WO2023030180A1 - Système biologique de pores d'une taille mesurée en angstroms basé sur un canal mécanosensible de faible conductance - Google Patents

Système biologique de pores d'une taille mesurée en angstroms basé sur un canal mécanosensible de faible conductance Download PDF

Info

Publication number
WO2023030180A1
WO2023030180A1 PCT/CN2022/115022 CN2022115022W WO2023030180A1 WO 2023030180 A1 WO2023030180 A1 WO 2023030180A1 CN 2022115022 W CN2022115022 W CN 2022115022W WO 2023030180 A1 WO2023030180 A1 WO 2023030180A1
Authority
WO
WIPO (PCT)
Prior art keywords
medium
angstrom
pore
insulating film
mscs
Prior art date
Application number
PCT/CN2022/115022
Other languages
English (en)
Chinese (zh)
Inventor
耿佳
包锐
柯博文
陈路
赵长健
李开菊
Original Assignee
四川大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 四川大学 filed Critical 四川大学
Publication of WO2023030180A1 publication Critical patent/WO2023030180A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M1/00—Apparatus for enzymology or microbiology
    • C12M1/34—Measuring or testing with condition measuring or sensing means, e.g. colony counters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/483—Physical analysis of biological material
    • G01N33/487—Physical analysis of biological material of liquid biological material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/483—Physical analysis of biological material
    • G01N33/487—Physical analysis of biological material of liquid biological material
    • G01N33/48707—Physical analysis of biological material of liquid biological material by electrical means
    • G01N33/48721—Investigating individual macromolecules, e.g. by translocation through nanopores
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/205—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Campylobacter (G)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/21—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Pseudomonadaceae (F)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • G01N2333/245—Escherichia (G)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention belongs to the field of nanopore detection, and in particular relates to a biological angstrom pore system based on a small conductance mechanical force sensitive channel.
  • Nanopore single-molecule detection technology is a sensing and detection technology that has the advantages of simple operation, high sensitivity, fast detection speed, and no need for labeling. It is widely used in protein detection, gene sequencing, and marker detection. At present, the cost, sensitivity and precision of genetic testing are the main problems to be solved in the development of this testing technology, so the development of new nanoporous materials is the key means to solve these problems.
  • a biological nanopore is a naturally occurring nanoscale pore with a pore size similar to that of many important biomolecules. As molecules pass through the channels inside the nanopore, specific blockage currents and translocation events arise. According to the blocking current and translocation frequency of molecules, qualitative and quantitative analysis of target molecules can be achieved. Therefore, the channel pore size is the dominant factor affecting the detection ability and application range of nanopores.
  • Some protein nanopores with suitable channel pore sizes have been used for nanobiotechnology applications, such as ⁇ -hemolysin ( ⁇ -HL), MspA, CsgG, Aerolysin, phi29-linked device etc.
  • biological nanopores are mainly derived from bacterial porins or viral phyla, and have pore diameters (1.0 nm-3.6 nm) about the size of single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). Therefore, they are suitable for detecting nucleic acids and have been used in DNA/RNA sequencing, nucleic acid biomarker detection, and biomolecular interaction studies.
  • biological nanopores need to be locally modified according to specific application requirements, such as site-directed mutagenesis or modification of specific aptamers, etc., in order to adapt to a wider range of sequencing.
  • ⁇ -HL its limited pore size is about 1.4nm, so the scope of application is limited to the analysis of ssDNA, RNA or other molecules.
  • cyclodextrin (cyclodextrin) modification it can be used to directly detect monophosphate deoxyribose nucleus Glycoside dNMPs without fluorescent labeling.
  • changing the pore size of biological nanopores through modification requires a lot of bioengineering technology assistance.
  • protein pores are much less flexible in adjusting the size. In this sense, it is urgent to find a nanopore with a flexible structure to efficiently detect molecules of various sizes.
  • the present invention provides a novel biological angstrom pore system based on a small conductance mechanosensitive channel.
  • the angstrom pore is a pore size smaller than a nanopore Protein, this novel protein angstrompore system does not require aptamers or modifications, providing a low-cost, highly versatile new approach for real-time molecular sensing, genetic detection, and DNA computing.
  • the present invention provides an application of an angstrom hole system in detecting charged molecules, characterized in that, the angstrom hole system comprises an angstrom hole, an insulating film, a first medium, and a second medium; An angstrom hole is embedded in the insulating film, the insulating film separates the first medium from the second medium, the angstrom hole provides communication between the first medium and the second medium channel, after applying a driving force between the first medium and the second medium, the charged molecules located in the first medium interact with the angstrom pore; the angstrom pore is MscS Mipore, the Angstrom hole has a heptamer structure that is radially symmetrical and shaped like a cylinder, and the heptamer structure includes 7 side openings and 1 bottom opening.
  • the charge properties and/or pore size of the openings are adjustable.
  • the way of adjusting the opening includes subjecting the insulating film to mechanical stimulation and/or changing the physical state of the insulating film.
  • the mechanical stimulation includes one or more of changes in the osmotic pressure difference of the medium on both sides of the insulating film, direct physical stimulation of the micro-targeted insulating film, and stimulation of the insulating film by negative pressure pressure.
  • the change in the physical state of the insulating film includes a change in the thickness of the insulating film, a change in the composition of the insulating film, a change in the curvature of the surface of the insulating film, and the like.
  • the aperture of the opening can be adjusted in the following manner:
  • the emipore is derived from bacillus.
  • the pore is derived from one or more of Pseudomonas aeruginosa, Escherichia coli, Tengchong thermophilic anaerobic bacteria and Helicobacter pylori.
  • the emipore is a variant of MscS.
  • the MscS variants include side hole volume variants and/or side hole charge variants.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • the charged molecules include one or more of nucleotides, amino acids, peptides, and drug molecules.
  • the emipore is a variant of PaMscS.
  • the angstrompore includes one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P.
  • the molar mass of the drug molecule is less than 1000 g/mol.
  • the drug molecule may be pyrophosphate, gentamicin sulfate, neomycin sulfate, sisomicin, glutamic acid and the like.
  • first medium and/or the second medium include one or more of sodium chloride solution, lithium chloride solution, cesium chloride solution, potassium chloride solution and sodium bromide solution.
  • the present invention also provides a biological angstrompore system, characterized in that the biological angstrompore system includes an angstrompore, an insulating film, a first medium, and a second medium, and the In the insulating film, the insulating film separates the first medium from the second medium, and the Angstrom hole provides a channel connecting the first medium and the second medium; the Angstrom hole It is a MscS variant angstrom pore, and the angstrom hole has a heptamer structure that is radially symmetrical and shaped like a cylinder, and the heptamer structure includes 7 side openings and 1 bottom opening.
  • Angstrom pore is a side pore volume variant and/or a side pore charge variant of MscS.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • the phospholipid membrane includes DPHPC, DOPC, E.coli lipid; the polymer membrane includes a triblock copolymer polymer membrane.
  • the emipore is derived from bacillus.
  • the pore is derived from one or more of Pseudomonas aeruginosa, Escherichia coli, Tengchong thermophilic anaerobic bacteria and Helicobacter pylori.
  • the emipore is a variant of PaMscS.
  • the angstrompore includes one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P.
  • the mutation sites of the above-mentioned variants are located at the side opening of the cytoplasmic end, specifically involving changes in the volume and charge properties of amino acids.
  • the pore diameter of the mutated side hole (also can be understood as "pore size") can be changed, thereby improving the detection ability of molecules with a specific molecular volume; the local charge characteristics of the mutated side hole channel can also be changed , and then improve the detection ability of specific charged molecules; it can also enhance the stability of the protein channel current of the mutant PaMscS angstrom pore.
  • the charge properties and/or pore size of the openings are adjustable.
  • the manner of adjusting the opening includes subjecting the insulating film to mechanical force stimulation and/or changing the physical state of the insulating film.
  • the mechanical stimulation includes one or more of changes in the osmotic pressure difference of the medium on both sides of the insulating film, direct physical stimulation of the micro-targeted insulating film, and stimulation of the insulating film by negative pressure pressure. kind.
  • the aperture of the opening can be adjusted in the following manner:
  • the present invention also provides the application of the above-mentioned biological angstrompore system in the detection of charged molecules, characterized in that the charged molecules include one or more of nucleotides, amino acids, peptides, and drug molecules .
  • the invention provides an application of an angstrom hole system in detecting charged molecules, wherein the angstrom hole system comprises a MscS angstrom hole.
  • the present invention creatively forms a small conductance mechanosensitive channel (Mechanosensitive channel of small conductance, MscS) into an angstrom pore system, and uses the characteristics of the mechanosensitive channel protein to detect charged molecules, specifically embodied as follows:
  • the pore size of the MscS pore is narrow.
  • the pore size of the MscS angstrompore is estimated to be in the range of ⁇ 6-16 angstrom, much smaller than the nanopores commonly used in the prior art (for example, the ⁇ -hemolysin nanopore has a pore size of about 1.4-2.4 nm, i.e. 14–24 Amy).
  • the pore size of the MscS angstrompore is adjustable (it can also be understood as a flexible structure).
  • MscS angiopores can convert mechanical stimuli into electrical or biochemical signals within milliseconds, eliciting modulation of channel configuration.
  • the pore size of the MscS angstrompore can be adjusted by affecting the insulating film without complicated chemical modification. For example, the concentration of the first medium and the second medium (i.e.
  • 30mM NaCl/300mM NaCl, 100mM NaCl/300mM NaCl and 300mM NaCl/300mM NaCl) can be adjusted to adjust the osmotic pressure difference on both sides of the insulating membrane and then adjust the pore size to achieve optimal pairing.
  • Protein nanopores in the prior art usually have a fixed channel structure, which requires additional protein engineering modification or chemical modification to achieve channel structure adjustment.
  • the pore diameter of the MscS angstrompore provided by the present invention can be reversibly adjusted in situ only by changing the external conditions, and is suitable for direct detection of molecules of various types and sizes.
  • the angstrom pore system provided by the present invention can be applied to the sensing and detection of single molecules.
  • the angstrom pore system provided by the present invention is applicable to a variety of charged molecules (in theory, as long as the molecules with a size smaller than the pore diameter of the MscS pore can be sensed and detected), for example, nucleotides, amino acids, peptides, drug molecules etc.; while larger-sized nucleic acids (such as ssDNA) and proteins (such as proteins in whole blood samples) cannot enter the channel of the MscS angstrompore and will not interfere with the detection molecules.
  • the angstrom system provided by the present invention has wide application scenarios.
  • mutations can be introduced into the side pore of the MscS angstrompore, adjusting the volume (e.g., W to A, S, P) and charge (e.g., W to H, K to R) of the amino acids at the side pore. ), to achieve better detection of specific charged molecules and molecules of specific sizes.
  • the angstrom pore system provided by the present invention can directly detect single nucleotides, and can also be used with consumption strategies (for example, detecting the remaining nucleotides of the nucleic acid amplification system) to identify the presence or absence of the target nucleic acid in the sample, For example, in the diagnosis of SARS-CoV-2 samples, it exhibited good specificity and sensitivity.
  • the angstrom system provided by the present invention can detect the presence or absence of drug molecules in complex samples (such as whole blood), and can also directly measure the drug concentration in whole blood with molar sensitivity and the effect on blood drug concentration in living animals. Continuous, real-time monitoring exhibits robustness and sensitivity.
  • the angstrom pore system provided by the present invention can also detect amino acids and short peptides (eg, dipeptides).
  • the present invention also provides a method for detecting nucleotides in a sample, which is characterized by comprising the following steps:
  • the angstrom hole system includes: a angstrom hole, an insulating film, a first medium, and a second medium, wherein the angstrom hole is embedded in the insulating film, the The insulating film separates the first medium from the second medium, the angstrom hole provides a channel connecting the first medium and the second medium, the angstrom hole is a MscS angstrom hole,
  • the Angstrom hole has a heptamer structure that is radially symmetrical and shaped like a cylinder, and the heptamer structure includes 7 side openings and 1 bottom opening; the sample is added to the first medium;
  • S2 applies a driving force to the first medium and the second medium, and the nucleotides in the sample interact with the angstrom pores and generate electrical signals;
  • S3 analyzes the electrical signal, and then identifies nucleotides in the sample.
  • the charge properties and/or pore size of the openings are adjustable.
  • the way of adjusting the opening includes subjecting the insulating film to mechanical stimulation and/or changing the physical state of the insulating film.
  • the mechanical stimulation includes one or more of changes in the osmotic pressure difference of the medium on both sides of the insulating film, direct physical stimulation of the micro-targeted insulating film, and stimulation of the insulating film by negative pressure pressure. kind.
  • the aperture of the opening can be adjusted in the following manner:
  • the osmotic pressure difference between the first medium and the second medium is adjusted by the concentration difference between the first medium and the second medium.
  • the concentration difference between the first medium and the second medium is about 0-270 mM.
  • Amypore is a MscS variant Amypore.
  • the MscS variants include side hole volume variants and/or side hole charge variants.
  • the emipore is derived from bacillus.
  • the pore includes one or more of Pseudomonas aeruginosa, Escherichia coli, Tengchong thermophilic anaerobic bacteria and Helicobacter pylori.
  • the Amipore is a PaMscS variant Amipore.
  • the mutation site of the angmipore of the PaMscS variant is located at the side opening of the cytoplasmic region of the PaMscS.
  • the PaMscS variant angstrompore includes one or more of 130A, 130H, 180R, 271I, 130S and 130P.
  • nucleotides include one or more of dGTP, dATP, dTTP, dCTP, dUTP, GTP, ATP, TTP, CTP, UTP.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • first medium and/or the second medium include one or more of sodium chloride solution, lithium chloride solution, cesium chloride solution, potassium chloride solution and sodium bromide solution.
  • the present invention also provides a rapid detection kit for nucleotides, characterized in that the kit includes:
  • the MscS Angstrom pore includes a side pore volume variant and/or a side pore charge variant of MscS.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • the conductive solution includes one or more of sodium chloride solution, lithium chloride solution, cesium chloride solution, potassium chloride solution and sodium bromide solution.
  • the MscS pore includes a PaMscS variant pore.
  • the PaMscS variant angstrompore includes one or more of 130A, 130H, 180R, 271I, 130S and 130P.
  • the invention provides a method for detecting nucleotides in a sample by using an angstrom hole system, wherein the angstrom hole system includes a MscS angstrom hole.
  • the present invention creatively utilizes the characteristics of a small conductance mechanosensitive channel (Mechanosensitive channel of small conductance, MscS) to detect nucleotides in a sample, specifically embodied as follows:
  • the pore size of the MscS pore is narrow.
  • the pore size of the MscS angstrompore is estimated to be in the range of ⁇ 6-16 angstrom, much smaller than the nanopores commonly used in the prior art (for example, the ⁇ -hemolysin nanopore has a pore size of about 1.4-2.4 nm, i.e. 14–24 Amy).
  • the pore size of the MscS angstrompore is adjustable (it can also be understood as a flexible structure).
  • MscS angiopores can convert mechanical stimuli into electrical or biochemical signals within milliseconds, eliciting modulation of channel configuration.
  • the pore size of the MscS angstrompore can be adjusted by affecting the insulating film without complicated chemical modification. For example, the concentration of the first medium and the second medium (i.e.
  • 30mM NaCl/300mM NaCl, 100mM NaCl/300mM NaCl and 300mM NaCl/300mM NaCl) can be adjusted to adjust the osmotic pressure difference on both sides of the insulating membrane and then adjust the pore size to achieve optimal pairing.
  • Protein nanopores in the prior art usually have a fixed channel structure, and the direct detection of nucleotides (for example, dNTP and other similar molecules) usually requires the introduction of additional protein engineering modifications or chemical modifications.
  • the pore diameter of the MscS angstrom hole involved in the present invention can realize reversible in-situ adjustment only by changing the external conditions, and is suitable for direct single-molecule sensing and recognition of nucleotides (also can be understood as direct detection of nucleotides ).
  • the method provided by the present invention can directly detect and distinguish one or more nucleotides, and can also be used in conjunction with other strategies to further detect the presence of the target nucleic acid in the sample.
  • mutations can be introduced into the side pore of the MscS angstrompore, adjusting the volume (e.g., W to A, S, P) and charge (e.g., W to H, K to R) of the amino acids at the side pore. ), to achieve better detection of specific charged molecules and molecules of specific sizes.
  • the present invention also provides a method for detecting drug molecules in a sample, which is characterized in that it includes the following steps:
  • the angstrom hole system includes: a angstrom hole, an insulating film, a first medium, and a second medium, wherein the angstrom hole is embedded in the insulating film, the The insulating film separates the first medium from the second medium, the angstrom hole provides a channel connecting the first medium and the second medium, the angstrom hole is a MscS angstrom hole,
  • the Angstrom hole has a heptamer structure that is radially symmetrical and shaped like a cylinder, and the heptamer structure includes 7 side openings and 1 bottom opening; the sample is added to the first medium;
  • S3 analyzes the electrical signal, and then identifies drug molecules in the sample.
  • the charge properties and/or pore size of the openings are adjustable.
  • the manner of adjusting the opening includes subjecting the insulating film to mechanical force stimulation and/or changing the physical state of the insulating film.
  • the mechanical stimulation includes one or more of changes in the osmotic pressure difference of the medium on both sides of the insulating film, direct physical stimulation of the micro-targeted insulating film, and stimulation of the insulating film by negative pressure pressure. kind.
  • the aperture of the opening can be adjusted in the following manner:
  • Amypore is a MscS variant Amypore.
  • the MscS variants include side hole volume variants and/or side hole charge variants.
  • the emipore is derived from bacillus.
  • the pore includes one or more of Pseudomonas aeruginosa, Escherichia coli, Tengchong thermophilic anaerobic bacteria and Helicobacter pylori.
  • the Amipore is a PaMscS variant Amipore.
  • the angstrompore includes one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P.
  • the molecular weight of the drug molecule is less than 1000 g/mol.
  • the molecular weight of the drug molecule is 177.98-712.72 g/mol.
  • the concentration of the drug molecule is greater than 10 nM.
  • sample is a body fluid sample.
  • the body fluid samples include urine, blood, serum, plasma, lymph fluid, cyst fluid, pleural fluid, ascitic fluid, peritoneal fluid, amniotic fluid, epididymal fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, tear fluid, saliva , One or more of sputum.
  • sample volume of the body fluid sample is greater than 10 ⁇ L.
  • the concentration of drug molecules in the body fluid sample is greater than 10 nM.
  • the method further includes S4: connecting a dialysis device with the first medium through a catheter, so that the blood sample enters the angstrom pore system through the dialysis device, wherein S4 is prior to S1.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • the invention provides a method for detecting drug molecules in a sample by using an angstrom hole system, wherein the angstrom hole system includes a MscS angstrom hole.
  • the present invention creatively utilizes the characteristics of a small conductance mechanosensitive channel (Mechanosensitive channel of small conductance, MscS) to detect drug molecules in a sample, specifically embodied as follows:
  • the pore size of the MscS pore is narrow.
  • the pore size of the MscS angstrompore is estimated to be in the range of ⁇ 6-16 angstrom, much smaller than the nanopores commonly used in the prior art (for example, the ⁇ -hemolysin nanopore has a pore size of about 1.4-2.4 nm, i.e. 14–24 Amy).
  • the pore size of the MscS angstrompore is adjustable (it can also be understood as a flexible structure).
  • MscS angiopores can convert mechanical stimuli into electrical or biochemical signals within milliseconds, eliciting modulation of channel configuration.
  • the pore size of the MscS angstrompore can be adjusted by affecting the insulating film without complicated chemical modification. For example, the concentration of the first medium and the second medium (i.e.
  • 30mM NaCl/300mM NaCl, 100mM NaCl/300mM NaCl and 300mM NaCl/300mM NaCl) can be adjusted to adjust the osmotic pressure difference on both sides of the insulating membrane and then adjust the pore size to realize the analysis Optimize the selectivity of analytes and improve the discrimination of analytes.
  • Protein nanopores in the prior art usually have a fixed channel structure, which requires additional protein engineering modification or chemical modification to achieve channel structure adjustment.
  • the pore diameter of the MscS angstrompore involved in the present invention can be reversibly adjusted in situ only by changing the external conditions, and is suitable for the direct detection of various types and sizes of drug molecules.
  • drug molecules such as aminoglycoside antibiotics and glutamic acid can cause corresponding blocking current signals in the MscS pore, and the MscS pore can detect drug molecules at the single-molecule level.
  • the MscS pore can realize the quantitative analysis of drug molecules.
  • the gradient concentration measurement of drug molecules shows a good linear relationship between the signal frequency and drug concentration, so the MscS pore can not only detect drug molecules but also detect the concentration of drug molecules (quantitative analysis).
  • MscS pore has strong anti-interference ability.
  • the cytoplasmic end of MscS is a sieve-like structure, with one bottom opening at the bottom and seven side openings at the side, and the channels of each opening (pore) are narrow. Molecular substances, such as proteins, are blocked out of the channel, so these biomacromolecules cannot enter and block the channel. Therefore, MscS exhibits strong anti-interference ability and can be directly detected in body fluid samples (such as whole blood samples). More specifically, the method of the present invention can also be used in conjunction with devices such as dialysis devices to realize real-time and continuous monitoring of blood drug concentration.
  • the present invention also provides a method for detecting the presence of target nucleic acid in a sample, characterized in that it comprises the following steps:
  • the single-channel electrophysiological detection system includes: a transmembrane pore, an insulating membrane, a first medium, and a second medium, wherein the transmembrane pore is covered Embedded in the insulating film, the insulating film separates the first medium from the second medium, the transmembrane pores provide channels for communicating the first medium and the second medium, the The nucleic acid amplification product of the sample is added to the first medium;
  • S3 applies a driving force between the first medium and the second medium, and the remaining nucleotides in the nucleic acid amplification product of the sample interact with the transmembrane pore and generate an electrical signal;
  • S4 quantifies the electrical signal to obtain the quantity of the remaining nucleotides
  • S5 compares the quantity of the remaining nucleotides with the quantity of the substrate nucleotides to determine whether the target nucleic acid exists in the sample.
  • transmembrane pore is an MscS variant pore.
  • the MscS variants include side hole volume variants and/or side hole charge variants.
  • the charge properties and/or pore size of the opening of the angstrom pore of the MscS variant are adjustable.
  • the way of adjusting the opening includes subjecting the insulating film to mechanical stimulation and/or changing the physical state of the insulating film.
  • the mechanical stimulation includes one or more of changes in the osmotic pressure difference of the medium on both sides of the insulating film, direct physical stimulation of the micro-targeted insulating film, and stimulation of the insulating film by negative pressure pressure. kind.
  • the aperture of the opening can be adjusted in the following manner:
  • the osmotic pressure difference between the first medium and the second medium is adjusted by the concentration difference between the first medium and the second medium.
  • the concentration difference between the first medium and the second medium is about 0-270 mM.
  • first medium and/or the second medium include one or more of sodium chloride solution, lithium chloride solution, cesium chloride solution, potassium chloride solution and sodium bromide solution.
  • MscS variant emicon is derived from Bacillus.
  • the MscS variant Emipore includes one or more of Pseudomonas aeruginosa, Escherichia coli, Tengchong thermophilic anaerobic bacteria and Helicobacter pylori.
  • MscS variant emipore is a PaMscS variant emipore.
  • the PaMscS variant angstrompore includes one or more of 130A, 130H, 180R, 271I, 130S and 130P.
  • the nucleic acid amplification is performed by one or more of polymerase chain reaction, ligase chain reaction, strand displacement amplification technique, transcription-mediated amplification technique, and loop-mediated isothermal amplification technique.
  • nucleotides include ribonucleotides and/or deoxyribonucleotides.
  • nucleotides include one or more of dGTP, dATP, dTTP, dCTP, dUTP, GTP, ATP, TTP, CTP, UTP.
  • the nucleic acid amplification system further includes:
  • a probe the probe includes a complementary region and a repeating region, the complementary region includes a sequence that is complementary to the target nucleic acid, and the repeating region includes an oligonucleotide sequence that repeats the same base, so
  • the bases include A, T, C, G, U; or
  • target nucleic acid is coronavirus nucleic acid.
  • the coronavirus includes one or more of SARS-CoV-2, HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV and MERS-CoV.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • the present invention also provides a virus rapid detection kit, comprising:
  • the MscS Angstrom pore includes a side pore volume variant and/or a side pore charge variant of MscS.
  • the insulating film includes a phospholipid film and/or a polymer film.
  • the conductive solution includes one or more of sodium chloride solution, lithium chloride solution, cesium chloride solution, potassium chloride solution and sodium bromide solution.
  • the Amipore is a PaMscS variant Amipore.
  • the Angstrom hole includes one or more of 130A, 130H, 180R, 271I, 130S and 130P.
  • the present invention provides a method for detecting the presence of a target nucleic acid in a sample using a single-channel electrophysiological detection system.
  • the method provided by the present invention can rapidly detect the presence of target nucleic acid in a sample.
  • Traditional nucleic acid detection methods usually require fluorescent labeling or staining of target nucleic acids, therefore, they rely on expensive fluorescence monitoring equipment or staining systems.
  • Current nanopore-based nucleic acid detection methods often require complex systems such as auxiliary polynucleotide binding proteins (such as helicases and polymerases).
  • the method provided by the present invention utilizes transmembrane pores, and only needs to detect the consumption of substrate dNTPs in an in vitro nucleic acid amplification system (such as substrate dNTPs, polymerase, reverse transcriptase), and then judge whether there is a target nucleic acid in the nucleic acid amplification system , which has the advantages of rapidity, low cost, easy high-throughput detection, and good specificity and sensitivity.
  • the transmembrane pore involved in the present invention can detect (or distinguish) different nucleotides, and is not interfered by other substances (eg, amplified nucleic acid, enzyme) in the nucleic acid amplification system.
  • the transmembrane pore of the present invention is a MscS (small conductance mechanosensitive channel) Angstrom pore, which has a narrow pore size and an adjustable pore size (it can also be understood as a flexible structure).
  • the pore size of the MscS angstrompore is estimated to be in the range of ⁇ 6-16 angstrom, much smaller than the nanopores commonly used in the prior art (for example, the ⁇ -hemolysin nanopore has a pore size of about 1.4-2.4 nm, i.e. 14–24 Amy).
  • MscS angiopores can convert mechanical stimuli into electrical or biochemical signals within milliseconds, eliciting modulation of channel configuration.
  • the pore size of the MscS angstrompore can be adjusted by affecting the insulating film without complicated chemical modification.
  • the concentration of the first medium and the second medium i.e. 30mM NaCl/300mM NaCl, 100mM NaCl/300mM NaCl and 300mM NaCl/300mM NaCl
  • the concentration of the first medium and the second medium can be adjusted to adjust the osmotic pressure difference on both sides of the insulating membrane and then adjust the pore size to achieve optimal pairing.
  • Selectivity of dNTPs and improved discrimination of dNTPs can be adjusted to adjust the osmotic pressure difference on both sides of the insulating membrane.
  • Protein nanopores in the prior art usually have a fixed channel structure, and the direct detection of nucleotides (for example, dNTP and other similar molecules) usually requires the introduction of additional protein engineering modifications or chemical modifications.
  • the pore diameter of the MscS angstrom hole involved in the present invention can realize reversible in-situ adjustment only by changing the external conditions, and is suitable for direct single-molecule sensing and recognition of nucleotides (also can be understood as direct detection of nucleotides ).
  • the term "derived from” refers not only to proteins produced by the strain of organism in question, but also to proteins encoded by DNA sequences isolated from such strains and produced in host organisms containing such DNA sequences.
  • charged molecule refers to a substance with a net charge and a size smaller than or equal to the Angstrom pore size to which the present invention relates.
  • exemplary charged molecules include nucleotides, amino acids, peptides, drug molecules, and/or other charged small molecules (eg, short peptides).
  • Figure 1 shows the electrophysiological test and dNTP detection based on PaMscS angstrompore
  • Figure 2 shows the translocation frequency of dNTPs through PaMscS1 pores under different osmotic pressure conditions
  • Figure 3 shows the detection of SARS-CoV-2 nucleic acid based on real-time monitoring of dNTPs consumption by PaMscS2;
  • Figure 4 shows the detection of AFP aptamers and miR21 by PaMscS1 through dNTPs depletion
  • FIG. 5 shows the SDS-PAGE results of PaMscS protein (1: wild-type PaMscS; 2: W130A mutant; 3: K180R mutant; 4: marker);
  • Figure 6 shows the current signal or current distribution of wild-type or mutant PaMscS
  • Figure 7 shows the current trajectory through a single PaMscS1 angstrom hole under a ramp voltage from 0 mV to +100 mV;
  • Figure 8 shows the transport capacity of different ions through the pores of PaMscS1;
  • Figure 10 shows the current trajectory and residence time distribution of PaMscS1 detecting single nucleotides
  • Figure 11 shows that single-stranded DNA cannot translocate through the PaMscS1 pore
  • Figure 12 shows the results of the Angstrom hole detection of the SARS-CoV-2 orf1ab gene by loop-mediated isothermal amplification (LAMP);
  • Figure 13 shows the result of the non-denaturing (native) PAGE electrophoresis of the PCR reagent mixed with miR21 and AFP aptamer
  • Figure 14 shows the drug single-molecule biosensing experiment based on PaMscS3 (V271I) pore;
  • Figure 15 shows drug concentration measurements of whole blood samples
  • Figure 16 shows a proof-of-concept experiment for continuous monitoring of drug concentration in living rats via an emipore
  • Figure 17 shows the continuous current trace of the PaMscS3(V271I) angstrom pore of gentamicin sulfate
  • Figure 18 shows the continuous current trace of the PaMscS3 (V271I) angstrom pore of neomycin sulfate
  • Figure 19 shows that high concentrations of gentamicin sulfate and neomycin sulfate can block PaMscS3 (V271I) angstrom pores for a long time;
  • Figure 20 shows that the MspA-2NNN angstrom pore can be frequently blocked by whole blood samples (10 ⁇ L whole blood sample to the 1 mL end);
  • Figure 21 shows the continuous current trace of the PaMscS3(V271I) angstrom pore in a blood sample
  • Figure 22 shows the current trace of direct measurement of rat whole blood samples by PaMscS3 (V271I) angstrom hole;
  • Figure 23 shows the current signal of gentamicin sulfate from -50mV to -80mV through PaMscS3 (V271I) angstrompore;
  • Fig. 24 shows the current signal of the sisomi star through the PaMscS3 (V271I) emipore from -50mV to -80mV;
  • Figure 25 shows a single channel embedded current track of wild-type EcMscS (voltage+100mV, conductive solution 30mM:300mM NaCl);
  • Figure 26 shows the channel sweep voltage (-100mV to 100mV) of wild-type EcMscS
  • FIG. 27 shows the conductance distribution of wild-type EcMscS
  • Figure 28 shows a sequence alignment of PaMscS with MscS of other bacteria
  • Figure 29 shows dNTP detection based on wild-type PaMscS angiopores
  • Figure 30 shows the current trace of the detection of glutamate by PaMscS1
  • Figure 31 shows the PaMscS Angstrompore-based amino acid detection scheme and different amino acid blocking current distributions.
  • the term "about” typically means +/- 5% of the stated value, more typically +/- 4% of the stated value, more typically +/- 4% of the stated value /-3%, more typically +/-2% of the stated value, even more typically +/-1% of the stated value, even more typically +/-0.5% of the stated value.
  • Figure 1 A. Schematic diagram of the electrophysiological measurement chamber.
  • D. Conductance distribution of PaMscS1 and PaMscS2 angstrom pores (N 18 respectively) (buffer conditions are -cis end: 300mM NaCl, -trans end: 30mM NaCl).
  • Figure 2 The translocation frequency of dCTP (indicated in orange) and dGTP (indicated in blue) was tested under different osmotic pressure differences, symmetrical (A, 300mM NaCl: 300mM NaCl for cis end: trans end) , low osmotic pressure difference (LOD) (B, 300 mM NaCl: 100 mM NaCl for cis end: trans end), and high osmotic pressure difference (HOD) (C, 300 mM NaCl: 30 mM NaCl for cis end: trans end).
  • A 300mM NaCl: 300mM NaCl for cis end: trans end
  • LOD low osmotic pressure difference
  • HOD high osmotic pressure difference
  • dNTPs concentrations 0.5 mM, 1.0 mM, 1.5 mM and 2.0 mM, were used to test the translocation of dCTP and dGTP.
  • E The increase rate of f dCTP and f dGTP under 3 different osmotic pressure difference conditions.
  • Figure 3 A. Schematic diagram of the detection of SARS-CoV-2 by angstrom.
  • Test results of 22 clinical samples including 15 positive samples (patient numbers: 1-15) and 7 negative samples (patient numbers: 16-22), Amypore test results of 21 samples and hospital qPCR test results Consistent (Patient No.: 1-15, 17-22), 1 negative sample (Patient No.: 16) was diagnosed as positive by Amypore (buffer conditions were -cis end: 300mM NaCl, -trans end: 100mM NaCl, voltage is +50mV).
  • Monitoring dNTPs depletion via MscS angstropores can be combined with nucleic acid amplification techniques (NAAT) such as polymerase chain reaction (PCR) and strand displacement amplification (SDA).
  • NAAT nucleic acid amplification techniques
  • PCR polymerase chain reaction
  • SDA strand displacement amplification
  • Figure 4 A. Schematic of the detection strategy.
  • B. Current traces of no target control group, miR21 group, AFP aptamer group, and both miR21 and AFP aptamer groups.
  • C. Current distribution of the 4 test groups. Relative increase in dATP and dGTP signals in group D.4.
  • Figure 6 A. The background signal frequency of wild-type PaMscS and mutant PaMscS1, PaMscS2, the background noise frequency of PaMscS1 and PaMscS2 is lower than that of wild-type PaMscS (voltage +50mv, n ⁇ 3).
  • Figure 7 Current traces through a single PaMscS1 angstrom pore under a ramped voltage from 0 mV to +100 mV: Voltage gating was observed when the voltage was raised above +90 mV (buffer conditions at the -cis end: 300 mM NaCl, - Trans end: 30mM NaCl, sampling frequency: 4999hz).
  • Figure 8 The buffer conditions are: -cis side 300mM NaCl, -trans side 30mM NaCl, each data point n ⁇ 3, mean ⁇ SD.
  • Figure 10 Residence time distribution: dGTP(A), dATP(B), dTTP(C) and dCTP(D); the concentration of each nucleotide is 2mM and the buffer condition is -cis end: 300mM NaCl, -trans end : 30mM NaCl, the voltage is +50mV.
  • Figure 11 Voltage: +50mV; buffer conditions: 300mM NaCl on the cis side, 30mM NaCl on the trans side.
  • the final concentration of ssDNA was 5 ⁇ M and the sequence was 5'TAGCTTATCAGACTGATGTTGA 3' (SEQ ID NO:5).
  • Figure 12 Samples containing 10 ⁇ 3 copies/mL to 10 ⁇ 11 copies/mL of the Orf1ab gene can be detected.
  • Figure 13 1. DNA template 1 (containing poly T); 2. DNA template 2 (containing poly C); 3. PCR reagents with miR21 and AFP aptamers; 4. Control group (without miR21 and AFP aptamers ).
  • the electrolyte conditions are -cis end: 300mM NaCl, -trans end: 30mM NaCl, 10mM HEPES, pH 7.0, and the voltage for drug detection is -50mV.
  • E Comparison of detection results for 1.5 ⁇ M gentamicin sulfate between LC-MS and PaMscS3 angstrompores.
  • the electrolyte conditions are -cis end: 130mM NaCl, -trans end: 130mM NaCl, 10mM HEPES, pH 7.0, and the drug detection voltage is -50mV.
  • Figure 15 A. Direct detection of whole blood samples through the PaMscS3(V271I) angstrompore, the PaMscS3 angstrompore remained open after addition of the whole blood sample. Electrolyte conditions are -cis end: 130mM NaCl, -trans end: 130mM NaCl, 10mM HEPES, pH 7.0, voltage -50mV. B. After adding 20 ⁇ L of rat blood, the conductivity buffer at the -cis end turns red. C. Percentage of channel opening for whole blood samples. D. The quantitative standard curve of gentamicin sulfate ranges from 0 to 3 ⁇ M. E.
  • Electrolyte conditions for whole blood Amypore detection are -cis end: 130mM NaCl, -trans end: 130mM NaCl, 10mM HEPES, pH 7.0, voltage -50mV, N ⁇ 3.
  • Figure 16 A. Setup of the Rat Drug Concentration Monitoring System.
  • D. Results of continuous drug blood concentration monitoring of rats with different doses of gentamicin sulfate through the PaMscS3 angstrom pore (N 1). Gray data points indicate drug blocking signal frequencies higher than the highest signal frequency within the range of the standard curve, double-step signals occur frequently and make quantitation inaccurate.
  • Electrolyte conditions are -cis end: 130mM NaCl, -trans end: 130mM NaCl, 10mM HEPES, pH 7.0, voltage -50mV.
  • Figure 19 At high drug concentrations, the blocking signal of the drug is difficult to count and the pore of PaMscS3(V271I) can be blocked for a long time, making quantitative calculation impossible.
  • the electrolyte conditions are -cis end: 300mM NaCl, -trans end: 30mM NaCl, 10mM HEPES, pH 7.0, and the voltage for drug detection is -50mV.
  • Figure 21 Current traces in the background of the angstrom hole and traces after the addition of whole blood samples.
  • Figure 22 Adding 20 ⁇ L of rat whole blood to the -cis end (1 mL), the PaMscS3(V271I) angstrom pore can work well in the presence of whole blood samples.
  • Electrolyte conditions are -cis end: 130mM NaCl, -trans end: 130mM NaCl, 10mM HEPES, pH 7.0. Notably, two peaks appeared in the gradient voltage.
  • Electrolyte conditions are -cis end: 130mM NaCl, -trans end: 130mM NaCl, 10mM HEPES, pH 7.0.
  • the structure of sisomicin is close to the C1a component of gentamicin sulfate. Under the gradient voltage, only one blocking current peak was observed.
  • Figure 28 Sequence alignment of the MscS family. Residues highlighted in red in Figure 28D are identical across the 4 sequences; columns above the sequences designate ⁇ -helices and ⁇ -strands.
  • the angstrom pore used in the present invention is a small conductance mechanosensitive channel (Mechanosensitive channel of small conductance, MscS), preferably PaMscS (Pseudomonas aeruginosa small conductance mechanosensitive channel) or a variant thereof.
  • the variant also understood as “mutant” may be a naturally occurring variant expressed by an organism such as Pseudomonas aeruginosa. Variants also include non-naturally occurring variants produced by recombinant techniques.
  • “PaMscS variant”, “mutant PaMscS”, “mutant PaMscS”, and “PaMscS mutant” have the same meaning unless otherwise specified.
  • the angstrompore may be a MscS variant.
  • Amino acid substitutions may be made to the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4, for example single or multiple amino acid substitutions. Substitutions may be conservative or non-conservative. Preferably, non-conservative substitutions can be made to one or more positions of the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4, wherein the substituted amino acid residue is replaced by Amino acids that differ significantly in chemical properties and/or physical size are substituted.
  • the MscS variants can be divided into side hole volume variants and side hole charge variants.
  • the side pore volume variant refers to a variant in which the mutation site is located at the side opening (also known as "side pore") at the cytoplasmic end and the volume of the side pore is changed by changing the amino acid at this site.
  • the side hole charge variant refers to a variant in which the mutation site is located at the side opening of the cytoplasmic end and the side hole charge is changed by changing the amino acid at this site.
  • the side pore volume variant may be the substitution of a larger amino acid (e.g. tryptophan (W)) for a smaller amino acid (e.g.
  • Side hole charge variants can be the substitution of a certain charged amino acid for an oppositely charged or neutral amino acid, or the substitution of a neutral amino acid for a charged amino acid.
  • non-limiting examples of positively charged amino acids include histidine, arginine, and lysine; non-limiting examples of negatively charged amino acids include aspartic acid and glutamic acid; neutral, non-limiting Examples include glycine, alanine, phenylalanine, valine, leucine, isoleucine, cysteine, asparagine, glutamine, serine, threonine, tyrosine, Methionine, Proline and Tryptophan.
  • Amino acid conservative substitutions or non-conservative substitutions as well as many different types of amino acid modifications (deletion, substitution, addition) and other modifications are well known in the art, and those skilled in the art can modify MscS according to the actual situation to obtain the corresponding MscS Variants.
  • the means of modification include modifying the corresponding DNA sequence (for example, directly synthesizing the corresponding protein after modifying the DNA sequence information or using PCR to perform site-directed mutation on the DNA sequence), and then obtain the corresponding variant (and its corresponding DNA sequence).
  • said MscS variant may be a PaMscS variant.
  • the PaMscS variants include, for example, one or more of 130A, 130H, 180R, 271I, 130S and 130P.
  • the side pore volume mutants of PaMscS include, for example, 130A, 130S, and 130P, and the side pore charge variants of PaMscS, for example, include 130H, 180R, and 271I.
  • Such modification can change the pore diameter of the modified side hole (also can be understood as "pore size"), thereby improving the detection ability of the analyte with a specific molecular volume; it can also change the local charge characteristics of the modified side hole channel, Further, the detection ability of specific charged analytes is improved; the stability of the protein channel current of the PaMscS variant can also be enhanced.
  • the angstrompore may be wild-type PaMscS, which has the ability to detect analytes despite its high background noise.
  • the angstrom pore may be wild-type EcMscS (Escherichia coli small conductance mechanosensitive channel) or a variant thereof.
  • EcMscS and PaMscS are highly similar, and they can also form a stable channel current and have the ability to detect analytes.
  • the sequence similarity between PaMscS and EcMscS is 60%.
  • Conservative substitutions or non-conservative substitutions of amino acids, as well as many different types of modifications (deletion, substitution, addition) to amino acids are well known in the art, and those skilled in the art can modify EcMscS according to actual conditions to obtain Corresponding EcMscS variant.
  • the emipore in addition to Escherichia coli (Escherichia coli) and Pseudomonas aeruginosa (Pseudomonas aeruginosa), can also be derived from other bacilli, such as Tengchong thermophilic anaerobic bacteria (Thermoanaerobacter tengcongensis ) and Helicobacter pylori.
  • the structures of PaMscS and TtMscS and HpMscS are also highly similar, and the sequence similarities are 55% and 44%, respectively.
  • MscS can be used as an analyte in the angmipore.
  • Conservative substitutions or non-conservative substitutions of amino acids, as well as many different types of modifications (deletion, substitution, addition) to amino acids are well known in the art, and those skilled in the art can modify MscS according to actual conditions to obtain Corresponding MscS variant.
  • the analyte is a charged species. An analyte is charged if it has a net charge.
  • the analyte can be negatively or positively charged.
  • An analyte is negatively charged if it has a net negative charge.
  • An analyte is positively charged if it has a net positive charge.
  • Suitable analytes should be substances with a size smaller than or equal to the angstrom pore diameter, preferably nucleotides, amino acids, peptides, drug molecules.
  • the analyte may be a nucleotide.
  • Nucleotide refers to a monomeric unit consisting of a heterocyclic base, a sugar and a phosphate group. It is to be understood that heterocyclic bases include naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T) and uracil (U)) as well as non-naturally occurring bases base analogs. Sugars include naturally occurring sugars (deoxyribose and ribose) and non-naturally occurring sugar analogs.
  • the nucleotides include deoxyribonucleotides and ribonucleotides such as ATP, dATP, CTP, dCTP, GTP, dGTP, UTP, TTP, dUTP, GMP, UMP, TMP, CMP, dGMP, dAMP, dTMP, dCMP, dUMP, ADP, GDP, TDP, UDP, CDP, dADP, dGDP, dTDP, dUDP, dCDP.
  • the nucleotides include naturally occurring nucleotides and non-naturally occurring nucleotide analogs that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.
  • the nucleotides are free (or, it may be understood as “single”).
  • the nucleotides are ATP, dATP, CTP, dCTP, GTP, dGTP, UTP, TTP, dUTP.
  • the analyte may be an amino acid.
  • amino acid refers to any of the 20 naturally occurring amino acids found in proteins, the D-stereoisomers of naturally occurring amino acids (eg, D-threonine), unnatural amino acids, and chemically modified amino acids. Each of these amino acid types are not mutually exclusive.
  • alanine (Ala; A), asparagine (Asn; N), aspartic acid (Asp; D), arginine (Arg; R), cysteine amino acid (Cys; C), glutamic acid (Glu; E), glutamine (Gln; Q), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I ), Leucine (Leu; L), Lysine (Lys; K), Methionine (Met; M), Phenylalanine (Phe; F), Proline (Pro; P), Serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y) and valine (Val; V).
  • the analyte may be a short peptide, such as a dipeptide.
  • the analyte may be a drug molecule.
  • a drug molecule can be a compound. More specifically, a "drug molecule" may be a drug having a molecular weight of 1000 g/mol or lower (eg, lower than 800, 700, 600, 500, 400, 300 or 200 g/mol).
  • the drug molecule can be an aminoglycoside antibiotic.
  • the drug molecules include amino acids and their salts (including non-druggable amino acids) and peptides.
  • the "angstrom hole system” includes a hole having a size in the angstrom order (abbreviated as "angstrom hole”), an insulating film, a first medium, and a second medium.
  • the pore with a size in the Angstrom order is a small conductance mechanosensitive channel (MscS) Angstrom pore.
  • the pores with angstrom size are preferably heptamer structures with radial symmetry and cylindrical shape, and the heptamer structures include 7 side openings and 1 bottom opening.
  • the pore with Angstrom size has a typical heptamer structure with radial symmetry and cylindrical shape, and the heptamer structure contains 8 openings, 7 of which are equal The openings are distributed on the side, and the eighth opening is distributed on the bottom and formed by 7 subunits; the pore size of the above 8 openings can be adjusted.
  • the pores having Angstrom dimensions allow translocation of the analyte from one side of the insulating membrane to the other.
  • the hole with the angstrom-scale size is embedded in the insulating film, and the insulating film (also can be understood as, the hole with the angstrom-scale size and the insulating film Composite) separates the first medium from the second medium, and the channels with pores in the Angstrom order provide passages connecting the first medium and the second medium; After a driving force is applied between the first medium and the second medium, the analyte located in the first medium interacts with the MscS pore to form a current (ie, an electrical signal).
  • a current ie, an electrical signal
  • first medium refers to the medium in which the analyte is added to the angstrom pore system
  • second medium refers to the two parts of the medium separated by the insulating film. , the other side of the "first medium”.
  • the driving force refers to the force driving the interaction between the analyte and the angstrom pore by means of potential, electroosmotic flow, concentration gradient and the like.
  • the first medium and the second medium may be the same or different, and the first medium and the second medium may comprise electrically conductive fluids.
  • the conductive liquid is an aqueous alkali metal halide solution, specifically sodium chloride (NaCl), lithium chloride (LiCl), cesium chloride (CsCl), potassium chloride (KCl), and sodium bromide (NaBr).
  • the concentrations of the conductive liquid contained in the first medium and the second medium are different, in other words, the concentrations of the conductive liquid in the first medium and the second medium exist The difference, and then there is a difference in the osmotic pressure on both sides of the insulating film.
  • the first medium and/or the second medium may also comprise a buffer, such as HEPES.
  • the concentration range of the first medium and/or the second medium may be 30mM-3M.
  • An insulating film refers to a film that has the ability to host angstrompores (or nanopores) and block ionic currents passing through non-angstrompores (or nanopores).
  • the insulating film may include a phospholipid film and/or a polymer film.
  • Exemplary phospholipid membranes include DPHPC, DOPC, E.coli lipid, and exemplary polymer membranes include triblock copolymer polymer membranes.
  • the present pore system can comprise any of the small conductance mechanosensitive channels described herein, such as wild-type PaMscS (SEQ ID NO: 1), wild-type EcMscS (SEQ ID NO: 2), wild-type TtMscS (SEQ ID NO :3) and wild-type HpMscS (SEQ ID NO: 4) and its corresponding variants, the specific sequence information of the above four MscSs is shown in Table 4.
  • the small conductance mechanosensitive channel can be mutant PaMscS1 (W130A), mutant PaMscS2 (K180R), mutant PaMscS3 (V271I).
  • the Angstrom pore system includes two electrolyte chambers, which are separated by an insulating membrane to form a trans (-trans) compartment and a cis (-cis) compartment, so The holes of the above-mentioned angstrom holes are embedded in the insulating film, and there are only small conductance mechanical force-sensitive channel angmometer holes on the insulating film to communicate with the above-mentioned two electrolyte chambers.
  • electrolyte ions in solution in the electrolyte chambers move by electrophoresis and pass through the Angstrom pores.
  • the small conductance mechanosensitive channel (MscS) angstrom hole can be embedded in the insulating film, but it retains the response to the mechanical stimulation of the insulating film and the change of the physical state of the insulating film The ability to change the structure of a protein.
  • mechanical force stimulation includes osmotic pressure changes on both sides of the insulating membrane, direct physical stimulation of micro-targeting on the insulating membrane, stimulation of the insulating membrane by negative air pressure, and the like.
  • the physical change of the insulating film includes the change of the thickness of the insulating film, the change of the composition of the insulating film, and the change of the surface curvature of the insulating film.
  • Said altering the protein structure comprises altering the charge properties and/or pore size of the openings of MscS. Further, the charge properties and/or pore size of the altered opening of the MscS angstrompore can be utilized to detect different analytes.
  • the pore diameter of the angstrom hole involved in the present invention can be adjusted in the range of 5-15 angstrom.
  • the analyte may be in contact with the Angstrom pore on either side of the insulating film.
  • the analyte may be in contact with either side of the insulating film such that the analyte passes through the passage of the Angstrom pore to the other side of the insulating film.
  • the analyte interacts with the Angstrom pore as it passes through the insulating membrane via the passage of the pore.
  • the analyte may be in contact with the side of the insulating film that allows the analyte to interact with the Angstrom pore, separate it from the Angstrom pore, and reside in the Angstrom pore. on the same side as the insulating film.
  • the analyte can interact with the pore in any manner and at any site.
  • the analyte may also impinge on the Angstrompore, interact with the Angstrompore, separate it from the Angstrompore and reside on the same side of the insulating membrane.
  • the analyte affects the current flowing through the pore in a manner specific to the analyte, i.e. the current flowing through the pore
  • the current is characteristic of a particular analyte.
  • Control experiments can be performed to determine the effect of a particular analyte on the current flowing through the angstrom pore, and then to identify the particular analyte in the sample or to determine the presence or absence of the particular analyte in the sample. More specifically, the presence or absence or concentration of the analyte can be identified based on the comparison of the current pattern obtained by detecting the analyte with the known current pattern obtained using the known analyte under the same conditions.
  • the angstrompore system of the present invention may also include one or more measuring devices that measure the current flowing through the angstrompore, such as patch clamp amplifiers or data acquisition devices.
  • the analyte can be present in any suitable sample.
  • the invention is generally performed on samples known to contain or suspected to contain the analyte.
  • the invention can be performed on samples containing one or more analytes of unknown type.
  • the present invention may identify the species of said one or more analytes known to be present or predicted to be present in said sample.
  • the sample can be a biological sample.
  • the invention may be performed in vitro on a sample obtained or extracted from any organism or microorganism.
  • the invention can also be performed in vitro on samples obtained or extracted from any virus.
  • the sample is a fluid sample.
  • the sample typically includes bodily fluids.
  • the sample may be a body fluid sample, such as urine, blood, serum, plasma, lymph fluid, cyst fluid, pleural fluid, ascitic fluid, peritoneal fluid, amniotic fluid, epididymal fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, tear fluid, Saliva, sputum, or a combination thereof.
  • the sample can be derived from humans or from other mammals.
  • the sample can be a non-biological sample.
  • the non-biological samples are preferably fluid samples such as drinking water, sea water, river water and reagents for laboratory tests.
  • the sample may not be processed prior to analysis, eg, the analyte is detected directly in whole blood.
  • the sample may also be treated prior to analysis, eg, by centrifugation, filtration, dilution, sedimentation, or other physical or chemical means known in the art.
  • the sample is a whole blood sample.
  • the sample is a nucleic acid amplification product.
  • the invention also provides a method of detecting the presence of nucleic acid in a sample.
  • the method includes: S1 placing the sample in a nucleic acid amplification system and performing nucleic acid amplification, determining the number of substrate nucleotides in the nucleic acid amplification system, and obtaining a nucleic acid amplification product of the sample; S2 placing the The nucleic acid amplification product of the sample is added to the angstrom hole system, and the angstrom hole system includes: a angstrom hole, an insulating film, a first medium, and a second medium, wherein the protein angstrom hole is embedded in the insulating film, The insulating film separates the first medium from the second medium, the angstrom hole provides a channel connecting the first medium and the second medium, and the angstrom hole is MscS angstrom A hole, the Angstrom hole has a heptamer structure that is radially symmetrical and shaped like a cylinder, the hepta
  • S1 and S2 can be performed simultaneously or in the same system.
  • a threshold can also be set, for example, only when the quantity of at least one of the remaining nucleotides is lower than the threshold, it is considered that the target nucleic acid exists in the sample; or, only the quantity of all kinds of remaining nucleotides is high When this threshold is reached, it is considered that the target nucleic acid does not exist in the sample.
  • transmembrane pore is a structure that passes through a membrane to some extent. It allows the analyte to flow through or within the membrane driven by an applied driving force. Transmembrane pores typically span the entire length of the membrane, allowing analytes to flow from one side of the membrane to the other. However, the transmembrane pore does not necessarily have to pass through the membrane. It can be closed at one end.
  • a pore may be a well, gap, channel, groove or slit in a membrane along which or into which analyte may flow.
  • transmembrane pores can be biological or artificial. Suitable pores may be protein pores, polynucleotide pores and solid state pores.
  • the transmembrane pore in the present invention should at least have the ability to detect and distinguish multiple nucleotides, preferably a transmembrane protein pore.
  • the present invention relates to transmembrane protein pores that allow the flow of analytes from one side of the membrane to the other, driven by a driving force.
  • Nucleic acid refers to a polymer of deoxyribonucleotides or ribonucleotides in single- or double-stranded form.
  • Nucleic acid amplification of a target nucleic acid refers to the process of constructing a nucleic acid chain in vitro that is at least partially identical or complementary to a target nucleic acid sequence, and the nucleic acid amplification process can only occur when the target nucleic acid is present in a sample.
  • nucleic acid amplification enzymes (such as nucleic acid polymerase, transcriptase) are usually used to generate multiple copies of a target nucleic acid or a fragment thereof, or multiple copies of a sequence complementary to the target nucleic acid or a fragment thereof.
  • the substrate nucleotides of the nucleic acid amplification system will decrease correspondingly with the increase of the copy number.
  • Figure 3 and Figure 4 are examples of nucleic acid amplification.
  • the principle of the method of the present invention is based on in vitro nucleic acid amplification technology, to consume the substrate nucleotide in the nucleic acid amplification system, so common in vitro nucleic acid amplification technology, such as polymerase chain reaction (PCR), ligase chain reaction (LCR) ), Strand Displacement Amplification (SDA), Transcription-Mediated Amplification (TMA), Loop-Mediated Isothermal Amplification (LAMP) can all be used in conjunction with the method provided by the invention.
  • PCR polymerase chain reaction
  • LCR Ligase chain reaction
  • SDA Strand Displacement Amplification
  • TMA Transcription-Mediated Amplification
  • LAMP Loop-Mediated Isothermal Amplification
  • the method provided by the present invention can detect whether there is a new coronavirus nucleic acid in a sample.
  • the method provided by the present invention can detect whether there is a single-stranded nucleic acid in a sample.
  • the present invention constructs suitable primers (for example, specific primers for SARS-CoV-2 nucleic acid) and introduces the primers into the nucleic acid amplification system (including substrate dNTPs, polymerase, reverse transcriptase). If the new coronavirus nucleic acid exists in the sample, the new coronavirus nucleic acid is amplified under suitable conditions to consume substrate dNTPs and generate multiple copies of the nucleic acid.
  • suitable primers for example, specific primers for SARS-CoV-2 nucleic acid
  • the nucleic acid amplification product of the sample is added to the angstrom pore system provided by the present invention, macromolecular substances (such as enzymes, polynucleotides, etc.) in the nucleic acid amplification system cannot pass through the angstrom pore, nor That is to say, only free single nucleotides in the nucleic acid amplification system can pass through the angstrompore and generate a specific current, and then determine the number of remaining nucleotides to determine whether there is a target new coronavirus nucleic acid in the sample (That is, if there is no target new coronavirus nucleic acid in the sample, the number of remaining nucleotides is closer to the number of substrate nucleotides before nucleic acid amplification; if there is new coronavirus nucleic acid in the sample, the number of remaining nucleotides is significantly lower than The number of substrate nucleotides before nucleic acid amplification, more specifically, at least one of the substrate nucleo
  • the present invention constructs a suitable probe (for example, the probe includes a sequence complementary to the target nucleic acid sequence and a polynucleotide sequence) and introduces the probe into the nucleic acid Amplification system (including substrate dNTPs, polymerase).
  • a suitable probe for example, the probe includes a sequence complementary to the target nucleic acid sequence and a polynucleotide sequence
  • the probe introduces the probe into the nucleic acid Amplification system (including substrate dNTPs, polymerase).
  • the target nucleic acid sequence is amplified under suitable conditions, consumes substrate dNTPs and generates multiple copies of the target nucleic acid sequence; more specifically, since the probe also has multiple Polynucleotide sequence (for example, Poly T, Poly A, Poly C, Poly G), therefore, after described target nucleic acid sequence is combined with described probe, also can consume a large amount of corresponding to polynucleotide sequence Substrate nucleotides, therefore, the presence or absence of target nucleic acid sequences in samples can be judged from the specific consumption of certain substrate nucleotides.
  • Polynucleotide sequence for example, Poly T, Poly A, Poly C, Poly G
  • the nucleic acid amplification product of the sample is added to the angstrom pore system provided by the present invention, macromolecular substances (such as enzymes, polynucleotides, etc.) in the nucleic acid amplification system cannot pass through the angstrom pore, that is, Said, in the nucleic acid amplification system, only free single nucleotides can pass through the angstrom hole and generate a specific current, and then determine the number of remaining nucleotides to judge whether there is a target nucleic acid sequence in the sample (i.e.
  • the number of remaining nucleotides is closer to the number of substrate nucleotides before nucleic acid amplification; if there is a target nucleic acid sequence in the sample, the number of remaining nucleotides is significantly lower than that of nucleic acid amplification
  • the number of substrate nucleotides in the front and the corresponding polynucleotides in the probe are consumed in large quantities. Based on this, different probes can be designed to simultaneously detect different target nucleic acid sequences in the same nucleic acid amplification system.
  • the present invention also provides a method for detecting drug molecules in a sample, the method comprising: S1 adding the sample to an angstrom hole system, the angstrom hole system comprising: an angstrom hole, an insulating film, a first medium, a second medium, wherein the Angstrom hole is embedded in the insulating film separating the first medium from the second medium, the Angstrom hole providing communication with the first medium With the channel of the second medium, the angstrom hole is a MscS angstrom hole, the angstrom hole has a heptamer structure that is radially symmetrical and shaped like a cylinder, and the heptamer structure includes 7 sides Opening and 1 bottom opening; the sample is added to the first medium; S2 applies a driving force to the first medium and the second medium, and the drug molecule in the sample interacts with the angstrom hole function and generate an electrical signal; S3 analyzes the electrical signal, and then identifies the drug molecule in the sample.
  • S1 adding the sample to an ang
  • the sample is a body fluid sample.
  • the body fluid sample can be urine, blood, serum, plasma, lymph fluid, cystic fluid, pleural fluid, ascitic fluid, peritoneal fluid, amniotic fluid, epididymal fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, tear fluid, saliva, sputum or a combination thereof.
  • the sample may not be processed prior to analysis, eg, the analyte is detected directly in whole blood.
  • the sample can also be processed before analysis, such as by centrifugation, filtration, dilution, precipitation or other physical or chemical means known in the art.
  • the samples referred to in the present invention include untreated samples and processed samples.
  • the detectable range of the drug molecule may be greater than 10 nM (it can also be understood that the detection limit is 10 nM).
  • the detectable range of the drug molecule may be 10nM-1mM. If the concentration of the drug molecule is much greater than 10 nM (eg 10 mM), its concentration can be diluted to 10 nM-1 mM.
  • said drug molecule is a compound. More specifically, a "drug molecule” may be a drug having a molecular weight of 1000 g/mol or lower (eg, lower than 800, 700, 600, 500, 400, 300 or 200 g/mol).
  • the drug molecule can be an aminoglycoside antibiotic, such as gentamicin sulfate, neomycin sulfate, sisomicin and the like.
  • the drug molecules include amino acids and their salts (including non-druggable amino acids) and peptides.
  • the present invention detects drug molecules in body fluid samples, wherein the detection limit of drug molecules is 10 nM.
  • the detectable range of the drug molecule in the bodily fluid sample may be greater than 10 nM.
  • the present invention detects drug molecules in whole blood samples (also known as "blood samples").
  • whole blood samples also known as "blood samples”.
  • the cells for example, red blood cells, white blood cells, platelets
  • macromolecular substances such as proteins
  • the drug molecules present in the whole blood sample can pass through the angstrom pore and generate a specific current.
  • the angstrom hole provided by the present invention can sensitively recognize the drug molecule at a lower concentration, and then judge the whole blood The presence and concentration of the drug molecule in the sample.
  • the method provided by the present invention can be used for continuous monitoring of the blood drug concentration of the drug molecule in the subject.
  • PaMscS2 K180R
  • PaMscS3 V271I angmipores are used to detect drug molecules in whole blood samples, but other MscS and their corresponding variants are also included in the protection scope of the present invention , based on the fact that the above variants all have the ability to sense and detect drug molecules.
  • Sodium Chloride NaCl, >99.0%, CAS#7647-14-5
  • dNTP Mixture >99.0%
  • dATP >97%, CAS#1927-31-7
  • dCTP >98%, CAS# 102783-51-7
  • dGTP >98%, CAS#93919-41-6
  • dTTP >98%, CAS#18423-43-3
  • Yeast Extract (CAS#8013-01-2), Trypsin (CAS#73049-73-7), Ampicillin Sodium Salt ( ⁇ 98.5%, CAS#69-52-3), Tris ( ⁇ 99.9%, CAS #77-86-1), Imidazole ( ⁇ 99%, CAS#288-32-4), Dodecyl- ⁇ -D-maltoside (n-Dodecyl- ⁇ -D-Maltopyranoside, DDM) ( ⁇ 99%, CAS#69227-93-6), isopropyl- ⁇ -D-thiogalactoside (IPTG) ( ⁇ 99%, CAS#367-93-1 ), phenylmethylsulfonyl fluoride (PMSF) ( ⁇ 99.%, CAS#329-98-6), 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (4-(2 -Hydroxyethyl)piperazine-1-ethanesulfonic acid, HEPES) (>99.5%,
  • Phospholipids extracted from Escherichia coli were purchased from Avanti.
  • PrimeSTAR HS DNA polymerase was purchased from TaKaRa.
  • the pUC57 vector plasmid, DNA template, miRNA-21, and AFP aptamer were synthesized by Sangon Biotech, and their sequence information is listed in Table 1.
  • the gene from PaMscS in Pseudomonas aeruginosa genomic DNA was amplified by polymerase chain reaction (PCR) using gene-specific primers. Genes were inserted into plasmids using the ClonExpress II One Step Cloning Kit (Vazyme).
  • the Escherichia coli BL21 (DE3) cells containing the plasmid of the PaMscS gene were cultured at 37° C. in Luria-Bertani (LB) medium in the presence of 50 ⁇ g/mL ampicillin, and expressed and purified. Peaks were identified by SDS-PAGE analysis.
  • the expression and purification steps of the wild-type and mutant proteins in the present invention are the same, but there are differences in the plasmid synthesis stage due to sequence differences between the wild-type protein and the mutant protein.
  • the experimental team of the present invention revealed the structure of the protein angstrom pore through modeling, which is a typical heptamer that is radially symmetrical and resembles a cylinder. It contains 8 openings, 7 on the sides and 1 on the bottom. N-terminal residues 1-13 are too flexible to be resolved in the model. Topologically, PaMscS can be divided into 2 parts, the transmembrane region and the large cytoplasmic part. Each monomer generates three N-terminal transmembrane helices, including TM1 (residues 17-52), TM2 (residues 58-83) and TM3 (residues 90-122).
  • the C-terminal cytoplasmic region can be divided into an intermediate ⁇ domain and a COOH terminal domain.
  • TM1 and TM2 in each subunit are aligned together in an antiparallel orientation, with TM1 passing through the bilayer membrane on the outside of the channel and TM2 forming the central layer, thus forming a permeation pathway around the channel axis.
  • the TM3 helix can be described as two helical segments, TM3a and TM3b, separated by a distinct kink ⁇ 53° at Gly108, residues that are conserved in homology.
  • TM3a like TM1, crosses the membrane with a different deflection, while TM3b returns to the cytoplasm, where it interacts with the cytoplasmic domain.
  • 7 subunits form a radius of The central pore of , which senses tension and is involved in conformational changes.
  • the slant angles of TM1 and TM2 of the former are smaller than those of the latter, which leads to a large deflection of the TM region, especially the loop between TM1 and TM2.
  • the middle ⁇ -domain contains 5 ⁇ -strands that are tightly connected to ⁇ -strands of other different subunits.
  • the C-terminal domain (177-273 residues) is composed of 5 ⁇ -strands and 2 ⁇ -helices, which is a mixed structure. Between these two domains of adjacent monomers, there are seven equal openings on the sides, clearly visible, with a radius of approx. It has been proposed to be responsible for ion permeation in EcMscS.
  • PaMscS2 In addition to these entrances, an 8th opening exists at the bottom of the protein, which is expressed by 7 ⁇ -strands with a narrowest radius of In all sizes, extends to PaMscS2 is parallel to the heptad axis and has a vertical width of
  • the structure of PaMscS is similar to that of EcMscS in the closed state (PDB:2OAU), and the TM domain has more than 101 rmsd as C ⁇ atoms, but in the open state (PDB:2VV5), there is a large difference in the TM region, the rmsd is
  • Mutant PaMscS protein Amypore muteins may include 130A, 130H, 180R, 271I, 130S or 130P.
  • Different sets of amplification products were detected by MscS angstrompores. Different samples were added to the -cis end, recorded at +50 mV and observed for 20 min. When a stable PaMscS1 angstrom hole is formed on the planar phospholipid membrane, the single nucleotide to be detected is added to the -cis end of the sample hole, and then a voltage is applied to record the current signal.
  • the SARS-CoV-2 RNA reverse transcription amplification system of the present invention is as follows: random hexamer (60 ⁇ M) and anchor poly T (23): 1 ⁇ L, dNTP mixture (each 10 mM): 1 ⁇ L, RNA sample: 11 ⁇ L. Reactions were incubated in a thermal cycler at 65°C for 5 minutes. Immediately place samples on ice to rapidly cool >1 min. Then, in a clean pre-PCR hood, mix the following reagents with the sample: 5X SuperScript IV Buffer: 4 ⁇ L, DTT (100 mM): 1 ⁇ L, RNaseOUT RNase Inhibitor: 1 ⁇ L, Superscript IV Reverse Transcriptase: 1 ⁇ L.
  • cDNA was obtained after incubating the samples in a thermal cycler using a program of 42 °C for 50 min and 70 °C for 10 min.
  • the cDNA PCR amplification system in the experiment of the present invention is as follows: ddH2O: 26.5 ⁇ L, 5 ⁇ PrimeSTAR buffer (Mg2+Plus): 10 ⁇ L, dNTP mixture (2.5mM): 4 ⁇ L, primer 1 (forward primer ORF P1, 10 ⁇ M): 2 ⁇ L, primer 2 (reverse primer ORF P2, 10 ⁇ M): 2 ⁇ L, PrimeSTARHS DNA polymerase (2.5U/ ⁇ L): 0.5 ⁇ L, cDNA sample: 5 ⁇ L.
  • the amplification program was as follows: preheating at 95°C for 5 minutes, heat denaturation at 98°C for 10 seconds. Refractive annealing at 55°C for 15 seconds, followed by extension at 72°C for 12 seconds. The cycle was repeated for a total of 35 times.
  • the above primers were independently synthesized by our research team, and the sequences are as follows:
  • ORF P1 TTGTTTGAATAGTAGTTGTCTGA (SEQ ID NO:7)
  • ORF P2 TCAACTCAATATGAGTATGGTACTG (SEQ ID NO:8)
  • RTP-LAMP Reverse Transcriptase Loop-mediated Isothermal Amplification
  • the nucleic acid amplification system of the present invention is as follows: ddH2O: 64.6 ⁇ L, 5 ⁇ PrimeSTAR buffer (Mg2+Plus): 20 ⁇ L, dNTP mixture (each 10 mM): 6 ⁇ L, primer 1 (miRNA21, 100 ⁇ M): 0.4 ⁇ L, primer 2 ( AFP aptamer, 10 ⁇ M): 4 ⁇ L, template 1 (extracted, poly T): 2 ⁇ L, template 2 (poly C, 1 ⁇ M): 2 ⁇ L, PrimeSTAR HS DNA polymerase (2.5U/ ⁇ L): 1 ⁇ L.
  • the amplification procedure was as follows: preheating at 95°C for 5 minutes and thermal denaturation at 98°C for 10s. Refractive annealing at 60°C for 15 seconds, followed by extension at 68°C for 23 seconds. A total of 30 cycles were repeated, and the nucleic acid amplification results are shown in FIG. 13 .
  • electrobiological data were processed by Clampfit software and plotted by Origin software.
  • MscS The basic function of MscS is a rapid on/off switch in response to mechanical stimuli such as changes in membrane tension during osmolarity.
  • the cytoplasmic domain of MscS functions as a molecular sieve that balances the loss of osmolytes during osmoadaptation.
  • the seven side pores from the cytoplasmic region play a key role in the translocation of ions and solutes. Therefore, side hole mutants PaMscS1(W130A) and PaMscS2(K180R) were selected for subsequent studies due to low background noise (Fig. 5, Fig. 6A-C).
  • the purified protein was added to the -cis end of the electrophysiological device ( Figure 1A).
  • Figure 1A When the PaMscS mutant channel was embedded in a bilayer lipid membrane (BLM, a type of insulating membrane), a steady channel current jump could be observed at a voltage of +50 mV (Fig. 1B).
  • the channel conductance of PaMscS1 remained stable at voltages ranging from -50 mV to +50 mV (Fig. 1C), and the gating probability of PaMscS1 increased when the voltage was higher than +90 mV (Fig. 7).
  • the ion transport results of PaMscS1 showed that PaMscS1 had better selectivity for Br- (Fig. 8).
  • PaMscS1 and PaMscS2 angstrom Pores present a different profile for the distribution of dNTPs blocking currents. Specifically, PaMscS1 angstrompores showed three peaks for the blocking rate of the four dNTPs mixtures, while PaMscS2 angstrompores showed two peaks for the blocking rate of the four dNTPs mixtures. Because the difference between PaMscS1 and PaMscS2 mutations lies in the amino acid difference of the side hole, it is speculated that the detection signal of dNTPs is related to the side hole.
  • PaMscS1 Since PaMscS1 has a better discrimination effect on dNTP mixtures, it is more suitable for the discrimination of dNTPs mixtures. As for PaMscS2, it exhibited more stable channel conductance and relatively higher membrane fusion efficiency, so it was more suitable for subsequent rapid diagnosis (Fig. 6A-C). The blocking rate of the wild-type PaMscS pore for the four dNTPs mixtures showed two peaks (Fig. 29). The current traces and residence time distributions of PaMscS1 detecting single nucleotides are shown in Fig. 10A-D.
  • ssDNA single-stranded DNA
  • 50 ⁇ M ssDNA was detected under buffer conditions of 30 mM NaCl/300 mM NaCl and a bias voltage of +50 mV, and no translocation events were observed due to its narrow channel size ( Figure 11). Therefore, the PaMscS mutant emipore has the potential to be a useful small molecule sensor.
  • the experimenters tuned the selectivity of PaMscS1 angstrompores by applying different osmotic pressure differences.
  • the experimenters kept the conductivity buffer concentration at the -cis end at 300 mM and changed the conductivity buffer concentration at the -trans end to change the osmotic pressure difference.
  • the PaMscS1 angstrompore was tested for its ability to detect macromolecular dGTP and small molecular dCTP under three osmotic pressure differential conditions, including symmetric conditions (Fig.
  • Figure 2E summarizes the detection of dGTP and dCTP, and it concludes that low osmolality conditions showed the highest increase in dCTP translocation events, while high osmolality conditions showed the highest increase in dGTP translocation events (Figure 2E).
  • Low osmolarity differential conditions showed a balanced capture capacity for both dCTP and dGTP compared to the reduced capture efficiency of dCTP for high osmolarity conditions.
  • the channel size of the MscS family (such as EcMscS, HpMscS, AtMsL1 proteins, etc.) can vary under different pressure, osmotic pressure conditions or membrane potentials.
  • the experimenters can conclude that the difference in the selectivity of the PaMscS1 angstrompore to dNTPs is caused by the variation of the channel size under different osmotic pressure difference conditions.
  • the synthetic SARS-CoV-2 Orf1ab gene could be detected in the concentration range from 10 ⁇ 3 copies/mL to 10 ⁇ 11 copies/mL (Fig. 3B). Then, 22 clinical samples were tested, including 15 samples from confirmed patients and 7 samples from healthy controls. All 15 positive samples and 6 negative samples (patient numbers: 1-15, 17-22) tested by Amipore showed results consistent with clinical testing (Table 3), and 1 negative sample was diagnosed as a false positive Results (patient number: 16). The method had a specificity of 86% and a sensitivity of 100% (Fig. 3C).
  • the PaMscS mutant angstrom system can be combined with various NAAT (Nucleic Acid Amplification Tests, nucleic acid amplification detection) such as polymerase chain reaction and chain displacement amplification ( Figure 12),
  • NAAT Nucleic Acid Amplification Tests, nucleic acid amplification detection
  • Figure 12 polymerase chain reaction and chain displacement amplification
  • the well also has the potential to monitor the reverse transcription process, which enables rapid and amplification-free detection of the target RNA.
  • probe A includes a barcode sequence complementary to miR21 and a polyT
  • AFP aptamer probe includes a sequence complementary to the AFP aptamer and a poly C barcode sequence.
  • LC-MS and LC-MS/MS analyzes were performed on a Shimadzu ultrafast liquid chromatography system (UFLC, Shimadzu) and an AB SCIEX Qtrap 5500 mass spectrometer equipped with a Turbo Spray ion source.
  • UFLC Shimadzu ultrafast liquid chromatography system
  • AB SCIEX Qtrap 5500 mass spectrometer equipped with a Turbo Spray ion source.
  • the collection and analysis of chromatographic and mass spectrometric data were completed by Analyst 1.6.2 software (AB SCIEX, USA).
  • Chromatographic separation was achieved on a WatersACQUITYUPLC BEH C18 column (2.1mm ⁇ 100mm I.D., 1.7 ⁇ m).
  • the mobile phase consisted of water (A) and acetonitrile (B), and the gradient elution was as follows: 0-1.0 minutes, 10-90% B; 1-2.0 minutes, 90% B.
  • the flow rate was 0.5 mL/min.
  • the temperature of the column and the autosampler were maintained at 35°C and 15°C, respectively.
  • the injection volume is 1 ⁇ L.
  • MS/MS analysis the positive ionization mode was used for sample detection, and the mass spectrometry parameters were optimized as follows: ion spray voltage, 5500V; declustering voltage, 100V; temperature, 500°C. Select the MRM (Multiple Reaction Monitoring) mode to quantify gentamicin sulfate and IS (internal standard), and the ion pairs are 450.2-160.1, 464.2-160.1, 478.2-157.1 and 265.2-232.2, respectively.
  • MRM Multiple Reaction Monitoring
  • an initial 0.4 mL of heparin solution 250 U/mL was infused through the catheter, followed by 0.1 mL every 40 minute cycle to prevent clot formation during monitoring.
  • the left femoral artery was then isolated, catheterized, and immediately connected to the device through a pre-designed tubing with a dialysis membrane. After the air in the device is expelled by the blood flow, the tube is connected to an IV catheter, creating a steady cycle.
  • the baseline signal in the absence of the drug of interest was first recorded, and then a specific concentration of gentamicin sulfate was infused at a slow rate through the venous catheter.
  • a similar cycle is set up, without the device and without the dialysis membrane.
  • Blood samples at 0, 15, 30, 45, and 60 min were collected from the catheter arteriosus and drug concentrations were measured using a PaMscS3(V271I) angstrom. After each experiment, the rats were sacrificed by cervical dislocation.
  • small molecule drugs (molar mass less than 1000 g/mol) were selected for detection.
  • the detection experiments of gentamicin sulfate and neomycin sulfate were carried out under the electrolyte conditions of 300mM NaCl (-cis end) and 30mM NaCl (-trans end), 10mM HEPES, pH 7.0, and the voltage of drug detection was -50mV.
  • PaMscS emipores can also single-molecule sense other drugs, such as sisomicin (MW: 447.53), pyrophosphate (MW: 177.975).
  • LC-MS was used to measure the concentration of gentamicin sulfate.
  • concentration of gentamicin sulfate For the 1.5 ⁇ M gentamicin sulfate sample, PaMscS3(V271I) angstrompore and LC-MS showed similar detection results, indicating that the detection of PaMscS3(V271I) angstrompore had good precision ( FIG. 14E ).
  • the drug concentration trend measured by the PaMscS3(V271I) angiopore conforms to the law of pharmacokinetics, indicating that the PaMscS angiopore can accurately measure the change of the drug concentration in the living rat.
  • the blocking current profile of gentamicin sulfate showed two peaks at higher negative voltages in a buffer of 130 mM NaCl (Fig. 23), while the monocomponent sisomicin ) showed a blocking current peak under the same conditions (Fig. 24), which indicated that the two blocking current peaks of gentamicin sulfate may be related to its multi-component.
  • gentamicin sulfate In a feasibility verification experiment in live rats, based on a simple dialysis device, a clear signal of gentamicin sulfate could be continuously observed until 3 hours after injection ( FIG. 16C ). Different doses of gentamicin sulfate to rats, including 4 mg/kg and 20 mg/kg, could be differentiated by the emipore monitoring device (Fig. 16D). These results demonstrate that the system can continuously monitor drug concentrations in living animals with minimal loss.
  • Figures 28a-c show the structures of EcMscS, TtMscS and HpMscS, respectively, which are highly similar to the structure of PaMscS, that is, they are all heptamers with radial symmetry and cylindrical shape.
  • Figure 28a-c and Figure 28d further compared the sequences of PaMscS and EcMscS, TtMscS, HpMscS, and the results showed that EcMscS, TtMscS, HpMscS and PaMscS have certain homology, but this homology is not highly homologous.
  • EcMscS and PaMscS are only 60% similar, but both have the ability to detect analytes.
  • PaMscS1 is taken as an example to detect amino acids.
  • the detection experiment of glutamic acid (10mM) was carried out under the electrolyte conditions of 300mM NaCl (-cis end) and 30mM NaCl (-trans end), 10mM HEPES, pH 7.0, and the voltage of drug detection was -50mV.
  • the current trajectory of glutamate is shown in Figure 30.
  • the Angstrompores contemplated by the present invention can also detect short peptides (eg, dipeptides).
  • short peptides eg, dipeptides
  • the amino acid to be tested is dehydrated and condensed with the aspartic acid carrier to form a dipeptide, which is detected under the electrolyte conditions of 300mM NaCl (-cis end) and 30mM NaCl (-trans end), 10mM HEPES, pH 7.0
  • the dipeptide is formed, and the current signal generated by it is compared with the specific current signal of the detected amino acid to determine the type of amino acid to be tested.
  • Maksaev, G. & Haswell, E.S. MscS-Like10 is a stretch-activated ion channel from Arabidopsis thaliana with a preference for anions. Proceedings of the National Academy of Sciences 109, 19015–19020 (2012).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Sustainable Development (AREA)
  • Toxicology (AREA)
  • Nanotechnology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Système biologique de pores d'une taille mesurée en angstroms basé sur un canal mécanosensible à faible conductance (MscS), et application du système biologique de pores d'une taille mesurée en angstroms à la détection de molécules chargées, appartenant au domaine de la détection par nanopores. Le système de pores d'une taille mesurée en angstroms comprend des pores d'une taille mesurée en angstroms MscS, un film isolant, un premier milieu et un second milieu, la taille de pore du pore d'une taille mesurée en angstroms MscS pouvant être ajustée de manière réversible in situ simplement en modifiant les conditions externes, et étant applicable à la détection directe de molécules de différents types et tailles, par exemple des nucléotides, des acides aminés, des peptides et des molécules médicamenteuses.
PCT/CN2022/115022 2021-08-30 2022-08-26 Système biologique de pores d'une taille mesurée en angstroms basé sur un canal mécanosensible de faible conductance WO2023030180A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN202111006260 2021-08-30
CN202111004249.6 2021-08-30
CN202111004249 2021-08-30
CN202111006260.6 2021-08-30

Publications (1)

Publication Number Publication Date
WO2023030180A1 true WO2023030180A1 (fr) 2023-03-09

Family

ID=85292590

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/115022 WO2023030180A1 (fr) 2021-08-30 2022-08-26 Système biologique de pores d'une taille mesurée en angstroms basé sur un canal mécanosensible de faible conductance

Country Status (2)

Country Link
CN (5) CN115725686A (fr)
WO (1) WO2023030180A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112481363B (zh) * 2020-03-09 2024-05-28 南京大学 突变Aerolysin单体在检测RNA碱基序列及RNA修饰方面的应用

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101680873A (zh) * 2007-04-04 2010-03-24 加利福尼亚大学董事会 使用纳米孔的组合物、设备、系统和方法
CN104011866A (zh) * 2011-07-27 2014-08-27 伊利诺伊大学评议会 用于生物分子表征的纳米孔传感器
CN109996888A (zh) * 2016-09-23 2019-07-09 阿尔韦奥科技公司 用于检测分析物的方法和组合物
US20190383720A1 (en) * 2018-06-07 2019-12-19 Nanohmics, Inc. Sensor And Methods For Detecting and Quantifying Ions And Molecules
CN111521766A (zh) * 2020-04-10 2020-08-11 浙江大学 人工合成的大环结构分子纳米孔结构及制备方法及应用
WO2020168286A1 (fr) * 2019-02-14 2020-08-20 University Of Washington Systèmes et procédés pour analyse fondée sur des nanopores d'acides nucléiques améliorée
CN112041331A (zh) * 2018-02-28 2020-12-04 豪夫迈·罗氏有限公司 α-溶血素变体及其用途
CN112739712A (zh) * 2018-09-11 2021-04-30 格罗宁根大学 具有可调孔径的生物纳米孔及其作为分析工具的用途

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2422497A1 (fr) * 2000-09-15 2002-03-21 Incyte Genomics, Inc. Transporteurs et canaux ioniques
US20050063989A1 (en) * 2003-09-22 2005-03-24 Commissariat A L'energie Atomique Ion channel hybrid proteins as electrical sensors and use thereof
EP1722374B1 (fr) * 2005-05-13 2013-08-14 nAmbition GmbH Méthode de détérmination d'état d'activation d'une proteine
EP2578081B1 (fr) * 2006-10-11 2016-03-09 The General Hospital Corporation Compositions, procédés et dispositifs pour le traitement des maladies hépatiques
WO2011025602A1 (fr) * 2009-07-20 2011-03-03 The Board Of Regents Of The University Of Texas System Puces mésoporeuses à multidomaines combinatoires et procédé pour le fractionnement, la stabilisation et le stockage de biomolécules
WO2015160952A1 (fr) * 2014-04-15 2015-10-22 Pittenger Mark Frings Appareil ou dispositif pour thérapie cellulaire
KR102106040B1 (ko) * 2018-12-05 2020-05-04 한국과학기술원 자가혈당측정기를 활용한 표적핵산 검출방법

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101680873A (zh) * 2007-04-04 2010-03-24 加利福尼亚大学董事会 使用纳米孔的组合物、设备、系统和方法
CN104011866A (zh) * 2011-07-27 2014-08-27 伊利诺伊大学评议会 用于生物分子表征的纳米孔传感器
CN109996888A (zh) * 2016-09-23 2019-07-09 阿尔韦奥科技公司 用于检测分析物的方法和组合物
CN112041331A (zh) * 2018-02-28 2020-12-04 豪夫迈·罗氏有限公司 α-溶血素变体及其用途
US20190383720A1 (en) * 2018-06-07 2019-12-19 Nanohmics, Inc. Sensor And Methods For Detecting and Quantifying Ions And Molecules
CN112739712A (zh) * 2018-09-11 2021-04-30 格罗宁根大学 具有可调孔径的生物纳米孔及其作为分析工具的用途
WO2020168286A1 (fr) * 2019-02-14 2020-08-20 University Of Washington Systèmes et procédés pour analyse fondée sur des nanopores d'acides nucléiques améliorée
CN111521766A (zh) * 2020-04-10 2020-08-11 浙江大学 人工合成的大环结构分子纳米孔结构及制备方法及应用

Also Published As

Publication number Publication date
CN115725686A (zh) 2023-03-03
CN115725708A (zh) 2023-03-03
CN115725685B (zh) 2023-12-12
CN117568437A (zh) 2024-02-20
CN115725685A (zh) 2023-03-03
CN115927738A (zh) 2023-04-07

Similar Documents

Publication Publication Date Title
EP2350122B1 (fr) Procédés d'amélioration de la translocation d'analytes chargés à travers des pores protéiques transmembranaires
EP2917366B1 (fr) Procede quadruplex
US20230132387A9 (en) Method of characterizing a target ribonucleic acid (rna) comprising forming a complementary polynucleotide which moves through a transmembrane pore
US20230392157A1 (en) Aptamer method
US9758823B2 (en) Enzyme method
JP6169976B2 (ja) 変異体細孔
IL191319A (en) Methods using Purim
US20140001056A1 (en) Method using fluorinated amphiphiles
WO2023030180A1 (fr) Système biologique de pores d'une taille mesurée en angstroms basé sur un canal mécanosensible de faible conductance
Zihan et al. Nanopore-based biomolecular detection
CN116814816A (zh) 一种基于小电导机械力敏感性通道的新型孔膜复合体
Luo et al. Functional Nucleic Acid Based Platforms for Heavy Metal Ion Detection
EP4341427A1 (fr) Procédés multiplex de détection de molécules à l'aide de nanopores

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22863318

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE