WO2023027476A1 - Recombinant e. coli for producing nicotinamide mononucleotide, and method for producing nicotinamide mononucleotide by using same - Google Patents

Recombinant e. coli for producing nicotinamide mononucleotide, and method for producing nicotinamide mononucleotide by using same Download PDF

Info

Publication number
WO2023027476A1
WO2023027476A1 PCT/KR2022/012580 KR2022012580W WO2023027476A1 WO 2023027476 A1 WO2023027476 A1 WO 2023027476A1 KR 2022012580 W KR2022012580 W KR 2022012580W WO 2023027476 A1 WO2023027476 A1 WO 2023027476A1
Authority
WO
WIPO (PCT)
Prior art keywords
nmn
recombinant
coli
pyrophosphate synthase
prps1
Prior art date
Application number
PCT/KR2022/012580
Other languages
French (fr)
Korean (ko)
Inventor
김범수
마하르잔아노트
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Publication of WO2023027476A1 publication Critical patent/WO2023027476A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1077—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1235—Diphosphotransferases (2.7.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/02—Pentosyltransferases (2.4.2)
    • C12Y204/02012—Nicotinamide phosphoribosyltransferase (2.4.2.12), i.e. visfatin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/06—Diphosphotransferases (2.7.6)
    • C12Y207/06001—Ribose-phosphate diphosphokinase (2.7.6.1)

Definitions

  • the present invention relates to a recombinant E. coli producing nicotinamide mononucleotide (NMN) and a method for producing nicotinamide mononucleotide using the same.
  • NPN nicotinamide mononucleotide
  • Nicotinamide mononucleotide which has recently been spotlighted as an anti-aging agent, is a precursor of nicotinamide adenine dinucleotide (NAD+), a coenzyme that plays an important role in redox reactions in cells. It has been reported that as we age, our bodies produce less NAD+ and the communication between mitochondria and cell nuclei is impaired, and a decrease in NAD+ impairs the cells' ability to generate energy, which can lead to aging and disease. When NMN enters the body, it changes to NAD+ and the amount of NAD+ in the body increases, eventually minimizing aging. Therefore, it is expected that NMN will be commercialized in various fields such as treatment for each disease, nutritional food related to longevity, and anti-aging cosmetics.
  • the present invention relates to a recombinant plasmid vector containing nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2), using the same
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate synthase 2
  • the present invention relates to a method for producing NMN, and an object of the present invention is to provide a method for producing NMN that improves the yield of NMN production using the recombinant E. coli.
  • the present invention provides a nucleotide encoding nicotinamide phosphoribosyltransferase (NAMPT), a nucleotide encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1), and a phosphoribosyl pyrophosphate synthase
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate synthase
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate synthase 2
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 Phosphoribosyl pyrophosphate synthase 2
  • a recombinant E. coli transformed with the vector of the present invention is provided.
  • "recombinant E. coli” is characterized in that it produces NMN, but is not limited thereto.
  • "recombinant Escherichia coli” is the simultaneous expression of nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2). Characterized by, but not limited to, expression.
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate synthase 2
  • the second step of adding 10 g/L and NAM recombinant Escherichia coli was recombined at a high concentration by supplying a solution with a composition of 600 g/L glucose, 60 g/L yeast extract, and 60 g/L tryptone before the glucose concentration decreased to zero.
  • a nicotinamide mononucleotide (NMN) production method comprising three steps of fed-batch culture.
  • NPN nicotinamide mononucleotide
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate Characterized by, but not limited to, co-expression of synthase 2
  • the "method for producing nicotinamide mononucleotide (NMN)" is characterized in that the concentration of NAM is 3 to 10 (g / L), but is not limited thereto.
  • the present invention provides a recombinant yeast transformed by the vector.
  • the present invention provides a recombinant animal cell transformed with the vector.
  • the present invention provides a recombinant plant cell transformed with the vector.
  • the present invention provides a health functional food composition for antioxidant containing nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
  • NNN nicotinamide mononucleotide
  • the present invention provides a cosmetic composition for antioxidant comprising nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
  • NNN nicotinamide mononucleotide
  • the present invention provides nucleotides encoding nicotinamide phosphoribosyltransferase (NAMPT), nucleotides encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1) and nucleotides encoding phosphoribosyl pyrophosphate synthase 2 (PRPS2).
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate synthase 2
  • NMN neurotinamide mononucleotide
  • NAM nicotinamide
  • Figure 2 is a diagram showing the results of SDS-PAGE analysis of NAMPT-PRPS1-PRPS2 synthetase recombinant protein expressed by E. coli ( Escherichia coli BL21 (DE3)) of the present invention.
  • FIG. 3 is a diagram showing comparison results of NMN production values in the case of lactose and IPTG induction (a) when Mg 2+ and no phosphate were added (b) when Mg 2+ was added and (c) when phosphate was added.
  • FIG. 4 is a diagram showing the effect of adding Mg 2+ and phosphate to NMN production by recombinant Escherichia coli (Escherichia coli BL21(DE3)) cells.
  • FIG. 5 is a diagram showing NMN production by concentration when lactose or an IPTG inducer was used.
  • FIG. 6 is a diagram showing LC/MS spectra according to HPLC analysis of (a) NMN standard reagent, (b) reaction mixture, and (c) NMN production of reaction mixture.
  • Figure 7 shows the results of fed-batch culture of recombinant Escherichia coli ( Escherichia coli BL21(DE3)) strains by initial NAM concentration (FIG. 7a: 3 g/L, FIG. 7b: 5 g/L, FIG. 7c: 10 g/L) It is also
  • FIG. 8 is a diagram showing a comparison result of dry cell weight for each NAM concentration in fed-batch culture.
  • FIG. 9 is a diagram showing the results of comparison of maximum NMN concentrations for each NAM concentration in fed-batch culture.
  • the present invention provides a nucleotide encoding nicotinamide phosphoribosyltransferase (NAMPT), a nucleotide encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1), and a nucleotide encoding phosphoribosyl pyrophosphate synthase 2 (PRPS2). It is for a recombinant plasmid vector containing a nucleotide that
  • the present invention relates to a recombinant E. coli transformed by the vector.
  • the present invention is a first step of batch culture of recombinant E. coli in an initial medium to which NAM is added, 600 g/L of glucose, 60 g/L of yeast extract, and 60 g/L of tryptone before the glucose concentration is reduced to zero.
  • a nicotinamide mononucleotide (NMN) production method comprising a second step of supplying a solution and a third step of fed-batch culture of recombinant E. coli at a high concentration by simultaneously supplying 10 g/L of a lactose inducer.
  • NMN of the present invention is an intermediate product produced by the reaction between a nucleoside containing a phosphate group and ribose and nicotinamide (NAM) in the NAD+ biosynthesis process.
  • NMN can be produced by chemical and enzymatic synthetic methods, but enzymatic methods are preferred because chemical synthetic methods are expensive and produce unwanted by-products.
  • NMN is produced using phosphoribosyl pyrophosphate (PRPP) and nicotinamide (NAM) as substrates in the presence of the enzyme nicotinamide phosphoribosyl transferase (NAMPT).
  • PRPP phosphoribosyl pyrophosphate
  • NAM nicotinamide
  • PRPP phosphoribosyl pyrophosphate
  • PRPS phosphoribosyl pyrophosphate
  • PRPS D-ribose-5-phosphate
  • PRPS genes are classified into three groups: PRPS1, PRPS2, and PRPS3.
  • PRPS1 the diphosphoryl group is transferred to R5P only from ATP or dATP
  • PRPS2 has a fairly broad specificity for diphosphoryl donors including ATP, dATP, UTP, CTP and GTP.
  • Most PRPS1 enzymes require Mg 2+ and phosphate for enzymatic activity.
  • PRPS3 there is not much information about its role in nucleotide synthesis and NMN production.
  • NMN is produced by the conversion of NAM via the catalytic activity of NAMPT in the presence of PRPP via the salvage pathway.
  • the present invention first focused on the metabolic design of Escherichia coli, which is a biocatalyst including sugar metabolism and enzymatic reactions (FIG. 1).
  • This metabolic process consists of a fermentation process that provides PRPP through the pentose phosphate pathway and an enzymatic process that converts NAM to NMN.
  • Recently, several studies related to the intracellular biosynthesis of NMN through metabolic engineering of Escherichia coli have been reported, but the yield of NMN is very low.
  • PRPS1 and PRPS2-inserted recombinant Escherichia coli were developed to improve NMN yield, and various factors such as carbon source, magnesium, and inorganic phosphate source were used in RSM (response) to increase NMN production. surface method) approach was used for optimization.
  • the present invention provides a recombinant yeast transformed by the vector.
  • the present invention provides a recombinant animal cell transformed with the vector.
  • the present invention provides a recombinant plant cell transformed with the vector.
  • the present invention provides a health functional food composition for antioxidant containing nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
  • NNN nicotinamide mononucleotide
  • the present invention provides a cosmetic composition for antioxidant comprising nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
  • NNN nicotinamide mononucleotide
  • the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional food compositions.
  • natural carbohydrates examples include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents thaumatin
  • stevia extracts eg rebaudioside A, glycyrrhizin, etc.
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the food composition of the present invention is formulated in the same way as the following pharmaceutical composition and can be used as a functional food or added to various foods.
  • Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. there is
  • the food composition in addition to active ingredients, various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like.
  • the food composition of the present invention may contain natural fruit juice and fruit flesh for preparing fruit juice beverages and vegetable beverages.
  • the health functional food composition of the present invention may be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills, and the like.
  • 'health functional food composition' refers to a food manufactured and processed using raw materials or ingredients having useful functionalities for the human body according to the Health Functional Food Act No. 6727, and the structure and function of the human body It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological functions.
  • the health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and general test methods approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is judged according to the relevant standards and standards.
  • Examples of the items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations.
  • chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid
  • natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum
  • mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations.
  • a health functional food in the form of a tablet is obtained by granulating a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives in a conventional manner, and then adding a lubricant or the like to compression molding, or The mixture can be directly compression molded.
  • the health functional food in the form of a tablet may contain a flavoring agent or the like, if necessary.
  • hard capsules can be prepared by filling a mixture in which the active ingredient of the present invention is mixed with additives such as excipients in a normal hard capsule. It can be prepared by filling a mixture mixed with gelatin in a capsule base.
  • the soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.
  • the health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, binder, disintegrant, etc. by a conventionally known method, and can be coated with sucrose or other coating agent if necessary, Alternatively, the surface may be coated with a material such as starch or talc.
  • Health functional food in the form of granules can be prepared in granular form by a conventionally known method of mixing the excipients, binders, disintegrants, etc. of the active ingredients of the present invention, and if necessary, flavoring agents, flavoring agents, etc. can
  • the “cosmetic composition” of the present invention may be prepared by including a cosmetically effective amount of the nicotinamide mononucleotide (NMN) of the present invention described above and a cosmetically acceptable carrier.
  • NNN nicotinamide mononucleotide
  • cosmetic effective amount means an amount sufficient to achieve the antioxidant efficacy of the present invention described above.
  • the appearance of the cosmetic composition contains a cosmetic or dermatologically acceptable medium or base.
  • a cosmetic or dermatologically acceptable medium or base e.g. solutions, gels, solids, anhydrous pasty products, emulsions obtained by dispersing an oily phase in an aqueous phase, suspensions, microemulsions, microcapsules, microgranules or ionic forms (liposomes) and It may be provided in the form of a non-ionic follicular dispersant, or in the form of a cream, toner, lotion, powder, ointment, spray or conceal stick.
  • These compositions can be prepared according to conventional methods in the art.
  • the composition according to the present invention can also be used in the form of a foam or in the form of an aerosol composition further containing a compressed propellant.
  • the cosmetic composition according to an embodiment of the present invention is not particularly limited in its dosage form, for example, softening lotion, astringent lotion, nutrient lotion, nutrient cream, massage cream, essence, eye cream, eye essence, cleansing It can be formulated into cosmetics such as cream, cleansing foam, cleansing water, pack, powder, body lotion, body cream, body oil and body essence.
  • the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fibers, vegetable fibers, wax, paraffin, starch, tracanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. this can be used
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additionally chlorofluorohydro propellants such as carbon, propane/butane or dimethyl ether.
  • a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene fatty acid esters of glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan.
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.
  • the formulation of the cosmetic composition of the present invention is surfactant-containing cleansing
  • carrier components aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate , fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives or ethoxylated glycerol fatty acid esters, and the like can be used.
  • the cosmetic composition of the present invention can be applied to skin, lotion, cream, essence, pack, foundation, color cosmetics, sunscreen, two-way cake, face powder, compact, makeup base, skin cover, eye shadow, lipstick, lip gloss, lip fix, eyebrow pencil , It can be applied to cosmetics such as lotion and detergents such as shampoo and soap.
  • the cosmetic composition according to an embodiment of the present invention may further include functional additives and components included in general cosmetic compositions in addition to the above active ingredients.
  • the functional additive may include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extracts.
  • the cosmetic composition of the present invention may further contain components included in general cosmetic compositions as needed.
  • Ingredients other than those included include fats and oils, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, blood circulation accelerators, cooling agents, antiperspirants, purified water and the like.
  • E. coli DH5 ⁇ and BL21 (DE3) competent cells were purchased from Takara and used as cloning and protein expression hosts, respectively. Both strains were cultured in Luria Bertani (LB) medium (Kisan Bio). Ampicillin was used as a selection marker at a concentration of 75 ⁇ g/ml.
  • pET21b plasmid (Novagen) was used as an expression vector. Restriction enzymes were purchased from Takara. Glucose and lactose were used as substrates. NMN standard reagents were purchased from Prohealth Longevity Company.
  • NAMPT nicotinamide phosphoribosyltransferase
  • PRPS1 phosphoribosyl pyrophosphate synthase 1
  • PRPS2 phosphoribosyl pyrophosphate synthase 2
  • NAMPT Genes encoding the enzymes NAMPT (GenBank: AAI06047.1), PRPS1 (GenBank: NM_001204402.2) and PRPS2 (GenBank: AAI10876.2) were selected from Homo sapiens sources and cloned into E. coli DH5 ⁇ cells. A DNA sequence encoding a glycine-serine flexible linker (GGGGS)2 was introduced between the functional domains. The expressed NAMPT, PRPS1 and PRPS2 genes were amplified by PCR using forward primer GCGGCTAGCATGAATCCTGCGG for NAMPT and reverse primer GCGGTCGACTAAAGGGACATGGC for PRPS1 and reverse primer GCGCTCGAGTAGCGGGACATGG for PRPS2.
  • the amplified PCR product was loaded on an agarose gel to confirm the presence of the vector, and the additionally constructed plasmid was transformed into E. coli DH5 ⁇ strain.
  • the entire gene sequence of NAMPT-PRPS1-PRPS2 is shown in Table 1 below.
  • Competent E. coli BL21 was prepared for bacterial transformation. 50 ⁇ l of competent cells were mixed with 4 ⁇ l of plasmid DNA (pET21b-NAMPT-PRPS1-PRPS2). All tubes were placed on ice for 30 min, heat shocked at 42 °C for 30 sec, then cooled on ice for 2 min. Then, 900 ⁇ l of LB medium was added and the tube was incubated for 1 hour at 37° C. under 200 rpm shaking conditions. After culturing, the transformed cells were transferred to an LB agar plate containing an ampicillin antibiotic marker (75 ⁇ g/ml), and then ampicillin-resistant colonies were selected and cultured at 37° C. for 16 hours.
  • an ampicillin antibiotic marker 75 ⁇ g/ml
  • the cloned vector was confirmed using colony PCR as follows. Initial denaturation was performed at 95 °C for 5 minutes, followed by 25 cycles of final denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, extension at 72 °C for 3 minutes, and final elongation at 72 °C for 5 minutes. did. PCR products were examined on agarose (2.5%) gel electrophoresis. After confirming the presence of the desired gene in the recombinant E. coli strain, the transformed E. coli BL21(DE3) cells were used for further studies on NMN production.
  • Transformed Escherichia coli BL21 (DE3) containing the pET21b plasmid was cultured in 100 ml of LB medium supplemented with 75 ⁇ g/ml ampicillin at 37° C. until the optical density at 600 nm reached 0.6, followed by induction was added.
  • Transformed Escherichia coli Escherichia coli BL21(DE3) cells were grown in LB medium (100 ml) containing ampicillin (75 ⁇ g/ml) in a 250 mL Erlenmeyer flask and incubated at 37 °C with shaking at 200 rpm. Cell growth was monitored by measuring optical density (OD) at a wavelength of 600 nm using a spectrophotometer (UVmini-1240, Shimadzu). Cultured samples (1 ml) were collected every 2 h and centrifuged at 15,000 rpm for 5 min at 4 °C.
  • OD optical density
  • the cell pellet was separated and resuspended in 1 ml of lysis buffer (50 mM HEPES and 500 mM NaCl, pH 7.5). The cell suspension was sonicated on ice for 2 minutes and the supernatant was recovered after centrifugation. The supernatant was filtered through a 0.25 ⁇ m syringe filter to quantify NMN using high-performance liquid chromatography (HPLC) analysis.
  • HPLC high-performance liquid chromatography
  • a recombinant E. coli strain containing both the PRPS1 and PRPS2 genes together with the NAMPT gene necessary for converting NAM to NMN was used.
  • the PRPS1 gene acts as a diphosphoryl donor in the conversion of R5P to PRPP, which ultimately uses NAMPT via the salvage pathway to produce NMN in the presence of NAM.
  • PRPS1 and PRPS2 PRPP synthase genes
  • NMN production was also significantly higher (1.57 mM) when the PRPS1 and PRPS2 genes were co-expressed than when only the PRPS1 or PRPS2 genes were expressed (Fig. 4d). Therefore, it can be concluded that the combined effect of Mg 2+ and phosphate on NMN production is significant when PRPS1 and PRPS2 genes are co-expressed.
  • NMN is an intermediate product formed during the biosynthesis of NAD+ that uses NAM as a substrate via the salvage pathway. Through this pathway, the NAMPT gene transfers a phosphoribosyl residue from PRPP to NAM for NMN biosynthesis.
  • the effect of substrate concentration and the comparative effect of IPTG and lactose in LB culture medium were studied using Escherichia coli BL21(DE3) cells transformed with a bicistronic expression plasmid.
  • protein expression in lactose-supplemented media showed an improvement in NMN production over IPTG induction for all substrate concentrations.
  • NMN yield also increased with NAM concentration (0.1-0.5%) as shown in Figure 5 for both lactose and IPTG induction.
  • NMN yields of 0.82 mM and 0.93 mM were obtained through lactose induction when 0.1% and 0.3% NAM concentrations were used, respectively.
  • Using 0.5% NAM concentration the highest yields of NMN were obtained, 1.57 mM when lactose-induced and 1.08 mM when IPTG-induced, respectively.
  • coli was grown for up to 6 hours, and then 10 g/L of lactose inducer, 10 g/L of ribose and various Concentrations of NAM (3, 5, 10 g/L) were added. Feed-batch culture of recombinant Escherichia coli was performed at high concentration by starting feeding of the feed solution (glucose 600 g/L, yeast extract 60 g/L, tryptone 60 g/L) before the glucose concentration decreased to zero.
  • the feed solution glucose concentration decreased to zero.
  • This NMN concentration corresponds to the highest concentration among those reported so far.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to recombinant E. coli for producing nicotinamide mononucleotide (NMN), and a method for producing nicotinamide mononucleotide by using same, and is technically characterized by: E. coli in which phosphoribosyl transferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2) are recombined; and a production method for increasing the production of nicotinamide mononucleotide by using a high cell density fed-batch culture of the E. coli.

Description

니코틴아미드 모노뉴클레오티드를 생산하는 재조합 대장균 및 이를 이용한 니코틴아미드 모노뉴클레오티드의 생산방법Recombinant Escherichia coli producing nicotinamide mononucleotide and production method of nicotinamide mononucleotide using the same
본 발명은 니코틴아미드 모노뉴클레오티드(nicotinamide mononucleotide, NMN)를 생산하는 재조합 대장균 및 이를 이용한 니코틴아미드 모노뉴클레오티드 생산방법에 관한 것이다.The present invention relates to a recombinant E. coli producing nicotinamide mononucleotide (NMN) and a method for producing nicotinamide mononucleotide using the same.
최근 항노화제로 각광받고 있는 니코틴아미드 모노뉴클레오티드(nicotinamide mononucleotide, 이하 NMN)는 세포 내의 산화환원 반응에 있어서 중요한 매개체 역할을 하는 조효소 니코틴아미드 아데닌 다이뉴클레오티드(nicotinamide adenin dinucleotide, 이하 NAD+)의 전구물질이다. 나이가 들어감에 따라 우리 몸은 NAD+를 적게 생성하고 미토콘드리아와 세포핵 사이의 통신이 손상되며, NAD+의 감소는 세포의 에너지 생성 능력을 손상시켜 노화와 질병으로 이어질 수 있음이 보고되었다. NMN이 체내에 들어가면 NAD+로 변화하면서 체내 NAD+의 양이 증가하여 결국 노화를 최소화 시킬 수 있다. 따라서 NMN을 활용한 질환별 치료제, 장수 관련 영양식품, 노화방지용 화장품 등 다양한 분야에서 제품화가 이루어질 것으로 기대되고 있다.Nicotinamide mononucleotide (NMN), which has recently been spotlighted as an anti-aging agent, is a precursor of nicotinamide adenine dinucleotide (NAD+), a coenzyme that plays an important role in redox reactions in cells. It has been reported that as we age, our bodies produce less NAD+ and the communication between mitochondria and cell nuclei is impaired, and a decrease in NAD+ impairs the cells' ability to generate energy, which can lead to aging and disease. When NMN enters the body, it changes to NAD+ and the amount of NAD+ in the body increases, eventually minimizing aging. Therefore, it is expected that NMN will be commercialized in various fields such as treatment for each disease, nutritional food related to longevity, and anti-aging cosmetics.
본 발명은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)를 포함하는 재조합 플라스미드 벡터에 대한 것으로, 이를 이용하여 NMN생산 수율을 향상시키는 재조합 대장균을 제공하는데 목적이 있다.The present invention relates to a recombinant plasmid vector containing nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2), using the same An object of the present invention is to provide a recombinant E. coli that improves the yield of NMN production.
또한, 본 발명은 NMN 생산 방법에 대한 것으로, 상기 재조합 대장균을 이용해 NMN 생산 수율을 향상시키는 NMN 생산 방법을 제공하는데 목적이 있다.In addition, the present invention relates to a method for producing NMN, and an object of the present invention is to provide a method for producing NMN that improves the yield of NMN production using the recombinant E. coli.
상기와 같은 목적을 달성하기 위하여, 본 발명은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT)를 코딩하는 뉴클레오티드, 포스포리보실 피로포스페이트 합성효소 1(PRPS1)을 코딩하는 뉴클레오티드 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)를 코딩하는 뉴클레오티드를 포함하는 재조합 플라스미드 벡터를 제공한다.In order to achieve the above object, the present invention provides a nucleotide encoding nicotinamide phosphoribosyltransferase (NAMPT), a nucleotide encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1), and a phosphoribosyl pyrophosphate synthase A recombinant plasmid vector containing nucleotides encoding 2 (PRPS2) is provided.
본 발명의 일 실시예에 있어서, “니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)”는 인간 유래 소스에서 선택된 것을 특징으로 하나 이에 한정되는 것은 아니다.In one embodiment of the present invention, “nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2)” are derived from human sources. Characterized by selected ones, but not limited thereto.
본 발명의 일 실시예에 있어서, “니코틴아미드 포스포리보실트랜스퍼라제(NAMPT)”는 서열번호 1로 이루어진 것이고, “포스포리보실 피로포스페이트 합성효소 1(PRPS1)”는 서열번호 2로 이루어진 것이며 “포스포리보실 피로포스페이트 합성효소 2(PRPS2)”는 서열번호 3으로 이루어진 것을 특징으로 한다.In one embodiment of the present invention, “nicotinamide phosphoribosyltransferase (NAMPT)” consists of SEQ ID NO: 1, and “phosphoribosyl pyrophosphate synthase 1 (PRPS1)” consists of SEQ ID NO: 2 and “ Phosphoribosyl pyrophosphate synthase 2 (PRPS2)” is characterized in that it consists of SEQ ID NO: 3.
본 발명의 상기 벡터에 의해 형질전환된 재조합 대장균을 제공한다.A recombinant E. coli transformed with the vector of the present invention is provided.
본 발명의 일 실시예에 있어서, “재조합 대장균”은 NMN을 생산하는 것을 특징으로 하나 이에 한정되는 것은 아니다.In one embodiment of the present invention, "recombinant E. coli" is characterized in that it produces NMN, but is not limited thereto.
본 발명의 일 실시예에 있어서, “재조합 대장균”은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)의 동시 발현을 특징으로 하나 이에 한정되는 것은 아니다.In one embodiment of the present invention, "recombinant Escherichia coli" is the simultaneous expression of nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2). Characterized by, but not limited to, expression.
본 발명은 상기 재조합 대장균을 포도당 20 g/L, 암피실린 75 μg/ml 및 표 3의 초기 배지 조성을 이용하여 회분식 배양하는 1단계, 재조합 대장균을 6시간까지 성장시킨 다음, 유당 유도제 10g/L, 리보스 10 g/L 및 NAM을 첨가하는 2단계, 포도당 농도가 0으로 감소하기 전에 포도당 600 g/L, 효모 추출물 60 g/L 및 트립톤 60 g/L 조성의 용액을 공급하여 재조합 대장균을 고농도로 유가식 배양하는 3단계를 포함하는 니코틴아미드 모노뉴클레오티드(NMN) 생산 방법을 제공한다.In the present invention, the first step of culturing the recombinant E. coli in batches using 20 g/L of glucose, 75 μg/ml of ampicillin and the initial medium composition of Table 3, growing the recombinant E. coli for up to 6 hours, and then adding 10 g/L of lactose inducer, ribose In the second step of adding 10 g/L and NAM, recombinant Escherichia coli was recombined at a high concentration by supplying a solution with a composition of 600 g/L glucose, 60 g/L yeast extract, and 60 g/L tryptone before the glucose concentration decreased to zero. Provided is a nicotinamide mononucleotide (NMN) production method comprising three steps of fed-batch culture.
본 발명의 일 실시예에 있어서, “니코틴아미드 모노뉴클레오티드(NMN) 생산 방법법”은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)의 동시 발현을 특징으로 하나 이에 한정되는 것은 아니다.In one embodiment of the present invention, "nicotinamide mononucleotide (NMN) production method" is nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate Characterized by, but not limited to, co-expression of synthase 2 (PRPS2).
본 발명의 일 실시예에 있어서, “니코틴아미드 모노뉴클레오티드(NMN) 생산 방법”은 NAM의 농도를 3 내지 10(g/L) 인 것을 특징으로 하나 이에 한정되는 것은 아니다.In one embodiment of the present invention, the "method for producing nicotinamide mononucleotide (NMN)" is characterized in that the concentration of NAM is 3 to 10 (g / L), but is not limited thereto.
또한, 본 발명은 상기 벡터에 의해 형질전환된 재조합 효모를 제공한다.In addition, the present invention provides a recombinant yeast transformed by the vector.
또한, 본 발명은 상기 벡터에 의해 형질전환된 재조합 동물세포를 제공한다.In addition, the present invention provides a recombinant animal cell transformed with the vector.
또한, 본 발명은 상기 벡터에 의해 형질전환된 재조합 식물세포를 제공한다.In addition, the present invention provides a recombinant plant cell transformed with the vector.
또한, 본 발명은 상기 생산방법에 의해 생산된 니코틴아미드 모노뉴클레오티드(NMN)를 유효성분으로 포함하는 항산화용 건강기능식품 조성물을 제공한다.In addition, the present invention provides a health functional food composition for antioxidant containing nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
또한, 본 발명은 상기 생산방법에 의해 생산된 니코틴아미드 모노뉴클레오티드(NMN)를 유효성분으로 포함하는 항산화용 화장료 조성물을 제공한다.In addition, the present invention provides a cosmetic composition for antioxidant comprising nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
본 발명은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT)를 코딩하는 뉴클레오티드, 포스포리보실 피로포스페이트 합성효소 1(PRPS1)을 코딩하는 뉴클레오티드 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)를 코딩하는 뉴클레오티드를 포함하는 재조합 플라스미드 벡터에 대한 것으로, 보다 구체적으로 상기 벡터에 의해 형질전환된 재조합 대장균을 이용해 NMN을 생산하고, 생산수율이 높은 NMN 생산방법을 제공한다.The present invention provides nucleotides encoding nicotinamide phosphoribosyltransferase (NAMPT), nucleotides encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1) and nucleotides encoding phosphoribosyl pyrophosphate synthase 2 (PRPS2). It relates to a recombinant plasmid vector containing, and more specifically, provides a method for producing NMN using a recombinant E. coli transformed by the vector and producing NMN with high production yield.
도 1은 대장균(Escherichia coli) 5탄당 인산 경로를 통한 NAM(nicotinamide) 으로부터의 NMN(nicotinamide mononucleotide)의 세포내 생산 경로를 나타낸 도이다.1 is a diagram showing the intracellular production pathway of NMN (nicotinamide mononucleotide) from NAM (nicotinamide) through Escherichia coli pentose phosphate pathway.
도 2는 본 발명의 대장균(Escherichia coli BL21(DE3))에 의해 발현되는 NAMPT-PRPS1-PRPS2 합성효소 재조합 단백질의 SDS-PAGE 분석 결과를 나타낸 도이다.Figure 2 is a diagram showing the results of SDS-PAGE analysis of NAMPT-PRPS1-PRPS2 synthetase recombinant protein expressed by E. coli ( Escherichia coli BL21 (DE3)) of the present invention.
도 3은 유당과 IPTG 유도의 경우 (a) Mg2+와 인산염 미첨가시 (b) Mg2+첨가시 (c)인산염 첨가시, NMN 생산값 비교 결과를 나타낸 도이다.3 is a diagram showing comparison results of NMN production values in the case of lactose and IPTG induction (a) when Mg 2+ and no phosphate were added (b) when Mg 2+ was added and (c) when phosphate was added.
도 4는 재조합 대장균(Escherichia coli BL21(DE3)) 세포에 의한 NMN 생성에 대한 Mg2+ 및 인산염 첨가의 효과를 나타낸 도이다.4 is a diagram showing the effect of adding Mg 2+ and phosphate to NMN production by recombinant Escherichia coli (Escherichia coli BL21(DE3)) cells.
도 5는 유당 또는 IPTG 유도제를 사용한 경우 농도별 NMN 생산량을 나타낸 도이다.5 is a diagram showing NMN production by concentration when lactose or an IPTG inducer was used.
도 6은 (a) NMN 표준시약, (b) 반응 혼합물, (c) 반응 혼합물의 NMN 생산의 HPLC 분석에 따른 LC/MS 스펙트럼을 나타낸 도이다.6 is a diagram showing LC/MS spectra according to HPLC analysis of (a) NMN standard reagent, (b) reaction mixture, and (c) NMN production of reaction mixture.
도 7은 초기 NAM 농도별(도 7a : 3 g/L, 도 7b : 5 g/L, 도 7c : 10 g/L) 재조합 대장균(Escherichia coli BL21(DE3)) 균주의 유가식 배양 결과를 나타낸 도이다.Figure 7 shows the results of fed-batch culture of recombinant Escherichia coli ( Escherichia coli BL21(DE3)) strains by initial NAM concentration (FIG. 7a: 3 g/L, FIG. 7b: 5 g/L, FIG. 7c: 10 g/L) It is also
도 8은 유가식 배양에서 NAM 농도별 건조 세포 무게 비교 결과를 나타낸 도이다.8 is a diagram showing a comparison result of dry cell weight for each NAM concentration in fed-batch culture.
도 9는 유가식 배양에서 NAM 농도별 최대 NMN 농도 비교 결과를 나타낸 도이다.9 is a diagram showing the results of comparison of maximum NMN concentrations for each NAM concentration in fed-batch culture.
이하, 첨부된 도면을 참조하여 본 발명의 구현예로 본 발명을 상세히 설명하기로 한다. 다만, 하기 구현 예는 본 발명에 대한 예시로 제시되는 것으로, 당업자에게 주지 저명한 기술 또는 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략할 수 있고, 이에 의해 본 발명이 제한되지는 않는다. 본 발명은 후술하는 특허 청구범위의 기재 및 그로부터 해석되는 균등 범주 내에서 다양한 변형 및 응용이 가능하다.Hereinafter, the present invention will be described in detail as an embodiment of the present invention with reference to the accompanying drawings. However, the following implementation examples are presented as examples of the present invention, and if it is determined that a detailed description of a well-known technology or configuration may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the description of the claims described later and equivalent scopes interpreted therefrom.
또한, 본 명세서에서 사용되는 용어(terminology)들은 본 발명의 바람직한 실시 예를 적절히 표현하기 위해 사용된 용어들로서, 이는 사용자, 운용자의 의도 또는 본 발명이 속하는 분야의 관례 등에 따라 달라질 수 있다. 따라서 본 용어들에 대한 정의는 본 명세서 전반에 걸친 내용을 토대로 내려져야 할 것이다. 명세서 전체에서, 어떤 부분이 어떤 구성요소를 “포함”한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성요소를 제외하는 것이 아니라 다른 구성 요소를 더 포함할 수 있는 것을 의미한다.In addition, the terminology used in this specification is a term used to appropriately express a preferred embodiment of the present invention, which may vary according to the intention of a user or operator or customs in the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the contents throughout this specification. Throughout the specification, when a certain component is said to "include", it means that it may further include other components without excluding other components unless otherwise stated.
일 측면에서 본 발명은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT)를 코딩하는 뉴클레오티드, 포스포리보실 피로포스페이트 합성효소 1(PRPS1)을 코딩하는 뉴클레오티드 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)를 코딩하는 뉴클레오티드를 포함하는 재조합 플라스미드 벡터에 대한 것이다.In one aspect, the present invention provides a nucleotide encoding nicotinamide phosphoribosyltransferase (NAMPT), a nucleotide encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1), and a nucleotide encoding phosphoribosyl pyrophosphate synthase 2 (PRPS2). It is for a recombinant plasmid vector containing a nucleotide that
일 측면에서 본 발명은 상기 벡터에 의해 형질전환된 재조합 대장균에 대한 것이다.In one aspect, the present invention relates to a recombinant E. coli transformed by the vector.
일 측면에서 본 발명은 재조합 대장균을 NAM이 첨가된 초기 배지에서 회분식 배양하는 1단계, 포도당 농도가 0으로 감소하기 전에 포도당 600 g/L, 효모 추출물 60 g/L 및 트립톤 60 g/L 조성의 용액을 공급하는 2단계, 상기 2단계와 동시에 유당 유도제를 10 g/L 공급하여 재조합 대장균을 고농도로 유가식 배양하는 3단계를 포함하는 니코틴아미드 모노뉴클레오티드(NMN) 생산 방법에 대한 것이다.In one aspect, the present invention is a first step of batch culture of recombinant E. coli in an initial medium to which NAM is added, 600 g/L of glucose, 60 g/L of yeast extract, and 60 g/L of tryptone before the glucose concentration is reduced to zero. A nicotinamide mononucleotide (NMN) production method comprising a second step of supplying a solution and a third step of fed-batch culture of recombinant E. coli at a high concentration by simultaneously supplying 10 g/L of a lactose inducer.
본 발명의 NMN은 NAD+ 생합성 과정에서 인산기와 리보스를 함유하는 뉴클레오사이드와 nicotinamide(NAM)가 반응하여 생성되는 중간 생성물이다. NMN은 화학적 및 효소적 합성 방법에 의해 생성될 수 있으나, 화학적 합성 방법은 비용이 많이 들고 원치 않는 부산물을 생성하기 때문에 효소적 방법이 선호된다. NMN은 NAMPT(nicotinamide phosphoribosyl transferase) 효소의 존재 하에서 PRPP(phosphoribosyl pyrophosphate)와 NAM(nicotinamide)을 기질로 사용하여 생성된다.NMN of the present invention is an intermediate product produced by the reaction between a nucleoside containing a phosphate group and ribose and nicotinamide (NAM) in the NAD+ biosynthesis process. NMN can be produced by chemical and enzymatic synthetic methods, but enzymatic methods are preferred because chemical synthetic methods are expensive and produce unwanted by-products. NMN is produced using phosphoribosyl pyrophosphate (PRPP) and nicotinamide (NAM) as substrates in the presence of the enzyme nicotinamide phosphoribosyl transferase (NAMPT).
PRPP(phosphoribosyl pyrophosphate)는 포스포리보실 피로포스페이트 합성효소(phosphoribosyl pyrophosphate synthetase, PRPS)가 존재할 때 ATP와 D-리보스-5-포스페이트(D-ribose-5-phosphate, R5P)로부터 생성되는 퓨린 및 피리미딘 뉴클레오티드의 생합성을 위한 빌딩 블록으로 작용한다. PRPS는 PRPP 생성에 필요한 가장 중요한 효소 중 하나이며, 인간에서 PRPS 유전자는 PRPS1, PRPS2 및 PRPS3의 3개의 그룹으로 분류된다. PRPS1은 퓨린 생합성에서 중요한 역할을 한다(https://www.genecards.org/cgi-bin/carddisp.pl?gene=PRPS1). PRPS2는 ATP 및 R5P 반응을 통한 PRPP 형성 과정에서 퓨린과 피리미딘의 합성에 관여한다(https://www.genecards.org/ cgi-bin/carddisp.pl?gene=PRPS2). PRPS1의 경우, 디포스포릴기는 ATP 또는 dATP에서만 R5P로 전달되는 반면, PRPS2는 ATP, dATP, UTP, CTP 및 GTP를 포함하는 디포스포릴 공여체에 대해 상당히 넓은 특이성을 가지고 있다. 대부분의 PRPS1 효소는 효소 활동을 위해 Mg2+ 및 인산염을 필요로 한다. PRPS3와 관련하여 뉴클레오타이드 합성 및 NMN 생산에서의 역할에 대한 정보는 많지 않다.PRPP (phosphoribosyl pyrophosphate) is a purine and pyrimidine produced from ATP and D-ribose-5-phosphate (R5P) in the presence of phosphoribosyl pyrophosphate synthetase (PRPS). It serves as a building block for the biosynthesis of nucleotides. PRPS is one of the most important enzymes required for PRPP production, and in humans, PRPS genes are classified into three groups: PRPS1, PRPS2, and PRPS3. PRPS1 plays an important role in purine biosynthesis (https://www.genecards.org/cgi-bin/carddisp.pl?gene=PRPS1). PRPS2 is involved in the synthesis of purines and pyrimidines in the process of forming PRPP through ATP and R5P reactions (https://www.genecards.org/cgi-bin/carddisp.pl?gene=PRPS2). In the case of PRPS1, the diphosphoryl group is transferred to R5P only from ATP or dATP, whereas PRPS2 has a fairly broad specificity for diphosphoryl donors including ATP, dATP, UTP, CTP and GTP. Most PRPS1 enzymes require Mg 2+ and phosphate for enzymatic activity. Regarding PRPS3, there is not much information about its role in nucleotide synthesis and NMN production.
본 발명에서는 NMN 생산을 위해 인간 유래의 PRPS1 및 PRPS2와 함께 NAMPT를 대장균에 클로닝하기 위해 대사 공학 접근이 사용되었다. PRPP 합성 과정에서 PRPS2의 상당한 역할을 염두에 두고 PRPP 및 궁극적으로 NMN의 향상된 생산을 달성하기 위해 E. coli에서 PRPS2를 PRPS1 및 NAMPT와 함께 유전자 조작하였다. E. coli는 잘 알려진 강력한 유전 도구이자 대사 공학 연구에 가장 선호되는 숙주이다. 일반적으로 인간 유래의 NAMPT는 박테리아, 효모 유래보다 NAM에 대해 더 높은 특이성을 나타낸다. 대부분의 연구가 박테리아 유래의 NAMPT와 함께 PRPS1만 구현했지만 본 발명에서는 인간 유래의 PRPS1 및 PRPS2 유전자와 함께 NAMPT를 이용하였다.In the present invention, a metabolic engineering approach was used to clone NAMPT into E. coli along with human-derived PRPS1 and PRPS2 for NMN production. Keeping in mind the significant role of PRPS2 in the process of PRPP synthesis, PRPS2 was engineered along with PRPS1 and NAMPT in E. coli to achieve enhanced production of PRPP and ultimately NMN. E. coli is a well-known and powerful genetic tool and a preferred host for metabolic engineering research. In general, human-derived NAMPTs show higher specificity to NAMs than bacterial or yeast-derived NAMPTs. Although most studies implemented only PRPS1 together with bacterial NAMPT, the present invention used NAMPT together with human PRPS1 and PRPS2 genes.
NMN은 살비지(salvage) 경로를 통해 PRPP의 존재 하에 NAMPT의 촉매 활성을 통해 NAM의 전환에 의해 생성된다. 이러한 관점에서 본 발명에서는 먼저 당 대사 및 효소 반응을 포함하는 생체 촉매인 대장균의 대사 설계에 중점을 두었다(도 1). 이 대사 과정은 오탄당 인산 경로를 통해 PRPP를 제공하는 발효 과정과 NAM을 NMN으로 전환시키는 효소 반응 과정으로 구성된다. 최근 대장균의 대사공학을 통한 NMN의 세포내 생합성과 관련된 여러 연구가 보고되었으나 NMN의 수율은 매우 낮았다. 따라서 본 연구에서는 NMN 수율을 향상시키기 위해 PRPS1 및 PRPS2가 삽입된 재조합 대장균(Escherichia coli BL21(DE3))를 개발하였으며, NMN 생산 증가를 위해 탄소원, 마그네슘 및 무기 인산염 공급원과 같은 다양한 요소를 RSM(response surface method) 접근법을 사용하여 최적화했다.NMN is produced by the conversion of NAM via the catalytic activity of NAMPT in the presence of PRPP via the salvage pathway. From this point of view, the present invention first focused on the metabolic design of Escherichia coli, which is a biocatalyst including sugar metabolism and enzymatic reactions (FIG. 1). This metabolic process consists of a fermentation process that provides PRPP through the pentose phosphate pathway and an enzymatic process that converts NAM to NMN. Recently, several studies related to the intracellular biosynthesis of NMN through metabolic engineering of Escherichia coli have been reported, but the yield of NMN is very low. Therefore, in this study, PRPS1 and PRPS2-inserted recombinant Escherichia coli ( Escherichia coli BL21(DE3)) were developed to improve NMN yield, and various factors such as carbon source, magnesium, and inorganic phosphate source were used in RSM (response) to increase NMN production. surface method) approach was used for optimization.
현재까지 박테리아 및 효모를 사용한 NMN 생산에 관한 연구는 소수에 불과하다. 대부분의 보고된 연구에서 더 높은 NMN 수율을 달성하기 위해 대사적으로 조작된 E. coli 균주가 사용되었다. 본 발명에서 추가로 삽입된 PRPS2는 Mg2+ 및 인산염의 존재 하에 유전자를 상향 조절함으로써 향상된 NMN 생성에 중요한 역할을 한다. 또한 대사적으로 조작된 대장균(Escherichia coli BL21(DE3))은 RSM 최적화 연구 및 고농도 유가식 배양을 통해 NMN의 더 높은 세포내 생산을 나타냈다. 대사적으로 조작된 대장균을 사용한 NMN 생산에 대한 여러 연구가 보고되었지만, 본 연구는 보고된 것보다 세포내 수준에서 가장 높은 NMN 생산을 나타냈다. 본 발명은 포도당, 유당, NAM과 같은 저렴한 기질을 사용하여 개량된 대장균 균주에 의해 약학적으로 중요한 NMN을 쉽고 경제적으로 생산하는 방법을 제공한다.To date, there are only a few studies on NMN production using bacteria and yeast. In most of the reported studies, metabolically engineered E. coli strains were used to achieve higher NMN yields. In the present invention, the additionally inserted PRPS2 plays an important role in enhanced NMN production by upregulating the gene in the presence of Mg 2+ and phosphate. In addition, metabolically engineered Escherichia coli ( Escherichia coli BL21(DE3)) showed higher intracellular production of NMN through RSM optimization studies and high-dose fed-batch culture. Although several studies on NMN production using metabolically engineered E. coli have been reported, this study showed the highest NMN production at the intracellular level than reported. The present invention provides a method for easily and economically producing pharmaceutically important NMN by an improved E. coli strain using inexpensive substrates such as glucose, lactose, and NAM.
또한, 본 발명은 상기 벡터에 의해 형질전환된 재조합 효모를 제공한다.In addition, the present invention provides a recombinant yeast transformed by the vector.
또한, 본 발명은 상기 벡터에 의해 형질전환된 재조합 동물세포를 제공한다.In addition, the present invention provides a recombinant animal cell transformed with the vector.
또한, 본 발명은 상기 벡터에 의해 형질전환된 재조합 식물세포를 제공한다.In addition, the present invention provides a recombinant plant cell transformed with the vector.
또한, 본 발명은 상기 생산방법에 의해 생산된 니코틴아미드 모노뉴클레오티드(NMN)를 유효성분으로 포함하는 항산화용 건강기능식품 조성물을 제공한다.In addition, the present invention provides a health functional food composition for antioxidant containing nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
또한, 본 발명은 상기 생산방법에 의해 생산된 니코틴아미드 모노뉴클레오티드(NMN)를 유효성분으로 포함하는 항산화용 화장료 조성물을 제공한다.In addition, the present invention provides a cosmetic composition for antioxidant comprising nicotinamide mononucleotide (NMN) produced by the above production method as an active ingredient.
본 발명의 건강기능식품 조성물은 유효성분을 함유하는 것 외에 통상의 식품 조성물과 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.In addition to containing the active ingredient, the health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional food compositions.
상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 향미제는 천연 향미제(타우마틴), 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 본 발명의 식품 조성물은 하기 약학적 조성물과 동일한 방식으로 제제화 되어 기능성 식품으로 이용하거나, 각종 식품에 첨가할 수 있다. 본 발명의 조성물을 첨가할 수 있는 식품으로는 예를 들어, 음료류, 육류, 초코렛, 식품류, 과자류, 피자, 라면, 기타 면류, 껌류, 사탕류, 아이스크림류, 알콜 음료류, 비타민 복합제 및 건강보조식품류 등이 있다.Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agents described above, natural flavoring agents (thaumatin), stevia extracts (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used. The food composition of the present invention is formulated in the same way as the following pharmaceutical composition and can be used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. there is
또한, 상기 식품 조성물은 유효성분 외에 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그밖에 본 발명의 식품 조성물은 천연 과일 주스 및 과일 주스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다.In addition, the food composition, in addition to active ingredients, various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like. In addition, the food composition of the present invention may contain natural fruit juice and fruit flesh for preparing fruit juice beverages and vegetable beverages.
본 발명의 건강기능식품 조성물은, 정제, 캅셀, 분말, 과립, 액상, 환 등의 형태로 제조 및 가공될 수 있다. 본 발명에서 '건강기능식품 조성물'이라 함은 건강기능식품에 관한 법률 제6727호에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 말하며, 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다. 본 발명의 건강 기능성 식품은 통상의 식품 첨가물을 포함할 수 있으며, 식품 첨가물로서의 적합 여부는 다른 규정이 없는 한, 식품의약품안전처에 승인된 식품 첨가물 공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다. 상기 '식품 첨가물 공전'에 수재된 품목으로는 예를 들어, 케톤류, 글리신, 구연산칼슘, 니코틴산, 계피산 등의 화학적 합성물; 감색소, 감초추출물, 결정셀룰로오스, 고량색소, 구아검 등의 천연첨가물; L-글루타민산나트륨 제제, 면류첨가알칼리제, 보존료 제제, 타르색소제제 등의 혼합제제류 등을 들 수 있다. 예를 들어, 정제 형태의 건강 기능성 식품은 본 발명의 유효성분을 부형제, 결합제, 붕해제 및 다른 첨가제와 혼합한 혼합물을 통상의 방법으로 과립화한 다음, 활택제 등을 넣어 압축성형하거나, 상기 혼합물을 직접 압축 성형할 수 있다. 또한 상기 정제 형태의 건강 기능성 식품은 필요에 따라 교미제 등을 함유할 수도 있다. 캅셀 형태의 건강 기능성 식품 중 경질 캅셀제는 통상의 경질 캅셀에 본 발명의 유효성분을 부형제 등의 첨가제와 혼합한 혼합물을 충진하여 제조할 수 있으며, 연질 캅셀제는 본 발명의 유효성분을 부형제 등의 첨가제와 혼합한 혼합물을 젤라틴과 같은 캅셀 기제에 충진하여 제조할 수 있다. 상기 연질 캅셀제는 필요에 따라 글리세린 또는 소르비톨 등의 가소제, 착색제, 보존제 등을 함유할 수 있다. 환 형태의 건강 기능성 식품은 본 발명의 유효성분과 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 성형하여 조제할 수 있으며, 필요에 따라 백당이나 다른 제피제로 제피할 수 있으며, 또는 전분, 탈크와 같은 물질로 표면을 코팅할 수도 있다. 과립 형태의 건강 기능성 식품은 본 발명의 유효성분의 부형제, 결합제, 붕해제 등을 혼합한 혼합물을 기존에 공지된 방법으로 입상으로 제조할 수 있으며, 필요에 따라 착향제, 교미제 등을 함유할 수 있다.The health functional food composition of the present invention may be prepared and processed in the form of tablets, capsules, powders, granules, liquids, pills, and the like. In the present invention, 'health functional food composition' refers to a food manufactured and processed using raw materials or ingredients having useful functionalities for the human body according to the Health Functional Food Act No. 6727, and the structure and function of the human body It refers to intake for the purpose of obtaining useful effects for health purposes such as regulating nutrients or physiological functions. The health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and general test methods approved by the Ministry of Food and Drug Safety, unless otherwise specified. It is judged according to the relevant standards and standards. Examples of the items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations. For example, a health functional food in the form of a tablet is obtained by granulating a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives in a conventional manner, and then adding a lubricant or the like to compression molding, or The mixture can be directly compression molded. In addition, the health functional food in the form of a tablet may contain a flavoring agent or the like, if necessary. Among capsule-type health functional foods, hard capsules can be prepared by filling a mixture in which the active ingredient of the present invention is mixed with additives such as excipients in a normal hard capsule. It can be prepared by filling a mixture mixed with gelatin in a capsule base. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary. The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention mixed with an excipient, binder, disintegrant, etc. by a conventionally known method, and can be coated with sucrose or other coating agent if necessary, Alternatively, the surface may be coated with a material such as starch or talc. Health functional food in the form of granules can be prepared in granular form by a conventionally known method of mixing the excipients, binders, disintegrants, etc. of the active ingredients of the present invention, and if necessary, flavoring agents, flavoring agents, etc. can
본 발명의 “화장료 조성물”은 상술한 본 발명의 니코틴아미드 모노뉴클레오티드(NMN)의 화장품학적 유효량(Cosmetically effective amount) 및 화장품학적으로 허용되는 담체를 포함하여 제조할 수 있다.The “cosmetic composition” of the present invention may be prepared by including a cosmetically effective amount of the nicotinamide mononucleotide (NMN) of the present invention described above and a cosmetically acceptable carrier.
본 명세서에서 “화장품학적 유효량”은 상술한 본 발명의 항산화 효능을 달성하는 데 충분한 양을 의미한다.In the present specification, "cosmetic effective amount" means an amount sufficient to achieve the antioxidant efficacy of the present invention described above.
화장료 조성물의 외형은 화장품학 또는 피부과학적으로 허용 가능한 매질 또는 기제를 함유한다. 이는 국소적용에 적합한 모든 제형으로, 예를 들면, 용액, 겔, 고체, 반죽 무수 생성물, 수상에 유상을 분산시켜 얻은 에멀젼, 현탁액, 마이크로에멀젼, 마이크로캡슐, 미세과립구 또는, 이온형(리포좀) 및 비이온형의 소낭 분산제의 형태로, 또는 크림, 스킨, 로션, 파우더, 연고, 스프레이 또는 콘실 스틱의 형태로 제공될 수 있다. 이들 조성물은 당해 분야의 통상적인 방법에 따라 제조될 수 있다. 본 발명에 따른 조성물은 또한 포말(Foam)의 형태로 또는 압축된 추진제를 더 함유한 에어로졸 조성물의 형태로도 사용될 수 있다.The appearance of the cosmetic composition contains a cosmetic or dermatologically acceptable medium or base. These are all formulations suitable for topical application, e.g. solutions, gels, solids, anhydrous pasty products, emulsions obtained by dispersing an oily phase in an aqueous phase, suspensions, microemulsions, microcapsules, microgranules or ionic forms (liposomes) and It may be provided in the form of a non-ionic follicular dispersant, or in the form of a cream, toner, lotion, powder, ointment, spray or conceal stick. These compositions can be prepared according to conventional methods in the art. The composition according to the present invention can also be used in the form of a foam or in the form of an aerosol composition further containing a compressed propellant.
본 발명의 일 실시예에 따른 상기 화장료 조성물은 그 제형에 있어서 특별히 한정되는 바가 없으며, 예를 들면, 유연화장수, 수렴화장수, 영양화장수, 영양크림, 마사지크림, 에센스, 아이크림, 아이에센스, 클렌징크림, 클렌징폼, 클렌징워터, 팩, 파우더, 바디로션, 바디크림, 바디오일 및 바디에센스 등의 화장품으로 제형화될 수 있다.The cosmetic composition according to an embodiment of the present invention is not particularly limited in its dosage form, for example, softening lotion, astringent lotion, nutrient lotion, nutrient cream, massage cream, essence, eye cream, eye essence, cleansing It can be formulated into cosmetics such as cream, cleansing foam, cleansing water, pack, powder, body lotion, body cream, body oil and body essence.
본 발명의 화장료 조성물의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fibers, vegetable fibers, wax, paraffin, starch, tracanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. this can be used
본 발명의 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the cosmetic composition of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additionally chlorofluorohydro propellants such as carbon, propane/butane or dimethyl ether.
본 발명의 화장료 조성물의 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알콜, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene fatty acid esters of glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan.
본 발명의 화장료 조성물의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알콜, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.When the formulation of the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspending agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tracanth and the like may be used.
본 발명의 화장료 조성물의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알콜 설페이트, 지방족 알콜 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알콜, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the cosmetic composition of the present invention is surfactant-containing cleansing, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate , fatty acid amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives or ethoxylated glycerol fatty acid esters, and the like can be used.
본 발명의 화장료 조성물은 스킨, 로션, 크림, 에센스, 팩, 파운데이션, 색조화장품, 선크림, 투웨이케이크, 페이스파우더, 콤팩트, 메이크업베이스, 스킨커버, 아이쉐도우, 립스틱, 립글로스, 립픽스, 아이브로우 펜슬, 화장수 등의 화장품 및 샴푸, 비누 등의 세정제에 적용될 수 있다.The cosmetic composition of the present invention can be applied to skin, lotion, cream, essence, pack, foundation, color cosmetics, sunscreen, two-way cake, face powder, compact, makeup base, skin cover, eye shadow, lipstick, lip gloss, lip fix, eyebrow pencil , It can be applied to cosmetics such as lotion and detergents such as shampoo and soap.
본 발명의 일 실시예에 따른 화장료 조성물에는 상기 유효성분 이외에 기능성 첨가물 및 일반적인 화장료 조성물에 포함되는 성분이 추가로 포함될 수 있다. 상기 기능성 첨가물로는 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당, 스핑고 지질 및 해초 엑기스로 이루어진 군에서 선택된 성분을 포함할 수 있다.The cosmetic composition according to an embodiment of the present invention may further include functional additives and components included in general cosmetic compositions in addition to the above active ingredients. The functional additive may include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extracts.
본 발명의 화장료 조성물에는 또한, 상기 기능성 첨가물과 더불어 필요에 따라 일반적인 화장료 조성물에 포함되는 성분을 배합해도 된다. 이외에 포함되는 배합 성분으로서는 유지 성분, 보습제, 에몰리엔트제, 계면 활성제, 유기 및 무기 안료, 유기 분체, 자외선 흡수제, 방부제, 살균제, 산화 방지제, 식물 추출물, pH 조정제, 알콜, 색소, 향료, 혈행 촉진제, 냉감제, 제한(制汗)제, 정제수 등을 들 수 있다.In addition to the above functional additives, the cosmetic composition of the present invention may further contain components included in general cosmetic compositions as needed. Ingredients other than those included include fats and oils, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, blood circulation accelerators, cooling agents, antiperspirants, purified water and the like.
이하, 실시예를 통하여 본 발명을 보다 자세히 설명한다. 다만, 상기 실시예 및 실험예는 본 발명에 대한 예시로 제시되는 것으로, 당업자에게 주지 저명한 기술 또는 구성에 대한 구체적인 설명이 본 발명의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우에는 그 상세한 설명을 생략할 수 있고, 이에 의해 본 발명이 제한되지는 않는다. 본 발명은 후술하는 특허청구범위의 기재 및 그로부터 해석되는 균등 범주 내에서 다양한 변형 및 응용이 가능하다.Hereinafter, the present invention will be described in more detail through examples. However, the above embodiments and experimental examples are presented as examples of the present invention, and detailed descriptions thereof are omitted if it is determined that detailed descriptions of well-known techniques or configurations may unnecessarily obscure the gist of the present invention. It can be done, and the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of the claims described below and equivalents interpreted therefrom.
<준비예><Preparation example>
1. 균주, 플라스미드 및 시약1. Strains, Plasmids and Reagents
대장균 DH5α 및 BL21(DE3)의 컴피턴트(competent) 세포는 Takara에서 구입하여 각각 클로닝 및 단백질 발현 숙주로 사용하였다. 두 균주 모두 Luria Bertani(LB) 배지(기산바이오)에서 배양하였다. 암피실린은 75 μg/ml 농도에서 선택 마커로 사용되었다. pET21b 플라스미드(Novagen)를 발현 벡터로 사용하였다. 제한 효소는 Takara에서 구입했다. 기질로 포도당과 유당을 사용하였다. NMN 표준 시약은 Prohealth Longevity Company에서 구입했다.E. coli DH5α and BL21 (DE3) competent cells were purchased from Takara and used as cloning and protein expression hosts, respectively. Both strains were cultured in Luria Bertani (LB) medium (Kisan Bio). Ampicillin was used as a selection marker at a concentration of 75 μg/ml. pET21b plasmid (Novagen) was used as an expression vector. Restriction enzymes were purchased from Takara. Glucose and lactose were used as substrates. NMN standard reagents were purchased from Prohealth Longevity Company.
2. 클로닝 발현 벡터2. Cloning expression vectors
재조합 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2) 유전자는 단백질 발현을 위한 pET21b 발현 벡터(Novagen)에 클로닝되었다. NAMPT-PRPS1-PRPS2 효소를 코딩하는 전체 유전자를 pBHA 플라스미드(바이오니아)에 구축한 후 대장균에서 발현시켰다. NAMPT(GenBank: AAI06047.1), PRPS1(GenBank: NM_001204402.2) 및 PRPS2(GenBank: AAI10876.2) 효소를 인코딩하는 유전자는 Homo sapiens 소스에서 선택하고 E. coli DH5α 세포에 클로닝했다. 글리신-세린 유연 링커(GGGGS)2를 코딩하는 DNA 서열이 기능적 도메인 사이에 도입되었다. 발현된 NAMPT, PRPS1 및 PRPS2 유전자는 NAMPT에 대한 정방향 프라이머 GCGGCTAGCATGAATCCTGCGG 및 PRPS1에 대한 역방향 프라이머 GCGGTCGACTAAAGGGACATGGC 및 PRPS2에 대한 역방향 프라이머 GCGCTCGAGTAGCGGGACATGG를 사용하여 PCR에 의해 증폭되었다. 증폭된 PCR 산물을 아가로스 겔에 로딩하여 벡터의 존재를 확인하고, 추가적으로 구축된 플라스미드를 E. coli DH5α 균주로 형질전환시켰다. NAMPT-PRPS1-PRPS2 전체 유전자 서열은 하기 표 1과 같다.Recombinant nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2) genes were cloned into the pET21b expression vector (Novagen) for protein expression. . The entire gene encoding the NAMPT-PRPS1-PRPS2 enzymes was constructed into a pBHA plasmid (Bioneer) and then expressed in E. coli. Genes encoding the enzymes NAMPT (GenBank: AAI06047.1), PRPS1 (GenBank: NM_001204402.2) and PRPS2 (GenBank: AAI10876.2) were selected from Homo sapiens sources and cloned into E. coli DH5α cells. A DNA sequence encoding a glycine-serine flexible linker (GGGGS)2 was introduced between the functional domains. The expressed NAMPT, PRPS1 and PRPS2 genes were amplified by PCR using forward primer GCGGCTAGCATGAATCCTGCGG for NAMPT and reverse primer GCGGTCGACTAAAGGGACATGGC for PRPS1 and reverse primer GCGCTCGAGTAGCGGGACATGG for PRPS2. The amplified PCR product was loaded on an agarose gel to confirm the presence of the vector, and the additionally constructed plasmid was transformed into E. coli DH5α strain. The entire gene sequence of NAMPT-PRPS1-PRPS2 is shown in Table 1 below.
유전자 이름gene name 서열번호sequence number 염기서열base sequence
NAMPTNAMPT 1 One ACAAGTTGCTGCCACCTTATCTTAGAGTTATTCAAGGGGATGGAGTAGATATTAATACCTTACAAGAGATTGTAGAAGGCATGAAACAAAAAATGTGGAGTATTGAAAATATTGCCTTCGGTTCTGGTGGAGGTTTGCTACAGAAGTTGACAAGAGATCTCTTGAATTGTTCCTTCAAGTGTAGCTATGTTGTAACTAATGGCCTTGGGATTAACGTCTTCAAGGACCCAGTTGCTGATCCCAACAAAAGGTCCAAAAAGGGCCGATTATCTTTACATAGGACGCCAGCAGGGAATTTTGTTACACTGGAGGAAGGAAAAGGAGACCTTGAGGAATATGGTCAGGATCTTCTCCATACTGTCTTCAAGAATGGCAAGGTGACAAAAAGCTATTCATTTGATGAAATAAGAAAAAATGCACAGCTGAATATTGAACTGGAAGCAGCACATCATGGTGGTGGTGGCAGTGGTGGAGGTGGTAGCACAAGTTGCTGCCACCTTATCTTAGAGTTATTCAAGGGGATGGAGTAGATATTAATACCTTACAAGAGATTGTAGAAGGCATGAAACAAAAAATGTGGAGTATTGAAAATATTGCCTTCGGTTCTGGTGGAGGTTTGCTAC AGAAGTTGACAAGAGATCTCTTGAATTGTTCCTTCAAGTGTAGCTATGTTGTAACTAATGGCCTTGGGATTAACGTCTTCAAGGACCCAGTTGCTGATCCCAACAAAAGGTCCAAAAAGGGCCGATTATCTTTACATAGGACGCCAGCAGGGAATTTTGTTACACTGGAGGAAGGAAAAGGAGACCTTGAGGAATATGGTCAGGATCTTCTCCATACTGTCTTCAAGAATGGCAAGGTGACAAAAAGCTATTCATTTGATGAAATAAGAAAAAATGCACAGCTGAATATTGAACTGGAAGCAGCACATCATGGTGGTGGTGGCAGTGGTGGAGGTGGTAGC
PRPS1PRPS1 2 2 ATGGTGCTTGTGGGAGATGTGAAGGATCGGGTGGCCATCCTTGTGGATGACATGGCTGACACTTGTGGCACAATCTGCCATGCAGCTGACAAACTTCTCTCAGCTGGCGCCACCAGAGTTTATGCCATCTTGACTCATGGAATCTTCTCCGGTCCTGCTATTTCTCGCATCAACAACGCATGCTTTGAGGCAGTAGTAGTCACCAATACCATACCTCAGGAGGACAAGATGAAGCATTGCTCCAAAATACAGGTGATTGACATCTCTATGATCCTTGCAGAAGCCATCAGGAGAACTCACAATGGAGAATCCGTTTCTTACCTATTCAGCCATGTCCCTTTAATGGTGCTTGTGGGAGATGTGAAGGATCGGGTGGCCATCCTTGTGGATGACATGGCTGACACTTGTGGCACAATCTGCCATGCAGCTGACAAACTTCTCTCAGCTGGCGCCACCAGAGTTTATGCCATCTTGACTCATGGA ATCTTCTCCGGTCCTGCTATTTCTCGCATCAACAACGCATGCTTTGAGGCAGTAGTAGTCACCAATACCATACCTCAGGAGGACAAGATGAAGCATTGCTCCAAAATACAGGTGATTGACATCTCTATGATCCTTGCAGAAGCCATCAGGAGAACTCACAATGGAGAATCCGTTTCTTACCTATTCAGCCATGTCCCTTTA
PRPS2PRPS2 33 ATGCCCAACATCGTGCTGTTCAGCGGCAGCTCGCATCAGGACCTGTCCCAGCGCGTGGCCGACCGCCTGGGCCTGGAGCTGGGCAAGGTGGTCACGAAGAAGTTCAGCAACCAGGAGACCAGCGTGGAGATTGGTGAAAGCGTGAGAGGGGAAGATGTCTACATCATCCAGAGCGGCTGCGGGGAAATTAACGACAACCTGATGGAACTCCTCATCATGATCAATGCCTGCAAGATTGCGTCATCATCCAGAGTAACTGCCGTGATCCCGTGTTTCCCATACGCCCGACAAGATAAAAAGGACAAGGTAGGAGAGAGTCGTGCCCCAATTTCTGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTGGGGCGGATCACATCATCACCATGGACCTGCATGCTTCTCAGATACAGGGATTCTTTGATATTCCTGTGGATAATTTGTATGCGGAGCCCGCAGTCCTGCAGTGGATTCGGGAAAACATTGCCGAGTGGAAGAACTGTATCATTGTTTCACCTGACGCAGGGGGAGCCAAAAGGGTTACATCAATTGCAGACAGGTTGAATGTGGAATTTGCTTTGATCCACAAAGAGAGGAAGAAGGCGAATGAAGTGGACCGGATGGTCCTGGTGGGCGACGTGAAGGACCGTGTGGCCATCCTCGTGGATGACATGGCTGACACTTGCGGCACCATCTGCCATGCTGCGGACAAGCTGCTGTCAGCTGGAGCCACCAAAGTGTATGCTATCCTTACCCATGGGATCTTCTCTGGACCAGCTATTTCCAGAATAAATAATGCCGCCTTTGAGGCTGTTGTCGTCACAAACACAATTCCGCAAGAGGACAAAATGAAACACTGCACCAAGATTCAGGTCATTGACATTTCCATGATCTTGGCCGAAGCAATCCGAAGGACACACAATGGGGAATCCGTGTCCTACCTGTTCAGCCATGTCCCGCTAATGCCCAACATCGTGCTGTTCAGCGGCAGCTCGCATCAGGACCTGTCCCAGCGCGTGGCCGACCGCCTGGGCCTGGAGCTGGGCAAGGTGGTCACGAAGAAGTTCAGCAACCAGGAGACCAGCGTGGAGATTGGTGAAAGCGTGAGAGGGGAAGATGTCTACATCATCCAGAGCGGCTGCGGGGAAATTAACGACAACCTGATGGAACTCCTCATCATGATCAATGCCTGCAAGATTGCGTCATCATCCAGAGTAACTGCCGTGATCCCGTGTTTCCCATACGCCCGACAAGATAAAAAGGACAAGGTAGGAGAGAGTCGTGCCCCAATTTCTGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTGGGGCGGATCACATCATCACCATGGACCTGCATGCTTCTCAGATACAGGGATTCTTTGATATTCCTGTGGATAATTTGTATGCGGAGCCCGCAGTCCTGCAGTGGATTCGGGAAAACATTGCCGAGTGGAAGAACTGTATCATTGTTTCACCTGACGCAGGGGGAGCCAAAAGGGTTACATCAATTGCAGACAGGTTGAATGTGGAATTTGCTTTGATCCACAAAGAGAGGAAGAAGGCGAATGAAGTGGACCGGATGGTCCTGGTGGGCGACGTGAAGGACCGTGTGGCCATCCTCGTGGATGACATGGCTGACACTTGCGGCACCATCTGCCATGCTGCGGACAAGCTGCTGTCAGCTGGAGCCACCAAAGTGTATGCTATCCTTACCCATGGGATCTTCTCTGGACCAGCTATTTCCAGAATAAATAATGCCGCCTTTGAGGCTGTTGTCGTCACAAACACAATTCCGCAAGAGGACAAAATGAAACACTGCACCAAGATTCAGGTCATTGACATTTCCATGATCTTGGCCGAAGCAATCCGAAGGACACACAATGGGGAATCCGTGTCCTACCTGTTCAGCCATGTCCCGCTA
3. 세균의 형질전환과 단백질 발현3. Bacterial transformation and protein expression
박테리아 형질전환을 위해 컴피턴트 대장균 BL21을 준비했다. 50 μl의 컴피턴트 세포를 4 μl의 플라스미드 DNA(pET21b-NAMPT-PRPS1-PRPS2)와 혼합했다. 모든 튜브를 30분 동안 얼음 위에 놓고 42 ℃에서 30초 동안 열 충격을 가한 다음 얼음 위에서 2분 동안 냉각했다. 그런 다음, 900 μl의 LB 배지를 첨가하고 튜브를 200 rpm 진탕 조건 하에 37 ℃에서 1시간 동안 배양하였다. 배양 후, 형질전환된 세포를 암피실린 항생제 마커(75 μg/ml)가 포함된 LB 한천 플레이트에 옮긴 후 암피실린 내성 콜로니를 선택하고 37 ℃에서 16시간 동안 배양하였다. 클로닝된 벡터는 다음과 같이 콜로니 PCR을 이용하여 확인하였다. 초기 변성은 95 ℃에서 5분 동안 수행한 후, 95 ℃에서 30초 동안 최종 변성, 55 ℃에서 30초 동안 어닐링, 72 ℃에서 3분간 확장, 72 ℃에서 5분간 최종 신장 단계의 25주기를 수행했다. PCR 산물은 아가로스(2.5%) 겔 전기영동에서 검사되었다. 재조합 대장균 균주에서 원하는 유전자의 존재를 확인한 후, 형질전환된 대장균 BL21(DE3) 세포를 NMN 생산에 대한 추가 연구에 사용하였다. pET21b 플라스미드를 함유하는 형질전환 대장균(Escherichia coli BL21(DE3))을 600 nm에서 광학 밀도가 0.6에 도달할 때까지 37 ℃에서 75 ㎍/ml의 암피실린이 보충된 LB 배지 100 ml에서 배양한 후 유도제를 첨가하였다.Competent E. coli BL21 was prepared for bacterial transformation. 50 μl of competent cells were mixed with 4 μl of plasmid DNA (pET21b-NAMPT-PRPS1-PRPS2). All tubes were placed on ice for 30 min, heat shocked at 42 °C for 30 sec, then cooled on ice for 2 min. Then, 900 μl of LB medium was added and the tube was incubated for 1 hour at 37° C. under 200 rpm shaking conditions. After culturing, the transformed cells were transferred to an LB agar plate containing an ampicillin antibiotic marker (75 μg/ml), and then ampicillin-resistant colonies were selected and cultured at 37° C. for 16 hours. The cloned vector was confirmed using colony PCR as follows. Initial denaturation was performed at 95 °C for 5 minutes, followed by 25 cycles of final denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, extension at 72 °C for 3 minutes, and final elongation at 72 °C for 5 minutes. did. PCR products were examined on agarose (2.5%) gel electrophoresis. After confirming the presence of the desired gene in the recombinant E. coli strain, the transformed E. coli BL21(DE3) cells were used for further studies on NMN production. Transformed Escherichia coli BL21 (DE3) containing the pET21b plasmid was cultured in 100 ml of LB medium supplemented with 75 μg/ml ampicillin at 37° C. until the optical density at 600 nm reached 0.6, followed by induction was added.
NAMPT-PRPS1-PRPS2 유전자를 발현하는 재조합 대장균(Escherichia coli BL21(DE3)) 세포를 스크리닝하기 위해, LB 플레이트 상의 암피실린 내성 콜로니를 분리하고 NMN 생산 실험에 사용하였다. 유도 후 발현된 단백질은 SDS PAGE(10%) 분석에 의해 추가로 확인되었으며, 도 2와 같이 재조합 유전자 NAMPT-PRPS1-PRPS2에 해당하는 약 105 kDa 크기의 밴드를 나타냈다. 발현된 단백질을 검증한 후, 형질전환된 대장균(Escherichia coli BL21(DE3)) 세포는 NMN 생산의 최적화 연구에 추가로 사용되었다.To screen for recombinant Escherichia coli ( Escherichia coli BL21(DE3)) cells expressing the NAMPT-PRPS1-PRPS2 gene, ampicillin-resistant colonies on LB plates were isolated and used for NMN production experiments. The protein expressed after induction was further confirmed by SDS PAGE (10%) analysis, and showed a band of about 105 kDa in size corresponding to the recombinant gene NAMPT-PRPS1-PRPS2 as shown in FIG. 2 . After validating the expressed protein, the transformed Escherichia coli ( Escherichia coli BL21(DE3)) cells were further used for optimization studies of NMN production.
4. 형질전환된 E. coli BL21(DE3) 세포를 사용한 플라스크 수준에서의 회분식 배양4. Batch culture at the flask level using transformed E. coli BL21(DE3) cells
형질전환된 대장균(Escherichia coli BL21(DE3)) 세포를 250 mL 삼각 플라스크에 암피실린(75 ㎍/ml)을 함유하는 LB 배지(100 ml)에서 성장시키고 200 rpm에서 진탕하면서 37 °C에서 배양하였다. 분광광도계(UVmini-1240, Shimadzu)를 사용하여 600 nm 파장에서 광학 밀도(OD)를 측정하여 세포 성장을 모니터링했다. 배양된 샘플(1 ml)을 2시간 간격으로 수집하고 4 °C에서 15,000 rpm으로 5분 동안 원심분리했다. 원심분리 후, 세포 펠릿을 분리하고 1 ml의 용해 완충액(50 mM HEPES 및 500 mM NaCl, pH 7.5)에 재현탁시켰다. 세포 현탁액을 얼음 위에서 2분 동안 초음파 처리하고 원심분리 후 상등액을 회수하였다. 고성능 액체 크로마토그래피(HPLC) 분석을 사용하여 NMN을 정량하기 위해 상등액을 0.25 μm 주사기 필터로 여과했다.Transformed Escherichia coli ( Escherichia coli BL21(DE3)) cells were grown in LB medium (100 ml) containing ampicillin (75 μg/ml) in a 250 mL Erlenmeyer flask and incubated at 37 °C with shaking at 200 rpm. Cell growth was monitored by measuring optical density (OD) at a wavelength of 600 nm using a spectrophotometer (UVmini-1240, Shimadzu). Cultured samples (1 ml) were collected every 2 h and centrifuged at 15,000 rpm for 5 min at 4 °C. After centrifugation, the cell pellet was separated and resuspended in 1 ml of lysis buffer (50 mM HEPES and 500 mM NaCl, pH 7.5). The cell suspension was sonicated on ice for 2 minutes and the supernatant was recovered after centrifugation. The supernatant was filtered through a 0.25 μm syringe filter to quantify NMN using high-performance liquid chromatography (HPLC) analysis.
<실시예><Example>
1. NMN 생성에 대한 Mg1. Mg for NMN generation 2+2+ 및 무기 인산염 농도의 영향 and the effect of inorganic phosphate concentration
NMN 생성에 대한 마그네슘(MgCl2, 1 mM) 및 무기 인산염(Na2HPO4 및 NaH2PO4, 1 mM)의 효과는 IPTG 및 유당 유도제의 존재 하에 조사되었다. Mg2+ 및 인산염을 첨가하지 않은 경우, 얻어진 NMN 수율은 IPTG 및 유당 유도의 경우 모두 유도 8시간 후 1 mM 미만이었다(도 3a). 그러나 Mg2+ 및 인산염의 첨가는 NMN 수율을 1.57 mM로 향상시켰으며, 이는 유당을 유도제로 사용한 경우 대조군(도 3a)에 비해 거의 두 배였다(도 3b 및 도 3c). IPTG 유도의 경우, NMN 생산 수준(1.05 mM)은 Mg2+(도 3b)와 인산염(도 3c)을 모두 사용한 유당 유도의 경우보다 낮았다. 따라서 이러한 결과는 IPTG 및 유당 유도의 경우 모두 Mg2+와 인산염이 NMN 생성에 긍정적인 영향을 미친다는 것을 나타낸다.The effects of magnesium (MgCl 2 , 1 mM) and inorganic phosphate (Na 2 HPO 4 and NaH 2 PO 4 , 1 mM) on NMN production were investigated in the presence of IPTG and lactose inducers. When Mg 2+ and phosphate were not added, the yield of NMN obtained was less than 1 mM after 8 h of induction for both IPTG and lactose induction (Fig. 3a). However, the addition of Mg 2+ and phosphate improved the NMN yield to 1.57 mM, which was almost twice as high as that of the control (Fig. 3a) when lactose was used as an inducer (Figs. 3b and 3c). In the case of IPTG induction, the level of NMN production (1.05 mM) was lower than in the case of lactose induction using both Mg 2+ (Fig. 3b) and phosphate (Fig. 3c). Therefore, these results indicate that Mg 2+ and phosphate have a positive effect on NMN production in both IPTG and lactose induction cases.
본 발명에서는 NAM을 NMN으로 변환하는 데 필요한 NAMPT 유전자와 함께 PRPS1 및 PRPS2 유전자를 모두 보유하는 재조합 대장균 균주를 사용했다. PRPS1 유전자는 R5P에서 PRPP로의 전환에서 디포스포릴 공여체로 작용하며, 이는 궁극적으로 살비지 경로를 통해 NAMPT를 이용하여 NAM의 존재하에 NMN을 생성한다. 재조합 대장균 세포에 의한 NMN 생산에 대한 NAMPT 및 PRPP 합성효소 유전자(PRPS1 및 PRPS2)의 동시 발현 효과를 조사하기 위해 Mg2+ 및 인산염 존재 하에서 NAMPT-PRPS1 및 NAMPT-PRPS2 유전자의 개별 발현을 연구했다. 도 4a에서 볼 수 있듯이 PRPS1과 PRPS2의 동시 발현은 인산염을 첨가하는 것보다 Mg2+의 존재 하에 더 높은 NMN 생산을 나타냈다(1.25 mM). 개별 PRPS1 유전자 발현의 경우, Mg2+ 및 인산염이 개별적으로 사용될 때 NMN 생산(0.59 mM)의 거의 유사한 프로필이 얻어졌다(도 4b). 도 4c에 도시된 바와 같이, Mg2+의 존재하에 개별 PRPS2 유전자 발현은 0.79 mM NMN의 생산을 나타내었으며, 이는 인산염을 첨가하는 것보다 약간 더 높았다. PRPS2는 Mg2+와 인산염이 모두 존재할 때 PRPS1(0.82 mM)보다 비교적 높은 NMN 수율(0.95 mM)을 보여주었다(도 4d). 또한 NMN 생산은 PRPS1 또는 PRPS2 유전자만 발현된 경우보다 PRPS1 및 PRPS2 유전자가 공동 발현될 때 훨씬 더 높았다(1.57 mM)(도 4d). 따라서 PRPS1과 PRPS2 유전자가 동시에 발현되었을 때 NMN 생성에 대한 Mg2+와 인산염의 결합 효과가 현저하다고 결론지을 수 있다.In the present invention, a recombinant E. coli strain containing both the PRPS1 and PRPS2 genes together with the NAMPT gene necessary for converting NAM to NMN was used. The PRPS1 gene acts as a diphosphoryl donor in the conversion of R5P to PRPP, which ultimately uses NAMPT via the salvage pathway to produce NMN in the presence of NAM. To investigate the effect of co-expression of NAMPT and PRPP synthase genes (PRPS1 and PRPS2) on NMN production by recombinant E. coli cells, we studied the individual expression of NAMPT-PRPS1 and NAMPT-PRPS2 genes in the presence of Mg 2+ and phosphate. As shown in Fig. 4a, co-expression of PRPS1 and PRPS2 showed higher NMN production in the presence of Mg 2+ than in the presence of phosphate (1.25 mM). For individual PRPS1 gene expression, nearly similar profiles of NMN production (0.59 mM) were obtained when Mg 2+ and phosphate were used separately (Fig. 4b). As shown in Fig. 4c, individual PRPS2 gene expression in the presence of Mg 2+ showed production of 0.79 mM NMN, which was slightly higher than adding phosphate. PRPS2 showed a relatively higher NMN yield (0.95 mM) than PRPS1 (0.82 mM) in the presence of both Mg 2+ and phosphate (Fig. 4d). NMN production was also significantly higher (1.57 mM) when the PRPS1 and PRPS2 genes were co-expressed than when only the PRPS1 or PRPS2 genes were expressed (Fig. 4d). Therefore, it can be concluded that the combined effect of Mg 2+ and phosphate on NMN production is significant when PRPS1 and PRPS2 genes are co-expressed.
2. NMN 생성에 대한 기질 농도 및 유도제의 영향2. Effect of substrate concentration and inducer on NMN production
NMN은 살비지 경로를 통해 NAM을 기질로 사용하는 NAD+의 생합성 동안 형성된 중간 생성물이다. 이 경로를 통해 NAMPT 유전자는 NMN 생합성을 위해 PRPP에서 NAM으로 포스포리보실 잔기를 전달한다. 본 발명에서는 bicistronic 발현 플라스미드로 형질전환된 대장균(Escherichia coli BL21(DE3)) 세포를 사용하여 기질 농도의 효과와 LB 배양 배지에서 IPTG와 lactose의 비교 효과를 연구하였다. 도 5에 나타난 바와 같이, 유당 보충 배지에서의 단백질 발현은 모든 기질 농도에 대해 IPTG 유도보다 NMN 생산의 개선을 나타내었다. 또한 NMN 수율은 유당 및 IPTG 유도 모두에 대해 도 5에 나타난 바와 같이 NAM 농도(0.1-0.5%)에 따라 증가했다. 0.1% 및 0.3% NAM 농도를 사용한 경우 유당 유도를 통해 각각 0.82 mM 및 0.93 mM의 NMN 수율을 얻었다. 0.5% NAM 농도를 사용하여 유당 유도 시 1.57 mM, IPTG 유도 시 1.08 mM의 가장 높은 NMN 수율을 각각 얻었다.NMN is an intermediate product formed during the biosynthesis of NAD+ that uses NAM as a substrate via the salvage pathway. Through this pathway, the NAMPT gene transfers a phosphoribosyl residue from PRPP to NAM for NMN biosynthesis. In the present invention, the effect of substrate concentration and the comparative effect of IPTG and lactose in LB culture medium were studied using Escherichia coli BL21(DE3) cells transformed with a bicistronic expression plasmid. As shown in Figure 5, protein expression in lactose-supplemented media showed an improvement in NMN production over IPTG induction for all substrate concentrations. NMN yield also increased with NAM concentration (0.1-0.5%) as shown in Figure 5 for both lactose and IPTG induction. NMN yields of 0.82 mM and 0.93 mM were obtained through lactose induction when 0.1% and 0.3% NAM concentrations were used, respectively. Using 0.5% NAM concentration, the highest yields of NMN were obtained, 1.57 mM when lactose-induced and 1.08 mM when IPTG-induced, respectively.
3. RSM을 사용한 배지 성분의 최적화3. Optimization of media components using RSM
CCD 접근법을 사용하여 30개의 회분식 실험을 수행한 결과, 유당 유도의 경우 0.5% NAM, 1 mM Mg2+ 및 인산염, 1% 리보스(Run 9) 조건에서 2.31 mM의 가장 높은 NMN 수율을 얻은 것을 확인하였다. 표 2는 유당 유도를 사용한 실제 값 및 응답 값을 갖는 최적화 변수의 중심 합성 설계 매트릭스에 관한 것이다.As a result of performing 30 batch experiments using the CCD approach, it was confirmed that the highest NMN yield of 2.31 mM was obtained in the case of lactose induction, 0.5% NAM, 1 mM Mg 2+ and phosphate, 1% ribose (Run 9). did Table 2 relates the central composite design matrix of optimization variables with actual and response values using lactose induction.
RunRun Nicotinamide (wt%)Nicotinamide (wt%) MgMg 2+2+ (mM)(mM) Phosphate (mM)Phosphate (mM) Ribose (wt%)Ribose (wt%) NMN concentration (mM)NMN concentration (mM)
ActualActual PredictedPredicted
1One 0.50.5 1One 1One 0.50.5 2.0302.030 1.901.90
22 0.750.75 1.51.5 1.51.5 0.750.75 0.8680.868 0.870.87
33 0.50.5 22 1One 0.50.5 1.6761.676 1.661.66
44 1One 22 1One 0.50.5 0.9550.955 0.8170.817
55 0.50.5 1One 22 0.50.5 1.8191.819 1.661.66
66 1One 1One 22 0.50.5 1.0911.091 0.990.99
77 0.50.5 22 22 0.50.5 1.4001.400 1.321.32
88 0.750.75 1.51.5 1.51.5 0.750.75 0.8680.868 0.870.87
99 0.50.5 1One 1One 1One 2.3112.311 1.901.90
1010 1One 1One 1One 1One 1.1401.140 1.111.11
1111 0.50.5 22 1One 1One 1.6671.667 1.491.49
1212 1One 22 1One 1One 1.2881.288 1.251.25
1313 0.750.75 1.51.5 1.51.5 0.750.75 0.8680.868 0.870.87
1414 1One 1One 22 1One 0.9700.970 0.9040.904
1515 0.50.5 22 22 1One 1.5231.523 1.201.20
1616 1One 22 22 1One 1.0401.040 1.061.06
1717 0.250.25 1.51.5 1.51.5 0.750.75 1.1831.183 1.641.64
1818 1.251.25 1.51.5 1.51.5 0.750.75 0.5920.592 0.5010.501
1919 0.750.75 0.50.5 1.51.5 0.750.75 1.4711.471 1.691.69
2020 0.750.75 1.51.5 1.51.5 0.750.75 0.8680.868 0.870.87
2121 0.750.75 1.51.5 0.50.5 0.750.75 1.2851.285 1.191.19
2222 0.750.75 1.51.5 2.52.5 0.750.75 1.1301.130 1.201.20
2323 0.750.75 1.51.5 1.51.5 0.250.25 0.9360.936 1.041.04
2424 0.750.75 1.51.5 1.51.5 1.251.25 0.8750.875 1.131.13
2525 0.750.75 1.51.5 1.51.5 0.750.75 0.8680.868 0.870.87
2626 0.750.75 2.52.5 1.51.5 0.750.75 1.3061.306 1.441.44
2727 1One 1One 1One 0.50.5 0.8390.839 0.9030.903
2828 0.750.75 1.51.5 1.51.5 0.750.75 0.8680.868 0.870.87
2929 0.50.5 1One 22 1One 1.3381.338 1.371.37
3030 1One 22 22 0.50.5 0.8200.820 0.980.98
4. 고농도 유가식 배양에 의한 NMN 농도 향상4. Improvement of NMN concentration by high-concentration fed-batch culture
재조합 대장균을 고농도로 배양하여 NMN농도를 향상시키기 위해 기질 공급을 계단식으로 증가시키는 유가식 배양을 실시하였으며, 이를 위한 초기 배지 조성은 표 3과 같고, 공급 용액의 조성은 포도당 600 g/L, 효모 추출물 60 g/L, 트립톤 60 g/L에 해당하였다. 재조합 대장균을 포도당 20 g/L, 암피실린 75 μg/ml 및 표 3의 초기 배지 조성을 이용하여 회분식 배양 후, 재조합 대장균을 6시간까지 성장시킨 다음, 유당 유도제 10g/L, 리보스 10 g/L 및 다양한 농도의 NAM(3, 5, 10 g/L)을 첨가하였다. 포도당 농도가 0으로 감소하기 전에 공급 용액(포도당 600 g/L, 효모 추출물 60 g/L, 트립톤 60 g/L)의 공급을 시작하여 재조합 대장균을 고농도로 유가식 배양하였다.In order to increase the NMN concentration by culturing recombinant E. coli at high concentration, fed-batch culture was performed to increase the substrate supply stepwise. The initial medium composition for this is shown in Table 3, and the composition of the supply solution is glucose 600 g / L, yeast This corresponded to 60 g/L of extract and 60 g/L of tryptone. After batch culture of recombinant E. coli using 20 g/L of glucose, 75 μg/ml of ampicillin and the initial medium composition of Table 3, the recombinant E. coli was grown for up to 6 hours, and then 10 g/L of lactose inducer, 10 g/L of ribose and various Concentrations of NAM (3, 5, 10 g/L) were added. Feed-batch culture of recombinant Escherichia coli was performed at high concentration by starting feeding of the feed solution (glucose 600 g/L, yeast extract 60 g/L, tryptone 60 g/L) before the glucose concentration decreased to zero.
성분ingredient 농도density
Citric acidCitric acid 1.7 g/L1.7g/L
KH2PO4 KH 2 PO 4 13.3 g/L13.3 g/L
(NH4)2HPO4 (NH 4 ) 2 HPO 4 4 g/L4g/L
MgSO4.7H2OMgSO 4 .7H 2 O 1.2 g/L1.2g/L
Trace element solution Trace element solution 10 ml/L10 ml/L
FeSO4.7H2OFeSO 4 .7H 2 O 10 g/L10 g/L
CaCl2.2H2OCaCl 2 .2H 2 O 2 g/L2g/L
ZnSO4.7H2OZnSO 4 .7H 2 O 2.25 g/L2.25g/L
MnSO4.4H2OMnSO 4 .4H 2 O 0.5 g/L0.5 g/L
(NH4)6Mo7O24.4H2O(NH 4 ) 6 Mo 7 O 24 .4H 2 O 0.1 g/L0.1 g/L
Na2B4O7.10H2ONa 2 B 4 O 7 .10H 2 O 0.02 g/L0.02g/L
CuSO4.5H2OCuSO 4 .5H 2 O 1 g/L1g/L
NAM 첨가 농도를 3, 5, 10 g/L로 변화시키면서 세 가지 유가식 배양을 수행한 결과, NAM 농도가 5 g/L일 때 18시간에 최대 건조 균체 농도 68 g/L, NMN 농도 55 mM(18 g/L)을 얻을 수 있었다(도 7 내지 9 참조).As a result of three fed-batch cultures with varying NAM concentrations of 3, 5, and 10 g/L, the maximum dry cell concentration was 68 g/L and the NMN concentration was 55 mM at 18 hours when the NAM concentration was 5 g/L. (18 g/L) was obtained (see FIGS. 7 to 9).
이와 같은 NMN 농도는 지금까지 보고된 값 중 가장 높은 농도에 해당한다.This NMN concentration corresponds to the highest concentration among those reported so far.

Claims (14)

  1. 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT)를 코딩하는 뉴클레오티드, 포스포리보실 피로포스페이트 합성효소 1(PRPS1)을 코딩하는 뉴클레오티드 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)를 코딩하는 뉴클레오티드를 포함하는 재조합 플라스미드 벡터.A recombinant composition comprising a nucleotide encoding nicotinamide phosphoribosyltransferase (NAMPT), a nucleotide encoding phosphoribosyl pyrophosphate synthase 1 (PRPS1) and a nucleotide encoding phosphoribosyl pyrophosphate synthase 2 (PRPS2) Plasmid vector.
  2. 제1항에 있어서,According to claim 1,
    상기 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)는 인간 유래 소스에서 선택된 것을 특징으로 하는, 재조합 플라스미드 벡터.The nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2) are selected from human-derived sources.
  3. 제1항에 있어서,According to claim 1,
    상기 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT)는 서열번호 1이고, 포스포리보실 피로포스페이트 합성효소 1(PRPS1)은 서열번호 2이며, 포스포리보실 피로포스페이트 합성효소 2(PRPS2)은 서열번호 3인 재조합 플라스미드 벡터.The nicotinamide phosphoribosyltransferase (NAMPT) is SEQ ID NO: 1, phosphoribosyl pyrophosphate synthase 1 (PRPS1) is SEQ ID NO: 2, and phosphoribosyl pyrophosphate synthase 2 (PRPS2) is SEQ ID NO: 3 Recombinant plasmid vectors.
  4. 제1항 내지 제3항 중 어느 한 항의 벡터에 의해 형질전환된 재조합 대장균.A recombinant E. coli transformed with the vector of any one of claims 1 to 3.
  5. 제4항에 있어서, According to claim 4,
    상기 대장균은 니코틴아미드 모노뉴클레오티드(nicotinamide mononucleotide, NMN)를 생산하는 것을 특징으로 하는 재조합 대장균.The E. coli recombinant E. coli, characterized in that for producing nicotinamide mononucleotide (NMN).
  6. 제4항에 있어서, According to claim 4,
    상기 대장균은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)의 동시 발현을 특징으로 하는 재조합 대장균.The E. coli is a recombinant E. coli characterized by simultaneous expression of nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2).
  7. 제4항의 재조합 대장균을 포도당 20 g/L, 암피실린 75 μg/ml 및 표 3의 초기 배지 조성을 이용하여 회분식 배양하는 1단계,Step 1 of culturing the recombinant E. coli of claim 4 in a batch manner using 20 g/L of glucose, 75 μg/ml of ampicillin, and the initial medium composition of Table 3;
    재조합 대장균을 6시간까지 성장시킨 다음, 유당 유도제 10g/L, 리보스 10 g/L 및 NAM을 첨가하는 2단계,Recombinant Escherichia coli was grown for up to 6 hours, and then 10 g/L of a lactose inducer, 10 g/L of ribose and NAM were added in the second step,
    포도당 농도가 0으로 감소하기 전에 포도당 600 g/L, 효모 추출물 60 g/L 및 트립톤 60 g/L 조성의 용액을 공급하는 3단계를 포함하는 니코틴아미드 모노뉴클레오티드(NMN) 생산 방법.A method for producing nicotinamide mononucleotide (NMN) comprising three steps of supplying a solution having a composition of 600 g/L of glucose, 60 g/L of yeast extract and 60 g/L of tryptone before the glucose concentration decreases to zero.
  8. 제7항에 있어서,According to claim 7,
    상기 방법은 니코틴아미드 포스포리보실트랜스퍼라제(NAMPT), 포스포리보실 피로포스페이트 합성효소 1(PRPS1) 및 포스포리보실 피로포스페이트 합성효소 2(PRPS2)의 동시 발현을 특징으로 하는, 니코틴아미드 모노뉴클레오티드(NMN) 생산 방법.The method is characterized by co-expression of nicotinamide phosphoribosyltransferase (NAMPT), phosphoribosyl pyrophosphate synthase 1 (PRPS1) and phosphoribosyl pyrophosphate synthase 2 (PRPS2), nicotinamide mononucleotide ( NMN) production method.
  9. 제7항에 있어서,According to claim 7,
    상기 니코틴아미드(NAM)의 농도는 3 내지 10(g/L) 인 것을 특징으로 하는, 니코틴아미드 모노뉴클레오티드(NMN) 생산 방법.Characterized in that the concentration of the nicotinamide (NAM) is 3 to 10 (g / L), nicotinamide mononucleotide (NMN) production method.
  10. 제1항 내지 제3항 중 어느 한 항의 벡터에 의해 형질전환된 재조합 효모.A recombinant yeast transformed with the vector of any one of claims 1 to 3.
  11. 제1항 내지 제3항 중 어느 한 항의 벡터에 의해 형질전환된 재조합 동물세포.A recombinant animal cell transformed with the vector of any one of claims 1 to 3.
  12. 제1항 내지 제3항 중 어느 한 항의 벡터에 의해 형질전환된 재조합 식물세포.A recombinant plant cell transformed with the vector of any one of claims 1 to 3.
  13. 제7항의 생산방법에 의해 생산된 니코틴아미드 모노뉴클레오티드(NMN)를 유효성분으로 포함하는 항산화용 건강기능식품 조성물.An antioxidant health functional food composition comprising nicotinamide mononucleotide (NMN) produced by the production method of claim 7 as an active ingredient.
  14. 제7항의 생산방법에 의해 생산된 니코틴아미드 모노뉴클레오티드(NMN)를 유효성분으로 포함하는 항산화용 화장료 조성물.A cosmetic composition for antioxidant comprising nicotinamide mononucleotide (NMN) produced by the production method of claim 7 as an active ingredient.
PCT/KR2022/012580 2021-08-24 2022-08-23 Recombinant e. coli for producing nicotinamide mononucleotide, and method for producing nicotinamide mononucleotide by using same WO2023027476A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0111714 2021-08-24
KR1020210111714A KR20230029344A (en) 2021-08-24 2021-08-24 Recombinant Escherichia coli for producing nicotinamide mononucleotide, and method for producing nicotinamide mononucleotide using the same

Publications (1)

Publication Number Publication Date
WO2023027476A1 true WO2023027476A1 (en) 2023-03-02

Family

ID=85323351

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/012580 WO2023027476A1 (en) 2021-08-24 2022-08-23 Recombinant e. coli for producing nicotinamide mononucleotide, and method for producing nicotinamide mononucleotide by using same

Country Status (2)

Country Link
KR (1) KR20230029344A (en)
WO (1) WO2023027476A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200061374A (en) * 2017-09-29 2020-06-02 미쯔비시 케미컬 주식회사 Method for producing nicotinamide mononucleotide and transformant used in the method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100599934B1 (en) 1998-12-22 2006-11-30 주식회사 엘지생활건강 Composition for preventing or treating periodontal disease

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200061374A (en) * 2017-09-29 2020-06-02 미쯔비시 케미컬 주식회사 Method for producing nicotinamide mononucleotide and transformant used in the method

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ANOTH MAHARJAN, MAMATA SINGHVI, BEOM SOO KIM: "Biosynthesis of a therapeutically important nicotinamide mononucleotide through a phosphoribosyl pyrophosphate synthetase 1 and 2 engineered strain of Escherichia coli", ACS SYNTHETIC BIOLOGY, vol. 10, 8 November 2021 (2021-11-08), pages 3055 - 3065, XP093039609 *
MARINESCU, GEORGE CATALIN; POPESCU, ROUA-GABRIELA; STOIAN, GHEORGHE; DINISCHIOTU, ANCA: "beta-nicotinamide mononucleotide (NMN) production in Escherichia coli", SCIENTIFIC REPORTS, NATURE PUBLISHING GROUP, US, vol. 8, no. 1, 16 August 2018 (2018-08-16), US , pages 12278, XP009528352, ISSN: 2045-2322, DOI: 10.1038/s41598-018-30792-0 *
TANG WENYING, LI XIAOWU, ZHU ZHIQIANG, TONG SHUILONG, LI XU, ZHANG XIAO, TENG MAIKUN, NIU LIWEN: "Expression, purification, crystallization and preliminary X-ray diffraction analysis of human phosphoribosyl pyrophosphate synthetase 1 (PRS1)", ACTA CRYSTALLOGRAPHICA SECTION F STRUCTURAL BIOLOGY AND CRYSTALLIZATION COMMUNICATIONS, vol. 62, no. 5, 1 May 2006 (2006-05-01), pages 432 - 434, XP093039610, DOI: 10.1107/S1744309106009067 *
YAMAURA KOHEI, MIFUNE YUTAKA, INUI ATSUYUKI, NISHIMOTO HANAKO, KATAOKA TAKESHI, KUROSAWA TAKASHI, MUKOHARA SHINTARO, NIIKURA TAKAH: "Anti-oxidative effects of nicotinamide mononucleotide, a regulator of aging, on rat high glucose-induced tenocytes in vitro", RESEARCH SQUARE, 17 July 2020 (2020-07-17), XP093039613, DOI: 10.21203/rs.3.rs-44917/v1 *

Also Published As

Publication number Publication date
KR20230029344A (en) 2023-03-03

Similar Documents

Publication Publication Date Title
JP6022603B2 (en) Cosmetic composition for skin whitening, pharmaceutical composition for prevention or treatment, and pharmaceutical composition for treatment
WO2021049852A1 (en) Lactobacillus paracasei subsp. tolerans sw1 strain having skin wrinkle improvement ability and producing highly functional natural metabolites, and use thereof
US20220340945A1 (en) Lactic acid bacteria that produce nicotinamide riboside, and lactic acid bacteria that produce nicotinamide mononucleotide and nicotinamide riboside
JP5721516B2 (en) Compound WS727713
WO2023027476A1 (en) Recombinant e. coli for producing nicotinamide mononucleotide, and method for producing nicotinamide mononucleotide by using same
WO2015041498A1 (en) Immune enhancement or anticancer composition containing neoagarooligosaccharide
CN108883121B (en) Use of 3, 6-anhydro-L-galactose for preventing dental caries
WO2013109096A1 (en) Method for preparing 3,6-anhydro-l-galactose, and use thereof
US20190127313A1 (en) Antimicrobial agents
KR20190056179A (en) Method for producing agarotriose and prebiotics use thereof
KR20120049684A (en) A novel compound, quercetin 3-o-n-acetylglucosamine, gene for producing the compound, and method for producing the compound
KR102513450B1 (en) Novel ectoine synthase and uses thereof
US8952140B2 (en) Compound amycolose derivative, method for producing the same, and use of the same
KR101687726B1 (en) Novel carotinoid and use thereof
TWI827814B (en) Novel compounds and their applications
KR102674605B1 (en) Method for mass production of maysin using E. coli
KR102164589B1 (en) Pyrido[2,3-d]pyrimidin-7(8H)-one derivatives and Composition for skin whitening and Pharmaceutical composition for use in preventing or treating disorders of Melanin Hyperpigmentation containing the same as an active ingredient
WO2022085938A1 (en) Planococcus sp. strain having astaxanthin secreting ability, and use thereof
KR20180032526A (en) A composition for external use comprising a ferro-stilbene glycoside
KR101846368B1 (en) Method for Preparing Astilbin from Taxifolin Using Microorganism Mutants
KR101118572B1 (en) Hydroquinone-beta-d-fructoside and composition comprising the same
KR20230023376A (en) Recombinant yeast introduced with a gene encoding retinol dehydrogenase and manufacturing method the same
KR20170008367A (en) A protein having activity of glucose transfer and use thereof
Liu et al. Efficient Biosynthesis of Three Rare Formononetin Derivatives by a Newly Discovered Bacillus Velezensis Strain

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22861685

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE