WO2023036966A1 - Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof - Google Patents
Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof Download PDFInfo
- Publication number
- WO2023036966A1 WO2023036966A1 PCT/EP2022/075185 EP2022075185W WO2023036966A1 WO 2023036966 A1 WO2023036966 A1 WO 2023036966A1 EP 2022075185 W EP2022075185 W EP 2022075185W WO 2023036966 A1 WO2023036966 A1 WO 2023036966A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sequence
- polynucleotide
- nucleotides
- otoferlin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/16—Otologicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0306—Animal model for genetic diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/40—Systems of functionally co-operating vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
Definitions
- the present invention is based on the observation that a dual AAV vector strategy encoding isoform 5 of otoferlin cDNA that has been split into two expression cassettes both packaged in - and delivered by - an AAV8 capsid can efficiently deliver the otoferlin cDNA to the inner hair cell (IHC).
- IHC inner hair cell
- the inventors highlighted that the use of the CMV promoter in one of the two AAV8 vectors provides a significant expression of otoferlin in these particular cells.
- the AAV serotype and the type of promoter used are two key elements that have a significant effect on the transduction efficiency, the development of the vector system of the invention is going to provide optimal therapeutic benefit in patients suffering from DFNB9 deafness.
- the inventors finally tested some particular otoferlin-encoding dual vector constructs to identify enhanced transfection rate and a very effective in vitro and in vivo otoferlin expression in mature cochlea of DFNB9 mice models, leading to the restoration of their hearing.
- Deafness genes encode proteins with a wide range of molecular functions vital for cochlear functioning, such as development of the sensory organ, sound transduction in the stereocilia of hair cells, maintenance of the endocochlear potential (EP) and high concentration of extracellular potassium, and synaptic neurotransmission between hair cells and spiral ganglion neurons (SGNs).
- Major proteins made from deafness genes include ion channels and transporters, gap junctions and tight junctions, protein subunits in cytoskeleton and molecular motors, and transcription factors transiently expressed in cochlear development. Whether a mutation affects early cochlear development and leads to a significant cellular degeneration is a major factor in determining the "treatment time window", which is a crucial problem in this therapeutic field.
- Prosthetic cochlear implants are currently used for rehabilitation (Kral A & O'Donoghue GM N Engl J Med 363(15):1438-1450 (2010)), but hearing recovery is far from perfect, particularly for the perception of speech in noisy environments or of music, because of their inherent limitation of frequency resolution as imposed by inter-channel electrical interference.
- a primary motivation in developing biological treatments is to restore hearing without the implantation of any prosthetic device, and to achieve sound resolution quality and unit cost that is much better than what is currently achievable with cochlear implants.
- gene therapy with local Adeno-associated virus (AAV)-mediated gene therapy has already been proposed for treating human forms of deafness (Zhang et al, Frontiers in Molecular Neuroscience, vol.11, Art.221, 2018). This approach is now being tested for several inherited disorders, including Parkinson's disease, visual impairment and metabolism disorders, in various preclinical and clinical trials.
- the present inventors have designed new therapeutic recombinant vectors that can be used in DFNB9 preclinical trials. These vectors differ from those of the prior art in that they express the isoform 5 of the human otoferlin protein, placed under the control of the CMV promoter optionally followed by an intronic sequence, and are packaged in an AAV8 capsid, which specifically target inner hair cells (IHCs).
- IHCs inner hair cells
- the different dual plasmids were tested in vitro by transfecting HEK293 cells using liposome as carrier and OTOF expression was assessed 48 hours post transfection, using immunocytochemistry and Western-Blot (figures 3, 5, and 7).
- the recombination efficacy of the various dual AAV OTOF vectors to produce the full-length protein was furthermore investigated by RT-PCR (figure 7A).
- the dual vector showing the best transfection rate and the most effective in vitro protein expression was furthermore investigated by verifying the accuracy of the recombined region that produced the full-length protein.
- the dual expression cassettes were packaged in the AAV8 capsid and in vivo delivered to cochlea of the DFNB9 mouse model. Immunoconfocal microscopy was used to determine whether the otoferlin protein was properly targeted to the IHC after cochlear AAV delivery. Hearing restoration in the mice was assessed by auditory-evoked brainstem response recordings at different stages after AAV delivery.
- Otoferlin is abundantly expressed in sensory IHCs of the cochlea. It is also expressed in other cells of the central nervous system. It plays a key role in the final steps of synaptic vesicle fusion at cochlear hair cell synapses with afferent spiral ganglion neurons. More precisely, it is important for exocytosis at the auditory ribbon synapse (Roux et al, Cell 127(2):277-89, 2006). In human beings, mutations affecting the Otoferlin gene (“OTOF gene”) lead to severe non-syndromic bilateral loss of hearing that occurs after birth but before the acquiring of language.
- OTOF gene mutations affecting the Otoferlin gene
- At least 75 mutations have been identified so far, among which 7 are known to be thermosensitive (P.Q.994VfsX6, P.I515T, p.G541S, PR1607W, p.E1804del, c.2975_2978delAG/c.4819C>T, C.4819OT (c.R1607W) reviewed in Pangrsic T. et al, Trends in Neurosciences, 2012, col.35, No.11. These deafness phenotypes (constitutive and inducible) are found all over the world and known as the "Deafness, Autosomal Recessive 9" or "DFNB9" deafness. DFNB9 deafness accounts for up to 10% of autosomal recessive non-syndromic hearing loss, thereby residing within the top five of genetic hearing disorders that still require a therapeutic intervention.
- the present inventors have shown that AAV8 vectors containing the 5' portions of the human otoferlin cDNA under the transcriptional control of the CMV promoter are optimal and efficient in the target cells. Therefore, the present inventors have set up a dual-AAV vector system containing the identified promoter and two half-portions of the Otoferlin gene to IHCs, where a trans-plicing and/or homologous recombination occur leading to the expression of protein full-length.
- nucleic acid and “nucleotide sequence” and “polynucleotide sequence” refer to a deoxyribonucleotide or ribonucleotide polymer in either single or double stranded form, and unless otherwise limited, encompass known analogues of natural nucleotides that can function in a similar manner as naturally occurring nucleotides.
- Otoferlin designates the Otoferlin polypeptide. It is herein abbreviated as "OTOF”. This polypeptide is also known as "AUNB1", “DFNB6”, “DFNB9”, “NSRD9” and "FER1L2".
- This polypeptide is a member of the Ferlin family of transmembrane proteins, which has C2 domains as synaptotagmins, PKC and PLC (Yasunaga S et al, J Hum Genet. 2000 Sep;67(3):591-600). This long form contains six C2 domains. As mentioned above, it is involved in synaptic vesicle fusion between cochlear hair cell and afferent spiral ganglion neurons (Roux et al, Cell 127(2):277-89, 2006; Michalski et al, Elife, 2017 Nov 7;6 e31013).
- Otoferlin polypeptide designates the isoform 5 (variant e) of the wild-type human Otoferlin polypeptide of SEQ ID NO:5 (corresponding to Genbank number NP_001274418) and homologous sequences. It is encoded for example by the cDNA sequence NM_001287489.1 (SEQ ID NO:91, wherein the coding sequence of said isoform starts at nucleotide 186) and by SEQ ID NO:15 (corresponding to the coding sequence of said isoform).
- homologous polypeptide thereof whose amino acid sequence shares at least 70% identity and/or similarity with SEQ ID NO:5, that retain at least one biological function of the Otoferlin polypeptide of SEQ ID NO:5.
- this biological function is related to the modulation of vesicles fusion at the cochlear inner hair cell ribbon synapses that activate the primary auditory neurons (Michalski et al, Elife, 2017 Nov 7;6 e31013). This modulation could be assessed with classical ex vivo electrophysiological measures.
- Said homologous sequence more preferably shares at least 75%, and even more preferably at least 80%, at least 85%, or at least 90% identity and/or similarity with SEQ ID NO:5. When the homologous polypeptide is much shorter than SEQ ID NO:5, then local alignment can be considered.
- Said homologous polypeptide can have for example the amino acid sequence presented in SEQ ID NO:1 (corresponding to Genbank number NP_919224.1). Said sequence characterises the isoform a (variant
- Said homologous polypeptide can also have the amino acid sequence presented in SEQ ID NO:2 (corresponding to Genbank number NP_004793.2) or the amino acid presented in SEQ ID NO:3 (corresponding to Genbank number NP_919303.1) corresponding to the short isoforms b and c (variants 2 and 3) respectively. More precisely, SEQ ID NO:2 represents the isoform b (variant 2, also called 'short form 1') which has a shorter N-terminus and lacks a segment compared to SEQ ID NO:1.
- SEQ ID NO:3 represents the isoform c (variant 3, also called “short form 2”), which differs in the 5' UTR and coding sequence compared to variant 1 (SEQ ID NO:1) because it has a shorter and distinct C-terminus compared to SEQ ID NO:1.
- Said homologous polypeptide can also have the amino acid sequence presented in SEQ ID NO:4 (corresponding to Genbank number NP_919304.1) corresponding to the isoform d (variant 4).
- This variant differs in the 5' UTR and coding region, as well as in the 3' coding region, compared to variant 1.
- the resulting isoform (d) has a shorter N-terminus and a distinct C-terminus compared to isoform a of SEQ ID NO:1. It is encoded by SEQ ID NO:14 (corresponding to GenBank number NM_194323.3).
- the vector system of the invention can allow for the expression of a functional fragment of the Otoferlin polypeptide of SEQ ID NO:5.
- the term "functional fragment” herein designates any fragment of the human Otoferlin polypeptide or any fragment of a polypeptide having a homologous sequence as defined above, wherein said fragment retains at least one biological function of the Otoferlin polypeptide that is of interest in the present context.
- this biological function is related to the modulation of vesicles fusion at the cochlear inner hair cell ribbon synapses that activate the primary auditory neurons (Michalski et al, Elife, 2017 Nov 7;6 e31013). This modulation could be assessed with classical ex vivo electrophysiological measures.
- the vector system of the invention can allow for the expression of three particular homologous proteins of the variant 5 (see the Example 2 and associated Figure 6).
- These three alternative OTOF isoforms have the amino acid sequences of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. They can be encoded by the cDNA sequences of SEQ. ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, respectively. It is thus preferred to use in the vector system of the invention any of these new isoforms, as they are thought to have a potential to restore hearing in humans.
- these new isoforms may encode in situ the proteins of SEQ ID NO:6, SEQ ID NO:7 and/or SEQ ID NO:8 having a potential to restore hearing in humans, in addition to the current human isoform 5 transcript.
- the vector system of the invention therefore allows for the expression of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, or for a functional homologous polypeptide thereof, that retain the activity of these new isoforms and/or of SEQ ID NO:5.
- These functional homologous are the ones whose amino acid sequence shares at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% identity and/or similarity with SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.
- the homologous polypeptide is much shorter than SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, then local alignment can be considered.
- the invention provides systems encoding homologous amino acid sequences that are "similar" to these sequences, as defined above.
- they contain a coding sequence that can be for example the long cDNA sequence NM_194248.3 (isoform a or variant 1, SEQ ID NO:11), the shorter cDNA sequence NM_004802.4 (isoform b or variant 2, SEQ ID NO:12), the cDNA sequence NM_194322.3 (isoform c or variant 3, SEQ ID NO:13), or the cDNA sequence NM_194323.3 (isoform d or variant 4, SEQ ID NO:14).
- Said coding sequence can also have the sequence SEQ ID NO:16, 17 or 18 corresponding to the cDNAs of new isoforms of the OTOF gene, as explained below.
- said coding sequence is derived from the human Otoferlin gene of SEQ ID NO:91 (NM_001287489.1) encoding the transcript variant 5 (which coding sequence begins at nucleotide 186). It is more preferably as disclosed in SEQ ID NO:15.
- the coding sequence is preferably SEQ ID NO:15. It is also possible to use any homologous sequence thereof, having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ. ID NO:15.
- the identity percentage between two homologous sequences is preferably identified by a global alignment of the sequences in their entirety when the sequences are of about the same size.
- This alignment can be performed by means of an algorithm that is well known by the skilled person, such as the one disclosed in Needleman and Wunsch (1970).
- sequence comparisons between two amino acid sequences or two nucleotide sequences can be performed for example by using any software known by the skilled person, such as the "needle” software using the "Gap open” parameter of 10, the "Gap extend” parameter of 0.5 and the "Blosum 62" matrix.
- Similarity of two targeted amino acid sequences can be determined by calculating a similarity score for the two amino acid sequences.
- the “similarity score” refers to the score generated for the two sequences using the BLOSUM62 amino acid substitution matrix, a gap existence penalty of 11, and a gap extension penalty of 1, when the two sequences are optimally aligned.
- Two sequences are “optimally aligned” when they are aligned so as to produce the maximum possible score for that pair of sequences, which might require the introduction of gaps in one or both of the sequences to achieve that maximum score.
- Two amino acid sequences are substantially similar if their similarity score exceeds a certain threshold value.
- the threshold value can be any integer ranging from at least
- the threshold similarity score can be 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, 1500, or higher.
- the threshold score is set at, for example, 1300, as compared with a reference sequence, then any amino acid sequence that can be optimally aligned with said reference sequence to generate a similarity score of greater than 1300 is "similar" to said reference sequence.
- Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well-known in the art and described, e.g., in Dayhoff et al. (1978), "A model of evolutionary change in proteins", “Atlas of Protein Sequence and Structure," Vol. 5, Suppl. 3 (ed. M. O. Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, D.C.
- the invention relates to a vector system comprising at least two different AAV particles, namely: a) at least one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a CMV promoter sequence followed by a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and b) at least one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadenylation sequence, wherein the first and second polynucleotides comprise a recombinogenic polynucleotide sequence, and wherein the
- the vector system of the invention contains at least one AAV8 particle containing the polynucleotide as defined in a) (i.e., encoding the N-terminal coding part of Otoferlin), and at least one AAV8 particle containing the polynucleotide as defined in b) (i.e., encoding the C-terminal coding part of Otoferlin).
- said vector system contains said first and second polynucleotides, each polynucleotide being preferably contained in separate AAV8 particles.
- the two different types of AAV8 particles can be contained within the same composition or within different compositions and may be administered together or separately.
- the vector system of the invention contains two different recombinant AAV vectors, one comprising the above-mentioned polynucleotide a) and the other comprising the above-mentioned polynucleotide b), so that the two polynucleotides are simultaneously present in the target cells, and the Otoferlin polypeptide can be generated in situ.
- AAVs are small replication-deficient adenovirus-dependent viruses from the Parvoviridae family. They have an icosaedrical capsid of 20-25 nm in diameter and a genome of 4.7 kb flanked by two inverted terminal repeats (ITRs). After uncoating in a host cell, recombinant AAV genome can persist in a stable episome state by forming high molecular weight head-to-tail circular concatamers providing long-term and high-level transgene expression.
- AAV8 which is the preferred AAV serotype in the context of the present invention, is currently tested in vivo.
- genetic modifications of AAV8 can be performed. These genetic modifications include the deletion of the El region, deletion of the El region along with deletion of either the E2 or E4 region, or deletion of the entire adenovirus genome except the cis-acting inverted terminal repeats and a packaging signal. Such modified vectors are advantageously encompassed in the present invention.
- AAV8 having a mutated capsid protein so as to direct the gene expression towards a particular tissue type, e.g., to auditory cells.
- AAV8 vectors in which tyrosine residues in the viral envelope are substituted for alanine residues can be used.
- tyrosine 733 can be substituted with an alanine residue (AAV8-Y733A).
- AAV8-Y733A it is possible to increase gene transfer by up to 10,000 fold, decreasing the amount of AAV necessary to infect the sensory hair cells of the cochlea.
- AAV8 vectors in which any tyrosine residues in the viral envelope are substituted by alanine residues.
- efficacy of AAV8 serotype can be further improved using peptide ligand insertion as disclosed in Michelfelder, PLoS One. 2011; 6(8): e23101.
- cells can be coinfected or transfected with adenovirus or polynucleotide constructs comprising adenovirus genes suitable for AAV helper function. Examples of materials and methods are described, for example, in U.S. 8,137,962 and 6,967,018. It is routine for the skilled person to generate the AAV particles that are essential to the vector system of the invention, based on the information provided herein and his / her common knowledge.
- promoter of the invention designates the CMV promoter having the SEQ ID NO:9 and homologous sequences thereof that retain the promoter function of SEQ. ID NO:9 on the Otoferlin polypeptide. It is indeed possible to use any homologous sequence of SEQ ID NO:9, having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% with SEQ ID NO:9.
- This additional sequence can be for example the sequence of SEQ ID NQ:10, said sequence representing a chimera between introns from human beta-globin and immunoglobin heavy chains.
- This promoter (optionally followed by the intronic sequence) can be incorporated into the vectors of the invention using standard techniques known in the art. It has to be located upstream of the first exon of the Otoferlin gene. In one embodiment, the promoter (and optionally the intronic sequence) is positioned about the same distance from the transcription start site as it is from the transcription start site in its natural genetic environment. Yet, variation in this distance is permitted without substantial decrease in promoter activity. A transcription start site is typically included in the vector.
- the polynucleotides included in the vector system of the invention contain the N- or the C-terminal coding part of the Otoferlin gene, encoding, when recombined, the isoform5 of the Otoferlin polypeptide of SEQ ID NO:5 (corresponding to Genbank number NP_001274418), or functional fragments and homologous sequences thereof, as defined above.
- the polynucleotides included in the vector system of the invention contain a part of the cDNA sequence NM_001287489.1 (isoform 5 or variant e, SEQ ID NO:91), more preferably the coding part thereof whose sequence is displayed on SEQ. ID NO:15.
- the polynucleotides included in the vector system of the invention contain a part of the cDNA sequence of SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, allowing for the expression of three particular homologous proteins of the isoform 5 (see the Example 2 and associated Figure 6) of SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 respectively.
- a dual-vector approach is advantageous to split a long coding sequence into two parts, in order to be packaged more easily into virions having a limited packaging capacity.
- AAVs capsids are herein used, it is preferred to use polynucleotides that contain an OTOF coding sequence that contains no more than 5 kilobases, preferably no more than 4,7 kilobases.
- the vector system of the invention should therefore contain two distinct polynucleotides each containing parts of the coding sequence of an Otoferlin gene that encodes the Otoferlin polypeptide described above.
- Said coding sequence is for example the one displayed in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18, or any homologous sequence thereof, having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18.
- the partial coding sequences contained in the polynucleotides described herein are designed so that, upon delivery of the polynucleotides, the partial coding sequences are joined together, e.g., through homologous recombination, and form a complete coding sequence (also referred to as "Otoferlin gene") that encodes an Otoferlin polypeptide as defined above.
- said coding sequence (or "Otoferlin gene") has the sequence displayed in nucleotides 186-6179 of SEQ ID NO:91, or it has the sequence displayed in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18 or an homologous sequence thereof, as defined above.
- the coding sequence of the human OTOF gene is preferably cut at a natural splicing site.
- the human OTOF gene isoform 5 of SEQ ID NO:15 can be split between exons 18 and 19 into a N-terminal coding part having the nucleotides 1-2214 of SEQ ID NO:15 and a C-terminal coding part having the nucleotides 2215-5991 of SEQ ID NO:15.
- the human OTOF gene isoform 5 of SEQ ID NO:15 can be split between exons 20 and 21 into a N-terminal coding part having the nucleotides 1-2406 of SEQ ID NO:15 and a C-terminal coding part having the nucleotides 2407-5991 of SEQ ID NO:15.
- the human OTOF gene isoform 5 of SEQ ID NO:15 can be split between exons 21 and 22 into a N-terminal coding part having the nucleotides 1-2523 of SEQ ID NO:15 and a C-terminal coding part having the nucleotides 2524-5991 of SEQ ID NO:15.
- the human OTOF gene isoform 5 of SEQ ID NO:15 can be split between exons 22 and 23 into a N-terminal coding part having the nucleotides 1-2676 of SEQ ID NO:15 and a C-terminal coding part having the nucleotides 2677-5991 of SEQ ID NO:15.
- the human OTOF gene isoform 5 of SEQ ID NO:15 can be split between exons 24 and 25 into a N- terminal coding part having the nucleotides 1-2991 of SEQ ID NO:15 and a C-terminal coding part having the nucleotides 2992-5991 of SEQ ID NO:15.
- the human OTOF gene isoform 5 of SEQ ID NO:15 can be split between exons 25 and 26 into a N-terminal coding part having the nucleotides 1-3126 of SEQ ID NO:15 and a C-terminal coding part having the nucleotides 3127-5991 of SEQ ID NO:15.
- the N-terminal coding part of the Otoferlin gene contained in one of the two polynucleotides preferably consists in: the nucleotides 1-2214, the nucleotides 1-2406, the nucleotides 1-2523, the nucleotides 1-2676, the nucleotides 1-2991, or the nucleotides 1-3126 of the Otoferlin gene of SEQ ID NO:15.
- the C-terminal coding part of the Otoferlin gene contained in the other polynucleotide consequently preferably consists in: the nucleotides 2215-5991, the nucleotides 2407-5991, the nucleotides 2524-5991, the nucleotides 2677-5991, the nucleotides 2992- 5991, or the nucleotides 3127-5991 of the Otoferlin gene of SEQ ID NO:15.
- Exemplary polynucleotides that can be used as first and second polynucleotide in the vector system of the invention are for example SEQ ID NO: 47&48 or 47&49, 50&51 or 50&52, 53&54 or 53&55, 56&57 or 56&58, 59&60 or 59&61, and 62&63 or 62&64, each SEQ ID NO: of said pair containing the CMV promoter of SEQ ID NO:9, and the sequence encoding respectively the N-terminal & the C-terminal part of the isoform 5 of the Otoferlin human protein mentioned above, in a hybrid AP vector.
- SEQ ID NO:48, 51, 54, 57, 60 and 63 contain the WPRE sequence of SEQ ID NO:23, whereas SEQ ID NO:49, 52, 55, 58, 61 and 64 don't.
- first polynucleotide of the vector system of the invention the nucleotides of SEQ ID NQ:70-75, containing the CMV promoter of SEQ ID NO:9, the intronic sequence SEQ ID NQ:10, and respectively the nucleotides 1-2214, the nucleotides 1-2406, the nucleotides 1-2523, the nucleotides 1-2676, the nucleotides 1-2991, or the nucleotides 1-3126 of SEQ ID NO:15, thereby encoding N-terminal parts of the isoform 5 of the human Otoferlin (SEQ ID NO:15).
- first polynucleotide of the vector system of the invention a polynucleotide whose sequence is SEQ ID NO:73, containing the CMV promoter of SEQ ID NO:9, the intronic sequence of SEQ ID NQ:10, and the N-terminal part of the isoform 5 of the Otoferlin human protein, more precisely the nucleotides 1-2676 of SEQ ID NO:15.
- first polynucleotide of the vector system of the invention a polynucleotide containing the AAV cassette of SEQ ID NQ:90, containing the CMV promoter of SEQ ID NO:9, the intronic sequence of SEQ ID NO:10, and the N-terminal part of the isoform 5 of the Otoferlin human protein, more precisely the nucleotides 1-2676 of SEQ. ID NO:15.
- polynucleotides that can be used as first and second polynucleotide in the hybrid AP vector system of the invention are for example SEQ ID NO: 79&80, SEQ ID NO:79 containing the CMV promoter of SEQ ID NO:9, and the sequence encoding the N-terminal part of the isoform 1 of the Otoferlin murine protein, in a hybrid AP vector.
- SEQ ID NO: 80 contains the sequence encoding the C- terminal part of the isoform 1 of the Otoferlin murine protein, without the WPRE sequence.
- the first and second polynucleotides used in this particular embodiment should contain specific genetic components (inverted terminal repeats, polyadenylation sequence, recombinogenic region, etc) in order to induce the appropriate recombination and expression of the Otoferlin protein in the target cells.
- these genetic components are the following:
- the vector system of the invention can contain wild-type ITR sequences or engineered ITR sequences.
- ITR can be used advantageously in a dual approach AAV system.
- the ITR sequences of a polynucleotide described herein can be derived from any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) or can be derived from more than one serotype.
- the ITR sequences are derived from AAV8.
- ITR sequences and plasmids containing ITR sequences are known in the art and commercially available.
- An exemplary AAV8 ITR sequence for flanking the 5' end of an expression construct comprises the sequence SEQ ID NO:19.
- An exemplary AAV8 ITR sequence for flanking the 3' end of an expression construct comprises the sequence SEQ. ID NO:20.
- any homologous sequence having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID NO:19 and/or SEQ ID NQ:20.
- the two polynucleotides of the invention also comprise a so-called "recombinogenic region" which can promote recombination, including homologous recombination, between the two polynucleotides once delivered to a cell, so as to produce the entire coding sequence of the OTOF polypeptide and expression thereof in the transfected inner hair cells (see, e.g., Ghosh et al. Hum Gene Ther. 2011 Jan;22(l):77-83).
- This recombinogenic region may typically consists in a first region of the first polynucleotide that has an homologous region in the second polynucleotide, or vice versa.
- the two regions preferably have a threshold level of sequence identity with each other of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity, as defined above.
- This recombinogenic region has preferably a size comprised between 50 and 500, 50 and 400, 50 and 300, 100 and 500, 100 and 400, 100 and 300, 200 and 500, 200 and 400, or 200 and 300 nucleotides.
- the two regions are identical and have a size comprised between 200 and 300 nucleotides.
- stringent conditions for hybridization refers to conditions wherein hybridization is typically carried out overnight at 20-25°C below the melting temperature (T m ) of the DNA hybrid in 6x SSPE, 5x Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA.
- T m melting temperature
- Washes are typically earned out as follows: (1) Twice at room temperature for 15 minutes in lx SSPE, 0.1 % SDS (low stringency wash). 2) Once at Tm-20°C for 15 minutes in 0.2x SSPE, 0.1% SDS (moderate stringency wash).
- the recombinogenic sequences, especially overlapping recombinogenic sequences, present in the two polynucleotides of the vector system of the invention are an exogenous fragment or a fragment of Otoferlin.
- Said recombinogenic sequence can be a fragment of an exogenous gene, coding or non-coding, or the ITRs present in the polynucleotide.
- sequence SEQ ID NO:69 (derived from the gene of the alkaline phosphatase AP), or an homologous sequence thereof, preferably having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ. ID NO:69.
- a "trans-splicing strategy” in which a splice donor (SD) signal is placed at the 3' end of the 5'- half vector and a splice acceptor (SA) signal is placed at the 5'end of the 3'-half vector.
- SD splice donor
- SA splice acceptor
- hybrid strategy in which a highly recombinogenic sequence is added, potentially from an exogenous gene (for example alkaline phosphatase, AP) to the trans-splicing vector disclosed above.
- This second recombinogenic sequence is for example placed downstream of the SD signal in the 5'-half vector and upstream of the SA signal in the 3'-half vector in order to increase recombination between the dual AAVs (cf. Ghosh et al, Hum Gene Then 2011. 22:77-83).
- the two exogenous recombinogenic sequences are preferably identical and have more preferably the sequence SEQ ID NO:69 (derived from the gene of the alkaline phosphatase AP), or an homologous sequence thereof, as defined above.
- the polynucleotides included in the dual-vector system of the invention comprise a splice donor or a splice acceptor site so that, once recombined in vivo, the exogenous recombinogenic region can be spliced out.
- the splice donor and/or splice acceptor sites contain splice consensus sequences.
- the splice donor and/or splice acceptor sites carried by the polynucleotides included in the vector system of the invention contain splice consensus sequences derived from the alkaline phosphatase enzyme (see SEQ. ID NO:21 and SEQ ID NO:22).
- the polynucleotides included in the dual-vector system of the invention comprise SEQ ID NO:21 and/or SEQ ID NO:22 as splice donor and acceptor site respectively, or splice sites comprising a sequence having a sequence identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with SEQ ID N0:21 and/or SEQ. ID NO:22.
- the polynucleotides of the invention may contain several recombinogenic sequences, i.e., for example, splice donor / acceptor sites, and an exogenous recombinogenic sequence.
- the presence of two recombinogenic regions is indeed preferable in order to ensure a precise and accurate recombination, in vivo, with no remaining unwanted nucleotides left.
- Any appropriate combination or use of other recombinogenic sequences than those disclosed above can be contemplated, as soon as it enables efficient recombination in the target cells, such as inner hair cells.
- the polynucleotide sequences present in the vector system of the invention may contain other regulatory components that are functional in the inner hair cells in which the vector is to be expressed.
- regulatory elements include, for example, internal ribosome entry site (IRES), transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements.
- the polynucleotide sequences present in the vector system of the invention may for example contain the WHV Posttranscriptional Regulatory Element (WPRE) that can stabilize the mRNA and enhance the protein yield.
- WPRE sequence can be of SEQ. ID NO:23. It can also contain a Kozak consensus sequence, e.g., the sequence of GCCGCCACCAUGG (SEQ ID NO:89), as disclosed in the exemplary sequences herein proposed (SEQ ID NO: 47, 50, 53, 56, 59, 62, SEQ ID NQ:70-75, SEQ ID NO:81, 82, 85 and SEQ ID NO:86).
- the polynucleotide containing the C terminal sequence of the Otoferlin gene contains preferably a
- DNA sequence which directs polyadenylation of the mRNA encoded by the structural gene can also be included in a vector of the invention.
- the polyA of the bovine growth hormone SEQ ID NO:24
- SEQ ID NO:24 can be used with this respect.
- Transcription termination regions can typically be obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of a coding sequence to provide for efficient termination.
- Signal peptide sequence is an amino terminal sequence that encodes information responsible for the relocation of an operably linked polypeptide to a wide range of post-translational cellular destinations, ranging from a specific organelle compartment to sites of protein action and the extracellular environment.
- Enhancers are cisacting elements that increase gene transcription and can also be included in a vector of the invention. Enhancer elements are known in the art, and include, but are not limited to, the CaMV 35S enhancer element, cytomegalovirus (CMV) early promoter enhancer element, and the SV40 enhancer element.
- CMV cytomegalovirus
- the vector system of the invention is a trans-splicing vector system comprising at least two different recombinant AAV8 particles, namely: a) one AAV8 particle comprising: a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter, optionally followed by a kozak sequence of SEQ.
- a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and a splice donor site as recombinogenic sequence then followed by a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and a splice donor site as recombinogenic sequence, and b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site as recombinogenic sequence, a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ ID NO:24).
- a polyadenylation sequence for example the polyA of the bovine growth hormone of SEQ ID NO:24.
- the CMV promoter which is preferably of SEQ. ID NO:9, is optionally followed by the intronic sequence of SEQ ID NQ:10 and/or by a kozak sequence of SEQ ID NO:89 or 92.
- the partial coding sequence encoding otoferlin is located downstream of this additional intronic sequence.
- the two different types of AAV8 particles can be contained within the same composition or within different compositions and may be administered together or separately.
- This vector system can be used in the trans-splicing strategy described above.
- the enclosed listing provides preferred vectors (SEQ ID NO: 85 - SEQ ID NO: 88) that can be used accordingly.
- SEQ ID NO:85 and SEQ ID NO:86 encode the N-terminal part (until amino acid 892) of the Otoferlin human isoform 5, respectively under control of the CMV promoter or of the CMV followed by the intronic sequence
- SEQ ID NO:87 and SEQ ID NO:88 encode the C-terminal part (as of amino acid 893) of the Otoferlin human isoform 5, with and without the WPRE sequence respectively.
- the vector system of the invention is an overlapping vector system comprising at least two different AAV8 particles, namely: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter, optionally followed by a kozak sequence of SEQ ID NO:89 or 92, then followed by a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ
- the CMV promoter which is preferably of SEQ ID NO:9, is optionally followed by the intronic sequence of SEQ. ID NO:10 and/or by a kozak sequence of SEQ ID NO:89 or 92.
- the partial coding sequence encoding otoferlin is located downstream of this additional intronic sequence.
- the two different types of AAV8 particles can be contained within the same composition or within different compositions and may be administered together or separately.
- SEQ ID NO:81 - SEQ ID NO:84 Such a vector system can be used in the overlapping strategy described above.
- the enclosed listing provides preferred overlapping vectors (SEQ ID NO:81 - SEQ ID NO:84).
- SEQ ID NO:81 and SEQ ID NO:82 encode the N-terminal part (until amino acid 892) of the Otoferlin human isoform 5, respectively under control of the CMV promoter or of the CMV followed by the intronic, whereas SEQ ID NO:83 and SEQ ID NO:84 encode the C-terminal part (as of amino acid 893) of the Otoferlin human isoform 5, with and without the WPRE sequence respectively.
- the vector system of the invention is an hybrid vector system comprising at least two different recombinant AAV8 particles, namely: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter followed by a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and a splice donor site, and b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of S
- the CMV promoter which is preferably of SEQ ID NO:9, is optionally followed by the intronic sequence of SEQ. ID NO:10 and/or by a kozak sequence of SEQ ID NO:89 or 92.
- the partial coding sequence encoding otoferlin is located downstream of this additional intronic sequence.
- the two different types of AAV8 particles can be contained within the same composition or within different compositions and may be administered together or separately.
- Such a vector system can be used in the hybrid strategy described above.
- the enclosed listing provides several exemplary vectors (SEQ ID NO: 47&48 or 47&49, 50&51 or 50&52, 53&54 or 53&55, 56&57 or 56&58, 59&60 or 59&61, and 62&63 or 62&64) corresponding to a cutting site between exons 18-19, 20-21, 21-22, 22-23, 24-25 and 26-27 respectively (the C-terminal vectors containing or not a WPRE sequence) that can be used with this respect.
- the C-terminal vector of SEQ ID NO:97 can be advantageously used.
- the N-terminal vectors of SEQ ID NQ:70-75 and 90, in which the CMV promoter is followed by the intronic sequence can be advantageously used.
- the first polynucleotide can contain the nucleotides 1-2214, the nucleotides 1-2406, the nucleotides 1-2523, the nucleotides 1-2676, the nucleotides 1-2991, or the nucleotides 1-3126 of the Otoferlin gene of SEQ ID NO:15.
- the second polynucleotide can contain the nucleotides 2215-5991, the nucleotides 2407-5991, the nucleotides 2524-5991, the nucleotides 2677-5991, the nucleotides 2992-5991, or the nucleotides 3127-5991 of the Otoferlin gene of SEQ ID NO:15.
- a particularly preferred vector system of the invention contains: a) a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter of the invention, optionally a intronic sequence (typically SEQ ID NO:10), optionally a kozak sequence of SEQ ID NO:89 or 92, followed by the nucleotides 1-2214, the nucleotides 1-2406, the nucleotides 1-2523, the nucleotides 1-2676, the nucleotides 1-2991 or the nucleotides 1-3126 of the Otoferlin gene of SEQ.
- a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter of the invention, optionally a intronic sequence (typically SEQ ID NO:
- a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, the nucleotides 2215-5991, the nucleotides 2407-5991, the nucleotides 2524-5991, the nucleotides 2677-5991, the nucleotides 2992-5991 or the nucleotides 3127-5991 of the Otoferlin gene of SEQ ID NO:15, optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ ID NO:24), each polynucleotide comprising as second recombinogenic sequence of SEQ ID NO:69 derived from the gene encoding alkaline phosphatase.
- a polyadenylation sequence for example the polyA of the bovine growth hormone of SEQ ID NO:24
- the first polynucleotide in said vector system is chosen among: SEQ ID NO:47, 50, 53, 56, 59, and 62 (without intronic sequence) or among SEQ ID NQ:70, 71, 72, 73, 74, and 75 (with a intronic sequence), said polynucleotides containing respectively the nucleotides 1-2214, the nucleotides 1- 2406, the nucleotides 1-2523, the nucleotides 1-2676, the nucleotides 1-2991, or the nucleotides 1- 3126 of SEQ ID NO:15, thereby encoding N-terminal parts of the isoform 5 of the human Otoferlin.
- the second polynucleotide in said vector system is chosen among: SEQ ID NO:48, 51, 54, 57, 60 and 63 (with the enhancer WPRE) or among SEQ ID NO:49, 52, 55, 58, 61 and 64 (without the enhancer WPRE), said polynucleotides containing respectively the nucleotides 2215-5991, the nucleotides 2407-5991, the nucleotides 2524-5991, the nucleotides 2677-5991, the nucleotides 2992- 5991, or the nucleotides 3127-5991 of SEQ ID NO:15, thereby encoding C-terminal parts of the isoform
- a particularly preferred vector system is a vector system comprising: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter of SEQ ID NO:9 and optionally a intronic sequence of SEQ ID NO: 10 and/or a kozak sequence of SEQ. ID NO:89 or 92, followed by the nucleotides 1-2214, the nucleotides 1-2676, or the nucleotides 1-2991 of the Otoferlin gene of SEQ.
- the nucleotides 1-2676, and a splice donor site and b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, the nucleotides 2215-5991, the nucleotides 2677-5991, or the nucleotides 2992-5991 of the Otoferlin gene of SEQ ID NO:15 (more preferably the nucleotides 2677-5991), optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ ID NO:24), wherein the said first and second polynucleotides also contain the AP recombinogenic sequence of SEQ ID NO:69 that is located after the splice donor site in said first polynucleotide and before the s
- Another particularly preferred vector system is a vector system comprising: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter of SEQ ID NO:9 and optionally a intronic sequence of SEQ ID NQ:10, and optionally a Kozak 1 sequence of SEQ ID NO : 89 or 92, followed by the nucleotides 1-2214, the nucleotides 1-2676, or the nucleotides 1-2991 of the Otoferlin gene of SEQ.
- the nucleotides 1-2676, and a splice donor site and b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, the nucleotides 2215-5991, the nucleotides 2677-5991, or the nucleotides 2992-5991 of the Otoferlin gene of SEQ ID NO:15 (more preferably the nucleotides 2677-5991), optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ ID NO:24), wherein the said first and second polynucleotides also contain the AP recombinogenic sequence of SEQ ID NO:69 that is located after the splice donor site in said first polynucleotide and before the s
- a particularly preferred vector system according to the invention contains SEQ ID NO: 56 (without intronic sequence) encoding the N-terminal part of the isoform 5 of the human Otoferlin, and SEQ ID NO:58 (without the enhancer WPRE) encoding the C-terminal part of the isoform 5 of the human Otoferlin.
- compositions of the invention are provided.
- the present invention targets a pharmaceutical composition comprising the vector system of the invention, as described above (i.e., the virions containing above-described polynucleotides), and a pharmaceutically acceptable carrier.
- the present invention also targets pharmaceutical compositions comprising only one population of the viruses of the invention, said viruses containing either the "first" or the "second" polynucleotides which have been described thoroughly above.
- Said pharmaceutical compositions typically contain any of the trans-splicing, hybrid or overlapping vectors disclosed above.
- the composition of the invention contains the particles comprising the hybrid vector of the invention, namely: either AAV8 particles comprising a polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter, optionally a kozak sequence, followed by a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and a splice donor site as recombinogenic sequence and a pharmaceutically acceptable carrier; or AAV8 particles comprising a polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site as recombinogenic sequence, a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadeny
- said composition comprises: a) one AAV8 particle comprising a first polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter, optionally a kozak sequence, followed by a partial coding sequence that contains the N- terminal coding part of the Otoferlin gene, and a splice donor site, and b) one AAV8 particle comprising a second polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ.
- a polyadenylation sequence for example the polyA of the bo
- first and second polynucleotides also contain a second recombinogenic sequence that is located after the splice donor site in said first polynucleotide and before the splice acceptor site in said second polynucleotide.
- the present invention also targets a pharmaceutical composition
- a pharmaceutical composition comprising, apart from the pharmaceutically acceptable carrier, AAV8 particles comprising polynucleotides comprising an inverted terminal repeat at each end of said polynucleotides, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter followed by a partial coding sequence that contains the N-terminal coding part of the Otoferlin gene, and a splice donor site, wherein said polynucleotide also contain a second recombinogenic sequence that is located after the splice donor site in said polynucleotides.
- the present invention also targets a pharmaceutical composition
- a pharmaceutical composition comprising, apart from the pharmaceutically acceptable carrier, AAV8 particles comprising polynucleotides comprising an inverted terminal repeat at each end of said polynucleotides, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, a partial coding sequence that contains the C-terminal coding part of the Otoferlin gene, optionally followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ. ID NO:24), wherein the polynucleotides also contain a second recombinogenic sequence that is located before the splice acceptor site in said polynucleotides.
- AAV8 particles comprising polynucleotides comprising an inverted terminal repeat at each end of said polynucleotides, and, between the said inverted terminal repeats, from 5' to 3': a splice acceptor site, a partial
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
- pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
- isotonic agents for example, sugars, polyalcohol such as mannitol, sorbitol, or sodium chloride in the composition.
- Pharmaceutically acceptable carriers can further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the the vector system or of the pharmaceutical compositions containing same.
- compositions of the invention may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories.
- liquid solutions e.g
- compositions typically must be sterile and stable under the conditions of manufacture and storage.
- the pharmaceutical composition of the invention is preferably formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration.
- Sterile injectable solutions can be prepared by incorporating the vectors of the invention in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the vectors or viruses of the invention into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and spray-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-f iltered solution thereof.
- the proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prolonged absorption of injectable compositions can be achieved by including an agent in the composition that delays absorption, for example, monostearate salts and gelatin.
- compositions of the invention typically include a "therapeutically effective amount” or a “prophylactically effective amount” of the vectors or viruses of the invention.
- a “therapeutically effective amount” refers to the amount of the vectors or viruses of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, in this case for both prophylaxis and treatment of hearing loss without unacceptable toxicity or undesirable side effects.
- the pharmaceutical composition of the invention contains a therapeutically effective amount of viruses containing SEQ ID NO: 56 encoding the N-terminal part of the isoform 5 of the human Otoferlin (without intronic sequence) and SEQ. ID NO:58 encoding the C- terminal part of the isoform 5 of the human Otoferlin (without the enhancer WPRE).
- the pharmaceutical composition of the invention contains a therapeutically effective amount of viruses containing SEQ ID NO: 56 encoding the N-terminal part of the isoform 5 of the human Otoferlin (without intronic sequence) and SEQ ID NO:57 encoding the C- terminal part of the isoform 5 of the human Otoferlin (with the enhancer WPRE).
- the pharmaceutical composition of the invention contains a therapeutically effective amount of viruses containing SEQ ID NO: 75 encoding the N-terminal part of the isoform 5 of the human Otoferlin (with intronic sequence) and SEQ ID NO:57 encoding the C- terminal part of the isoform 5 of the human Otoferlin (with the enhancer WPRE).
- the pharmaceutical composition of the invention contains a therapeutically effective amount of viruses containing SEQ. ID NO: 75 encoding the N-terminal part of the isoform 5 of the human Otoferlin (with intronic sequence) and SEQ ID NO:58 encoding the C- terminal part of the isoform 5 of the human Otoferlin (without the enhancer WPRE).
- the pharmaceutical composition of the invention contains a therapeutically effective amount of viruses containing :
- AAV8 particles comprising a polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the CMV promoter followed by the intronic sequence of SEQ ID NQ:10, the kozak sequence of SEQ ID NO:89, the N-terminal coding part of the human Otoferlin gene (isoform 5, exons 1-22), a splice donor site and the recombinogenic sequence of SEQ ID NO:69, said polypeptide having for example the sequence displayed in SEQ ID NO:73 or SEQ ID NQ:90, together with a pharmaceutically acceptable carrier;
- AAV8 particles comprising a polynucleotide comprising an inverted terminal repeat at each end of said polynucleotide, and, between the said inverted terminal repeats, from 5' to 3': the recombinogenic sequence of SEQ ID NO:69, a splice acceptor site, the C-terminal coding part of the human Otoferlin gene (isoform 5, as of exon 23), followed by a polyadenylation sequence (for example the polyA of the bovine growth hormone of SEQ ID NO:24), said polypeptide having for example the sequence displayed in SEQ ID NO:97, together with a pharmaceutically acceptable carrier.
- the pharmaceutical composition of the invention contains a therapeutically effective amount of viruses containing : AAV8 particles comprising a polynucleotide whose sequence is displayed in SEQ ID NO:90, together with a pharmaceutically acceptable carrier;
- a therapeutically effective amount of the vectors or viruses of the invention can vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of said compound to elicit a desired response in same.
- a therapeutically effective amount can also be one in which any toxic or detrimental effects of the claimed compounds are outweighed by the therapeutically beneficial effects.
- a “prophylactically effective amount” refers to an amount of the viruses or vectors of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose can be used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount is usually less than the therapeutically effective amount.
- Dosage regimens can be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus can be administered, several divided doses can be administered over time or the dose can be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.
- Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of the vector or virus of the invention calculated to produce the desired therapeutic or prophylactic effect in association with the required pharmaceutical carrier.
- first and second AAV polynucleotides / particles are to be used, the first and second AAV polynucleotides / particles may be contained within the same composition or within different compositions and may be administered together or separately.
- the composition of the invention contains from 10 s to 10 14 particles/mL or from 10 10 to 10 15 particles/mL, or any values there between for either range, such as for example, about 10 s , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 particles/mL. In one embodiment, the composition of the invention contains more than 10 13 of AAV particles/mL.
- the amount administered is the same for both particles.
- the present invention also relates to the viruses or the vector system of the invention or the pharmaceutical compositions as defined above, for use for treating patients suffering from DFNB9 deafness or preventing DFNB9 deafness in patients having DFNB9 mutations.
- the invention also relates to a treating or preventing method involving the administration of the viruses or the vector system of the invention, or pharmaceutical compositions containing same, to patients suffering from DFNB9 deafness or patients having DFNB9 mutations, respectively.
- viruses or the vector system of the invention or the pharmaceutical compositions can be administered to human subjects suffering from congenital hearing loss due to altered DFNB59 gene expression or deficiency. Said deficiency can be observed for example when
- Otoferlin is expressed at normal levels but is not functional.
- the present invention relates to the use of the viruses or vector system of the invention, as described above, for manufacturing pharmaceutical compositions intended to prevent and / or treat patients suffering from disorders linked to altered DFNB9 gene expression or deficiency.
- the term "treating” is intended to mean the administration of a therapeutically effective amount of the viruses or vector system of the invention to a patient suffering from DFNB9 deafness, in order to restore partially or completely the hearing in said patient. Said recovery can be assessed by testing the auditory brain stem responses (ABRs) with electrophysiologic devices. "Treatment of the DFNB9 deafness” is in particular intended to designate the complete restoration of hearing function regardless of the cellular mechanisms involved.
- viruses or the vector system or the composition of the invention can also be administered to prevent the loss of hearing induced from the body temperature modulation.
- the term "preventing" designates impairing or delaying the loss of hearing within audible frequency range.
- viruses or the vector system or the composition of the invention can be administered both for preventing the loss of hearing before it occurs, and for restoring at least partially the hearing capacity when hearing loss has already occurred.
- the viruses or the vector system or the composition of the invention are administered to patients suffering from DFNB9 deafness.
- patients suffering from DFNB9 deafness it is herein meant a patient, especially a human patient, that is thought to have (or has been diagnosed to have) a mutation in the constitutive Otoferlin gene, said mutation triggering an abnormal expression, function or both, of the Otoferlin protein.
- said mutation can be thermo-sensitive.
- the patient has one or more of the following nonsense or missense mutations in the OTOF gene: TYR730TER, GLN829TER, PR01825ALA, PRO50ARG, LEU1011PRO, ILE515THR, ARG1939GLN, or GLY541SER.
- the patient has an A-to-G transition at the intron 8/exon 9 junction (IVS8-2A-G) or a G-to-A transition at position +1, the first intronic nucleotide in the splice donor site of exon 5 or a G-C transversion in the donor splice site of intron 39.
- the patient has a one base pair deletion (1778G) in exon 16, leading to a stop codon, and a 6141G-A change, resulting in an ARG-to-GLN substitution in exon 48.
- the time of administration of the viruses, or virus system or composition of the invention will be within the purview of the skilled artisan having benefit of the present teachings. It is possible to administer the composition of the invention up to 12 years of age and over, but it can be also carried out as soon as the disease or the mutation is detected, e.g., in utero in embryos or foetuses, or soon after birth, for example before three months after birth, preferably before one month after birth.
- the patients to which the viruses or the vector system or the composition of the invention is administered are preferably patients, especially human patients, in which the auditory system, especially the cochlea, is already developed and mature. In this case, these patients, especially human patients, would therefore not be human embryos or foetuses. Accordingly, the patients targeted by the present invention would be preferably new born human babies, typically younger than 6 months old, or even younger than 3 months old, if DFNB9 deafness is diagnosed that young. These human babies would be more preferably between 3 months and 1 year.
- the human cochlea as a whole attains an adult size between 17 and 19 weeks' gestation and is fully morphologically mature at 30-36 weeks (corresponding to 12 days after birth in the mouse).
- the functional maturation of the inner hair cell ribbon synapse can be evaluated by monitoring the wave I of the ABR recording, that can be recorded at about the 28th week of gestation in humans. Recordings and analyses of the ABR wave I (reflecting the function of the inner hair cell synapses with the primary auditory neurons) have shown a complete functional maturation in human babies at birth (corresponding to 20 days after birth in the mouse). This is well known in the art (see for example Pujol et Lavigne-Rebillard, Acta oto-laryngologica. Suppiementum • February 1991).
- the present inventors have shown previously that gene therapy with otoferlin is efficient even when achieved on mature auditory system (Akil el al 2019, PNAS; Hardelin et al., medecine / sciences 2019; 35:1213-25).
- the patients of the invention are human beings that are 6 years and older, i.e., the administration of the treatment occurs when their Central Nervous System is completely mature.
- the viruses or the vector system or the composition of the invention are administered to human patients suffering from DFNB9 deafness induced by thermosensitive mutations, preferably chosen from: PQ994VfsX6, P.I515T, p.G541S, PR1607W, pE1804del, c.2975_2978delAG/c.4819C>T, c.4819C>T (c.R1607W) more preferably to teenagers or adult humans carrying at least one of the Otoferline thermosensitive mutations mentioned above.
- thermosensitive mutations preferably chosen from: PQ994VfsX6, P.I515T, p.G541S, PR1607W, pE1804del, c.2975_2978delAG/c.4819C>T, c.4819C>T (c.R1607W) more preferably to teenagers or adult humans carrying at least one of the Otoferline thermosensitive mutations mentioned above.
- the typical mode of administration of the pharmaceutical composition of the invention is intratympanic (in the middle ear), intracochlear, or parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal).
- the pharmaceutical composition of the invention is administered by intravenous infusion or injection.
- the pharmaceutical composition of the invention is delivered to a specific location using stereostatic delivery, particularly through the tympanic membrane or mastoid into the middle ear.
- viruses, the vector system or the pharmaceutical composition of the invention can be administered by using a micro-catheter that will be carried out either through the oval window using laser stapedotomy (trans-stapes) or transmastoid / trans-round window (Dai C. et al, JARO, 18:601-617, 2017).
- the viruses, the vector system or the pharmaceutical composition of the invention is administered in human ear via intra-cochlear administration, more precisely by targeting endolymphatic spaces in the vestibular system or by the semi-circular approach mentioned above.
- the cochlea is highly compartmentalized and separated from the rest of the body by the blood- cochlear barrier (BCB), which minimizes the therapeutic injection volume and leakage into the body's general circulation system, to protect cochlear immune privilege and reduce the chance of systemic adverse immune responses.
- BCB blood- cochlear barrier
- AAV nonintegrating viral vectors
- the viruses or the vector system or composition of the invention are administered in human ear via one of the two common and well-established techniques that are routinely used in clinical otologic surgical practice. More precisely, these approaches will be adopted to target the perilymphatic spaces. To this end, the injections using a micro-catheter will be carried out either through the oval window using laser stapedotomy (trans-stapes) or transmastoid / trans-round window (Dai C. et al, JARO, 18:601-617, 2017). Systemic administration by intravenous injections or infusions are also possible. The skilled person would easily determine if it is required, prior to the administration of the viruses or the vector(s) or composition of the invention, to enhance the permeability of the round window membrane as proposed in WO 2011/075838, depending on the target cell.
- trans-stapes laser stapedotomy
- transmastoid / trans-round window Dai C. et al, JARO, 18:601-617,
- OTOF isoforms have the amino acid sequences of SEQ ID NO:6, SEQ ID NO:7 or SEQ. ID NO:8. They can be encoded by the cDNA sequences of SEQ. ID NO:16, SEQ. ID NO:17 and SEQ ID NO:18, respectively.
- Each of them may have a potential to restore hearing in humans. They can therefore be used in gene therapy instead of the usual OTOF isoform proteins 1-5 disclosed in the art.
- the present invention also relates to homologous polypeptides thereof, whose amino acid sequence shares at least 70%, at least 75%, and even more preferably at least 80%, at least 85%, or at least 90% identity and/or similarity with SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.
- homologous polypeptide is much shorter than SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, then local alignment can be considered.
- the present invention also relates to any vector or vector system encoding SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, or an homologous polypeptide thereof, as defined above.
- any vector comprising the cDNA sequences of SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18.
- vectors are preferably useful for gene therapy. They include, yet are not limited to, DNA plasmid vectors as well as DNA and RNA viral vectors. In the present invention, such vectors may be used to express the new isoforms of OTOF in cells of the auditory pathway such as cochlear hair cells.
- vectors are well-known in the art. They are for example viral vectors such as lentiviruses, adenoviruses and Adeno-associated viruses (AAV).
- A Low and high magnification micrographs of a P30 organ of Corti immuno-labelled for GFP after RWM injection. Note that AAV8-CMV-GFP transduced all IHCs.
- B Confocal images of the mid-apex wild-type cochlea injected through the RWM at P20 with AAV8-GFP, Anc80-GFP, and AAV2-GFP. Scale bars: 100pm; 10pm for insets.
- C & D In vivo transduction of cochlear cells with AAV8 and AAV2 vectors in NHP. Confocal representative images of cochlea that underwent AAV8- (C) or AAV2-CMV-GFP (D) injection through the RWM combined to oval window fenestration delivery approach. GFP expressing cells (green) along the length of the cochlea. Cell nuclei were stained with DAPI (blue). Red, phalloidin-stained actin. Scale bars 100pm; 10pm for insets.
- Figure 3 Schematic representation of the recombination, transcription, splicing, and translation processes producing the full-length human protein Otoferlin in transduced cells.
- pA polyadenylation site
- SD splice donor element
- SA splice acceptor element
- AP alkaline phosphatase recombinogenic region
- ITR Inverted terminal repeats.
- Figure 5 A. Scheme of the in vitro ubiquitous CMV promoter-driven expression of human otoferlin protein after dual vector delivery using lipofectamine-based transfection.
- HEK293 cells were transfected with the Dual OTOF Nter-Cter 738-739 (black), 892-893 (dark grey), and 997-998 (light grey) plasmids and their respective controls (Nter or Cter alone). Experiments were performed 3 times with at least 2 independent wells per condition. For each condition, quantification of cells positive (Nter+Cter) for otoferlin was performed on at least 3 fields of 200-300 DAPI positive cells per well.
- Figure 6 Diagram summarizing the exons present in the mouse cochlea, highlighting the exons present on the murine transcript (A1-B2-C2) and the exons present on the human isoform 5 transcript (A2-B1-C2).
- Figure 7 A. RT-PCR analysis of the otoferlin transcript produced by the reconstituted full-length human cDNA in co-transfected HEK293 cells with the pair of recombinant plasmids.
- the RNA extracts were reverse-transcribed, and subjected to PCR amplification with primers designed to amplify a 898 or 946 bp fragment of the otoferlin cDNA encompassing the junction between the Otof Nter and Otof Cter cDNA.
- a negative (non-transfected HEK293 cells) and positive (pcDNA3 containing the HuOTOFcDNA under the control of the CMV promoter) control are shown.
- M DNA molecular weight marker. The position of the 0.5, and 1.5 kb molecular mass markers of the DNA ladder is indicated on the left side of the electrophoresis gel.
- B Full-length otoferlin expression following HEK293 cells transfection with dual otof plasmids.
- M For each of the dual plasmids, the corresponding Nter and Cter or only Nter or Cter parts were used for transfection. Otoferlin specific antibodies were used to identify the full-length otoferlin protein.
- HEK293 cells transfected with the HuOTOF (Hu cDNA) plasmid were used as positive control.
- M Prestained protein marker.
- TOT Input (soluble protein extracts).
- IP Extracts from HEK293 cells subjected to immunoprecipitation with the FP2 otoferlin antibody.
- NT Cell lysates from non-transfected cells.
- ACTB An anti human beta-actin monoclonal antibody was used as an internal-loading control between the different lanes. The position of the different molecular mass markers of the protein ladder is indicated on the left side of the electrophoresis gel. Stars indicated non-specific antibody detection (bands also observed in the non-transfected cells).
- the human otofelin coding sequence (OTOF transcript variant 5; NM_001287489.2) was split at different exon-exon natural junctions: exon 18-19 (nt 1- 2214/2215-5991, aa 738-739), exon 20-21 (nt 1-2406/2407-5991), exon 21-22 (nt 1-2523/2524-5991, aa 841-842), exon 22-23 (nt 1-2676/2677-5991, aa 892-893), exon 24-25 (nt 1-2991/2992-5991, aa 997-998), and exon 25-26 (nt 1-3126/3127-5991, aa 1042-1043).
- the 5' vectors p0101-CMV-intron-NterhuOTOF738, 802, 841, 892, 997, and 1042 were generated by mutagenesis from p0101-CMV-NterhuOTOF738, 802, 841, 892, 997, and 1042 constructs described above (Genscript).
- the full-length coding sequence of the murine otoferlin cDNA sequence (Otofl isoforml; NM_001100395.1) was divided into a 5' fragment (nucleotides 1-2448) and a 3' fragment (nucleotides 2449-5979), and these fragments were synthetized (Genscript).
- the 5' and 3' fragments have been cloned into p0101_CMV_eGFP plasmid (SEQ ID NO:77).
- the 5' vector p0101-CMV-Nter murine OTOF816_AP (SEQ ID NO:79) and 3' vector Cter OTOF murine817_AP (SEQ ID NQ:80) were generated (see Akil et al. 2019).
- the 5' fragment has been also cloned into p0101_smCBA_eGFP plasmid (SEQ ID NO:96).
- the 5' vector pOlOl-smCBA-Nter murine OTOF816_AP (SEQ ID NO:95) was generated (see Akil et al. 2019).
- AAV vectors were produced by either University of Pennsylvania Vector Core (UPenn) or ETH (Zurich) Vector Core facility.
- AAV titers were given in viral genomes per ml (vg/ml) as determined by ddPCR-based method (UPenn) or fluorometric assay (ETH).
- Final concentrated AAV vector stocks were stored in PBS with Pluronic-F68 (0,001%) (UPenn) or in PBS with MgCI2 (ImM) and KCI (2.5mM) (ETH).
- HEK293 cells were cultured at 37°C in a humidified chamber containing 5% CO2.
- HEK293 cells were grown in six-well plates on polylysine-coated coverslips in DMEM/F-12 Thermofisher) supplemented with lx non-essential amino acids and 10% FBS (Gibco), and penicillin/streptomycin (Pen/Strep; Invitrogen).
- FBS Gibco
- Pen/Strep penicillin/streptomycin
- cells were grown on polylysine-coated coverslips.
- cells were transfected at 70-80% of confluency with Lipofectamine 3000® (Thermofisher). Briefly, Lipofectamine® 3000 Reagent in was diluted in Opti-MEM® Medium- Mix.
- a master mix of DNA was prepared by diluting DNA (0.25 to 10 pg) in OptiMEM® Medium, then added to P3000TM Reagent. Diluted DNA was added to each tube of diluted Lipofectamine® 3000 Reagent (1:1 ratio). After an incubation for 5 minutes at room temperature the DNA-lipid complex was added to cells. The next day of transfection medium was replaced. Between 24-48 hours post-transfection, cells were collected for immunocytochemistry and RT-PCR analysis.
- RNA dosage was then assessed using a Nanovue Plus spectrophotometer.
- Retro-transcription PCR for the Otoferlin gene was performed on extracted RNA with the SuperscriptTM III One-Step RT-PCR System (Thermofisher, 12574018) with different couple of primers designed to amplify specific junction fragments (forward 4F TGGAGGCCTCAATGATCGAC, SEQ. ID NO:45 and reverse 4R AGCCACAGGGCAGGCCGCAC SEQ.
- RNA extract was used as template. PCR products was then migrated on a 0,8% agarose gel with Ethidium Bromide. Sanger sequencing of PCR products was performed by Transnetyx automated sequencing services.
- Immunoprecipitates were resuspended in 50pl at a ratio 1:1 with NuPAGETM LDS Sample Buffer (4X) (Invitrogen) and NuPage Sample Reducing Agent (10X) (Invitrogen) then incubated at 70°C for 10 minutes. Samples were mixed at a ratio 1:1 with NuPAGETM LDS Sample Buffer (4X) (Invitrogen) and NuPage Sample Reducing Agent (10X) (Invitrogen) then incubated at 70°C for 10 minutes.
- Housekeeping protein assessment was performed by a blotting with a monoclonal antibody to beta-actin.
- the membrane was probed with a primary antibody (mouse anti-beta-actin antibody, 1:5000 dilution, Sigma) in blocking buffer during 1 hour, then in anti-mouse HRP-antibodies (1:5000 dilution, Jackson Immunoresearch) in the same blocking buffer.
- Chemiluminescence was revealed with ECL substrate for 5 minutes at RT and detected with the ChemiDoc Imaging Systems (Biorad).
- mice at different postnatal stages were anesthetized with isoflurane (4% for induction and 2% for maintenance).
- isoflurane 4% for induction and 2% for maintenance.
- the anesthetized animal was placed on a thermopad throughout the procedure until the mouse was totally awake.
- Intracochlear injection was carried out as described by Akil et al. (2019).
- the left ear was approached via a retro-auricular incision.
- the otic bulla was exposed and punctured with a 25G needle.
- the opening was expanded as necessary with forceps to visualize the stapedial artery and the round window membrane (RWM).
- the RWM was gently punctured in the center with a glass pipette, then a fixed volume (2 microliters) of a PBS or viral solution containing either the AAV8-CMV_GFP of SEQ ID NO:77 (5.6xl0 13 vg/ml), or the Anc80L65-CMV-GFP of SEQ.
- the animals were anesthetized by intramuscular injection of a mixture of Ketamine (lOmg/kg) and Propofol (5-10 mg/kg) and intubated, and maintained with oxygen and isoflurane during surgery.
- Animals received a prophylactic injection of an antibiotic (Duphamox 15mg/kg, IM) and an anti-inflammatory (tolfedine 4mg/kg, IM).
- the round window niche (RW) of the left or the right ear was exposed using a trans-canal approach. Access to the canal was achieved through preauricular incision. The skin of the canal and the eardrum were uplifted.
- a canaloplasty was performed by drilling the posterior and inferior part of the external ear canal to access to the middle ear and expose the RW niche and the stapes.
- the niche of the round window was drilled to expose its membrane without opening it, than a platinotomy was performed using a diode laser and a 300 micrometer external diameter fiber.
- the opening of the platinum was checked with a trephine, with visualization of a perilymph leak from the oval window.
- an adapted enrichment program was in place to limit stress and group monitoring is carried out to identify and manage conflicts that may arise in a social group.
- the animals were anesthetized by injection of Ketamine (10 mg/kg; IM) then put in deep anesthesia maintained with Propofol following the placement of a venous catheter (lml/kg h, IV). Under deep anesthesia (without awakening), chest cage was open then animals received intracardiac perfusion first with PBS (200 mL) followed by 4% paraformaldehyde (pH 7.4) (500 mL) while deeply anesthetized.
- PBS 200 mL
- paraformaldehyde pH 7.4
- the dissected cochleae were perfused with the same fixative and then transferred to an EDTA solution for decalcification for 10 days (Kos micro-wave). EDTA was refreshed two times and decalcified bone was trimmed at each change.
- the cochlear sensory epithelium organ of Corti was micro dissected and then processed for GFP immunodetection.
- the organ of Corti was preincubated in PBS with 20% horse serum, 0.3% Triton X-100, and 0.3% Saponin in PBS (blocking buffer) at RT for one hour, then incubated with the primary antibody (chicken anti-GFP, Invitrogen) in diluted blocking buffer (dilution 1:20) at RT overnight. The samples were rinsed three times with PBS, and incubated with the appropriate secondary antibody (Alexa Fluor 488 Goat anti-chicken IgG, Invitrogen) in PBS at room temperature for one hour.
- phalloidin-Atto 565 Sigma
- DAPI 4',6-diamidino-2-phenylindole
- Auditory testing was carried out in anesthetized Otof +/+ , Otof and rescued Otof /_ mice at different time points, in a sound-proof chamber as previously described (Akil O. et al., 2019). Pure-tone stimuli were used at frequencies of 5, 10, 15, 20, 32, and 40 kHz. The hearing threshold was defined as the lowest stimulus level at which ABR peaks for waves l-V were clearly defined and repeatedly present upon visual inspection. ABRs were analyzed with Matlab software.
- Transfected cells grown on polylysine-coated coverslips were fixed using 4% paraformaldehyde in phosphate buffered saline (PBS), pH 7.4, at room temperature (RT) for 20 min, rinsed three times with PBS, and incubated with 0.25% Triton X-100 at RT for 15 minutes. Cells were rinsed two times with PBS and blocked with horse serum (20%) in PBS at RT for one hour.
- PBS phosphate buffered saline
- RT room temperature
- the cells were then incubated with a mixture of the rabbit polyclonal antibody FP2 (Institut Pasteur, dilution 1:200) directed against the C- terminal part of otoferlin and of the mouse monoclonal antibody (Institut Pasteur, dilution 1:100), directed against the N-terminal part of otoferlin at RT for 1 hour.
- the samples were washed twice with PBS, and incubated with secondary antibodies (AlexaFluor goat anti-rabbit 488, goat anti-mouse 555, Life Technologies, dilution 1:500) in PBS at room temperature for one hour.
- Mouse cochleas were perfused with 4% paraformaldehyde in 0.1 M PBS (pH 7.4) and incubated in the same fixative at 4 °C for 45 minutes at RT.
- the cochleas were rinsed three times with PBS and decalcified by incubation with ethylenediamine tetraacetic acid (EDTA) 0.5 M at 4 °C overnight.
- EDTA ethylenediamine tetraacetic acid
- the cochlear sensory epithelium organ of Corti was microdissected into a surface preparation, preincubated in 0.03% Triton X100 and 20% horse serum in PBS (blocking buffer) at room temperature for 1 h, and incubated with the primary antibody at 4 °C overnight.
- Chicken-polyclonal GFP (1:400 dilution, Abeam)
- rabbit anti- otoferlin (1:100 dilution, Institut Pasteur
- mouse (IgGl) anti-CtBP2 (1:200 dilution, Millipore)
- antiglutamate receptor subunit A2 (1:2000 dilution; Millipore).
- the samples were rinsed three times in PBS and incubated with the appropriate secondary antibody: The samples were washed three times in PBS, and mounted on a glass slide in one drop of Fluorsave, with DAPI (1:7500 dilution) to stain cell nuclei.
- Fluorescence confocal z stacks of the organ of Corti were obtained with an LSM 700 confocal microscope (Zeiss) equipped with a high- resolution objective (63x oil-immersion objective). The images were then analyzed using the FIJI software.
- the proportion of cells expressing the otoferlin protein was calculated as follows: Number of cells with detectable green fluorescent signal/Total number of cells (DAPI-stained cell nuclei). This count was carried out on the whole coverslip or slide by using the NIS Elements 3.1 Imaging software (Nikon). 2. Results
- AAV adeno-associated virus
- the AAV recombinant vectors were injected (2 microliters) through the RWM in C57BL/6 wild-type mice at a mature stage (P20). More precisely, the left ear was approached via a dorsal incision and the virus was delivered to the cochlea as previously described Akil et al. (2019).
- mice received an injection of 2 microliters of a viral solution containing either the AAV8- CMV-GFP containing SEQ ID NO:77 (5.6xl0 13 vg/ml), the Anc80L65-CMV-GFP containing SEQ ID NO:77 (5.5xl0 12 vg/ml), or the AAV2-CMV-GFP containing SEQ. ID NO:77 (1.2xl0 13 vg/ml) through the round window membrane of the cochlea.
- GFP expression in cochlea was assessed by immunofluorescence (figure IB).
- AAV8-CMV-GFP largely targeted IHCs (IHC transduction 94%) throughout the entire cochlear spiral, and not the outer hair cells (OHCs) ( ⁇ 1%).
- Anc80L65 mainly transduced IHCs (97%) and in a lesser extent OHCs (13%) throughout the cochlear spiral.
- AAV2 transduced not only IHCs (95%) but also OHCs (60-80%) (see exemplary images on figure IB).
- AAV8 combined with the ubiquitous CMV promoter is thus a highly efficient recombinant vector to target mature IHCs in vivo.
- the tropism of several AAVs tested in mice were further investigated in non-human primates.
- the viral preparations were injected (injection volume: 30 microliters) into the cochlea of non-human primates through the round window (trans-canalar hypotympanotomy approach) combined with a tiny fenestration in the oval window. All the injected cochleae were fixed 3 weeks after the transgene delivery and processed for immunolabelling for the GFP reporter gene.
- the results show that the transduction rate and pattern profile of the AAV8-CMV-GFP was similar to those obtained in mice: the AAV8 vector transduced efficiently and specifically IHCs (up to 95%) and to a lesser extent supporting cells of the injected cochlea. None of the OHCs were transduced by the AAV8 vector. On the contrary, AAV2 was able to transduce OHCs (40%), as well as IHCs (79%) as it was observed in mice (cf. 2.1.1.). This nonspecific infectivity could increase the risk of non-specific expression of the therapeutic gene by targeting OHCs as well, although these cells are not defective in the case of DFNB9 deafness.
- the full-length coding sequence of the cochlear isoforms of the human otoferlin cDNA was divided into different 5' fragments (nt 1-2214, nt 1-2406, nt 1-2523, nt 1-2676, nt 1-2991, and nt 1-3126) and 3' fragments (nt 2215-5991, nt 2407-5991, nt 2524-5991, nt 2677-5991, nt 2992-5991, and nt 3127- 5991).
- the 5' constructs contained the 5' fragment of the hOTOF cDNA (encoding the amino-acids (aa) 1-738, aa 1-802, aa 1-841, aa 1-892, aa 1-997 and aa 1-1042) under the control of the CMV promoter, optionally followed by the intronic sequence, and/or by a kozak sequence, then followed by a splice donor site (SD), and the 3' constructs contained the 3' part of the hOTOF cDNA (encoding the aa 739- 1997, aa 803-1997, aa-842-1997, aa 893-1997, aa 998-1997, and aa 1043-1997), and a splice acceptor (SA) site ( Figure 3).
- SA splice acceptor
- pOlOl-CMV-Nter huOTOF 738, 802, 841, 892, 997 and 1042
- pOlOl-hOTOF Cter huOTOF 739, 803, 842, 893, 998 and 1043 constructs.
- sequences of these constructs are given in the enclosed listing, in SEQ ID NO:47-64 and in SEQ ID NO:70-75, encoding N-terminal or C-terminal part of the isoform 5 of human OTOF.
- HEK293 cells were transfected using lipofectamine with either pOlOl CMV-NTerhuOTOF alone (738, 802, 841, 892, 997 and 1042, Left panel), pOlOl CTerhuOTOF alone (739, 803, 842, 893, 998 and 1043, Right panel), or both pOlOl CMV-NTerhuOTOF and pOlOl CTerhuOTOF (738-739, 802-803, 892-893, 997-998 and 1042-1043) (figure 5A).
- transfected cells were harvested, and RNA transcript expression was evaluated by RT-PCR with specific primers encompassing the splicing junction.
- RNA extracts were reverse-transcribed, and subjected to PCR amplification with primers designed to amplify a 898 or 946 bp fragment of the otoferlin cDNA encompassing the junction between the Otof Nter and Otof Cter cDNA.
- a negative (non-transfected HEK293 cells) and positive (pcDNA3 containing the HuOTOFcDNA under the control of the CMV promoter) control are shown.
- M DNA molecular weight marker. The position of the 0.5, and 1.5 kb molecular mass markers of the DNA ladder is indicated on the left side of the electrophoresis gel (figure 7A).
- plasmids were transfected into HEK293 cells.
- Cells were collected 48 hours and subjected to efficient protein extraction and lysis followed by Western immunoblotting using anti- otoferlin antibodies (figure 7B).
- anti- otoferlin antibodies For each of the dual plasmids, the corresponding Nter and Cter or only Nter or Cter parts were used for transfection.
- Otoferlin specific antibodies were used to identify the full-length otoferlin protein.
- HEK293 cells transfected with the HuOTOF (Hu cDNA) plasmid were used as positive control.
- the next step aimed to investigate the efficacy of gene therapy using a dual AAV8 vector with the CMV promoter driving the expression of either human or murine otoferlin protein to rescue hearing when administered before hearing onset (at P10), and reverse deafness phenotype when administered at mature stage (i.e., well after hearing onset, between P18-P25) into cochleae of DFNB9 mice.
- a single unilateral injection of the AAV8 dual murine CMV vector (AAV8-CMV-NterOTOFmu816_AP of SEQ. ID NO:79 (1.3xl0 13 vg/ml) and AAV8-CterOTOFmu817_AP of SEQ ID NO:80 (1.5xl0 13 vg/ml) was administered to Otof /_ mice at P10.
- the sensory epithelium of the treated cochleas was microdissected and immunolabeled for otoferlin to estimate the transduction rate of IHC.
- the murine protein was detected in almost all of the IHCs ( Figure 2A).
- ABR recordings 52 days after PIO injection demonstrated a substantial restoration of hearing thresholds (up to 40dB) in response to tone-burst stimuli (5, 10, 15, and 20 kHz) in the treated mice (n 6), but no restoration in the uninjected Otof /_ mice (Figure 2B).
- the long-term efficacy of gene therapy in the treated mice was also evaluated using ABR recordings in response to tone-burst stimuli at other frequencies (5, 10, 15, 20, 32 and 40 kHz) at different time points between 4 weeks and 47 weeks post-injection (figure 2D).
- ABR analysis showed that the rescued hearing thresholds were maintained overtime in all responding mice (6 out of 8) and were near wild-type level except for high frequencies (32 and 40 kHz).
- the longevity of hearing restoration was also tested at the sound frequency of 15 kHz after intracochlear injection of the dual AAV8-CMV-muOTOF versus AAV8-smCBA-muOTOF vector in Otof /_ mice at P10.
- AAV8-smCBA- muOTOF SEQ ID NO:95 and SEQ ID NO:80
- AAV8-CMV-muOTOF SEQ ID NO:79 and SEQ ID NO:80
- ABR Auditory Brainstem Response
- ABR thresholds are higher at the 15 kHz frequency in mice treated with the dual AAV8-smCBA-rnuOTOF vector compared to those injected with the dual AAV8-CMV-muOTOF vector (figure 2G).
- the vector pair consisting of the AAV8-CMV-NterOTOFmu816_AP of SEQ ID NO:79 (1.3xl0 13 vg/ml) and AAV8-CterOTOFmu817_AP of SEQ. ID NO:80 (1.5xl0 13 vg/ml), encoding the murine Otoferlin protein, was also used to treat twenty Otof /_ mice after hearing onset (between p21-p22). More precisely, these dual vectors were delivered to the cochlea of DFNB9 mice after hearing onset in P21- to 22-day-old Otof _/ “ mice (n 20), as described in the section "Material and Methods".
- mice injected treated with the dual AAV8-CMV-muOTOF vector at a mature stage were euthanized and their cochleae microdissected and immunolabeled for otoferlin and ribeye, a synaptic marker that also stains the IHC nuclei.
- the injected cochlea of all the responder mice displayed a variable IHC transduction rate.
- ABR threshold 40 dB on average, 15 kHz frequency between 60 to 81% of IHCs were transduced throughout the cochlear spiral (apex to base, figure 2H). None of the OHCs of the responder mice expressed otoferlin confirming the specificity of our therapeutic vector.
- mice The IHC transduction rate and otoferlin expression were studied in mice treated with the dual AAV8- CMV-huOTOF vector at a mature stage.
- the mice were euthanized and their cochleae microdissected and immunolabeled for otoferlin and ribeye, a synaptic marker that also stains the IHC nuclei.
- the injected cochlea of all the responder mice displayed transduced IHCs with a variable transduction rate. In the cochlea of the best responder mouse (#3, 60 dB on average, 15 kHz frequency), between 60 to 80% of IHCs were transduced throughout the cochlear spiral (apex to base, figure 21).
- the murine transcript for which a hearing recovery has been demonstrated in the PNAS publication (Akil et al., PNAS 2019), is different from the human isoform 5 transcript on 2 points:
- the murine transcript has an additional exon (exon 6 in the mouse sequence), and
- Exon 31 in the murine transcript is shorter than the human exon 30 which is the equivalent in the human isoform 5 transcript (numbering related to the absence of exon 6 reported in human).
- mouse_Otof-202_exon6_genomic_seq SEQ ID NO:65
- mouse_Otof-202_exon6_protein_seq SEQ ID NO:67
- exon 30 has been observed in other human isoforms of OTOF reported in databases (for instance, in isoform 2 and 3). It is therefore likely that the human therapeutic cDNA could also contain a short form of exon 30 (future exon 31 when taking into account a supplementary exon).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2024003052A MX2024003052A (es) | 2021-09-10 | 2022-09-09 | Sistema de vectores aav8 recombinante dual que codifica la isoforma 5 de otoferlina y sus usos. |
| CA3231374A CA3231374A1 (en) | 2021-09-10 | 2022-09-09 | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
| US18/690,424 US20250295716A1 (en) | 2021-09-10 | 2022-09-09 | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
| JP2024515645A JP2024534991A (ja) | 2021-09-10 | 2022-09-09 | オトフェリンのアイソフォーム5をコードする二重組換えaav8ベクター系およびその使用 |
| AU2022344528A AU2022344528A1 (en) | 2021-09-10 | 2022-09-09 | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
| EP22785946.9A EP4398943A1 (en) | 2021-09-10 | 2022-09-09 | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
| KR1020247011135A KR20240053630A (ko) | 2021-09-10 | 2022-09-09 | 오토페를린의 이소형 5를 인코딩하는 이중 재조합 aav8 벡터 시스템 및 이의 용도 |
| CN202280074731.3A CN118215508A (zh) | 2021-09-10 | 2022-09-09 | 编码耳畸蛋白同工型5的双重组aav8载体系统及其用途 |
| IL311345A IL311345A (en) | 2021-09-10 | 2022-09-09 | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21306245.8 | 2021-09-10 | ||
| EP21306245 | 2021-09-10 | ||
| US202263303743P | 2022-01-27 | 2022-01-27 | |
| US63/303,743 | 2022-01-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023036966A1 true WO2023036966A1 (en) | 2023-03-16 |
Family
ID=83598432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2022/075185 Ceased WO2023036966A1 (en) | 2021-09-10 | 2022-09-09 | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20250295716A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4398943A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024534991A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20240053630A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2022344528A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3231374A1 (cg-RX-API-DMAC7.html) |
| IL (1) | IL311345A (cg-RX-API-DMAC7.html) |
| MX (1) | MX2024003052A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023036966A1 (cg-RX-API-DMAC7.html) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116925239A (zh) * | 2023-07-17 | 2023-10-24 | 苏州星奥拓维生物技术有限公司 | 双载体系统表达Otof基因的组合物和方法 |
| CN117305367A (zh) * | 2023-08-21 | 2023-12-29 | 复旦大学附属眼耳鼻喉科医院 | 一种表达全长耳畸蛋白的双aav载体系统及其应用 |
| WO2025128559A1 (en) * | 2023-12-11 | 2025-06-19 | Akouos, Inc. | Compositions and methods for treating hearing loss in a human subject having a defective otoferlin gene |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6967018B2 (en) | 2002-01-11 | 2005-11-22 | Applied Genetic Technologies Corporation | Adiponectin gene therapy |
| WO2011075838A1 (en) | 2009-12-21 | 2011-06-30 | Audigen Inc. | Method of treating or preventing hearing loss |
| US8137962B2 (en) | 2004-09-03 | 2012-03-20 | University Of Florida Research Foundation | Compositions for treating cystic fibrosis |
| WO2013075008A1 (en) | 2011-11-16 | 2013-05-23 | University Of Florida Research Foundation Inc. | Aav dual vector systems for gene therapy |
| WO2016131981A1 (en) * | 2015-02-20 | 2016-08-25 | Institut Pasteur | Prevention and/or treatment of hearing loss or impairment |
| WO2019165292A1 (en) * | 2018-02-22 | 2019-08-29 | Akouos, Inc. | Compositions and methods for treating non-age-associated hearing impairment in a human subject |
| WO2020093018A1 (en) * | 2018-11-01 | 2020-05-07 | University Of Florida Research Foundation, Incorporated | A codon optimized otoferlin aav dual vector gene therapy |
| WO2020148458A1 (en) * | 2019-01-18 | 2020-07-23 | Institut Pasteur | Aav-mediated gene therapy restoring the otoferlin gene |
| WO2021087296A1 (en) * | 2019-10-30 | 2021-05-06 | Decibel Therapeutics, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| WO2022178298A1 (en) * | 2021-02-19 | 2022-08-25 | Decibel Therapeutics, Inc. | Methods for treating sensorineural hearing loss using otoferlin dual vector systems |
-
2022
- 2022-09-09 WO PCT/EP2022/075185 patent/WO2023036966A1/en not_active Ceased
- 2022-09-09 JP JP2024515645A patent/JP2024534991A/ja active Pending
- 2022-09-09 US US18/690,424 patent/US20250295716A1/en active Pending
- 2022-09-09 KR KR1020247011135A patent/KR20240053630A/ko active Pending
- 2022-09-09 EP EP22785946.9A patent/EP4398943A1/en active Pending
- 2022-09-09 AU AU2022344528A patent/AU2022344528A1/en active Pending
- 2022-09-09 CA CA3231374A patent/CA3231374A1/en active Pending
- 2022-09-09 IL IL311345A patent/IL311345A/en unknown
- 2022-09-09 MX MX2024003052A patent/MX2024003052A/es unknown
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6967018B2 (en) | 2002-01-11 | 2005-11-22 | Applied Genetic Technologies Corporation | Adiponectin gene therapy |
| US8137962B2 (en) | 2004-09-03 | 2012-03-20 | University Of Florida Research Foundation | Compositions for treating cystic fibrosis |
| WO2011075838A1 (en) | 2009-12-21 | 2011-06-30 | Audigen Inc. | Method of treating or preventing hearing loss |
| WO2013075008A1 (en) | 2011-11-16 | 2013-05-23 | University Of Florida Research Foundation Inc. | Aav dual vector systems for gene therapy |
| WO2016131981A1 (en) * | 2015-02-20 | 2016-08-25 | Institut Pasteur | Prevention and/or treatment of hearing loss or impairment |
| WO2019165292A1 (en) * | 2018-02-22 | 2019-08-29 | Akouos, Inc. | Compositions and methods for treating non-age-associated hearing impairment in a human subject |
| WO2020093018A1 (en) * | 2018-11-01 | 2020-05-07 | University Of Florida Research Foundation, Incorporated | A codon optimized otoferlin aav dual vector gene therapy |
| WO2020148458A1 (en) * | 2019-01-18 | 2020-07-23 | Institut Pasteur | Aav-mediated gene therapy restoring the otoferlin gene |
| WO2021087296A1 (en) * | 2019-10-30 | 2021-05-06 | Decibel Therapeutics, Inc. | Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems |
| WO2022178298A1 (en) * | 2021-02-19 | 2022-08-25 | Decibel Therapeutics, Inc. | Methods for treating sensorineural hearing loss using otoferlin dual vector systems |
Non-Patent Citations (33)
| Title |
|---|
| "GenBank", Database accession no. NM_194323.3 |
| "Genbank", Database accession no. NP_001274418 |
| AKIL ET AL., PROC NATL ACAD SCI USA., vol. 116, no. 10, 5 March 2019 (2019-03-05), pages 4496 - 4501 |
| AKIL, PNAS, 2019 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| DAI C. ET AL., JARO, vol. 18, 2017, pages 649 - 670 |
| DAYHOFF ET AL.: "Atlas of Protein Sequence and Structure", vol. 5, 1978, NATL. BIOMED. RES. FOUND., article "A model of evolutionary change in proteins", pages: 345 - 352 |
| DELMAGHANI ET AL., CELL, vol. 163, no. 4, 5 November 2015 (2015-11-05), pages 894 - 906 |
| DUAN D. ET AL., MOLECULAR THERAPY, vol. 4, no. 4, 2001, pages 383 - 391 |
| DULON ET AL., J CLIN INVEST., vol. 128, no. 8, 1 August 2018 (2018-08-01), pages 3382 - 3401 |
| EMPTOZ ET AL., PROC NATL ACAD SCI USA., vol. 114, no. 36, 5 September 2017 (2017-09-05), pages 9695 - 9700 |
| GHOSH ET AL., HUM GENE THER, vol. 22, 2011, pages 77 - 83 |
| GHOSH ET AL., HUM GENE THER, vol. 22, no. l, January 2011 (2011-01-01), pages 77 - 83 |
| GHOSH ET AL., HUM GENE THER., vol. 22, no. l, January 2011 (2011-01-01), pages 77 - 83 |
| HARDELIN ET AL., MEDECINE / SCIENCES, vol. 35, 2019, pages 1213 - 25 |
| HENIKOFF ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 - 10919 |
| KRAL AO'DONOGHUE GM, N ENGL J MED, vol. 363, no. 15, 2010, pages 1438 - 1450 |
| LOCK ET AL., HUMAN GENE THERAPY METHODS, vol. 25, 2014, pages 115 - 125 |
| MARLIN S. ET AL., BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 394, 2010, pages 737 - 742 |
| MICHALSKI ET AL., ELIFE, vol. 6, 7 November 2017 (2017-11-07), pages e31013 |
| PANGRSIC T. ET AL., TRENDS IN NEUROSCIENCES, vol. 17, no. 11, 2012, pages 2213 - 2236 |
| PUJOLLAVIGNE-REBILLARD, ACTA OTO-LARYNGOLOGICA, February 1991 (1991-02-01) |
| ROUX ET AL., CELL, vol. 127, no. 2, 2006, pages 277 - 89 |
| SMITHWATERMAN, J. MOL. EVOL., vol. 18, no. 1, 1981, pages 38 - 46 |
| STARR A. ET AL., BRAIN, vol. 119, June 1996 (1996-06-01), pages 741 - 753 |
| SUZUKI ET AL., SCI. REP., vol. 7, 2017, pages 45524 |
| VARGA R. ET AL., J. MED. GENET, vol. 43, 2006, pages 576 - 581 |
| YASUNAGA ET AL., J HUM GENET, 2000 |
| YASUNAGA S ET AL., J HUM GENET, vol. 67, no. 3, September 2000 (2000-09-01), pages 591 - 600 |
| YASUNAGA S ET AL., J HUM GENET., vol. 67, no. 3, September 2000 (2000-09-01), pages 591 - 600 |
| YOSHIMURA ET AL., SCI. REP., vol. 8, 2018, pages 2980 |
| ZHANG ET AL., FRONTIERS IN MOLECULAR NEUROSCIENCE, vol. 11, 2018 |
| ZHANG Q. ET AL., HEARING RESEARCH, vol. 335, May 2016 (2016-05-01), pages 53 - 63 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116925239A (zh) * | 2023-07-17 | 2023-10-24 | 苏州星奥拓维生物技术有限公司 | 双载体系统表达Otof基因的组合物和方法 |
| CN117305367A (zh) * | 2023-08-21 | 2023-12-29 | 复旦大学附属眼耳鼻喉科医院 | 一种表达全长耳畸蛋白的双aav载体系统及其应用 |
| WO2025040112A1 (zh) * | 2023-08-21 | 2025-02-27 | 复旦大学附属眼耳鼻喉科医院 | 一种表达全长耳畸蛋白的双aav载体系统及其应用 |
| WO2025128559A1 (en) * | 2023-12-11 | 2025-06-19 | Akouos, Inc. | Compositions and methods for treating hearing loss in a human subject having a defective otoferlin gene |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2022344528A1 (en) | 2024-03-28 |
| MX2024003052A (es) | 2024-05-14 |
| EP4398943A1 (en) | 2024-07-17 |
| KR20240053630A (ko) | 2024-04-24 |
| IL311345A (en) | 2024-05-01 |
| CA3231374A1 (en) | 2023-03-16 |
| US20250295716A1 (en) | 2025-09-25 |
| JP2024534991A (ja) | 2024-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3911354B1 (en) | Aav-mediated gene therapy restoring the otoferlin gene | |
| Maddalena et al. | Triple vectors expand AAV transfer capacity in the retina | |
| Ramlogan‐Steel et al. | Gene therapy and the adeno‐associated virus in the treatment of genetic and acquired ophthalmic diseases in humans: trials, future directions and safety considerations | |
| JP6453307B2 (ja) | デュアルaavベクターによる大型遺伝子の効果的送達 | |
| US20250295716A1 (en) | Dual recombinant aav8 vector system encoding isoform 5 of otoferlin and uses thereof | |
| Koilkonda et al. | LHON gene therapy vector prevents visual loss and optic neuropathy induced by G11778A mutant mitochondrial DNA: biodistribution and toxicology profile | |
| ES2826384T3 (es) | Terapia génica para trastornos oculares | |
| CN104994882A (zh) | 使用aavsflt-1治疗amd | |
| US20240218394A1 (en) | Gene therapy for ocular disorders | |
| US20240067989A1 (en) | Compositions and Methods for Treating Retinal Disorders | |
| JP2011512145A (ja) | 遺伝子治療による眼疾患の処置方法 | |
| US20200172929A1 (en) | Gene therapy for ocular disorders | |
| IL308027A (en) | Compositions and methods for enhancing visual function | |
| TW202426652A (zh) | 編碼氧化還原酶之aav載體及其用途 | |
| CN120322449A (zh) | Atp7b基因疗法 | |
| CN118215508A (zh) | 编码耳畸蛋白同工型5的双重组aav8载体系统及其用途 | |
| HK40105471A (en) | Aav-mediated gene therapy restoring the otoferlin gene | |
| WO2020180886A1 (en) | Neuroprotective gene therapy targeting the akt pathway | |
| US20240050520A1 (en) | Gene therapy for treating usher syndrome | |
| JP2021520231A (ja) | シュタルガルト病の処置のための組成物及び方法 | |
| WO2025162267A1 (zh) | 表达myo7a蛋白的双载体系统及其用途 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22785946 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 311345 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2024515645 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3231374 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022344528 Country of ref document: AU Ref document number: 809035 Country of ref document: NZ Ref document number: AU2022344528 Country of ref document: AU |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024004561 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022344528 Country of ref document: AU Date of ref document: 20220909 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202447025015 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20247011135 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022785946 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022785946 Country of ref document: EP Effective date: 20240410 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202401602U Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280074731.3 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 112024004561 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240307 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18690424 Country of ref document: US |