders such as arteriovenous malformations, intracranial hemorrhage or infarction. The medical records were reviewed in consideration of various variables such as sex, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, hypertension, diabetes, hyperlipidemia, smoking, and family history of aneurysms. Angiographic parameters for the size, location (anterior or posterior circulation), and number (singular or plural) of aneurysms were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2017-9).

As a result of the review, in the cerebral aneurysm patient group and the control group, the number of women was 108 (57.8%) and 212 (57.9%), respectively, and the mean age was 58.2 ± 11.5 years and 56.9 ± 14.2 years, respectively (P = 0.305). Other factors including hypertension, diabetes, hyperlipidemia and smoking status did not differ significantly between the two groups. Symptoms of subarachnoid hemorrhage occurred in 95 (50.8%) patients. Regarding aneurysm location, anterior circulatory aneurysm (n = 167; 89.3%) was recorded as follows: internal carotid artery, n = 34; Anterior or anterior cerebral artery, n = 39; Middle cerebral artery, n = 56; And posterior transit artery, n = 38. No family history of cerebral aneurysms was noted in this cohort.

Example 2. Single base polymorphism selection and examination

To investigate the association between single-base polymorphism on the SOX17 gene and the likelihood of developing cerebral aneurysms, five previously reported SNPs (rs1072737, rs1504749, rs10958409, rs12541742 and rs9298506) were selected from the previous GWAS consisting of East Asian and European composition groups (See SEQ ID NO: 38 to SEQ ID NO: 42 in Table 5).

SNP order Sequence number rs1072737 5'- GACATGGTTTTGCCATGTTGGCCCGGCTGGTATCAAACTCCTGGCCTCAGGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCACCGTGGCTTAACCTAAACTTCTAGATATGAAAACTATAATGTCTGAGGTGAAAAATAGACTGGAGGAAGAAAAAGGCAGATTGGACATTGTAGAAGAAAGGCGAGATCAGTGAAATTAAAAGTGTGGCAATGAAAACTACCCAAAATAAAACACGCAGAAAATAAAATTCCAAAAAATGAAAAAGCATAAGTGATATGTGGGATAGTTTCAGTGGCCTAATAC [A / C] TGAGTAACTGGAGTCCCTGAAGAAGAAAGACTGAAAAATATATTTTTAGAAATAATGGCTGAAAAATTTCCAAACTTAGTGAAGCTATAAACCTACAGATCTAAGCTCAATGAACACCAAGAAAAATAAACATGAAAATAACTACCCCAAATTACAGCATAAGTTACTAAAAAACAATGACAAAGAGAAAAATCTGACAGCCAGAAAATATACCCGTATTACATCCAGAGAAACAAAGATAAGGCTG -3 ' 38 rs1504749 5'-CGTGCTGGCAAACTTGAAATCTGATGAACCCACTACCTTCACTACACTCACTGTCTGGTCTCTCTCAGGTAGCTGAGGACTGAGAAACACCCCAGCCAGGCAGGTTGGGGTCACTATAAATTCACAGTCACCAACCACACATGGTGCTCTGTTTGGCTGGCCATCTCATTATACCTGTCTGACTTGCTTACTGTCCTGCCCTCCGAAAAAGCTTTTCAAACACTATCTCCTTCTGCCTCAAATGT [A] TCACCTCCCCCTCAATGACTTTGCTTCATATGTGACACAAAGAAATGTTAATACCAGCCAAGACCTTCCTCAACTTCCGGCCAGCAAATCTGGAACACAAGCTGCATCTGTCCTGGTTTGCCTCTTCTCTCTTCTCGTTACAGTAGAGTAGCCATTCCTCTTCTAAAAAACACTGATCTCCCATCCTGCTCTGGACATTAAAGTACTGAGAAGTGGTTTTGTGTTCCCAGCAATATGGGAGTCATTGG- 3 ' 39 rs10958409 5'-AAGTGATCCACCCACCTGAGCCTCCCAAAGTTCTGGGATTACAGGCTTGAGCCACTGCGCCCAGCTATAACCTTCACGTTCAAAGCACTCTCCCATCTATTATTAAGGCCTCTGAGAAAATCTCCTTTTTATATATATTCTCAAGTCAGAATTATTAGTCTCCATCTTTCATCTTAGTCTTCTTCAAATACCAAACTCTTTACTAAGCAGTTAGACACAAGTAGTTTCACCAGTTCTATCACTCAAATACGGTTTCATAAGTTCTGCCTAGTGATTGCCCATCAGAGGGGATATGGATTT [G] TGGGCAGGAAATAGAATAGAAACCTAACTCTAACTCTTCTGTGAAATGTAGTGTTTAGGTTAATATTCTTCCTTAACTGCCATCTGCTTTTTTTTGTTTGTTTAACACTTTGTCCAAATCTCTCAAACCTTACACCGCAGAATCATGGA- 3 ' 40 rs12541742 5'-GCTTTCATGGTGTGGGCTAAGGACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAGATGCTGGGTGAGTCCGAGTCGCAGACCCAGGCGGCCGGGCGCGCTGGCGCGAATCGCTAGGCCGATTTCTTAAACCCCAAACTGTTCTTTGCGAGCCTGACGCCCAAAACCAGGGGTGTGTAGCGGCCACGTCCTTTCTTAAGGCTCTGGGTTCC [C] TTCCCGCTTCCCGCCCTCCGACCCTCCAAAGCAGCTTTCCGCCTTGCTCTCCGGCTCCCGGATTCCCCAGGTGGCCGGGGGCGCGGGTCCAACGGCTCTGGGAAGGCGACTTCCCGGCACCTCCGGGCGGCGCGAGAGCACCCTTGGCCCTGAACTGGGCCGGTTGTGTCCATCCCTCGACCCCTTCCCTAGTTAGGTGTCCTTTTCTGTTTTTCGAACGACCGGGTGATGGGTGAGCGGAAAGCCGCTTCCAGGAGACCAAAAGAAAGGGGTGCCTTTAGAGGACGGGTGTTCCCCAAGGGCTCGGACTCAGGAGTCCCAGATCTCCCTC- 3 ' 41 rs9298506 5'- AGGTGTACCAACCCCAGACACTGGCAGAACGCTCTCTTTATGTAAGACCTCAAAATCTTACTGGTTGGTGTCTGCTGACTTGTTTTTCTCTGTTATCTTGCCTGTCTGCAGTGACAAATTCAGTGCAGCTCTAACTCATGTGGACAGGGAGGAAATGATTCTAGGATTGAGGACTTAAGGGTGTCTGGAAGAGAAGAGAATTGTTTTGTTTTGTTTTGTTTTGTTAGTTGTTGTTTTCCTCAGACAGGACCTTGTCA [A] CGCTTTCAAATATGTAGGCTGTTTGCTGTTTCCTTTATGTTGGTCCCTGAGAAGGATCTGCCCTTCTACCCTGTTTCCCTGGGGGGTGTGGACAGAGCCTTTGTCTTTGGGGAAGGGGGTCATCTTGGGAAAAGGAGAACAGGGCATCCTGAGGACCTGCTCCGTCTAAGGAGAGAAAGCCGAACAGATGGCAGCTGCCACGCAGAGGGCACTTTGTAGGAACTCTGGCTGGAGCAGGCTTCCTGCGCTCCAATGCCAAATCCTTCCCTTC-3 ' 42

For genotyping of five SNPs, genomic DNA was extracted from peripheral blood of 559 subjects using a HiGene ^TM Genomic DNA preparation kit (BIOFACT, Daejeon, Korea). Five SNP primers were designed using the Primer-3 v.0.4.0 program (http://bioinfo.ut.ee/primer3-0.4.0/), and the designed primers are shown in Table 6 below.

SNP primer order Sequence number rs1072737 Forward direction
Reverse 5'-GACATGGTTTTGCCATGTTG-3'
5'-CAGCCTTATCTTTGTTTCTCTGG-3' 43
44 rs1504749 Forward direction
Reverse 5'-CGTGCTGGCAAACTTGAAAT-3'
5'-CCAATGACTCCCATATTGCTG-3' 45
46 rs10958409 Forward direction
Reverse 5'-AAGTGATCCACCCACCTGAG-3'
5'-TCCATGATTCTGCGGTGTAA-3' 47
48 rs12541742 Forward direction
Reverse 5'-GCTTTCATGGTGTGGGCTA-3'
5'-GAGGGAGATCTGGGACTCCT-3' 49
50 rs9298506 Forward direction
Reverse 5'-AGGTGTACCAACCCCAGACA-3'
5'-GAAGGGAAGGATTTGGCATT-3' 51
52

Polymerase chain reaction (PCR) was performed using the primers of Table 6 and Solg ^TM 2X Taq PCR Pre-Mix (Solgent, Daejeon, Korea). Preliminary denaturation was performed at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 63°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 5 minutes were performed for 34 cycles. After confirming the fragment amplified by 1.5% agarose gel electrophoresis, and purified with Solg ^TM PCR purification kit (SolGent, Daejeon, Korea), each sequence was analyzed by ABI PRISM 3730XL analyzer (Applied Biosystems, California, USA). Analyzed.

Example 3. Statistical Analysis

Univariate logistic regression analysis was performed to evaluate the difference between 187 patients with cerebral aneurysms and 372 controls for age, sex, hypertension, diabetes, hyperlipidemia, and smoking. A generalized linear model was performed to evaluate the genetic association between cerebral aneurysms and SOX17 gene polymorphism under an additional effect inheritance model to estimate a 95% confidence interval (CI) and correspondence ratio (OR). In a subsequent analysis, we analyzed the genetic effect of SOX17 on the formation of cerebral aneurysms following aneurysm rupture. Descriptive and univariate analyzes were performed using Stata II.2 (StataCorp LLC, College Station, Texas, USA). To evaluate genotyping call rate (GCR), minor allele frequency (MAF), Hardy Weinberg equilibrium (HWE) p-value, and pairwise LD (LD), Haploview 4.2 (https: //www.broadinstitute.org/haploview/haploview) was used to perform quality control assays for 5 SNPs located near or on the SOX17 gene. Genotype and haplotype associations were analyzed using the PLINK program 1.07 (http://zzz.bwh.harvard.edu/plink/).

Example 4. Examination of genetic association between monobasic polymorphism and cerebral aneurysm

After quality control assay, 4 out of the 5 SNPs selected in Example 2 had a complete genotype classification rate (GCR), a minor allele frequency (MAF) greater than 10%, and a Hardy-Weinberg equilibrium (HWE) P value of 0.05. The excess, pairwise linkage disequilibrium (LD) was greater than 0.8. Rs12541742, located in the intron region of the SOX17 gene, was excluded from this association test due to the Hardy-Weinberg equilibrium (HWE).

Of the four SNPs, only one SNP, that is, the minor C allele of rs1072737 located approximately 41 kb upstream from the 5'-untranslated region (5'-UTR) of the SOX17 gene, had a statistically significant association with cerebral aneurysms. (OR = 0.69, 95% CI = 0.49-0.96, P = 0.03) (Fig. 8). This variant exhibited opposite effect sizes compared to the Dijon study involving the European ancestral population (OR = 0.69 and OR = 1.02, respectively). In the subsequent analysis, there was no SNP associated with cerebral aneurysm rupture among the 4 SNPs (P> 0.2, Fig. 9).

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts are included in the scope of the present invention.

<110> Industry Academic Cooperation Foundation, Hallym University <120> SNP marker for diagnosis of intracranial aneurysm comprising SNP of CUL4A gene <130> 6 <160> 52 <170> KoPatentIn 3.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <400> 1 ccttgagtat ctgctccatc actggygacg ccacaggtag gtgtgaatgg a 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <400> 2 tgcttcagaa actgaccagt agcacygatg tacaatcttg atcgcatggg c 51 <210> 3 <211> 51 <212> DNA <213> Homo sapiens <400> 3 cctccagctg ctgcagaagg atgccrccgc cgcccctgcc acccctgcca c 51 <210> 4 <211> 51 <212> DNA <213> Homo sapiens <400> 4 ttgtggttca gtcttaaaga ttcttrcccg gatgcagcat attttactcc a 51 <210> 5 <211> 51 <212> DNA <213> Homo sapiens <400> 5 ttcacaagtc ggacatctgt atatcytagg aggagacaag gccatagaag a 51 <210> 6 <211> 51 <212> DNA <213> Homo sapiens <400> 6 gaatccacgt tgaaaaatct gtccarggct cacccagtat caacaatagt g 51 <210> 7 <211> 51 <212> DNA <213> Homo sapiens <400> 7 atatctttct gtgcctttat ttattytgca tatgttaaaa gtggatgagg c 51 <210> 8 <211> 51 <212> DNA <213> Homo sapiens <400> 8 ttcaggaggt ccccgaggac atcccrgcca acaccgtgct cctgaagctc g 51 <210> 9 <211> 51 <212> DNA <213> Homo sapiens <400> 9 tattgaacag atagaacaaa cgggcygcgc tgcccacacc accgcttctc t 51 <210> 10 <211> 51 <212> DNA <213> Homo sapiens <400> 10 gaggcccgag aaccaggcac gccgaygaca gcacacttcc agcctgagag c 51 <210> 11 <211> 51 <212> DNA <213> Homo sapiens <400> 11 acagagaaaa tgtgggaggc aatacrgtga cagtggtgta attaaaatgt t 51 <210> 12 <211> 51 <212> DNA <213> Homo sapiens <400> 12 aagttttgac tattctactg gcctgrattt atctaacttg tgttgtactt t 51 <210> 13 <211> 51 <212> DNA <213> Homo sapiens <400> 13 ctcagtctca gggggactgg gaagarggaa ggacaaaagg atggtggccc t 51 <210> 14 <211> 504 <212> DNA <213> Homo sapiens <400> 14 tacgcatgat gtcctgtgta gcgaatgtca cagcgcacaa cattgttggt atagtcagat 60 tcaggaacca ggtagctggg gtttacactg acctgggcaa cacaaagagt tcctcagtat 120 ttctttttcc atagggctac aataaggaaa ttgttaatga ggacttagct aaatcaagca 180 gggaagggat tttaacttaa gtaagtggtt aaactctgga gacgttatgg aaagagactg 240 catattttcc cctgaagttc tttaaaataa gacagattag attagattag attgtttata 300 aatagtttga ggatgtataa ttgcttccaa taccatgatt atttaacatt tgaatccaga 360 gaagagggcc tattgatctg caatatcaat atatgatata ttttcaaagg tctttacctt 420 taggatatag tttccaggtt ttacatctgt aatatcaatc cactggcagt ctatgtctgc 480 accataggta tcataacagc cagg 504 <210> 15 <211> 815 <212> DNA <213> Homo sapiens <400> 15 gagcatgcaa cctaaatccc tcatatgcac agttcacaat ggggttcacg ctcatatgag 60 aatctaatgc catgattgat ctgacaggaa gcaaagctca ggtggtaatg tgaggaaaga 120 ggatcttggt aaacatgcta ttgtaagttt aatgtctcta ctccccttcc gagaacccca 180 tgtctcctta ctgggaaact tcaagtcaaa tggttttagg atttactgac agaggttact 240 tgctagtatg aatttgagaa attcatggga ggtacctcac caggaaccca aaaaatggaa 300 tttttgacgt ggggagtgtc tgtaaataca gatgaagctt cacttgctgg cccactgctc 360 acctcctgct gtgcagccca gttcctaaca gggatggtac tggtccgtgt cctggggttt 420 gggaaccact ggtttattga aaagacattc tgctgggttg gtatggagcc caagttatat 480 ttgggttaca cattagggac tacttcttgt gattttgagc ctaaattata ataaactcta 540 gatatacaca ccctatgcct atcagaatag taatgaaggg gtaaatggcc cccaacacaa 600 gtggcaatgg tttttggaat aataccaaaa gccaacgaaa tgtgatggag atttactgaa 660 gctaagcatt aattttgggg ataggatgtt ctcgatgtag gcctagatgt atgcagcatc 720 gtgtaaggct atctattaaa gaagtctaaa aaattcactt gtgatattga gtcataaagt 780 tggtttttaa tccattctca acagactctc aattt 815 <210> 16 <211> 603 <212> DNA <213> Homo sapiens <400> 16 tctagctcag ggcatcaaca aacagtacaa aaatgagagt gcaaatgaat aaataaatgg 60 agaatggatg aataaattaa ggaattataa aaattaagaa aaaactaatc tgtttattta 120 agtgcaaatt attttagctt aaattataat ggtgttctgg cggtgggggt cgggggttgg 180 ttctactata accaactcca cacaatatgg gccataaaac ctgccaggtt ttctgtgctg 240 tgggcatgtt cagaagaatg tatgtgactc tgttttttca gtgctatcct tttgctatca 300 caggcttcat ctatctctaa tgttgtgaca acacttgtaa agcacagtct ctgcttcttt 360 atgtagaaag tcctgggttt ttgtatcagg cagaaatttc tattaattat gagattctag 420 tatagctctg ctatacctgt ctgtatgatc cagtggcact ggtggttctc cagtgacaaa 480 gcaaagctga tgagtgttga gtatcattcc aatggaaata gtattctcat tgttgggaag 540 gcataactca agtggcatat gtaattataa tctagcaccc agcaacactt ggggaggtag 600 tgc 603 <210> 17 <211> 696 <212> DNA <213> Homo sapiens <400> 17 aataggcaga aactggacca aagctaatca atcaaatatt actgtcttta aatgtgacca 60 tagatcttca tgtaaggaag tgaaaattca cttattcaaa tcataaacta ccaatttcca 120 aacagtaaat tctgtgagga gaaaaaaaaa aacttacata gtatcttata actgaaagaa 180 gcctcagagt cacctggtcc gtacattttg tttcagtgag gaaaatgaag gagagagggt 240 acattaacag cacataccta ttcaactatt tactgggtgg cttttacaca tcaacagaat 300 gctcttaaat atctggcagg aaaagcaatc agtgaactga tacatgatat gtcttcagag 360 tcacactcac tgctgcttac acagccacca gactgacctg atggccttag gcaagttaca 420 cttcctgctc aaaaagcttc agcctcccac tgcctccaga ataaatttta gcctgctctt 480 cagggctgtc ttccatctgg ctcaacttac ttttccatcc tttttgtcca actcgtaact 540 ccacaaaatt cbatgcttta gccaaactag aagacttgtt tttccaaaca tgccctgcag 600 tttcctcctg ccatgcaagt tgcctgtgac gttgacttgc cctgggcttc ctttccttaa 660 tgctccccgg tgcattcccc agacttcaag gctcaa 696 <210> 18 <211> 549 <212> DNA <213> Homo sapiens <400> 18 ctacatgagg ggctattatc tccattttat agatgagaaa actaaggcac actaagatca 60 aataacttac ccaagggtat ccagcctagt aagtggctaa gctggttttg agtttaggta 120 atcaaggtcc agagtccctg ttcttaacta ccccactata ctctctctca tacagtcact 180 gaaatatgac atattttgtt gaaggggtaa atgcatgact aaattgatga atgccacatc 240 actccacttg ctaaaatatt cacatcaata agtaaatgaa tgccttctac aggctgggag 300 gagaaaaata taacaaatac aatccttgct tttaagaatg ttatagtcta gagaagtttc 360 ctcagattgg agtctgtagg tatattcttg attccattag ttcttcacaa aaagttttaa 420 cttgtatttt tattctaata gtaatttaaa ttcaaagtac atgctagatt cattttaact 480 caatactgcc attcaattct agcaaccaat attgctttgc tgtttaagat cactttggtc 540 acccaagag 549 <210> 19 <211> 706 <212> DNA <213> Homo sapiens <400> 19 ccgggactgc aaagcaatgt gaaaaggaag caggaggggc cagacgcgcg gtttgcactg 60 gattccaggg ctgccactgc aggcgcgtgg gggagggatc ggatctgcga ggaccggggc 120 ccgccgcgcc caggcagcca cgtcgagaag ccacatagct ggggaccagg tgcacgggtg 180 cttccagcgg acttgggggt acttaccgta ctggaagtag ccagtgccgt atccgggccg 240 gtacctgccc ccaggtctgg gcctttcata agtatcgtag tagttgtaat aagggttgtc 300 gtcagagtac ttgtaggggt tgtaagggtc gtcgcccacc atgccgtcca cgcggctggg 360 cggccgcagg ttactgagcg caggaacttc tcccggcgct gtctggttct ccgcgcgcga 420 ggcgccagct tcgcgggctc tagatgtcga gtagccagct tggaaccagt gacgggcggt 480 gggcctgggg cggccagcgg tgactccaga tgagccggcc gtccgcgttc gcgccgcggc 540 ggtgcggttg tcgcggatca gcaggatcgg agtgcggggc tgctgggcgg aggcgttggc 600 tgcaccaggg acggcggcgc ccgggtcccg gcggcgctga ggctggtact gtgagcccag 660 gctcagcaag ctgaacacct gcccgttgtt ctcccattgg atctgc 706 <210> 20 <211> 505 <212> DNA <213> Homo sapiens <400> 20 gatctgggcg ggagtcaaat tataatgtcc ttttacaaat tagggtttca tatggaaata 60 ctgacataga ttttaactga cacgcatttt ccaatgataa aacatgcaaa ctgcttagtt 120 cagcactact ttaaaaaaat ccatccaaac aacatctgac atcaattata ctgtagattt 180 aaatatatat gtgtggagaa agaaatggtg tccttctgct cttatttgca ttattaaaag 240 aggcaacttt ttaaagtgct tttaaagaaa cttatttttc ctccatttgc taaccgcaac 300 cactattcta ttttcagcat aaaacagaag gaaggaatgg tttcacaggt gaaaaaacag 360 agatatcttt ttttacagtt atttactaag ccggttaagg aatacagaat gggtgcatat 420 gttgtcaacc attcagactt tttcagagag taaatttttg ttcttcattg tggactgtaa 480 caaggaccca cactgacctg tgatc 505 <210> 21 <211> 698 <212> DNA <213> Homo sapiens <400> 21 ctaccctttg tcacacatgc taatgaaaag cttagttgat tttcactctc cttcatttcc 60 tctaaaatct ctctggctta ggactctgtc agctgaaaaa caaacatgtg gctaccacat 120 ttggggacaa tacagtgttt gcaagccctg cgggagataa tctagccaca cattgtgttc 180 cctgttcaat aacaaaacta ttattcacaa aattggagaa accatagttc ctttccactc 240 aaatctgaga tgataatgat gatgacaata ataataataa gccacggcta catcaagata 300 caaacagctt tttttgcttt gataagatcc acagctgatt tcacttttga ccatgagatt 360 ttcttctcgt gaacaattct gcagtatgtg ccataagaga agggaaggaa tgttgctaat 420 tctttttttg agtttctagc ccatcaatat caaatcttta aatggcaatg tctggcccat 480 tggccaagaa atgaaagttg ttgtaatgct atgttcctgg tatttgttaa atacatttat 540 ttttgtagga catttcacat aaatggaaaa cagaaagccg aaaccataaa gcagggcctc 600 tgaattgcag aagccagaac agtaatgcca cattcaaagc aatcaggttc aagtgtaaat 660 tcttttgttt gaggctcaag aagctcatac aaagcttg 698 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 22 cgcatgatgt cctgtgtagc 20 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 23 tggctgttat gatacctatg gtg 23 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 24 catgcaacct aaatccctca t 21 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 25 ttgagagtct gttgagaatg ga 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 26 agctcagggc atcaacaaac 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 27 ctacctcccc aagtgttgct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 28 aggcagaaac tggaccaaag 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 29 agccttgaag tctggggaat 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 30 catgaggggc tattatctcc a 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 31 ttgggtgacc aaagtgatct t 21 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 32 ggactgcaaa gcaatgtgaa 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 33 gatccaatgg gagaacaacg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 34 ctgggcggga gtcaaattat 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 35 cacaggtcag tgtgggtcct 20 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 36 ccctttgtca cacatgctaa tg 22 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 37 gctttgtatg agcttcttga gc 22 <210> 38 <211> 573 <212> DNA <213> Homo sapiens <400> 38 gacatggttt tgccatgttg gcccggctgg tatcaaactc ctggcctcag gtgatccacc 60 tgcctcggcc tcccaaagtg ctgggattat aggcgtgagc caccgtggct taacctaaac 120 ttctagatat gaaaactata atgtctgagg tgaaaaatag actggaggaa gaaaaaggca 180 gattggacat tgtagaagaa aggcgagatc agtgaaatta aaagtgtggc aatgaaaact 240 acccaaaata aaacacgcag aaaataaaat tccaaaaaat gaaaaagcat aagtgatatg 300 tgggatagtt tcagtggcct aatacatgag taactggagt ccctgaagaa gaaagactga 360 aaaatatatt tttagaaata atggctgaaa aatttccaaa cttagtgaag ctataaacct 420 acagatctaa gctcaatgaa caccaagaaa aataaacatg aaaataacta ccccaaatta 480 cagcataagt tactaaaaaa caatgacaaa gagaaaaatc tgacagccag aaaatatacc 540 cgtattacat ccagagaaac aaagataagg ctg 573 <210> 39 <211> 494 <212> DNA <213> Homo sapiens <400> 39 cgtgctggca aacttgaaat ctgatgaacc cactaccttc actacactca ctgtctggtc 60 tctctcaggt agctgaggac tgagaaacac cccagccagg caggttgggg tcactataaa 120 ttcacagtca ccaaccacac atggtgctct gtttggctgg ccatctcatt atacctgtct 180 gacttgctta ctgtcctgcc ctccgaaaaa gcttttcaaa cactatctcc ttctgcctca 240 aatgtatcac ctccccctca atgactttgc ttcatatgtg acacaaagaa atgttaatac 300 cagccaagac cttcctcaac ttccggccag caaatctgga acacaagctg catctgtcct 360 ggtttgcctc ttctctcttc tcgttacagt agagtagcca ttcctcttct aaaaaacact 420 gatctcccat cctgctctgg acattaaagt actgagaagt ggttttgtgt tcccagcaat 480 atgggagtca ttgg 494 <210> 40 <211> 450 <212> DNA <213> Homo sapiens <400> 40 aagtgatcca cccacctgag cctcccaaag ttctgggatt acaggcttga gccactgcgc 60 ccagctataa ccttcacgtt caaagcactc tcccatctat tattaaggcc tctgagaaaa 120 tctccttttt atatatattc tcaagtcaga attattagtc tccatctttc atcttagtct 180 tcttcaaata ccaaactctt tactaagcag ttagacacaa gtagtttcac cagttctatc 240 actcaaatac ggtttcataa gttctgccta gtgattgccc atcagagggg atatggattt 300 gtgggcagga aatagaatag aaacctaact ctaactcttc tgtgaaatgt agtgtttagg 360 ttaatattct tccttaactg ccatctgctt ttttttgttt gtttaacact ttgtccaaat 420 ctctcaaacc ttacaccgca gaatcatgga 450 <210> 41 <211> 568 <212> DNA <213> Homo sapiens <400> 41 gctttcatgg tgtgggctaa ggacgagcgc aagcggctgg cgcagcagaa tccagacctg 60 cacaacgccg agttgagcaa gatgctgggt gagtccgagt cgcagaccca ggcggccggg 120 cgcgctggcg cgaatcgcta ggccgatttc ttaaacccca aactgttctt tgcgagcctg 180 acgcccaaaa ccaggggtgt gtagcggcca cgtcctttct taaggctctg ggttcccttc 240 ccgcttcccg ccctccgacc ctccaaagca gctttccgcc ttgctctccg gctcccggat 300 tccccaggtg gccgggggcg cgggtccaac ggctctggga aggcgacttc ccggcacctc 360 cgggcggcgc gagagcaccc ttggccctga actgggccgg ttgtgtccat ccctcgaccc 420 cttccctagt taggtgtcct tttctgtttt tcgaacgacc gggtgatggg tgagcggaaa 480 gccgcttcca ggagaccaaa agaaaggggt gcctttagag gacgggtgtt ccccaagggc 540 tcggactcag gagtcccaga tctccctc 568 <210> 42 <211> 529 <212> DNA <213> Homo sapiens <400> 42 aggtgtacca accccagaca ctggcagaac gctctcttta tgtaagacct caaaatctta 60 ctggttggtg tctgctgact tgtttttctc tgttatcttg cctgtctgca gtgacaaatt 120 cagtgcagct ctaactcatg tggacaggga ggaaatgatt ctaggattga ggacttaagg 180 gtgtctggaa gagaagagaa ttgttttgtt ttgttttgtt ttgttagttg ttgttttcct 240 cagacaggac cttgtcaacg ctttcaaata tgtaggctgt ttgctgtttc ctttatgttg 300 gtccctgaga aggatctgcc cttctaccct gtttccctgg ggggtgtgga cagagccttt 360 gtctttgggg aagggggtca tcttgggaaa aggagaacag ggcatcctga ggacctgctc 420 cgtctaagga gagaaagccg aacagatggc agctgccacg cagagggcac tttgtaggaa 480 ctctggctgg agcaggcttc ctgcgctcca atgccaaatc cttcccttc 529 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 43 gacatggttt tgccatgttg 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 44 cagccttatc tttgtttctc tgg 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 45 cgtgctggca aacttgaaat 20 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 46 ccaatgactc ccatattgct g 21 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 47 aagtgatcca cccacctgag 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 48 tccatgattc tgcggtgtaa 20 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 49 gctttcatgg tgtgggcta 19 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 50 gagggagatc tgggactcct 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 51 aggtgtacca accccagaca 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 52 gaagggaagg atttggcatt 20

Claims (11)

CUL4A (cullin 4A) single nucleotide polymorphism (single nucleotide polymorphism, SNP) comprising rs74115822, a SNP marker composition for cerebral aneurysm diagnosis.
The method of claim 1,
The SNP of the CUL4A gene, rs74115822, comprises the 26th nucleotide of SEQ ID NO: 6, SNP marker composition for diagnosis of cerebral aneurysm.
The method of claim 1, wherein the composition is
1) GBA (Glucocerebrosidase) SNP of rs75822236,
2) rs112859779, the SNP of the TCF24 (transcription factor 24) gene,
3) rs79134766, the SNP of the OLFML2A (Olfactomedin Like 2A) gene,
4) rs371331393, a SNP of the ARHGAP32 (Rho GTPase Activating Protein 32) gene,
5) rs138525217, the SNP of the CD163L1 (CD163 Molecule Like 1) gene,
6) rs75861150, a SNP of the LOC102724084 gene,
7) rs116969723, the SNP of the LRRC3 (Leucine rich repeat containing 3) gene,
8) RNF144A (Ring Finger Protein 144A) gene SNP rs6741819,
9) rs59626274, a SNP of the FLJ45964 gene,
10) rs17688188, the SNP of the Signal Peptidase Complex Subunit 3 (SPCS3) gene,
11) LINGO2 (Leucine Rich Repeat And Ig Domain Containing 2) gene SNP rs56942085, and
12) MINK1 (misshapen/Nck-interacting kinase (NIK)-related kinase 1) SNP of the gene, which further comprises one or more SNPs selected from the group consisting of rs72835045, a SNP marker composition for cerebral aneurysm diagnosis.
A composition for diagnosing a cerebral aneurysm, comprising an agent capable of detecting or amplifying the SNP of the CUL4A gene, rs74115822.
The method of claim 4, wherein the composition is
1) rs75822236, which is the SNP of the GBA gene,
2) rs112859779, the SNP of the TCF24 gene,
3) rs79134766, the SNP of the OLFML2A gene,
4) rs371331393, a SNP of the ARHGAP32 gene,
5) rs138525217, which is the SNP of the CD163L1 gene,
6) rs75861150, a SNP of the LOC102724084 gene,
7) rs116969723, a SNP of the LRRC3 gene,
8) rs6741819, which is the SNP of the RNF144A gene,
9) rs59626274, a SNP of the FLJ45964 gene,
10) rs17688188, the SNP of the SPCS3 gene,
11) rs56942085, which is a SNP of the LINGO2 gene, and
12) A composition for diagnosing a cerebral aneurysm further comprising an agent capable of detecting or amplifying one or more SNPs selected from the group consisting of rs72835045, which is a SNP of the MINK1 gene.
A method for providing information for diagnosing a cerebral aneurysm comprising the step of determining an allele of rs74115822, a SNP of the CUL4A gene, from a biological sample isolated from an individual.
The method of claim 6,
The method further comprises determining that a cerebral aneurysm has occurred or predicting a high risk of developing a cerebral aneurysm when the allele of rs74115822, which is the SNP of the CUL4A gene, is G, the method of providing information for diagnosis of a cerebral aneurysm .
The method of claim 6,
The method comprises from a biological sample isolated from an individual,
1) rs75822236, which is the SNP of the GBA gene,
2) rs112859779, a SNP of the TCF24 gene,
3) rs79134766, the SNP of the OLFML2A gene,
4) rs371331393, a SNP of the ARHGAP32 gene,
5) rs138525217, which is the SNP of the CD163L1 gene,
6) rs75861150, a SNP of the LOC102724084 gene,
7) rs116969723, a SNP of the LRRC3 gene,
8) rs6741819, which is the SNP of the RNF144A gene,
9) rs59626274, a SNP of the FLJ45964 gene,
10) rs17688188, the SNP of the SPCS3 gene,
11) rs56942085, which is a SNP of the LINGO2 gene, and
12) A method for providing information for diagnosis of a cerebral aneurysm, further comprising the step of determining an allele of one or more SNPs selected from the group consisting of rs72835045, which is a SNP of the MINK1 gene.
The method of claim 8, wherein the method
1) When the allele of rs75822236, the SNP of the GBA gene, is C,
2) When the allele of rs371331393, the SNP of the ARHGAP32 gene, is G,
3) When the allele of rs138525217, which is the SNP of the CD163L1 gene, is C,
4) When the allele of rs56942085, the SNP of the LINGO2 gene, is G, or a combination of two or more of them, it further comprises the step of determining that a cerebral aneurysm has occurred or predicting the risk of developing a high level, How to provide information for diagnosing a cerebral aneurysm.
The method of claim 8, wherein the method
1) When the allele of rs112859779, the SNP of the TCF24 gene, is T,
2) When the allele of rs79134766, which is the SNP of the OLFML2A gene, is A,
3) When the allele of rs75861150, the SNP of the LOC102724084 gene, is C,
4) When the allele of rs116969723, the SNP of the LRRC3 gene, is A,
5) When the allele of rs6741819, the SNP of the RNF144A gene, is T,
6) When the allele of rs59626274, which is a SNP of the FLJ45964 gene, is T,
7) When the allele of rs17688188, the SNP of the SPCS3 gene, is A,
8) When the allele of rs72835045, which is the SNP of the MINK1 gene, is A, or a combination of two or more of them, it further comprises determining that the cerebral aneurysm has not occurred or predicting the risk of developing at a low level. , Method of providing information for diagnosis of cerebral aneurysm.
The method of claim 6,
The individual is a Korean and Asian, the method of providing information for diagnosing a cerebral aneurysm.

Images