KR20230023376A - Recombinant yeast introduced with a gene encoding retinol dehydrogenase and manufacturing method the same - Google Patents

Abstract

The present invention relates to a recombinant yeast introduced with a gene for encoding retinol dehydrogenase and a manufacturing method thereof. Specifically, the recombinant yeast according to the present invention produces retinol with an RDH12 gene at a higher yield than a recombinant yeast to which a gene for encoding another retinol dehydrogenase is applied; minimally reduces production of the retinol which is a precursor; and increases a retinol production yield by minimizing production of glycerol which is a by-product when additionally applying a noxE gene to the recombinant yeast. Therefore, the recombinant yeast is usefully used for mass production of the retinol.

Description

Recombinant yeast introduced with a gene encoding retinol dehydrogenase and method for producing the same

The present invention relates to recombinant yeast into which a gene encoding retinol dehydrogenase is introduced and a method for preparing the same.

Vitamins are essential organic compounds that are not naturally synthesized in the body and are important for general growth and nutrition, and can be divided into two groups, fat-soluble and water-soluble, according to their physiological characteristics or chemical structure. Among the fat-soluble vitamins, vitamin A consists of several retinoids and is of great interest to the pharmaceutical, cosmetic and food industries. Retinoids include retinol, retinal, retinoic acid, and retinyl ester, which are variants with different terminal groups such as alcohols, aldehydes, carboxylic acids, and esters.

Vitamin A including retinol is usually prepared through an organic chemical synthesis method, but the organic chemical synthesis method requires the use of toxic solvents that may cause harm to the natural environment and health as well as many reaction steps. Therefore, biological production methods of vitamins are being developed to overcome the problems of chemical production methods. For example, this is achieved by identifying organisms that naturally produce vitamin A, establishing conditions for their culture and developing downstream processes to obtain a pure end product. Nevertheless, the maximum content of vitamin A obtainable biologically using natural producers is lower than that obtainable by chemical production methods. After the development of biotechnology, the production of vitamins by microorganisms began to be used for industrial production that meets the needs of natural products based on environmentally friendly processes.

Microbial production of vitamins has the advantage of being economical, environmentally friendly and not dependent on global climate change. In particular, Saccharomyces cerevisiae is a GRAS (generally recognized as safe) microorganism, facile genetic manipulation, rapid growth rate, wide substrate availability, well-established large-scale fermentation conditions, and natural mevalonate (mevalonate, MVA) is considered a powerful host for the industrial production of vitamins based on its ideal properties such as mechanism. However, despite these various advantages for retinoid production, the preferential transfer of carbon to ethanol in Saccharomyces cerevisiae remains a problem to be solved. In addition, there is a report that the elimination of the ethanol biosynthetic pathway is unfavorable in terms of cell growth and productivity, and thus an alternative to overcome the crabtree effect is required. Undesirable metabolism due to glucose-dependent inhibition of respiratory metabolism when genetically engineered Saccharomyces cerevisiae is grown using non-native sugar, xylose, as the sole carbon source No control was seen. Moreover, xylose is a component of lignocellulosic biomass that enables feasible and sustained bioconversion of value-added compounds such as carotenoids and other isoprenoids, as well as non-edible It is the second most abundant sugar in nature, derived from sources.

In addition, the genetically engineered Saccharomyces cerevisiae produced β-carotene in high yield through fed-batch fermentation using xylose-rich hydrolysate derived from sorghum, which is a bioenergy. It has been reported to produce In addition, a heterologous Blh gene encoding BCMO (β-carotene 15, 15-monooxygenase) was further introduced into Saccharomyces cerevisiae strains producing β-carotene to transform β-carotene into retinal. The obtained strain showed high retinal production rate and yield from xylose. The strain did not produce pure vitamin A, but produced a mixture of retinal and retinol even though the mechanism involved in retinoid metabolism was not directly manipulated. In addition, Korean Patent Registration No. 10-1724992 discloses a saccharide that can mass-produce retinoids safely and with excellent efficiency by transforming a gene encoding hydroxymethylglutaryl (HMG)-CoA reductase among the enzymes of the MVA pathway. Microorganisms of the genus Myces are disclosed.

Despite intensive genetic modification of microorganisms, most of the produced fat-soluble molecules, including retinoids, were not transported to a water-containing medium and accumulated inside the cells. As a result, microbial production of fat-soluble molecules has markedly lower productivity and yield compared to chemical synthesis. To overcome these limitations, synthetic or natural oils such as emollients, emulsifiers, thickeners, lubricants, release agents, antifoaming agents and humectants are widely used in the cosmetic and pharmaceutical industries to improve the extraction process. Another reason why microbial production is not applied to the production of retinol instead of chemical synthesis is that the retinoid production method using microorganisms is extremely unstable. Specifically, retinol has isoprenoid side chains that contain conjugated double bonds that are chemically unstable and can undergo degradation reactions resulting in partial or total loss of activity.

In addition, various approaches using liposomes, solid water-insoluble organic polymers, and multiple emulsions have been used to enhance the chemical stabilization mechanism of vitamin A derivatives. In particular, the use of antioxidants such as BHT, BHA, and vitamin E is considered an effective and easy method for preventing decomposition by lipid peroxide as well as thermal isomerization.

Republic of Korea Patent No. 10-1724992

An object of the present invention is to provide a recombinant yeast into which a gene encoding retinol dehydrogenase is introduced and a method for producing the same.

Another object of the present invention is to provide a method for producing retinol using the recombinant yeast, retinol produced by the method, and a composition containing the retinol.

In order to achieve the above object, the present invention provides recombinant yeast into which the RDH12 gene encoding retinol dehydrogenase is introduced.

In addition, the present invention provides a retinol production method comprising culturing the recombinant yeast in a culture medium.

In addition, the present invention provides retinol produced by the production method and a composition containing the retinol.

Furthermore, the present invention provides a method for preparing recombinant yeast with enhanced retinol-producing ability, which includes introducing the RDH12 gene encoding retinol dehydrogenase.

The recombinant yeast according to the present invention is introduced with the RDH12 gene to produce retinol in a higher yield than recombinant yeast in which a gene encoding another retinol dehydrogenase is introduced, while minimizing the production of retinal, a precursor, and the recombinant When the noxE gene is additionally introduced into yeast, the production of glycerol as a by-product is suppressed to a minimum and this effect is further significantly enhanced, so that the recombinant yeast can be usefully used for mass production of retinol.

1 is a diagram schematically showing a pathway in which a genetically engineered Saccharomyces cerevisiae strain produces retinol using xylose in a medium containing a lipophilic material.
Figure 2 is a graph showing the results of retinol and retinal production of Saccharomyces cerevisiae strains into which RDH12 , RDH10 or ybbO genes were introduced in one embodiment of the present invention.
Figure 3 shows the content of retinol (A) and the RDH12 gene produced by culturing the Saccharomyces cerevisiae strain into which the RDH12 gene was introduced in an embodiment of the present invention in a culture medium containing dodecane, soybean oil or olive oil. It is a graph as a result of confirming the content (B) of retinol concentrated in a lipophilic solvent while culturing the introduced Saccharomyces cerevisiae strain.
4 is a batch fermentation profile in the case of culturing a Saccharomyces cerevisiae strain into which the RDH12 gene has been introduced in an embodiment of the present invention in a medium containing xylose (A) or glucose (B) as a carbon source. ) is the result of checking the graph.
Figure 5 shows the degree of oxidation and degradation of retinol produced from Saccharomyces cerevisiae strain into which the RDH12 gene was introduced according to temperature, BHT addition (A), or light (B) conditions in one embodiment of the present invention. This is the result graph.
6 is a fed - batch fermentation profile (A) and produced retinol and retinal contents (B ) is the result of checking the graph.
7 is a graph showing the results of retinol and glycerol production of Saccharomyces cerevisiae strains into which RDH12 and noxE genes were introduced in an embodiment of the present invention.
8 is a graph comparing the NADH oxidase activity of Saccharomyces cerevisiae strains into which RDH12 and noxE genes have been introduced with those of Saccharomyces cerevisiae strains into which only RDH12 genes have been introduced in one embodiment of the present invention. .
9 is a fed-batch fermentation profile (A) and produced retinol and retinal contents when a Saccharomyces cerevisiae strain into which RDH12 and noxE genes are introduced is cultured in a 3 ℓ bioreactor in an embodiment of the present invention. This is the result of checking (B).

Hereinafter, the present invention will be described in detail.

The present invention provides recombinant yeast into which the RDH12 gene encoding retinol dehydrogenase is introduced.

As used herein, the term "retinol dehydrogenase" refers to an enzyme that catalyzes a chemical reaction represented by Formula 1 below:

[Formula 1]

Retinol dehydrogenase is an enzyme belonging to the oxidoreductase family, and specifically acts on the CH-OH group of a donor using NAD+ or NADP+ as an acceptor. The retinol dehydrogenase is also known as retinol (vitamin A1) dehydrogenase, MDR, microsomal retinol dehydrogenase, retinal reductase, retinene reductase, and the like. The enzyme is involved in retinol metabolism, and specifically, promotes a major oxidation-reduction reaction in the visual cycle of converting vitamin A to 11-cis retinal.

The retinol dehydrogenase may include all types of retinol dehydrogenase known in the art. Specifically, the retinol dehydrogenase may be of mammalian origin, and more specifically, of human origin. In addition, the retinol dehydrogenase may include any amino acid sequence known as retinol dehydrogenase in the art. For example, the retinol dehydrogenase may be a polypeptide composed of the amino acid sequence shown in SEQ ID NO: 2 or a polynucleotide encoding the same.

The retinol dehydrogenase may be obtained by adding, deleting, or replacing one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2 as long as it maintains the same or corresponding biological activity. At this time, the amino acid substitution may be a conservative substitution performed within a range that does not affect or weakens the charge of the entire protein, that is, polarity or hydrophobicity. In addition, the retinol dehydrogenase may have a homology of at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% to the amino acid sequence of SEQ ID NO: 2.

In addition, the polynucleotide encoding the retinol dehydrogenase may be the RDH12 gene. For example, the RDH12 gene may be a polynucleotide composed of the nucleotide sequence shown in SEQ ID NO: 1. The polynucleotide may have one or more bases added, deleted or substituted in the nucleotide sequence shown in SEQ ID NO: 1 as long as the activity of the retinol dehydrogenase encoded therein is maintained. In addition, the polynucleotide may have a homology of at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% to the nucleotide sequence of SEQ ID NO: 1.

The recombinant yeast may include all types of yeast known in the art to be used for producing retinol. Specifically, the yeast is Saccharomyces cerevisiae ( Saccharomyces cerevisiae ), Rhodosporidium toruloides ( Rhodosporidium toruloides ) or Yarrowia lipolytica ( Yarrowia lipolytica ), and in one embodiment of the present invention, the yeast may be Saccharomyces cerevisiae.

Meanwhile, the Saccharomyces cerevisiae may have additional genetic modifications in addition to the introduction of the RDH12 gene. The additional genetic modification may include any one that can enhance retinol production. As an example, the Saccharomyces cerevisiae may have a β-carotene biosynthetic pathway introduced, and more specifically, a β-carotene 15, 15-monooxygenase (BCMO) gene.

In addition, the recombinant yeast may have the RDH12 gene introduced into the chromosome. In this case, the RDH12 gene may be introduced into any chromosomal position as long as it can enhance retinol production, but in one embodiment of the present invention, the RDH12 gene can be introduced into yeast chromosome XV position.

Introduction of the gene may be performed by any method known in the art. The introduction may be performed by appropriately selecting a known transformation method by a person skilled in the art, and the introduced gene may be expressed in the host cell to produce a target protein, thereby increasing its activity. In one embodiment of the present invention, the introduction may be performed using gene editing technology. In another aspect of the present invention, the introduction may be performed by introducing a polynucleotide encoding a target protein in the form of a plasmid. In this case, the introduced polynucleotide may be codon-optimized. In another aspect of the present invention, the polynucleotide to be introduced may include any sequence modified to increase its expression. Specifically, it may be a variant of a nucleotide sequence obtained by applying methods such as deletion, insertion, and substitution to the polynucleotide sequence alone or in combination so as to enhance the activity of a target protein encoded in the polynucleotide.

The RDH12 gene can be introduced into yeast as a host using a vector known in the art. The vector may have the form of an expression cassette, which is a gene construct including all elements necessary for the RDH12 gene to be expressed by itself. Specifically, the expression cassette may include a promoter, an operator, a ribosome binding site, a terminator, and the like. For example, the vector may include all plasmids, cosmids, viral vectors, bacteriophages, and the like. The promoter may be located at the top of the RDH12 gene, and specifically, the promoter may include all promoters that induce strong expression in yeast.

Recombinant yeast into which the RDH12 gene has been introduced can be selected using a selection marker. Selectable markers are for selecting cells into which a target gene is inserted, and markers conferring selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface protein expression may be used.

The recombinant yeast may further introduce a gene encoding NADH oxidase. As used herein, the term "NADH oxidase (NADH oxidase)" refers to a membrane-bound enzyme complex located in the extracellular space, and is a phagosome used by neutrophils among white blood cells to engulf microorganisms. ), as well as the plasma membrane. Human isoforms of the catalytic component of the complex may include NOX1 , NOX2 , NOX3 , NOX4 , NOX5 , DUOX1 and DUOX2 . NADPH oxidase can catalyze the production of superoxide free radicals by transferring one electron from NADPH to oxygen. During this process, oxygen can move from the extracellular space into the cell, and hydrogen ions can be released from the cell.

Specifically, the NADH oxidase may include all types of NADH oxidase known in the art, and specifically, the NADH oxidase may be derived from Lactococcus lactis . In addition, the NADH oxidase may include any sequence known in the art. For example, the NADH oxidase may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14 or a polynucleotide encoding the same.

As long as the NADH oxidase maintains the same or corresponding biological activity, one or more amino acids may be added, deleted, or substituted in the amino acid sequence shown in SEQ ID NO: 14. At this time, the amino acid substitution may be a conservative substitution performed within a range that does not affect or weakens the charge of the entire protein, that is, polarity or hydrophobicity. In addition, the NADH oxidase may have a homology of at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% to the amino acid sequence of SEQ ID NO: 14.

In addition, the polynucleotide encoding the NADH oxidase may be a noxE gene. For example, the noxE gene may be a polynucleotide composed of the nucleotide sequence shown in SEQ ID NO: 13. The polynucleotide may have one or more bases added, deleted or substituted in the nucleotide sequence shown in SEQ ID NO: 13 as long as the activity of the NADH oxidase encoded therein is maintained. In addition, the polynucleotide may have a homology of at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% to the nucleotide sequence of SEQ ID NO: 13.

The recombinant yeast according to the present invention may have improved retinol-producing ability and reduced retinal-producing ability. That is, the recombinant yeast according to the present invention can be usefully used for mass production of retinol. The term "retinol" is a type of vitamin A, and it is known that it plays an important role in maintaining the original function of epidermal cells of the skin, is present in the intestinal mucosal cells of animals, and is contained in a large amount in greenish-yellow plants. Retinol promotes the differentiation of skin cells and promotes the biosynthesis of collagen and elastin to reduce wrinkles and improve skin elasticity, so it is mainly used as a raw material for cosmetics. However, retinol is mainly produced through a chemical reaction after extracting a precursor from natural plant resources, and the product produced in this way has a disadvantage in that the unit price of the retinol produced is high due to low purity and yield.

In addition, the present invention provides a retinol production method comprising culturing the recombinant yeast in a culture medium.

The recombinant yeast used in the retinol production method according to the present invention may have the above-described characteristics. For example, the recombinant yeast may be introduced with the RDH12 gene encoding retinol dehydrogenase. The retinol dehydrogenase may be a human-derived polypeptide composed of the amino acid sequence shown in SEQ ID NO: 2. In addition, the recombinant yeast may be further introduced with a gene encoding NADH oxidase. In this case, the NADH oxidase may be a polypeptide derived from Lactococcus lactis and composed of the amino acid sequence shown in SEQ ID NO: 14.

The culturing may be performed according to a method known in the art, and at this time, it may be appropriately modified and performed by a person skilled in the art. For example, the culturing method may include batch, continuous, and fed-batch culture. Specifically, the culturing may be performed under an appropriate culture medium and conditions known to be capable of culturing yeast.

The culture medium may contain an appropriate amount of a carbon source, a nitrogen source, vitamins and minerals suitable for culturing yeast. Specifically, the carbon source may include at least one selected from the group consisting of starch, glucose, sucrose, galactose, fructose, xylose, and glycerol. In one embodiment of the present invention, the carbon source may be xylose. Meanwhile, the nitrogen source may include at least one selected from the group consisting of ammonium sulfate, ammonium nitrate, sodium nitrate, glutamic acid, casamino acid, Saccharomyces extract, peptone, tryptone, and soybean meal. In addition, the vitamin may be any one or more selected from the group consisting of vitamin B, vitamin C, vitamin D and vitamin E. Furthermore, the mineral may be at least one selected from the group consisting of sodium chloride, potassium diphosphate, and magnesium sulfate.

Yeast inoculated into the culture medium can be cultured under aerobic conditions by appropriately adjusting temperature and pH. The aerobic condition may be maintained by injecting oxygen or a gas containing oxygen into the incubator. Meanwhile, in order to maintain an anaerobic and microaerobic state, gas may not be injected or nitrogen, hydrogen, or carbon dioxide gas may be injected. During cultivation, the amount of aeration may be 1 to 5 vvm. On the other hand, the culture may be carried out at a temperature typically used for culturing yeast. For example, the culturing may be performed at a temperature of 20 to 45 °C, 20 to 40 °C, 25 to 45 °C or 25 to 40 °C.

In addition, the recombinant yeast may be cultured while stirring. The stirring may be performed under appropriate conditions known in the art. For example, the incubator may be stirred under conditions of 50 to 400 rpm, 100 to 400 rpm, 150 to 400 rpm, 50 to 350 rpm, 100 to 350 rpm or 150 to 350 rpm.

The culture medium used in the retinol production method according to the present invention may further contain a lipophilic substance. When cultured in a culture medium containing a lipophilic material, the recombinant yeast may be located on a layer of a lipophilic material. In general, when retinol is produced using microorganisms, the yield of retinol produced peaks at a certain point in time and gradually decreases thereafter. because it happens However, when the recombinant yeast is cultured in a culture medium containing a lipophilic substance, the produced retinol is absorbed into the lipophilic substance before being degraded in the cells, thereby improving production efficiency.

That is, any lipophilic material may be used as long as it does not affect the growth of yeast while maintaining the function as described above. For example, the lipophilic material may include octane, decane, dodecane, tetrathecan, phytosqualane, mineral oil, isopropyl myristate, cetylethylhexanoate, dioctanoyldecanoylglycerol, soybean oil, squalane, olive oil, and the like. can include The lipophilic substances may be used alone or in combination.

The retinol production method according to the present invention may further include separating retinol from the culture medium in which the recombinant yeast is cultured. The retinol may be separated by a method known in the art. For example, the separation may include methods such as centrifugation, filtration, crystallization, ion exchange chromatography, and high performance liquid chromatography (HPLC). On the other hand, when the culture medium contains a lipophilic substance, the produced retinol may be included in the lipophilic substance.

In addition, the separated retinol may be additionally separated and purified by an appropriate method by a person skilled in the art to increase its purity.

In addition, the present invention provides retinol produced by the production method and a composition containing the retinol.

Retinol produced by the production method according to the present invention may have characteristics as described above. For example, the retinol may be produced from recombinant yeast into which the RDH12 gene encoding retinol dehydrogenase is introduced. Specifically, the retinol dehydrogenase may be a human-derived polypeptide composed of the amino acid sequence shown in SEQ ID NO: 2. In addition, the recombinant yeast may be further introduced with a gene encoding NADH oxidase. In this case, the NADH oxidase may be a polypeptide derived from Lactococcus lactis and composed of the amino acid sequence shown in SEQ ID NO: 14.

The composition according to the present invention may include all fields to which the activity of retinol can be applied. For example, the composition may include a pharmaceutical composition, a cosmetic composition, a food composition, an external preparation for skin, and the like.

The pharmaceutical composition may be in the form of granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable liquids and sustained-release formulations of active compounds. The pharmaceutical composition may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically applied) depending on the desired method, and the dosage is the condition and weight of the patient, the severity of the disease, Depending on the drug form, administration route and time, it can be appropriately selected by those skilled in the art.

The food composition is meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, ice cream, dairy products including yogurt and lactic acid bacteria, various soups, beverages, tea, drinks, alcohol It may include beverages or health functional foods.

In addition, the cosmetic composition is skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrient lotion, massage cream, nutrient cream, moisture cream, hand cream, essence, nutrient essence, pack, soap, shampoo , cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, lipstick, makeup base, foundation, press powder, loose powder or eye shadow. The cosmetic composition may include conventional ingredients such as aqueous vitamins, oil-based vitamins, polymeric peptides, polymeric polysaccharides, and sphingolipids, and may be easily prepared according to techniques well known to those skilled in the art. In addition, in the composition of each formulation, other ingredients other than retinol according to the present invention as skin improving raw materials may be appropriately selected and blended without difficulty by those skilled in the art according to the formulation or purpose of use of the cosmetic. For example, antioxidants, sunscreens, stratum corneum exfoliants, surfactants, fragrances, pigments, preservatives, pH adjusters, chelating agents, stabilizers, solubilizers, vitamins, pigments and flavors, and conventional adjuvants such as flavoring agents, and carriers may be included. can

Furthermore, the present invention provides a method for preparing recombinant yeast with enhanced retinol-producing ability, which includes introducing the RDH12 gene encoding retinol dehydrogenase.

In the method for producing recombinant yeast with enhanced retinol-producing ability according to the present invention, recombinant yeast can be prepared by introducing the RDH12 gene encoding retinol dehydrogenase into yeast. At this time, the introduction may have the characteristics as described above. Meanwhile, the yeast may include all types of yeast known in the art to be used for producing retinol. Specifically, the yeast may be Saccharomyces cerevisiae, Rhodosporidium toruloides or Yarrowia lipolytica, and in one embodiment of the present invention, the yeast may be Saccharomyces cerevisiae .

The yeast produced by the production method according to the present invention may have an enhanced retinol-producing ability and at the same time suppress the intracellular residual amount of retinal, a precursor.

Hereinafter, the present invention will be described in detail by the following examples, however, the following examples are only for illustrating the present invention, and the present invention is not limited thereto. Anything that has substantially the same configuration and achieves the same effect as the technical concept described in the claims of the present invention is included in the technical scope of the present invention.

Example One. RDH12 gene was introduced Saccharomyces Celebrity Preparation of strains

A genetically engineered Saccharomyces cerevisiae strain producing retinol with high productivity and yield into which the RDH12 gene was introduced was prepared using CRISPR/Cas9 gene editing technology.

First, the Cas9-NAT plasmid (Addgene, 109 # 64329 ) was transformed into the SR8A Saccharomyces cerevisiae strain (Sun et al. , 2019) was transduced. Specifically, the human-derived RDH12 gene (SEQ ID NO: 1) was synthesized using IDT service (Integrated DNA Technologies, USA) after codon optimization. The synthesized RDH12 gene was amplified using primers of SEQ ID NOs: 5 and 6 shown in Table 1 below to use as a donor DNA fragment. The amplified DNA fragment was cloned into a Cas9-NAT plasmid, and at this time, an expression cassette was constructed so that the yeast strong promoter TEF1 and terminator CYC1 were included together. The recombinant plasmid prepared above was saccharomyces with pRS42H-CS5 (Biotechnol. Bioeng., 2017; 114: 2581-2591) plasmid encoding a guide RNA targeting chromosome XV of Saccharomyces cerevisiae strain as an insertion site. Myces cerevisiae strain was co-transformed (co-transformation). The transformed strain was cultured using YPDNG solid medium containing 120 μg/ml NAT (nourseothricin) and 300 μg/ml G418, and positive colonies were formed using primers of SEQ ID NOs: 7 and 8 shown in Table 1 below. It was confirmed by performing PCR.

primer Sequence (5'→3') sequence number F_donor_RDH AATGCAAAATATTCGTCCACATTCTTTTATCTATTGTCTTCATAGCTTCAAAATG SEQ ID NO: 5 R_donor_RDH TTCATTAATTAGTCTACTCGACTAGATGAAATAGCTTTTTGCAAATTAAAGCCTTCGAG SEQ ID NO: 6 F_check_CS5 AATGCAAAATATTCGTCCACATTCT SEQ ID NO: 7 R_check_CS5 TTCATTAATTAGTCTACTCGACTAGATG SEQ ID NO: 8

As a result, the Saccharomyces cerevisiae strain into which the RDH12 gene was introduced was named SR8AR strain.

Example 2. RDH10 gene was introduced Saccharomyces Celebrity Preparation of strains

A Saccharomyces cerevisiae strain into which the RDH10 gene was introduced was prepared under the same conditions and methods as in Example 1, except that the RDH10 gene (SEQ ID NO: 3) was used instead of the RDH12 gene.

Example 3. ybbO gene was introduced Saccharomyces Celebrity Preparation of strains

A Saccharomyces cerevisiae strain into which the ybbO gene was introduced was prepared under the same conditions and methods as in Example 1, except that the ybbO gene (SEQ ID NO: 4) was used instead of the RDH12 gene.

Example 4. noxE added gene Saccharomyces Celebrity Preparation of strains

A noxE gene encoding NADH oxidase was additionally introduced into the gene of the SR8AR strain prepared above.

First, the noxE gene was amplified by performing PCR using primers of SEQ ID NOs: 9 and 10 shown in Table 2 below. The amplified noxE gene was cloned into a plasmid having the TDH3 promoter and the CYC1 terminator as described above, and transformed into chromosome VI of the SR8AR strain prepared in Example 1. The transformed strain was cultured using YPDNH solid medium containing 120 μg/ml NAT (nourseothricin) and 300 μg/ml hygromycin, and the positive colonies were SEQ ID NOs: 11 and 11 described in Table 2 below. It was confirmed by performing PCR using 12 primers.

primer Sequence (5'→3') sequence number F_donor_noxE TTTCCCTTTGTGAGTTCTCATAACCTCGAGGAGAAGTTTTTTTACCCCTCTCCACAGATCTCATTATCAATACTCGCCAT SEQ ID NO: 9 R_donor_noxE ACTAGTGCGCCAAGAGAGTAATTAGGTAGACCGGGTAGATTTTTCCGTAACCTTGGTGTCGCAAATTAAAGCCTTC SEQ ID NO: 10 F_check_CS6 TTTCCCTTTGTGAGTTCTCATAACCTCGAG SEQ ID NO: 11 R_check_CS6 TCTACCTAATTACTCTCTTGGCGCACTAGT SEQ ID NO: 12

As a result, the Saccharomyces cerevisiae strain into which the noxE gene was additionally introduced was named the SR8ARN strain.

Experimental example One. retinoid production confirmation

Retinol and retinal can be interconverted by retinol dehydrogenase (RDH) in a genetically engineered Saccharomyces cerevisiae strain capable of producing vitamin A from β-carotene. Accordingly, retinoid productivity and yield were confirmed using the strains prepared in Examples 1 to 3 using a conventionally known method (Liang Sun et al. , ACS Synth. Biol., 2019, 8:2131-2140). As a result, the concentrations of retinoids produced by the strains of Examples 1 to 3 are shown in FIG. 2 .

As shown in FIG. 2, only retinol without retinal was significantly increased to a concentration of 100.7±5.05 mg/L only in flask culture using the strain prepared in Example 1. On the other hand, the strains prepared in Examples 2 and 3 produced 19.98 ± 0.63 mg / L and 29.27 ± 0.35 mg / L of retinol, respectively, and at the same time, significant amounts of 48.88 ± 7.89 mg / L and 58.95 ± 2.28 mg / L to produce retinal. Overall, the productivity of retinol and retinal was generally increased in the strains of Examples 1 to 3 compared to the SR8A strain, which is a control group in which the RDH gene was not introduced, but in particular, the strain of Example 1 into which the RDH12 gene was introduced efficiently It was found that the day was converted to retinol.

Experimental example 2. lipophilicity containing substances xylose Confirmation of retinol production through fermentation

Retinol productivity and yield were confirmed when the prepared SR8AR strain was cultured using a culture medium containing dodecane, soybean oil or olive oil as a lipophilic material.

First, the SR8AR strain prepared in Example 1 was cultured at 30 ° C., 300 rpm and dark conditions using Verduyn medium containing dodecane, soybean oil or olive oil. Thereafter, the produced retinol was confirmed by the method described in Experimental Example 1, and the results are shown in FIG. 3A. At this time, as a control, the content of intracellular β-carotene was measured.

As shown in Figure 3A, the SR8AR strain prepared in Example 1 produced 101.99 mg/L of retinol when using a medium containing dodecane, and 29.43 when cultured in a medium containing soybean oil or olive oil, respectively. Retinol was produced at mg/L and 33.47 mg/L. On the other hand, the contents of retinol and β-carotene accumulated in cells were similar regardless of the addition of lipophilic substances. In addition, xylose consumption rate and growth rate, which are indicators of fermentation, also did not show significant changes by the addition of lipophilic substances during cultivation.

Experimental example 3. lipophilicity Confirmation of accumulation in the material

In order to confirm whether the produced retinol is accumulated in the lipophilic material layer, the content of retinol present in the lipophilic material layer was confirmed.

Specifically, after culturing the strain in a medium containing dodecane in Experimental Example 2, the dodecane layer was recovered from the fermentation product in the first flask. The recovered dodecane layer was added to the second flask fermentation and cultured. After culturing, the dodecane layer was recovered again, added to the third flask fermentation, and cultured again. At this time, the dodecane layer was obtained as a sample in the first, second and third fermentation processes, and the produced retinol was confirmed by the method described in Experimental Example 1, and the results are shown in FIG. 3B.

As shown in FIG. 3B, it was confirmed that retinol was accumulated in the dodecane layer despite repeated use. From this, it was found that dodecane is excellent in concentration as well as production of retinol.

Experimental example 4. to the carbon source Check the productivity of retinol according to

In order to confirm the productivity of retinol according to carbon sources including xylose and glucose, after culturing the strain by adding xylose or glucose to the culture medium, the retinol content was measured. Specifically, after culturing the strain of Example 1, the results of measuring the content of retinol by the method described in Experimental Example 1 are shown in FIG. 4 .

As shown in Figure 4A, the SR8AR strain of Example 1 consumed xylose slower than glucose while producing less ethanol of 1.38 g/L, but exhibited higher cell density and greater accumulation of the by-product glycerol. On the other hand, as shown in FIG. 4B, glucose was consumed to produce 16.99 g/L of ethanol that can be consumed as a carbon source even under completely aerobic conditions within 20 hours. Accordingly, it was found from the above that the SR8AR strain showed higher retinol productivity when xylose was added as a carbon source than when glucose was added.

Experimental example 5. Check the storage conditions of retinol

It is well known that retinol is sensitively decomposed by light, oxygen, and temperature. After storing retinol under various conditions, the storage conditions of retinol were confirmed by measuring the content of retinol. The experiment was performed using a conventionally known method (Liang Sun et al. , ACS Synth. Biol., 2019, 8:2131-2140), and as a result, the measured retinol content is shown in FIG. 5 .

As shown in FIG. 5A, retinol was rapidly decomposed when stored in a cryogenic freezer (-20° C.) for more than 5 days, and when BTH was not added, retinol decreased to 34.2% when stored at room temperature for more than 2 weeks. On the other hand, when BTH was added, only 7.5% decreased even when stored for more than 2 weeks at room temperature. However, when retinol was refrigerated, the degree of decomposition was significantly reduced compared to when retinol was stored at a different temperature even under the condition that BTH was not added.

In addition, as shown in FIG. 5B, the content of retinol was slightly higher when stored under dark conditions compared to general light conditions.

Experimental example 6. Mass Fermentation - (1)

Large-scale fed-batch fermentation was performed in a 3 ℓ bioreactor using the prepared SR8AR strain.

Specifically, the SR8AR strain of Example 1 was pre-cultured to an appropriate cell density by culturing at 30° C. and 300 rpm using Verdun medium containing xylose. The pre-cultured cells were seeded to an initial density of 10 at OD ₆₀₀ in a 3 L bioreactor (New Brunswick 152 Scientific-Eppendorf, Enfield, CT) containing 600 ml of Verdun medium containing xylose. Initially, 80 g/L of xylose was added as a carbon source, and when the added xylose was consumed, the same amount of xylose was added to the medium again. From the third time, 55±5 g/ℓ of xylose was added, and xylose was supplied a total of 5 times. The pH was titrated to 5.8 using 4M NaOH and HCl, and an agitation speed of 700 to 800 rpm and oxygen supply of 2 to 3 vvm were maintained. Samples were taken during fed-batch culture and the contents of xylose, ethanol, glycerol and acetate were measured in a conventional manner, and the results are shown in FIG. 6 .

As shown in FIG. 6, a total of 379 g/L of xylose was consumed, and even though a high concentration of xylose was supplied to the culture medium, only small amounts of ethanol and acetate were accumulated. In addition, acetate was used as a carbon source when xylose was depleted. Meanwhile, 2,156 mg/L of retinol was produced at a production rate of 9.54 mg/L·h and a yield of 5.69 mg/g, and only 23 mg/L of retinal was accumulated. In addition, a large amount of glycerol (40.4 g/L) was produced at the end of the fermentation, and during the fermentation, the cells grew to an OD ₆₀₀ of 92.60.

Experimental example 7. noxE Confirmation of retinol production in strains in which the gene was additionally introduced

Productivity and yield of retinoid were confirmed using the SR8ARN strain prepared in Experimental Example 4. Experiments were performed as described above using a medium containing xylose and dodecane, except that the SR8ARN strain was used, and the results are shown in FIG. 7 .

As shown in FIG. 7 , compared to the parent strain SR8AR strain, retinol production significantly increased in the SR8ARN strain while glycerol production decreased. Accordingly, it can be seen from the above results that the retinol-producing ability was significantly increased and the accumulation of glycerol was decreased in the Saccharomyces cerevisiae strain into which both the RDH12 and noxE genes were introduced.

Experimental example 8. NADH Confirmation of oxidase activity

In order to measure the oxidase activity of the SR8ARN strain prepared in Experimental Example 4, the strain was cultured in YP medium containing xylose and harvested in the mid-exponential phase when the cells grew to 1×10 ⁹ . The harvested cells were washed twice with distilled water and lysed by adding yeast protein extraction reagent (Thermo Scientific, USA) containing protease (Roche, Switzerland). The lysed cells were centrifuged at 13,000 rpm and 4°C for 10 minutes, and the supernatant was obtained. A reaction buffer (50 mM potassium phosphate (pH 7.0), 0.4 mM NADH and 0.3 mM EDTA) was added to the obtained supernatant, and absorbance was measured at a wavelength of 340 nm for 10 minutes. As a result, the activity of 1 unit of the enzyme was calculated as the amount of enzyme required to oxidize 1 μmol of NADH, and is shown in FIG. 8 .

As shown in FIG. 8, the activity of NADH oxidase was significantly higher in the SR8ARN strain compared to the parent strain SR8AR strain.

Experimental example 9. Mass Fermentation - (2)

Mass fermentation was performed in the same manner and conditions as in Experimental Example 6 using the SR8ARN strain prepared in Experimental Example 4. During fermentation, oxygen was additionally supplied as a substrate for the BCMO gene that converts β-carotene to retinal, and oxygen was also consumed by NADH oxidase. Samples were taken during fed-batch culture, and the contents of xylose, ethanol, glycerol, and acetate were measured by conventional methods, and the results are shown in FIG. 9 . In addition, the fermentation results performed using the SR8AR strain and the fermentation result performed using the SR8ARN strain in Experimental Example 6 are summarized in Table 3 below.

SR8AR (Example 1) SR8ARN (Example 4) Xylose consumption (g/ℓ) 379 495 Retinol content (mg/ℓ) 2,156 3,368 Glycerol accumulation (g/L) 40.4 28.7 Retinol productivity (mg/ℓㆍhr) 9.54 15.89 Retinol yield (mg retinol/g xylose) 5.69 6.80 Glycerol yield (g glycerol/g xylose) 0.107 0.058

As shown in FIG. 9, during the fermentation process, the SR8ARN strain produced 3,368 mg/L of retinol from 495 g/L of xylose, while showing a reduced glycerol accumulation to 28.7 g/L. At this time, acetate was reduced more than the amount produced in the previously performed fed-batch culture by performing the mother strain, and xylose consumption and cell growth were maintained until the end of fermentation without any other delay. The final cell density was 115.2 at OD ₆₀₀ , and xylose was fed 7 times. Therefore, it was confirmed from the above that the retinol productivity of the SR8ARN strain was 15.89 mg/L·hr and the yield was 6.80 mg/g xylose. On the other hand, the yield of glycerol decreased rapidly to 0.058 g/g xylose, which was 46% lower than that of the parent strain.

From this, it was found that the Saccharomyces cerevisiae strain into which the RDH12 and noxE genes were introduced can be usefully used for mass production of retinol by producing retinol in high yield without by-products.

<110> Solus Advanced Materials co., Ltd. THE BOARD OF TRUSTEES OF THE UNIVERSITY OF ILLINOIS <120> RECOMBINANT YEAST INTRODUCED WITH A GENE ENCODING RETINOL DEHYDROGENASE AND MANUFACTURING METHOD THE SAME <130> DP210215 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 1026 <212> DNA <213> artificial sequence <220> <223> RDH12 <400> 1 atgaatattg tagtggagtt tttcgtcgtg acttttaaag tgttatgggc ttttgtactg 60 gcagcggcca gatggctggt gaggcctaaa gaaaaatctg tcgcggggaca agtgtgcctg 120 attacgggag cggggagtgg tctaggggagg ttattcgcct tggaatttgc ccgtaggcgt 180 gcccttttag ttctgtggga tataaacact cagtctaatg aggagacagc cggcatggta 240 cgtcacatat atagagacct tgaggcggcg gacgcagcag ccttacaggc cggtaatggt 300 gaagaagaga tccttccaca ttgcaacttg caggtgttta cgtatacttg cgatgttggt 360 aaaagagaga acgtctatct taccgcagag cgtgtcagga aagaagtagg ggaggtcagc 420 gtcctggtca acaatgcggg tgtagtatca ggccaccatc tgttggaatg ccccgacgag 480 ctaatagaaa ggacaatgat ggtgaactgc catgctcact tttggactac gaaggccttc 540 ctgccaacga tgttagaaat aaatcatggg cacattgtca ccgtagcttc cagccttgga 600 ttatttagca ctgctggcgt agaggattac tgtgcttcta agttcggagt cgtcggattt 660 cacgaatccc tgagtcacga gttaaaggcc gccgaaaagg atggaataaa aacgacgctt 720 gtatgtccat atcttgtaga tacagggatg ttcagaggct gcaggattcg taaggaaata 780 gagccttttc tacctccatt gaagcccgat tattgcgtca agcaagcaat gaaagctatt 840 ctaacagatc aaccaatgat atgtacgcca cgtttaatgt acatcgttac tttcatgaaa 900 tccatacttc cgtttgaagc ggtggtctgt atgtaccgtt ttctgggagc tgacaagtgt 960 atgtacccat tcatagcgca acgtaagcaa gcaactaata acaatgaagc gaaaaatggg 1020 atttaa 1026 <210> 2 <211> 316 <212> PRT <213> artificial sequence <220> <223> RDH12 <400> 2 Met Leu Val Thr Leu Gly Leu Leu Thr Ser Phe Phe Ser Phe Leu Tyr 1 5 10 15 Met Val Ala Pro Ser Ile Arg Lys Phe Phe Ala Gly Gly Val Cys Arg 20 25 30 Thr Asn Val Gln Leu Pro Gly Lys Val Val Val Ile Thr Gly Ala Asn 35 40 45 Thr Gly Ile Gly Lys Glu Thr Ala Arg Glu Leu Ala Ser Arg Gly Ala 50 55 60 Arg Val Tyr Ile Ala Cys Arg Asp Val Leu Lys Gly Glu Ser Ala Ala 65 70 75 80 Ser Glu Ile Arg Val Asp Thr Lys Asn Ser Gln Val Leu Val Arg Lys 85 90 95 Leu Asp Leu Ser Asp Thr Lys Ser Ile Arg Ala Phe Ala Glu Gly Phe 100 105 110 Leu Ala Glu Glu Lys Gln Leu His Ile Leu Ile Asn Asn Ala Gly Val 115 120 125 Met Met Cys Pro Tyr Ser Lys Thr Ala Asp Gly Phe Glu Thr His Leu 130 135 140 Gly Val Asn His Leu Gly His Phe Leu Leu Thr Tyr Leu Leu Leu Glu 145 150 155 160 Arg Leu Lys Val Ser Ala Pro Ala Arg Val Val Asn Val Ser Ser Val 165 170 175 Ala His His Ile Gly Lys Ile Pro Phe His Asp Leu Gln Ser Glu Lys 180 185 190 Arg Tyr Ser Arg Gly Phe Ala Tyr Cys His Ser Lys Leu Ala Asn Val 195 200 205 Leu Phe Thr Arg Glu Leu Ala Lys Arg Leu Gln Gly Thr Gly Val Thr 210 215 220 Thr Tyr Ala Val His Pro Gly Val Val Arg Ser Glu Leu Val Arg His 225 230 235 240 Ser Ser Leu Leu Cys Leu Leu Trp Arg Leu Phe Ser Pro Phe Val Lys 245 250 255 Thr Ala Arg Glu Gly Ala Gln Thr Ser Leu His Cys Ala Leu Ala Glu 260 265 270 Gly Leu Glu Pro Leu Ser Gly Lys Tyr Phe Ser Asp Cys Lys Arg Thr 275 280 285 Trp Val Ser Pro Arg Ala Arg Asn Asn Lys Thr Ala Glu Arg Leu Trp 290 295 300 Asn Val Ser Cys Glu Leu Leu Gly Ile Arg Trp Glu 305 310 315 <210> 3 <211> 951 <212> DNA <213> artificial sequence <220> <223> RDH10 <400> 3 atgttggtga ccttgggctt attgaccagt ttcttctcat tcctttacat ggtggccccg 60 tccatcagaa aattctttgc aggtggagta tgtaggacta acgttcaact tccggggaag 120 gtagttgtaa taactggagc aaacacggga attgggaagg aaacggcacg tgagcttgcg 180 tcaagagggg cgagggttta catagcctgc cgtgacgtgc tgaaaggtga aagtgctgca 240 tctgagattc gtgtagatac taaaaacagt caagttctgg ttaggaaatt agacttgtct 300 gacaccaaat caataagagc gttcgcggag ggatttctag cagaggagaa acagttacat 360 attctaatca ataacgccgg ggtgatgatg tgcccctact ctaagacagc agacggcttt 420 gaaacacatc taggagtgaa ccacctaggg cattttttac tgacgtatct gttgcttgag 480 aggctgaaag ttagtgcccc cgcacgtgtt gttaatgtca gcagtgtagc acatcacatc 540 gggaaaatac cttttcatga tcttcaatcc gagaaaagat acagcagggg ttttgcgtac 600 tgtcatagca aacttgcaaa tgtcttgttt acgagggaat tggccaaaag gctgcagggt 660 acaggtgtca caacctacgc tgtccaccct ggcgttgtaa gatccgagtt agttaggcat 720 tcaagccttc tgtgcctgct gtggagactt ttctctccct tcgtcaaaac tgcccgtgag 780 ggtgcccaga ccagtcttca ttgtgcattg gcggaaggac tagagccttt atccggcaag 840 tatttttcag attgtaagag gacgtgggtc tcccccaggg cgcgtaacaa taagactgcg 900 gagaggctat ggaacgtcag ttgtgagctg cttggcatca gatgggaata g 951 <210> 4 <211> 810 <212> DNA <213> artificial sequence <220> <223> ybO <400> 4 atgactcata aggcgactga gatcctact ggaaaagtga tgcagaagtc tgtcctgata 60 acgggctgta gctctggtat tggacttgag agtgccctag aactaaagag acagggcttt 120 catgtactgg caggatgccg taaaccggac gacgtagaga ggatgaacag tatgggcttc 180 acgggcgttc tgatagacct tgacagcccg gagtccgtgg atagagctgc cgatgaagta 240 attgctctaa cggataattg cttgtatggc attttcaaca acgccggatt cgggatgtac 300 gggcctttgt ctacgatctc cagggctcag atggagcagc agtttagtgc taatttcttt 360 ggggcccatc aacttactat gcgtcttctg cctgccatgc ttccgcacgg tgaaggtaga 420 atagtaatga cctcctccgt tatgggcctt atatccactc cggggagagg tgcgtatgcc 480 gcaagtaagt atgcacttga ggcttggtcc gacgccctga ggatggaact acgtcactca 540 ggtatcaaag tgtccctgat agaaccgggc ccgattcgta cccgtttcac ggacaatgta 600 aaccagaccc aatctgacaa gcccgttgag aaccctggta ttgcagccag attcacgcta 660 ggtcctgaag ccgtagtaga caaagtgagg catgccttca tttccgaaaa gccaaagatg 720 agatacccag ttacgttagt gacctgggct gtaatggttc taaaaagact tttacccgga 780 agagttatgg acaaaatcct gcaaggctga 810 <210> 5 <211> 55 <212> DNA <213> artificial sequence <220> <223> F_donor_RDH <400> 5 aatgcaaaat attcgtccac attcttttat ctattgtctt catagcttca aaatg 55 <210> 6 <211> 59 <212> DNA <213> artificial sequence <220> <223> R_donor_RDH <400> 6 ttcattaatt agtctactcg actagatgaa atagcttttt gcaaattaaa gccttcgag 59 <210> 7 <211> 25 <212> DNA <213> artificial sequence <220> <223> F_check_CS5 <400> 7 aatgcaaaat attcgtccac attct 25 <210> 8 <211> 28 <212> DNA <213> artificial sequence <220> <223> R_check_CS5 <400> 8 ttcattaatt agtctactcg actagatg 28 <210> 9 <211> 80 <212> DNA <213> artificial sequence <220> <223> F_donor_noxE <400> 9 tttccctttg tgagttctca taacctcgag gagaagtttt tttacccctc tccacagatc 60 tcattatcaa tactcgccat 80 <210> 10 <211> 76 <212> DNA <213> artificial sequence <220> <223> R_donor_noxE <400> 10 actagtgcgc caagagagta attaggtaga ccgggtagat ttttccgtaa ccttggtgtc 60 gcaaattaaa gccttc 76 <210> 11 <211> 30 <212> DNA <213> artificial sequence <220> <223> F_check_CS6 <400> 11 tttccctttg tgagttctca taacctcgag 30 <210> 12 <211> 30 <212> DNA <213> artificial sequence <220> <223> R_check_CS6 <400> 12 tctacctaat tactctcttg gcgcactagt 30

Claims (16)

Recombinant yeast into which the RDH12 gene encoding retinol dehydrogenase has been introduced.
The recombinant yeast according to claim 1, wherein the retinol dehydrogenase is of human origin.
The recombinant yeast according to claim 2, wherein the human-derived retinol dehydrogenase is a polypeptide composed of the amino acid sequence shown in SEQ ID NO: 2.
According to claim 1, wherein the yeast is Saccharomyces cerevisiae ( Saccharomyces cerevisiae ), Rhodosporidium toruleoids ( Rhodosporidium toruloides ) or Yarrowia lipolytica , recombinant yeast.
The recombinant yeast according to claim 1, wherein the retinol-producing ability of the recombinant yeast is improved and the retinal-producing ability is reduced .
The recombinant yeast according to claim 1, wherein a gene encoding NADH oxidase is further introduced.
The recombinant yeast according to claim 6, wherein the NADH oxidase is derived from Lactococcus lactis .
The recombinant yeast according to claim 7, wherein the NADH oxidase derived from Lactococcus lactis is a polypeptide composed of the amino acid sequence shown in SEQ ID NO: 14.
The recombinant yeast according to claim 6, wherein the gene encoding the NADH oxidase is a noxE gene.
A retinol production method comprising culturing the recombinant yeast of claim 1 in a culture medium.
The method of claim 10, wherein the culture medium contains at least one selected from the group consisting of starch, glucose, sucrose, galactose, fructose and glycerol as a carbon source.
The method of claim 11, wherein the culture medium further comprises a lipophilic material.
Retinol produced by the production method of claim 10.
A composition comprising the retinol of claim 13.
A method for producing recombinant yeast with enhanced retinol-producing ability, comprising introducing a RDH12 gene encoding retinol dehydrogenase.
The method of claim 15, further comprising introducing a gene encoding NADH oxidase.

Images