WO2023080281A1 - Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant - Google Patents

Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant Download PDF

Info

Publication number
WO2023080281A1
WO2023080281A1 PCT/KR2021/015995 KR2021015995W WO2023080281A1 WO 2023080281 A1 WO2023080281 A1 WO 2023080281A1 KR 2021015995 W KR2021015995 W KR 2021015995W WO 2023080281 A1 WO2023080281 A1 WO 2023080281A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
alanine
cell
pectin
composition
Prior art date
Application number
PCT/KR2021/015995
Other languages
English (en)
Korean (ko)
Inventor
심태진
김지훈
홍인기
김종필
이유진
이경민
정정일
김문정
Original Assignee
주식회사 프롬바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프롬바이오 filed Critical 주식회사 프롬바이오
Priority to PCT/KR2021/015995 priority Critical patent/WO2023080281A1/fr
Publication of WO2023080281A1 publication Critical patent/WO2023080281A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/04—Preserving or maintaining viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N1/00—Preservation of bodies of humans or animals, or parts thereof
    • A01N1/02—Preservation of living parts

Definitions

  • the present invention relates to a cell cryopreservation composition using pectin and alanine and a cell cryopreservation method using the same.
  • cells are separated from tissues such as fat, bone marrow, umbilical cord blood, and peripheral blood, cultured and proliferated in vitro, and manipulated by physical, chemical, and biological methods.
  • Cell therapy products are made from living cells with a short survival period. In order to preserve these cells, they can be subcultured over a long period of time. In this case, cell characteristics may change due to genetic mutation, and there is a risk of cell loss due to contamination. Therefore, there is a need for a preservation method for minimizing cell loss due to genetic mutation and contamination and stably maintaining cell characteristics.
  • stem cells are undifferentiated cells that exist between differentiated cells in tissues or organs, and have self-renewal ability to proliferate indefinitely while maintaining an undifferentiated state, and all tissue cells in the body under certain conditions. Since it has differentiation to specific tissue, it can be used as a cell therapy product to treat degenerative diseases or tissues damaged by trauma, so it is known that it has very high medical utilization. In order to use these stem cells as a cell therapy agent, it is essential to establish a cell cryopreservation method that guarantees cell viability or undifferentiation.
  • Cell cryopreservation methods are divided into slow freezing and rapid freezing.
  • Slow freezing is a method of preserving cells at an extremely low temperature of about -196 ° C by gently lowering the temperature by 1 to 2 ° C per minute with liquid nitrogen.
  • glycerol, DMSO (dimethyl sulphoxide), keratin or gelatin hydrolysate, acetamide, propylene glycol, polyethylene glycol, animal or human-derived serum or serum albumin, etc. of cryoprotectants are used. The generation of ice crystals inside and outside the cells is inhibited by the gentle cooling and use of cryopreservatives, thereby preventing cell damage.
  • the rapid freezing method (ie, vitrification freezing method) is a method of freezing by suppressing the formation of ice crystals inside and outside the cells by rapid freezing, and cryopreservatives such as DMSO, acetamide, propylene glycol, and polyethylene glycol are used.
  • cryopreservatives such as DMSO, acetamide, propylene glycol, and polyethylene glycol are used.
  • the rapid freezing method enables the cryopreservation of early mouse embryos and the cryopreservation of cow embryos and pig embryos, which were difficult to cryopreservate with the slow freezing method.
  • glycerol which has been used as a cryopreservative, does not have a complete buffering function during freezing and thawing, which often causes cell damage, and DMSO is expensive and has the potential to change the character of cells.
  • animal-derived serum such as fetal bovine serum (FBS) or human-derived serum can cause infections such as viruses and prions, and there is a risk of inducing an immune response, and for this reason, human administration There is a problem that is not suitable for preservation of cell therapy products for.
  • cryopreservatives capable of minimizing cell damage due to freezing and thawing while having excellent cell preservation effects is still required.
  • the present invention discloses the effect of pectin and alanine as cryopreservatives.
  • An object of the present invention is to provide a cell cryopreservation composition using pectin and alanine and a cell cryopreservation method using the same.
  • the present invention uses a DPBS (Dulbecco's phosphate-buffered saline) preservation solution containing pectin and alanine as cryopreservatives, in which pectin and alanine are not cytotoxic to human adipose-derived stem cells.
  • DPBS Denbecco's phosphate-buffered saline
  • pectin and alanine are not cytotoxic to human adipose-derived stem cells.
  • the present invention is provided based on the above experimental results, and the composition for cryopreservation of cells of the present invention is characterized in that it contains pectin and alanine.
  • Pectin is a component of the cell wall of dicotyledonous plants and has been widely used in the food field as a gelling agent, thickener, stabilizer, emulsifier, etc.
  • the structure is the main part and has a molecular weight of 200,000 to 400,000.
  • Pectin is generally classified into high methoxy pectin (DM>50) and low methoxy pectin (DM ⁇ 50) according to the degree of methylation (DM). It is toxy pectin, and low methoxy pectin is obtained by demethylation using acid, alkali, enzyme, ammonia, etc. further.
  • any pectin may be used regardless of the plant material from which it is obtained, the size of the molecular weight (preferably 100 to 300 g/mol), or the degree of methylation.
  • alanine may be L-alanine.
  • pectin and alanine are 1 to 30 ⁇ M of pectin, 3 to 90 ⁇ M of alanine, especially 5 to 15 ⁇ M of pectin, and 20 to 10 ⁇ M of alanine in order to exhibit sufficient cryopreservation effects (i.e., cell viability improvement after thawing, cell property maintenance effect). It can be included in the range of 40 ⁇ M.
  • composition for cryopreservation of the present invention may contain a preservative solution.
  • the preservative solution may be a cell culture medium, buffered or isotonic solution.
  • Cell culture media generally contain a carbon source, a nitrogen source, and trace elements.
  • carbon source monosaccharides, disaccharides, and the like may be preferably used. Specifically, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, or a mixture of one or more thereof may be used.
  • the nitrogen source may be an inorganic nitrogen compound, an organic nitrogen compound, or a complex compound containing these compounds.
  • inorganic nitrogen compounds include ammonia, ammonium salts (eg, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.), nitrate, and the like
  • organic nitrogen compounds include urea, amino acids, and the like.
  • trace elements include calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper, iron, phosphorus, sulfur, and the like, and these trace elements may be added to the medium in the form of salt compounds.
  • the cell culture medium may also further contain vitamins, growth factors, and the like, and in particular, serum substitutes such as insulin, transferrin, and selenium may be included for the use of a serum-free medium.
  • DMEM Dulbecco's Modified Eagle's Medium
  • MEM Minimal Essential Medium
  • BME Base Medium Eagle
  • RPMI 1640 F-10, F-12, DMEM/F12
  • MEM- ⁇ Minimal Essential Medium- ⁇
  • G-MEM Glasgow's Minimal Essential Medium
  • IMDM Iscove's Modified Dulbecco's Medium
  • MacCoy's 5A badge AmnioMax complete badge, AminoMaxII complete badge, EBM (Endothelial Basal Medium) badge, Chang's Medium, MesenCult-XF , DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose) medium, and MCDB+DMEM/LG (MCDB + Dulbecco's Modified Eagle's Medium low glucose) medium.
  • the preservative solution may be a buffer solution, which is a physiological saline solution containing citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, tris, etc. as a buffer.
  • a buffer solution which is a physiological saline solution containing citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, tris, etc.
  • PBS Phosphate Buffered Saline
  • TBS Tris Buffered Saline
  • HEPES Buffered Saline HEPES Buffered Saline
  • DPBS Dulbecco's phosphate-buffered saline
  • the preservative solution also contains sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose, etc. as an isotonic agent. It may be an isotonic solution. Such an isotonic solution may be Ringer's solution, lactate Ringer's solution, acetate Ringer's solution, bicarbonate Ringer's solution, or 5% glucose aqueous solution, and may be directly prepared and used or purchased commercially available.
  • the cell cryopreservation composition of the present invention may further include conventionally known cryopreservatives such as glycerol, keratin or gelatin hydrolysate, acetamide, DMSO, ethylene glycol, propylene glycol, polyethylene glycol, sericin, isomaltooligosaccharide, etc.
  • cryopreservatives such as glycerol, keratin or gelatin hydrolysate, acetamide, DMSO, ethylene glycol, propylene glycol, polyethylene glycol, sericin, isomaltooligosaccharide, etc.
  • EDTA, EGTA, citric acid, chelating agents such as salicylate, dissolution aids, preservatives, antioxidants, and amino acids such as proline and glutamine may be further included.
  • pectin and alanine which are cryopreservatives, have an equivalent level of effect on cell viability or pluripotency of stem cells compared to the case of using fetal bovine serum (FBS). It may not contain human-derived serum or serum-derived components (eg albumin).
  • composition for cryopreservation of the present invention can be used for cryopreservation of any animal cells, particularly mammalian cells.
  • Stem cells may be embryonic stem cells, adult stem cells, and dedifferentiated stem cells.
  • Adult stem cells may be stem cells originating from blood or tissues including fat, bone marrow, umbilical cord blood, and peripheral blood.
  • Stem cells may in particular be adipose-derived stem cells (ADSC).
  • ADSC adipose-derived stem cells
  • Adipose-derived stem cells have self-renewal ability and can be differentiated into various types of cells such as skin, cartilage, and bone, and are easier to collect and mass-cultivate than bone marrow-derived stem cells or cord blood-derived stem cells. However, because of its high content of stem cells, its utilization in cell therapy is high.
  • stem cells have self-renewal and differentiation capabilities, the type and origin are not particularly limited. For example, it may be from a mammal, human, monkey, pig, horse, cow, sheep, dog, cat, mouse or rabbit.
  • the stem cells may be derived from separated umbilical cord, placenta, fat, bone marrow, umbilical cord blood or amniotic fluid.
  • Various methods are known in the art for isolating, culturing, and proliferating stem cells or preparing embryonic stem cells, such as those described in [Curr Opin Chem Eng.
  • animal cells that can be used in the composition for cryopreservation of the present invention are islet cells administered intravenously to patients with type I diabetes, dendritic cells administered for cancer treatment, and natural killer cells.
  • NK cell islet cells administered intravenously to patients with type I diabetes, dendritic cells administered for cancer treatment, and natural killer cells.
  • T cell particularly cytotoxic T cell, cytotoxic T lymphocyte
  • CAR-T cell CAR-NK cell, etc.
  • animal cells may be isolated from living organisms or subcultured in vitro.
  • the animal cells are in a single cell state in which the cells do not aggregate with each other.
  • Mammalian cells in a single cell state can be obtained by enzymatically treating mammalian cells cultured in vitro with trypsin/EDTA, and then suspending the cells by a method known in the art, such as pipetting or tapping.
  • the cell ratio in a single cell state can be determined by dispersing the cells in PBS, observing them under a microscope, and examining the presence or absence of aggregation of a certain number of randomly selected cells.
  • the present invention provides a cell cryopreservation method.
  • the cell cryopreservation method of the present invention includes preparing a preservative solution containing pectin and alanine, suspending cells in the preservative solution, and freezing and preserving the preservative solution in which the cells are suspended.
  • pectin may be high methoxy pectin or low methoxy methine as described above, and alanine may be L-alanine.
  • the preservation solution may be a cell culture medium, buffer, or isotonic solution as described above.
  • the preservation solution may not contain animal-derived or human-derived serum or serum-derived components (eg, albumin).
  • the cells are stem cells, pancreatic islet cells, dendritic cells, natural killer cells, T cells, CAR-T cells, CAR-NK cells, CHO cells, HEK cells, MCF-7 cells, MDCK cells, Vero cells or the like.
  • the cell suspension is in the range of 1 ⁇ 10 3 cells to about 1 ⁇ 10 9 cells, particularly 1 ⁇ 10 5 to 1 ⁇ 10 8 cells, based on 1 ml of the preservation solution. It can be made by adding to the range.
  • freezing may be performed through a method known in the art, such as a slow freezing method or a rapid freezing method (vitrification freezing method).
  • Slow freezing is generally a method of freezing a preservative solution in which cells are suspended in a low-temperature freezer or an ultra-low-temperature freezer (usually in the range of -20 ° C to -150 ° C) by slowly dropping the temperature at a constant level for 12 to 24 hours.
  • the rapid freezing method is generally a method of rapidly freezing a preservative solution in which cells are suspended using equipment such as CRF (controlled rate freezing), usually using liquid nitrogen in a temperature range of -150 ° C to -196 ° C.
  • CRF controlled rate freezing
  • the cell viability when cells are cryopreserved and then thawed may differ depending on the cell type. Therefore, it may be necessary to adopt an appropriate cryopreservation method to increase the cell viability after thawing depending on the cells to be cryopreserved.
  • the preservation may be performed in a liquid nitrogen tank or a deep freezer.
  • the storage temperature may be -100 ° C to about -300 ° C, particularly -150 ° C to about -220 ° C, particularly preferably -150 ° C to -196 ° C.
  • the preservation period may be 1 day or 3 days or more, particularly 1 month, particularly preferably 3 months, 6 months or 1 year or more depending on the use of the cells, such as for research or drug development.
  • a cell cryopreservation composition using pectin and alanine and a cell cryopreservation method using the same can be provided.
  • the cell cryopreservation composition of the present invention and the cell cryopreservation method using the same have an effect of maintaining high cell viability after thawing and maintaining cell characteristics, similar to the case of using DMSO and FBS, which are conventional cryopreservatives, and also derived from animals such as cattle or It has an excellent cryopreservation effect without using human-derived serum or serum-derived components.
  • FIG. 2 confirms the cryopreservation effect of the cryopreservative of the present invention.
  • Adipose-derived stem cells are cryopreserved for 3 days using the cryopreservative and then thawed to measure the viability to confirm the cryopreservation effect.
  • Figure 3 is a photograph of the cells cultured in a culture dish after thawing and observing the cells cultured for 3 days under a microscope at a magnification of 4x over the entire upper and lower parts.
  • 5 is a result of confirming the expression level of adipose-derived stem cell-specific marker genes in cells cryopreserved using the cryopreservative of the present invention and then thawed.
  • the human adipose tissue used in this example was purchased from Goma Biotech Co., Ltd. (Seoul, Korea), and the method for isolating stem cells from adipose tissue was described by Zuk et al. (Mol Biol Cell. 2002 Dec; 13(12): 4279-4295) was used for reference and modification.
  • penicillin 100 U/ml
  • streptomycin 100 ug/ml
  • 10% heat-inactivated serum were added to DMEM (Dulbecco's Modified Eagle's Medium) in 95% air and 5% CO. 2 and cultured at 37 °C conditions. When the cells adhered to the culture dish and grew, the cells were collected using 0.25% trypsin/10 mM EDTA, divided at a ratio of 1:3, and maintained in 10% DMEM.
  • Pectin (194.14 g/mol) and alanine (L-alanine) used in the experiment were purchased from Sigma-Aldrich and used, and adipose-derived stem cells were the cells isolated in Example 1 above. was used.
  • CCK-8 The reagent used in the experiment, was purchased from Dongin Biotech Co., Ltd. (Seoul, Korea).
  • Adipose-derived stem cells were treated in 96-well plates at a concentration of 1 ⁇ 10 4 cells/well by 100 ul, and then cultured for 24 hours. When the cells adhered to the bottom, they were treated with the solvent DPBS (Dulbecco's phosphate-buffered saline), pectin and alanine up to 100 ⁇ M for up to 48 hours. After culturing for 3 hours under conditions of 10 ul of CCK-8 reagent and 100 ul of adipose-derived stem cell culture medium, absorbance was measured at 540 nm with a spectrophotometer.
  • DPBS Disbecco's phosphate-buffered saline
  • pectin as shown in A of FIG. 1 and alanine as shown in B of FIG. 1 can be safely used without showing toxicity up to 100 uM.
  • the present inventors used pectin and alanine as active ingredients in order to prepare a new composition for preserving adipose-derived stem cells.
  • alanine powder was mixed with 28.06 mL of DPBS by vortexing to completely dissolve to prepare a 100 mM alanine solution, and then mixed with DPBS to a final concentration of 300 ⁇ M.
  • the composition of the inventive cryoprotective prepared by the above manufacturing method is shown in Table 1 below, and was named FNCP (Frombio New Cryoprotective) for convenience.
  • composition of composition for cryopreservation FNCP solution concentration Capacity (1mL) final concentration Pectin 100 ⁇ M 100 ⁇ L 10 ⁇ M L-alanine 300 ⁇ M 300 ⁇ L 30 ⁇ M DPBS - 700 ⁇ L -
  • Adipose-derived stem cells cultured in a 75T flask were collected with 0.25% trypsin/10 mM EDTA, and then the cells at 1 ⁇ 10 6 cells/mL were suspended in a composition for cryopreservation prepared according to the composition of Table 1 above, using a Freezing Container, Frozen.
  • a group using 10 w/v% DMSO and 90 w/v% FBS was used as a control. Then, after 3 days of storage in LN2 tank and thawing, viable cells were counted using Trypan blue exclusion assay.
  • Example 4 It was cryopreserved according to Example 4, thawed, cultured for 3 days, and then the expression level of the stem cell pluripotency marker gene was examined.
  • Cells that were not cryopreserved were used as a negative control (NC), and cells cryopreserved with 10 w/v% DMSO and 90 w/v% FBS were used as a positive control (PC).
  • NC negative control
  • PC positive control
  • cDNA was synthesized from 1 ⁇ g total RNA using SuperscriptII reverse transcriptase (Invitrogen) and oligo dT.
  • Real-time PCR was performed by the SYBR green method using the synthesized cDNA and the primers of the stem cell pluripotency marker genes in Table 2 below.
  • SYBR Green I is an interchelator that exhibits fluorescence by binding to double-stranded DNA. The interchelator binds to the double-stranded DNA synthesized by the PCR reaction and emits fluorescence, and the amount of amplification product can be measured by detecting the fluorescence intensity.
  • the expression level of the stem cell pluripotency marker gene was not different from that of the negative control group and the positive control group. It was confirmed that the composition can be preserved without affecting the expression of the pluripotency marker gene of adipose-derived stem cells.
  • Example 5 Using the cDNA prepared in Example 5, the expression level of the specific marker gene of adipose-derived stem cells was investigated in the same manner.
  • CD73 known as a specific marker gene for adipose-derived stem cells.
  • the expression levels of CD90 and CD105 were confirmed using real-time PCR, and the primer sequences of each factor are shown in Table 3 below.
  • Primer sequences of specific marker genes for adipose-derived stem cells CD73-Forward AAGTGTCGAGTGCCCCAGTTA CD73-Reverse TGATCCGACCTTCAACTGCT CD90-Forward AGTACGAGTTCAGCCTGACC CD90-Reverse TCTGAGCACTGTGACGTTCT CD105-Forward TCCATTGTGACCTTCAGCCT CD105-Reverse CTTGGATGCCTGGAGAGTCA
  • the expression level of the adipose-derived stem cell-specific marker gene was not different from that of the negative control group and the positive control group. It was confirmed that the composition can be stably cryopreserved while preserving the unique characteristics of adipose-derived stem cells.

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Sont divulgués : une composition de cryoconservation cellulaire utilisant la pectine et l'alanine comme cryoprotecteurs, qui possède des effets de viabilité cellulaire élevée après décongélation et de maintien des propriétés cellulaires, et possède un excellent effet de cryoconservation sans utiliser de sérum provenant d'humains ou d'animaux tels que des vaches, ou de composants dérivés de sérum; et un procédé de cryoconservation cellulaire utilisant la composition.
PCT/KR2021/015995 2021-11-05 2021-11-05 Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant WO2023080281A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/015995 WO2023080281A1 (fr) 2021-11-05 2021-11-05 Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2021/015995 WO2023080281A1 (fr) 2021-11-05 2021-11-05 Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant

Publications (1)

Publication Number Publication Date
WO2023080281A1 true WO2023080281A1 (fr) 2023-05-11

Family

ID=86241646

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/015995 WO2023080281A1 (fr) 2021-11-05 2021-11-05 Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant

Country Status (1)

Country Link
WO (1) WO2023080281A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020031527A1 (en) * 1998-11-16 2002-03-14 Introgen Therapeutics, Inc. Formulation of adenovirus for gene therapy
JP2005270006A (ja) * 2004-03-25 2005-10-06 Kyudo Kk 精子凍結保存剤
KR20160033129A (ko) * 2013-07-02 2016-03-25 오스트리아노바 싱가포르 피티이 리미티드 캡슐화 세포의 동결-건조 방법, 동결 건조된 캡슐화 세포, 동결 건조된 캡슐화 세포를 함유하는 조성물, 및 상기 세포 및 조성물의 용도
US20180020658A1 (en) * 2016-07-22 2018-01-25 Tissue Testing Technologies Llc Enhancement of cell cryopreservation with glycolipids
US20190357525A1 (en) * 2016-12-23 2019-11-28 Cellular Biomedicine Group (Shanghai) Ltd. Cell freezing medium for clinical use
KR102391629B1 (ko) * 2021-11-04 2022-04-28 주식회사 프롬바이오 펙틴과 알라닌을 이용한 세포 동결 보존용 조성물 및 이를 이용한 세포 동결 보존 방법

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020031527A1 (en) * 1998-11-16 2002-03-14 Introgen Therapeutics, Inc. Formulation of adenovirus for gene therapy
JP2005270006A (ja) * 2004-03-25 2005-10-06 Kyudo Kk 精子凍結保存剤
KR20160033129A (ko) * 2013-07-02 2016-03-25 오스트리아노바 싱가포르 피티이 리미티드 캡슐화 세포의 동결-건조 방법, 동결 건조된 캡슐화 세포, 동결 건조된 캡슐화 세포를 함유하는 조성물, 및 상기 세포 및 조성물의 용도
US20180020658A1 (en) * 2016-07-22 2018-01-25 Tissue Testing Technologies Llc Enhancement of cell cryopreservation with glycolipids
US20190357525A1 (en) * 2016-12-23 2019-11-28 Cellular Biomedicine Group (Shanghai) Ltd. Cell freezing medium for clinical use
KR102391629B1 (ko) * 2021-11-04 2022-04-28 주식회사 프롬바이오 펙틴과 알라닌을 이용한 세포 동결 보존용 조성물 및 이를 이용한 세포 동결 보존 방법

Similar Documents

Publication Publication Date Title
CN113423268B (zh) 干细胞的低温保存
US11821006B2 (en) Method of isolating mesenchymal stem cells from the amniotic membrane of the umbilical cord, a mesenchymal stem cell population isolated from the amniotic membrane of the umbilical cord and a cell culture medium for isolating mesenchymal stem cells from the amniotic membrane of the umbilical cord
KR102391629B1 (ko) 펙틴과 알라닌을 이용한 세포 동결 보존용 조성물 및 이를 이용한 세포 동결 보존 방법
AU2017377309B9 (en) Mammalian cell cryopreservation liquid
WO2012091206A1 (fr) Composition pour milieu de congélation destinée à la cryoconservation des cellules souches dérivées du liquide amniotique et procédé de cryoconservation afférent
KR101321144B1 (ko) 줄기세포 초자화 동결보존액 및 이를 이용하는 줄기세포 초자화 동결보존방법
US20210102171A1 (en) Mesenchymal stem cell storing or transport formulation and methods of making and using the same
US11998569B2 (en) Method of transporting mesenchymal stem cells by means of a transporting solution and a method of administering stem cells to wounds
CN114557337B (zh) 脐带间充质干细胞无蛋白非程序冻存液及其制备方法
TWI732298B (zh) 包含阿卡波糖或水蘇糖之哺乳動物細胞保存用液
WO2023080281A1 (fr) Composition de cryoconservation de cellules utilisant de la pectine et de l'alanine et procédé de cryoconservation de cellules l'utilisant
WO2019103529A2 (fr) Composition de congélation et de conservation de cellules, et procédé de congélation et de conservation de cellules l'utilisant
WO2019199230A1 (fr) Procédé de transport de cellules souches mésenchymateuses au moyen d'un milieu de culture cellulaire et procédé d'administration de cellules souches à des plaies
KR20210134701A (ko) 트레할로스를 포함하는 포유동물 세포 보존용 액
WO2023113109A1 (fr) Procédé d'isolement de cellules souches dérivées du tissu adipeux utilisant des doubles puits possédant une structure partie supérieure/partie inférieure
WO2021193606A1 (fr) Solution de conservation de cellules de mammifère contenant de l'acarbose et du dextrane

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21963381

Country of ref document: EP

Kind code of ref document: A1