WO2022265196A1 - 염증성 피부 질환 예방 또는 치료용 약학조성물 - Google Patents

염증성 피부 질환 예방 또는 치료용 약학조성물 Download PDF

Info

Publication number
WO2022265196A1
WO2022265196A1 PCT/KR2022/004434 KR2022004434W WO2022265196A1 WO 2022265196 A1 WO2022265196 A1 WO 2022265196A1 KR 2022004434 W KR2022004434 W KR 2022004434W WO 2022265196 A1 WO2022265196 A1 WO 2022265196A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
preventing
inflammatory skin
pharmaceutical composition
dermatitis
Prior art date
Application number
PCT/KR2022/004434
Other languages
English (en)
French (fr)
Inventor
박준형
정호용
나타라잔사티시쿠마
Original Assignee
주식회사 쓰리빅스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 쓰리빅스 filed Critical 주식회사 쓰리빅스
Publication of WO2022265196A1 publication Critical patent/WO2022265196A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/07—Tetrapeptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin

Definitions

  • the present invention relates to a pharmaceutical composition and a cosmetic composition for preventing or treating inflammatory skin diseases containing a peptide exhibiting anti-inflammatory activity as an active ingredient.
  • Skin as an organ constituting the outside of the body, is an important physical barrier that protects the body from various external physical and chemical stimuli while maintaining internal homeostasis.
  • the skin not only prevents leakage of moisture and electrolytes, maintains homeostasis such as body temperature control and temperature, and responds to stimuli such as touch, pressure, pain, and warmth, as well as immune function, vitamin D synthesis, etc. perform the function of
  • a problem that prevents the skin from performing its function is called a skin disease.
  • an inflammatory skin disease in which the skin becomes inflamed is a disease in which symptoms such as redness, swelling, heat, and pain appear. It is classified as contact dermatitis, allergic contact dermatitis, phototoxic and photoallergic contact dermatitis, contact urticaria syndrome, atopic dermatitis, seborrheic dermatitis, blistering eczema, coinoid eczema, self-sensitized dermatitis, housewives' eczema, and stasis dermatitis.
  • Inflammatory skin diseases involve various cells such as T lymphocytes, Langerhans cells, eosinophils and dermal keratinocytes, and are induced by various factors such as cytokines, chemokines and immunoglobulin molecules.
  • dermal keratinocytes as components constituting most of the epidermis of the skin, act as inducers and targets of immune responses occurring in the skin.
  • Contact dermatitis refers to any dermatitis caused by contact with an external substance. It is divided into primary contact dermatitis, which is caused by stimulation of the contact substance itself, and allergic contact dermatitis, which occurs only in people who have an allergic reaction to the contact substance.
  • Primary contact dermatitis has many causative substances such as plants, metals, cosmetics, preservatives, pharmaceutical rubber, and synthetic resins. Symptoms of primary contact dermatitis and allergic contact dermatitis are similar, and mainly show eczema-type lesions accompanied by erythema and edema. In addition, it may be accompanied by blisters or ooze, and in some cases, acne lesions, urticaria lesions, erythema multiforme, pigmentation, and granulomatous lesions may occur.
  • contact dermatitis In the treatment of contact dermatitis, it is most important to avoid contact with the causative substance, and if a reaction has already occurred after exposure, apply a cold compress to dry the blistering lesion and use a moisturizing cream or lotion.
  • a cold compress For chronic contact dermatitis characterized by keratinization and lichenification, oily ointments or creams are effective, and sealing after applying these agents helps in quick treatment of the disease.
  • systemic antihistamines and corticosteroids are helpful if the lesions are spread throughout the body or if topical medications are ineffective.
  • drugs such as antihistamines and steroids show resistance within a short period of time after administration to patients, repeated administration after a certain period of time often does not improve the symptoms of patients. Therefore, it is necessary to develop drugs that can solve the side effects of antihistamines and steroids.
  • the present invention provides a pharmaceutical composition for preventing or treating inflammatory skin diseases containing a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the present invention provides a cosmetic composition for preventing or improving inflammatory skin disease containing a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the synthesized novel peptide suppressed the secretion or expression of cytokines inducing inflammation in the experimental group of human epidermal cells treated with TNF- ⁇ /IFN- ⁇ , which induce inflammation, and TNF- ⁇ /IFN- ⁇ Among the signaling pathways induced by the treatment, phosphorylation of major proteins in the JAK/STAT signaling pathway was inhibited, and it was confirmed that skin inflammation was reduced without a change in body weight in an animal model in which chronic contact dermatitis was induced.
  • the composition containing the active ingredient may be provided as a contact dermatitis treatment or a cosmetic composition for improving dermatitis.
  • Figure 1 shows TNF- ⁇ / IFN- ⁇ (10ng / ml) or TNF- ⁇ / IFN- ⁇ and a novel peptide (10 ⁇ g / ml) as a positive control in HaCaT cell line to confirm the anti-inflammatory activity of the synthesized peptide. This is the result of PCR analysis confirming the transcriptional inhibitory effect of CCL17, CCL22, KDM6B and GMCSF after the combined treatment.
  • Figure 2 shows TNF- ⁇ / IFN- ⁇ (10 ng / ml) or TNF- ⁇ / IFN- ⁇ and a novel peptide (10 ⁇ g / ml) as a positive control in HaCaT cell line to confirm the anti-inflammatory activity of the synthesized peptide. , and real-time PCR analysis results confirming the effect of TSLP transcriptional inhibition.
  • Figure 3 shows TNF- ⁇ / IFN- ⁇ (10 ng / ml) or TNF- ⁇ / IFN- ⁇ and a novel peptide (10 ⁇ g / ml) as a positive control in HaCaT cell line to confirm the anti-inflammatory activity of the synthesized peptide. This is the result of real-time PCR analysis confirming the IL-31 transcriptional inhibitory effect after concurrent treatment.
  • Figure 4 is a result confirming the reduction effect of chronic contact dermatitis after processing the novel peptide in mice with chronic contact dermatitis.
  • Figure 6 is a result of comparative analysis of the size of each organ by separating the spleen and lymph node, which are organs mainly involved in the immune response, after treating a mouse with chronic contact dermatitis with a novel peptide. .
  • Figure 7 shows the effect on phosphorylation of JAK2 and STAT1, major proteins of the JAK/STAT signaling pathway induced by TNF- ⁇ /IFN- ⁇ (10 ng/ml) in HaCaT cell line, in order to confirm the mechanism of action of the synthesized peptide. This is the result of analyzing the effect of the new peptide (10 ⁇ g/ml) by Western Blot.
  • a peptide preparation is a substance in which about 5 to 20 amino acids, which are protein components, are linked, and is defined as a 'minimum unit having a protein function'.
  • Peptide preparations select the smallest unit with excellent physiological activity among proteins to regulate biological signal transduction and function. It can show pharmacological action and activity.
  • the success rate of new drugs in the clinical stage is more than twice as high. Therefore, studies on newly discovering a suitable peptide preparation for the treatment of a specific disease and providing it as a new drug are being conducted very actively. Accordingly, the present inventors synthesized a peptide in view of this point, and completed the present invention by confirming that the novel peptide exhibits anti-inflammatory activity in human epithelial cells.
  • the present invention can provide a pharmaceutical composition for preventing or treating inflammatory skin disease containing a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the peptide is characterized in that it inhibits the expression of one or more selected from the group consisting of CCL17, CCL22, KDM6B, GMCSF, TSLP and IL-31.
  • the peptide is characterized in that it inhibits the phosphorylation of JAK2 or STAT1.
  • the inflammatory skin disease is one or more selected from the group consisting of contact dermatitis, allergic dermatitis, systemic lupus erythematosus, seborrheic dermatitis, psoriasis, and atopic dermatitis, but is not limited thereto.
  • the pharmaceutical composition may reduce an inflammatory response without a change in body weight.
  • the pharmaceutical composition for preventing or treating inflammatory skin disease containing the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient is an injection, granule, powder, tablet, or pill according to a conventional method.
  • Any one formulation selected from the group consisting of capsules, suppositories, gels, suspensions, emulsions, drops or liquids may be used.
  • a pharmaceutical composition for preventing or treating inflammatory skin disease containing a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient is suitable carriers, excipients, and boron commonly used in the manufacture of pharmaceutical compositions. It may further include one or more additives selected from the group consisting of release agents, sweeteners, coating agents, swelling agents, lubricants, flavoring agents, antioxidants, buffers, bacteriostatic agents, diluents, dispersing agents, surfactants, binders, and lubricants.
  • carriers, excipients and diluents are lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil may be used, and solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules.
  • solid preparations may be prepared by mixing at least one or more excipients, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the composition.
  • excipients for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc may also be used.
  • Liquid preparations for oral administration include suspensions, solutions for oral use, emulsions, syrups, and the like, and various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included in addition to commonly used simple diluents such as water and liquid paraffin.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, and the like.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • As a base material of the suppository witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.
  • the pharmaceutical composition is administered in a conventional manner through intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or intradermal routes.
  • a preferred dosage of the peptide may vary depending on the condition and body weight of the subject, the type and severity of the disease, the type of drug, the route and duration of administration, and may be appropriately selected by those skilled in the art. According to one embodiment of the present invention, but not limited thereto, the daily dosage may be 0.01 to 200 mg/kg, specifically 0.1 to 200 mg/kg, and more specifically 0.1 to 100 mg/kg. Administration may be administered once a day or divided into several administrations, and the scope of the present invention is not limited thereby.
  • the 'subject' may be a mammal including a human, but is not limited to these examples.
  • the present invention can provide a cosmetic composition for preventing or improving inflammatory skin disease containing a peptide consisting of the amino acid sequence represented by SEQ ID NO: 1 as an active ingredient.
  • the cosmetic composition is a formulation selected from the group consisting of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing, oils, powder foundations, emulsion foundations, wax foundations and sprays. It may have, but is not limited thereto.
  • the cosmetic composition may include a stabilizer, a solubilizer, a conventional auxiliary agent such as a stabilizer, a solubilizer, vitamins, pigments, and fragrances, and a carrier, in addition to the active ingredient, the peptide consisting of the amino acid sequence represented by SEQ ID NO: 1.
  • the cosmetic composition may be prepared in any formulation commonly prepared in the art, for example, a solution, suspension, emulsion, paste, gel, cream, lotion, powder, oil, powder foundation, emulsion foundation, It may be formulated as a wax foundation and spray, but is not limited thereto. More specifically, it may be prepared in the form of sun cream, softening lotion, astringent lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, pack, spray or powder.
  • the formulation is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. .
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon, propane/butane or a propellant such as dimethyl ether.
  • a solvent, solubilizing agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -Butyl glycol oil, fatty acid esters of glycerol, polyethylene glycol or sorbitan.
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspension agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose , aluminum metahydroxide, bentonite, agar or tracanth, and the like can be used.
  • peptides were prepared using Merrifield's liquid-solid phase method (Merrifield, RB., J. Am. Chem. Soc., 85, 2149, 1963) using Fmoc amino group protection. did
  • the peptide synthesis method is a solid phase method using Fmoc (9-fluorenylmethoxycarbonyl) as a protecting group for the N ⁇ -amino group of an amino acid, and more specifically, the carboxyl terminal is -NH Type 2 peptides used Rink Amide MBHA-Resin as a starting material, and carboxyl-terminal -OH peptides used Fmoc-amino acid-Wang Resin as a starting material.
  • the elongation of the peptide chain by Fmoc-amino acid coupling was performed by the DCC (N-hydroxybenzotriazole (HOBt)-dicyclo-hexylcar-bodiimide) method.
  • DCC N-hydroxybenzotriazole (HOBt)-dicyclo-hexylcar-bodiimide
  • the Fmoc group was removed with a 20% piperidine/N-methylpyrrolidone (NMP) solution, washed several times with NMP and dichloromethane (DCM), and nitrogen dried with gas.
  • NMP piperidine/N-methylpyrrolidone
  • the molecular weight was calculated based on the sequence of the synthesized peptide, and the exact molecular weight was measured using a matrix assisted laser desorption ionization mass spectrometer (MALDI).
  • MALDI matrix assisted laser desorption ionization mass spectrometer
  • the HaCaT cell line a human epidermal cell
  • a DMEM medium containing 1% penicillin-streptomycin and 10% FBS at 37°C in an environment of 5% CO 2 .
  • HaCaT was dispensed at 3 ⁇ 10 5 /well using DMEM medium supplemented with 10% FBS in a 6-well cell culture plate. After culturing the cells for one day, using serum-free medium, TNF- ⁇ /IFN- ⁇ (10ng/ml) alone (positive control) or TNF- ⁇ /IFN- ⁇ and KTFR peptide (10 ⁇ g/ml) were simultaneously treated and incubated for 24 hours.
  • PCR was performed using the synthesized cDNA using primers for target genes as shown in Table 1, and the results were confirmed after electrophoresis using a 1.2% agarose gel.
  • human epidermal cells the HaCaT cell line
  • DMEM medium containing 1% penicillin-streptomycin and 10% FBS.
  • HaCaT was dispensed at 3 ⁇ 10 5 /well using DMEM medium supplemented with 10% FBS in a 6-well cell culture plate. After culturing the cells for one day, TNF- ⁇ /IFN- ⁇ (10 ng/ml) alone (positive control) or TNF- ⁇ /IFN- ⁇ and KTFR peptide (10 ⁇ g/ml) was used in a serum-free medium. were simultaneously treated and incubated for 24 hours.
  • RNA-prep Bio-Zol, MA500, Bioses
  • 5 ⁇ g of isolated RNA was used.
  • cDNA was synthesized.
  • real-time PCR was performed using the primers of the target gene as shown in Table 2 and SYBR green, and the Ct value was confirmed.
  • the 6-week-old male BALB/c mouse used in the animal experiment is a 'SKH-1 hiarless' species and has almost no body hair, so it is convenient to intuitively observe the condition of the skin.
  • Subject / 6 subjects in the positive control group / 6 subjects in the novel peptide treatment group were divided into experiments.
  • DNCB 2,4-dinitrochlorobenzene
  • the contact dermatitis animal model was sacrificed and the spleen and lymph nodes were separated to examine the effects of each organ. The size was compared and analyzed.
  • the novel peptide has an excellent effect of suppressing the overall inflammatory response in addition to contact dermatitis.
  • HaCaT was dispensed at 3 ⁇ 10 5 /well using DMEM medium supplemented with 10% FBS in a 6-well cell culture plate. After culturing the cells for one day, treatment with TNF- ⁇ /IFN- ⁇ (10 ng/ml) alone using a serum-free medium (positive control), or TNF- ⁇ /IFN- ⁇ and KTFR peptide ( 10 ⁇ g/ml) were simultaneously treated and cultured for 24 hours.
  • the medium was removed from each well, washed with D-PBS, and cells were lysed with 200 ⁇ l of RIPA buffer on ice, and the lysate was centrifuged (15,000 rpm, 4° C., 20 minutes) to separate proteins. Protein concentration was determined by the Bradford method, and equal amounts of protein (40 ⁇ g) were separated by 10% SDS-PAGE. The separated proteins were transferred to a nitrocellulose membrane, and Western blotting was performed using antibodies specifically recognizing phosphorylated major proteins and total major proteins.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Birds (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 항염증 활성을 나타내는 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성물에 관한 것으로, 상기 합성된 신규 펩타이드는 염증을 유도시키는 TNF-α/IFN-γ가 처리된 사람 표피세포 실험군에서 염증을 유도하는 사이토카인의 분비 또는 발현을 억제하고, TNF-α/IFN-γ 처리에 의해 유도된 신호전달 경로 중 JAK/STAT 신호전달 경로의 주요 단백질의 인산화를 저해하고, 만성 접촉성 피부염이 유도된 동물모델의 체중 변화 없이 피부 염증을 감소시키며, 면역반응에 주요하게 관여하는 장기인 비장과 림프절의 크기를 양성대조군보다 현저하게 감소시키는 것을 확인함에 따라, 상기 펩타이드는 유효성분으로 함유하는 조성물은 접촉성 피부염 치료제 또는 피부염 개선을 위한 화장료 조성물로 제공될 수 있다.

Description

염증성 피부 질환 예방 또는 치료용 약학조성물
본 발명은 항염증 활성을 나타내는 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성물 및 화장료 조성물에 관한 것이다.
피부는 신체의 외부를 구성하는 기관으로서 다양한 외부 물리적 및 화학적 자극으로부터 신체를 보호하면서 내부의 항상성을 유지하는 중요한 물리적 장벽이다. 피부는 수분과 전해질의 외부 유출을 방지할 뿐만 아니라, 체온 조절, 온도 등의 항상성을 유지하고, 촉각, 압각, 통각, 온각 등의 자극에 대한 반응을 할 뿐만 아니라, 면역 기능, 비타민 D 합성 등의 기능을 수행한다.
이러한 피부가 기능을 수행할 수 없도록 문제가 생기는 것을 피부 질환이라고 하며, 그 중 피부에 염증이 생기는 염증성 피부 질환은 발적, 종창, 열감, 동통 등의 증상이 나타나는 질환이며, 유형별로 접촉피부염, 자극 접촉피부염, 알레르기 접촉피부염, 광독성 및 광알레르기 접촉 피부염, 접촉 두드러기 증후군, 아토피 피부염, 지루성 피부염, 물집 습진, 동전모양 습진, 자가 감작 피부염, 주부습진, 울체 피부염 등과 같이 분류된다.
염증성 피부 질환은 T 림프구, 랑게르한스 세포, 호산구 및 피부각질형성세포와 같이 여러 세포들이 관여하며, 사이토카인, 케모카인 및 면역글로불린 분자와 같은 여러 요소에 의해 유발된다. 이중, 피부각질형성세포는 피부의 표피 대부분을 구성하는 성분으로서 피부에서 발생하는 면역반응의 유도체 및 표적으로 작용한다.
접촉성 피부염은 외부 물질과의 접촉에 의하여 생기는 모든 피부염을 말한다. 접촉물질 자체의 자극에 의하여 생기는 원발성 접촉피부염과 접촉물질에 대한 알레르기 반응이 있는 사람에게만 생기는 알레르기성 접촉피부염으로 구분된다.
원발성 접촉피부염은 식물, 금속, 화장품, 방부제, 약제 고무, 함성수지 등 많은 원인 물질이 있다. 원발성 접촉피부염과 알레르기성 접촉피부염의 증상은 비슷하며, 주로 홍반, 부종 등을 동반한 습진 형태의 병변을 보인다. 또한, 수포나 진물을 동반하기도 하며, 일부에서는 여드름성 병변, 두드러기성 병변, 다형홍반, 색소침착, 육아종성 병변 등도 발생할 수 있다.
이러한 접촉성 피부염의 치료는 원인이 되는 물질에 접촉하지 않도록 하는 것이 가장 중요하고, 이미 노출 후 반응이 발생한 경우에는 냉습포를 시행하여 수포성 병변을 말리고 수분이 많은 크림과 로션을 사용한다. 각질과 태선화를 특징으로 하는 만성 접촉성 피부염은 기름기가 많은 연고나 크림제가 효과적이며, 이러한 약제를 바른 후 밀봉하면 질환의 빠른 치료에 도움이 된다. 또한 전신으로 병변이 퍼져있거나 국소제로 효과가 적은 경우 전신적인 항히스타민과 부신피질 호르몬제(스테로이드)가 도움이 된다.
그러나 항히스타민제 및 스테로이드와 같은 약물은 환자에게 투여 후 단 기간 내에 내성을 나타내기 때문에 일정기간 시간이 지난 후 반복 투여 시 환자들의 증상을 호전시키지 못하는 경우가 많다. 따라서 항히스타민제, 스테로이드 등의 부작용을 해결할 수 있는 약물의 개발이 필요한 실정이다.
본 발명은 서열번호 1로 표시되는 아미노산 서열로 이루어진 신규한 펩타이드의 항염증 효과를 확인함에 따라, 상기 펩타이드를 염증성 피부 질환 예방 또는 치료제 용도로 제공하고자 한다.
본 발명은 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 개선용 화장료 조성물을 제공한다.
본 발명에 따르면, 합성된 신규 펩타이드가 염증을 유도시키는 TNF-α/IFN-γ가 처리된 사람 표피세포 실험군에서 염증을 유도하는 사이토카인의 분비 또는 발현을 억제하였고, TNF-α/IFN-γ 처리에 의해 유도된 신호전달 경로 중 JAK/STAT 신호전달 경로의 주요 단백질의 인산화를 저해하였으며, 만성 접촉성 피부염이 유도된 동물모델의 체중 변화 없이 피부염증을 감소시키는 것을 확인함에 따라, 상기 펩타이드를 유효성분으로 함유하는 조성물은 접촉성 피부염 치료제 또는 피부염 개선을 위한 화장료 조성물로 제공될 수 있다.
도 1은 합성된 펩타이드의 항염증 활성을 확인하기 위해, HaCaT 세포 주에 양성 대조군으로 TNF-α/IFN-γ(10ng/ml) 또는 TNF-α/IFN-γ와 신규 펩타이드(10μg/ml)를 병용 처리하고 CCL17, CCL22, KDM6B 및 GMCSF 전사 억제 효과를 확인한 PCR 분석 결과이다.
도 2는 합성된 펩타이드의 항염증 활성을 확인하기 위해, HaCaT 세포 주에 양성 대조군으로 TNF-α/IFN-γ(10ng/ml) 또는 TNF-α/IFN-γ와 신규 펩타이드(10μg/ml)를 병용 처리하고 TSLP 전사 억제 효과를 확인한 실시간 PCR 분석 결과이다.
도 3은 합성된 펩타이드의 항염증 활성을 확인하기 위해, HaCaT 세포 주에 양성 대조군으로 TNF-α/IFN-γ(10ng/ml) 또는 TNF-α/IFN-γ와 신규 펩타이드(10μg/ml)를 병용 처리하고 IL-31 전사 억제 효과를 확인한 실시간 PCR 분석 결과이다.
도 4는 만성 접촉성 피부염이 발생된 마우스에 신규 펩타이드를 처리한 후 만성 접촉성 피부염의 감소 효과를 확인한 결과이다.
도 5는 만성 접촉성 피부염이 발생된 마우스에 신규 펩타이드를 처리한 후 체중 변화를 확인한 결과이다.
도 6은 만성 접촉성 피부염이 발생된 마우스에 신규 펩타이드를 처리한 후 면역반응에 주요하게 관여하는 장기인 비장(Spleen)과 림프절(Lymph node)을 분리하여 각 장기의 크기를 비교 분석한 결과이다.
도 7은 합성된 펩타이드의 작용기전을 확인하기 위해, HaCaT 세포 주에서 TNF-α/IFN-γ(10ng/ml)에 의해 유도되는 JAK/STAT 신호전달 경로의 주요 단백질인 JAK2와 STAT1 인산화에 미치는 신규 펩타이드(10μg/ml)의 효과를 Western Blot으로 분석한 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
펩타이드 제제는 단백질 구성요소인 아미노산이 5 내지 20개 정도 연결된 물질로, '단백질 기능을 가진 최소단위'로 정의한다. 펩타이드 제제는 단백질 중에서도 뛰어난 생리활성을 가진 최소단위를 선별해 생체 신호전달 및 기능을 조절하며 신약후보 물질로써 '생체친화적', '생체 내 특이성'이라는 차별성을 가져, 부작용은 적으면서 소량으로도 강력한 약리작용 및 활성을 나타낼 수 있다. 또한, 저분자 화합물에 비해 임상단계에서 신약 성공률이 2배 이상 높다. 따라서 특정 질환에 대한 치료에 있어 적합한 펩타이드 제제를 새롭게 발견하고, 이를 신약으로 제공하는 연구가 매우 활발히 진행되고 있다. 이에 본 발명자들은 이와 같은 점을 감안하여 펩타이드를 합성하였고, 상기 신규 펩타이드가 인간 상피 세포에서 항염증 활성을 나타내는 것을 확인함에 따라 본 발명을 완성하였다.
본 발명은 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성물을 제공할 수 있다.
상기 펩타이드는 CCL17, CCL22, KDM6B, GMCSF, TSLP 및 IL-31로 이루어진 군에서 선택된 하나 이상의 발현을 억제하는 것을 특징으로 한다.
또한, 상기 펩타이드는 JAK2 또는 STAT1의 인산화를 저해하는 것을 특징으로 한다.
상기 염증성 피부 질환은 접촉성 피부염, 알레르기성 피부염, 전신 홍반성 낭창, 지루성 피부염, 건선 및 아토피성 피부염으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하나, 이에 제한되는 것은 아니다.
상기 약학조성물은 체중 변화 없이 염증 반응을 감소시키는 것일 수 있다.
본 발명의 한 구체예에서, 상기 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성은 통상적인 방법에 따라 주사제, 과립제, 산제, 정제, 환제, 캡슐제, 좌제, 겔, 현탁제, 유제, 점적제 또는 액제로 이루어진 군에서 선택된 어느 하나의 제형을 사용할 수 있다.
본 발명의 다른 구체예에서, 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성은 약학조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕해제, 감미제, 피복제, 팽창제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 일실시예에 따르면 상기 약학 조성물은 정맥내, 동맥내, 복강내, 근육내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 대상체로 투여할 수 있다.
상기 펩타이드의 바람직한 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있다. 본 발명의 일실시예에 따르면 이에 제한되는 것은 아니지만 1일 투여량이 0.01 내지 200 mg/kg, 구체적으로는 0.1 내지 200 mg/kg, 보다 구체적으로는 0.1 내지 100 mg/kg 일 수 있다. 투여는 하루에 한 번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
본 발명에 있어서, 상기 '대상체'는 인간을 포함하는 포유동물일 수 있으나, 이들 예에 한정되는 것은 아니다.
또한, 본 발명은 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 개선용 화장료 조성물을 제공할 수 있다.
상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이로 구성된 군으로부터 선택되는 제형을 갖는 것일 수 있으나, 이에 제한되는 것은 아니다.
상기 화장료 조성물은 유효성분인 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드 외에 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함할 수 있다.
상기 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 등으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 썬 크림, 유연 화장수, 수렴 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.
상기 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜,실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.
상기 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진제를 포함할 수 있다.
상기 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해 화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.
상기 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
< 실시예 1> 펩타이드 제조
신규한 펩타이드를 합성하기 위하여, Fmoc 아미노기 보호용기를 이용한 메리필드(Merrifield)의 액상 고상법(Merrifield, RB., J. Am. Chem. Soc., 85, 2149, 1963)을 사용하여 펩타이드를 제조하였다.
상기 펩타이드 합성 방법은 Fmoc(9-fluorenylmethoxycarbonyl)를 아미노산의 Nα-아미노 그룹(amino group)의 보호기(protecting group)로 사용하는 고상법(solid phase method)으로, 보다 상세하게는 카르복실 말단이 -NH2 형태인 펩타이드는 Rink Amide MBHA-Resin을 출발물질로 사용하였으며, 카르복실 말단이 -OH 형태의 펩타이드는 Fmoc-아미노산-Wang Resin을 출발물질로 사용하였다.
Fmoc-아미노산의 커플링(coupling)에 의한 펩타이드 사슬의 연장 (elongation)은 DCC(N-hydroxybenzotriazole(HOBt)-dicyclo-hexylcar-bodiimide)법으로 수행되었다.
각 펩타이드의 아미노 말단에 Fmoc-아미노산을 커플링시킨 후, 20% 피페리딘/N-메틸피롤리돈(NMP)용액으로 Fmoc기를 제거하고 NMP 및 디클로로메탄(DCM)으로 여러 번 세척한 후 질소 가스로 건조시켰다.
여기에 TFA(trifluoroacetic acid)-phenol-thioanisole-H2O-triisop- ropylsilane(85: 5: 5: 2.5: 2.5,vol./vol.) 용액을 가하고 3시간 동안 반응시켜 보호기를 제거하고, 레진으로부터 펩타이드를 분리시킨 다음, 디에틸에테르로 펩타이드를 침전시켰다. 상기 과정으로 얻은 조(crude) 펩타이드를 0.1% TFA가 포함된 아세토니트릴 농도구배(acetonitrile gradient)로 정제형 역상-HPLC(reverse phase-HPLC) 컬럼(Delta Pak, C18 300Å, 15μm, 19.0mm × 30mm, Waters)을 이용하여 정제하였다.
합성 펩타이드를 6 N-HCl로 110℃에서 24시간 동안 가수분해한 후, 얻어진 잔사를 감압농축한 뒤, 0.02 N-HCl에 녹여서 아미노산 분석기(Hitachi 8500 A)로 아미노산 조성을 측정하였다.
또한, 합성된 펩타이드의 시퀀스(sequence)를 바탕으로 분자량을 계산하였으며, MALDI 질량 분석법(matrixassisted laser desorption ionization mass spectrometer)을 이용하여 정확한 분자량을 측정하였다.
그 결과, 측정된 분자량과 계산된 분자량이 일치하는 것이 확인됨에 따라 정확한 아미노산 서열을 가지는 KTFR 펩타이드(서열번호 1)의 합성이 확인되었다.
< 실시예 2> 펩타이드의 항염활성 확인
1. CCL17 , CCL22 , KDM6B 및 GMCSF 전사 억제 효과 확인
앞서 합성된 신규 펩타이드가 피부염에 대한 항염 활성을 나타낼 수 있는지를 확인하기 위해, CCL17, CCL22, KDM6B 및 GMCSF에 대한 전사 억제 효과를 확인하였다.
먼저, 사람의 표피 세포인 HaCaT 세포주를 1% 페니실린-스트렙토마이신 (penicillin-streptomycin)과 10% FBS를 포함하는 DMEM 배지를 사용하여 37℃, 5% CO2의 환경에서 배양하였다.
6-웰 세포 배양 플레이트에 10% FBS가 첨가된 DMEM 배지를 이용하여 HaCaT를 3 × 105/well로 분주하였다. 세포를 하루 배양한 후 무혈청(serum-free) 배지를 이용하여 TNF-α/IFN-γ(10ng/ml) 단독(양성 대조군) 또는 TNF-α/IFN-γ와 KTFR 펩타이드(10μg/ml)를 동시에 처리한 다음 24시간 동안 배양하였다.
24시간 후 각 웰에서 배지를 제거하고 D-PBS로 세척한 후 RNA-prep (Bio-Zol, MA500, 바이오세상) 용액을 사용하여 일반적인 방법을 응용하여 RNA를 분리하고, 분리된 RNA 5μg을 사용하여 cDNA를 합성하였다.
합성된 cDNA를 사용하여 표 1과 같은 타겟 유전자에 대한 프라이머를 사용하여 PCR을 수행하였으며, 1.2% 아가로스 겔을 사용하여 전기영동 후 결과를 확인하였다.
구분 정방향 프라이머 역방향 프라이머
CCL17 actgtctcccgggactacct tccctcactgtggctcttct
CCL22 tgccctgggtgaagatgatt agaggatgggttagaggggt
KDM6B cccttcacatggcagtag agagttgcagcctctcct
GMCSF agagcctgctgctcttg cagtcaaaggggatgaca
그 결과, 도 1과 같이 TNF-α/IFN-γ와 신규 펩타이드가 함께 처리된 실험군에서 CCL17, CCL22, KDM6B 및 GMCSF 전사 억제가 확인되었다.
2. TSLP와 IL-31 전사 억제 효과 확인
앞선 실험과 동일한 방법으로 사람의 표피 세포인 HaCaT 세포주를 1% 페니실린-스트렙토마이신(penicillin-streptomycin)과 10% FBS를 포함하는 DMEM 배지를 사용하여 37℃, 5% CO2의 환경에서 배양하였다.
6-웰 세포 배양 플레이트에 10% FBS가 첨가된 DMEM 배지를 이용하여 HaCaT를 3 × 105/well로 분주하였다. 세포를 하루 배양한 후 무혈청(serum-free) 배지를 이용하여 TNF-α/IFN-γ(10ng/ml) 단독 (양성 대조군) 또는 TNF-α/IFN-γ와 KTFR 펩타이드(10μg/ml)를 동시에 처리한 다음 24시간 동안 배양하였다.
24시간 후 각 웰에서 배지를 제거하고 D-PBS로 세척한 후 RNA-prep (Bio-Zol, MA500, 바이오세상) 용액을 사용하여 일반적인 방법을 응용하여 RNA를 분리하고, 분리된 RNA 5μg을 사용하여 cDNA를 합성하였다. 합성된 cDNA로 표 2와 같은 타겟 유전자의 프라이머와 SYBR green을 사용하여 real-time PCR을 수행하고 Ct 값을 확인하였다.
구분 정방향 프라이머 역방향 프라이머
TSLP ggggctaaaccatgacagaa gtttggctgaaggcttgttc
IL31 cgacgtctgtgctctttctg agcatcttcgagagggactg
그 결과, 도 2 및 도 3과 같이 신규 펩타이드가 처리된 세포군에서 TSLP 및 IL-31 감소가 매우 효과적인 것으로 확인되었다.
< 실시예 3> 동물 실험
동물실험에 사용한 생후 6주의 수컷 BALB/c 마우스는 ‘SKH-1 hiarless’ 종으로 체모가 거의 없어 피부의 상태를 직관적으로 관찰하기에 편리한 장점이 있으며, 총 18개체를 3개의 그룹(음성대조군 6개체 / 양성대조군 6개체/ 신규펩타이드 처리군 6개체)으로 나누어 실험하였다.
약 2주의 적응 기간을 거친 뒤, acetone:olive oil(3:1) 용액에 1%의 농도로 준비한 2,4-디니트로클로로벤젠(2,4-Dinitrochlorobenzene, DNCB) 100μL를 매일 일정한 시간에 마우스 등 피부에 도포하였다. 1주 경과 후, 접촉성 피부염의 유발이 확인되면, DNCB를 0.5%로 낮추어 2일 간격으로 100μL 씩 도포하고, 신규 펩타이드를 생리식염수에 1mg/ml의 농도로 준비하여 매일 100μg 씩 3주 동안 도포하였으며, 실험이 진행되는 동안에 매주 피부의 상태를 관찰하였다.
그 결과, 도 4와 같이 실험동물의 적응 기간 경과 후 음성대조군을 제외한 전체 그룹에 피부염증이 심각하게 유발되었으나, 신규 펩타이드 처리군은 일주일 정도의 짧은 처리 기간에서부터 피부염증 증상을 상당히 완화시키는 것을 확인할 수 있었으며, 총 3주 동안의 처리에서는 정상 피부와 거의 동일한 정도로 피부염증 증상을 개선시키는 것이 확인되었다.
또한, 음성대조군, 양성대조군 및 신규 펩타이드 처리군의 체중 변화를 확인한 결과, 도 5와 같이 모든 군에서 눈에 띄는 체중 변화는 확인되지 않았다.
상기 결과로부터 신규 펩타이드로 인한 스트레스가 유발되지 않았음이 확인되었다.
한편, 신규 펩타이드 처리가 면역반응에 주요하게 관여하는 장기인 비장과 림프절에 미치는 영향을 확인하기 위해, 접촉성 피부염 동물모델을 희생하여 비장 (spleen)과 림프절(lymph node)을 분리하여 각 장기의 크기를 비교하여 분석하였다.
그 결과, 도 6과 같이 각 장기의 크기를 음성대조군과 비교해 보았을 때 양성대조군에서는 비장 및 림프절로 면역세포들이 침착되어 크기가 상당히 증가한 반면, 신규 펩타이드가 처리된 그룹에서는 양성대조군에 비해서 비장과 림프절의 크기가 음성대조군과 비슷한 정도로 현저하게 감소한 것을 확인하였다.
상기 결과로부터 신규 펩타이드는 접촉성 피부염 이외에 전반적인 염증 반응의 억제 효과가 우수한 것을 확인하였다.
< 실시예 4> 펩타이드의 TNF -α/ IFN -γ 처리에 의해 유도된 신호전달 경로 관련 주요 단백질의 인산화 억제 효과 확인
염증 반응에서 신규 펩타이드의 작용기전을 확인하기 위해, 염증 관련 사이토카인 및 케모카인의 발현 조절인자인, 신호전달 경로에 관련된 주요 단백질의 인산화를 웨스턴 블롯(Western blot)으로 확인하였다. 6-웰 세포 배양 플레이트에 10% FBS가 첨가된 DMEM 배지를 이용하여 HaCaT를 3 × 105/well로 분주하였다. 세포를 하루 배양한 후 무혈청(serum-free) 배지를 이용하여 TNF-α/IFN-γ(10ng/ml)을 단독으로 처리하거나(양성 대조군), TNF-α/IFN-γ 및 KTFR 펩타이드(10μg/ml)를 동시에 처리한 후, 24시간 동안 배양하였다.
24시간 후 각 웰에서 배지를 제거하고 D-PBS로 세척한 후 얼음 위에서 200μl의 RIPA 완충액으로 세포 용해시키고, 용해물을 원심분리(15,000rpm, 4℃, 20분)하여 단백질을 분리하였다. 단백질 농도를 브래드포드 방법으로 결정하고, 동량의 단백질(40μg)을 10% SDS-PAGE로 분리하였다. 분리된 단백질들을 니트로섬유소막(nitrocellulose membrane)으로 옮기고, 인산화된 주요 단백질 및 총 주요 단백질을 특이적으로 인지하는 항체를 사용하여 웨스턴 블롯을 수행하였다.
그 결과, 도 7과 같이 TNF-α/IFN-γ처리에 의해 유도된 신호전달 경로 중에서 MAPK/ERK 신호전달 경로의 주요 단백질의 인산화는 신규 펩타이드 처리 시 변화가 없지만, JAK/STAT 신호전달 경로의 주요 단백질인 JAK2와 STAT1의 인산화가 신규 펩타이드가 처리 시 크게 감소하는 것을 확인하였다.
상기 결과로부터 관련 염증 매개자 및 사이토카인의 생성 저해에 대한 신규 펩타이드의 효과가 JAK/STAT 신호전달 경로의 억제를 통해 매개된다는 것을 확인하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (6)

  1. 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 치료용 약학조성물.
  2. 청구항 1에 있어서, 상기 펩타이드는 CCL17, CCL22, KDM6B, GMCSF, TSLP 및 IL-31로 이루어진 군에서 선택된 하나 이상의 발현을 억제하는 것을 특징으로 하는 염증성 피부 질환 예방 또는 치료용 약학조성물.
  3. 청구항 1에 있어서, 상기 펩타이드는 JAK2 또는 STAT1의 인산화를 저해하는 것을 특징으로 하는 염증성 피부 질환 예방 또는 치료용 약학조성물.
  4. 청구항 1에 있어서, 상기 염증성 피부 질환은 접촉성 피부염, 알레르기성 피부염, 전신 홍반성 낭창, 지루성 피부염, 건선 및 아토피성 피부염으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 염증성 피부 질환 예방 또는 치료용 약학조성물.
  5. 서열번호 1로 표시되는 아미노산 서열로 이루어진 펩타이드를 유효성분으로 함유하는 염증성 피부 질환 예방 또는 개선용 화장료 조성물.
  6. 청구항 5에 있어서, 상기 화장료 조성물은 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이로 구성된 군으로부터 선택되는 제형을 갖는 것을 특징으로 하는 염증성 피부 질환 예방 또는 개선용 화장료 조성물.
PCT/KR2022/004434 2021-06-16 2022-03-29 염증성 피부 질환 예방 또는 치료용 약학조성물 WO2022265196A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210078174A KR102302984B1 (ko) 2021-06-16 2021-06-16 염증성 피부 질환 예방 또는 치료용 약학조성물
KR10-2021-0078174 2021-06-16

Publications (1)

Publication Number Publication Date
WO2022265196A1 true WO2022265196A1 (ko) 2022-12-22

Family

ID=77924018

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004434 WO2022265196A1 (ko) 2021-06-16 2022-03-29 염증성 피부 질환 예방 또는 치료용 약학조성물

Country Status (2)

Country Link
KR (1) KR102302984B1 (ko)
WO (1) WO2022265196A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102302984B1 (ko) * 2021-06-16 2021-09-17 주식회사 쓰리빅스 염증성 피부 질환 예방 또는 치료용 약학조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150014483A (ko) * 2012-05-11 2015-02-06 주식회사 카엘젬백스 항염증 활성을 갖는 펩티드 및 이를 포함하는 조성물
KR20200027493A (ko) * 2017-07-05 2020-03-12 장인 우선 파마슈티컬 컴퍼니 리미티드 펩티드의 항-염증 용도
KR102302984B1 (ko) * 2021-06-16 2021-09-17 주식회사 쓰리빅스 염증성 피부 질환 예방 또는 치료용 약학조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180036580A (ko) 2016-09-30 2018-04-09 주식회사 유스바이오팜 수가용화(水加溶化)된 우르소데옥시콜산을 함유하는 염증성 피부질환 또는 중증 소양증 예방 또는 치료용 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150014483A (ko) * 2012-05-11 2015-02-06 주식회사 카엘젬백스 항염증 활성을 갖는 펩티드 및 이를 포함하는 조성물
KR20200027493A (ko) * 2017-07-05 2020-03-12 장인 우선 파마슈티컬 컴퍼니 리미티드 펩티드의 항-염증 용도
KR102302984B1 (ko) * 2021-06-16 2021-09-17 주식회사 쓰리빅스 염증성 피부 질환 예방 또는 치료용 약학조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HAN GANGWEN, WILLIAMS CORTNY A., SALTER KELLI, GARL PAMELA J., LI ALLEN G., WANG XIAO-JING: "A Role for TGFβ Signaling in the Pathogenesis of Psoriasis", JOURNAL OF INVESTIGATIVE DERMATOLOGY, ELSEVIER, NL, vol. 130, no. 2, 1 February 2010 (2010-02-01), NL , pages 371 - 377, XP055824702, ISSN: 0022-202X, DOI: 10.1038/jid.2009.252 *
KATIA BOURD‐BOITTIN; DOMINIQUE BONNIER; ANTHONY LEYME; BERNARD MARI; PIERRE TUFFERY; MICHEL SAMSON; FRÉDÉRIC EZAN; GEORGES BAFFET;: "Protease profiling of liver fibrosis reveals the ADAM metallopeptidase with thrombospondin type 1 motif, 1 as a central activator of transforming growth factor beta", HEPATOLOGY, JOHN WILEY & SONS, INC., US, vol. 54, no. 6, 2 December 2011 (2011-12-02), US , pages 2173 - 2184, XP071570245, ISSN: 0270-9139, DOI: 10.1002/hep.24598 *
KRAMPERT MONIKA, KUENZLE SANDRA, THAI SHELLEY N.-M., LEE NATHAN, IRUELA-ARISPE M. LUISA, WERNER SABINE: "ADAMTS1 Proteinase Is Up-regulated in Wounded Skin and Regulates Migration of Fibroblasts and Endothelial Cells", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 280, no. 25, 1 June 2005 (2005-06-01), US , pages 23844 - 23852, XP093014722, ISSN: 0021-9258, DOI: 10.1074/jbc.M412212200 *

Also Published As

Publication number Publication date
KR102302984B1 (ko) 2021-09-17

Similar Documents

Publication Publication Date Title
WO2011152671A2 (ko) 라말린을 함유하는 염증질환 또는 면역질환의 예방 또는 치료용 약학 조성물
WO2022265196A1 (ko) 염증성 피부 질환 예방 또는 치료용 약학조성물
WO2021033831A1 (ko) 피부 미백 활성을 갖는 펩타이드 및 이의 용도
US20050026845A1 (en) Pharmaceutical/cosmetic compositions comprising the lysine-D-proline-valine tripeptide
WO2021251788A1 (ko) 펜타펩타이드를 유효성분으로 포함하는 알러지성 질환 또는 가려움증의 예방, 개선 또는 치료용 조성물
WO2021153946A1 (ko) Snare 복합체의 형성을 저해하는 펩티드, 및 그의 용도
WO2018208124A2 (ko) 이소트레티노인과 펩타이드의 결합체
WO2018034453A1 (ko) 미녹시딜과 펩타이드의 결합체
Kalogjera et al. Dose-dependent protective effect of BPC 157 on capsaicin-induced rhinitis in rats
WO2011053007A2 (ko) 위릉채 추출물을 포함하는 모공 축소 또는 피지 분비 억제용 조성물
WO2021033832A1 (ko) 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
KR102149202B1 (ko) Zag 유래 펩타이드 및 그의 용도
WO2022050634A1 (ko) 펩타이드 및 이를 포함하는 화장료 조성물 및 약학 조성물
KR102354916B1 (ko) 신규 펩타이드 3ps_i014 및 이의 용도
WO2015034247A1 (ko) 모노아세틸디아실글리세롤 화합물을 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 조성물
WO2021251790A1 (ko) 항비만 활성을 가지는 디옥시콜산-펩타이드 결합체 및 이의 용도
WO2022092523A1 (ko) 중대가리풀 유래의 추출물을 포함하는 항염, 자가면역 질환 및 비알코올성 지방간 질환 예방 및 치료용 조성물
WO2023055009A1 (ko) 항염증 활성을 갖는 펩타이드 및 이의 용도
WO2012046922A1 (en) Novel use of antimicrobial peptides in regeneration of skin cells
WO2024080399A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
WO2024080402A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
WO2024080398A1 (ko) 발모 촉진 및 탈모 억제 활성을 갖는 펩타이드 및 이의 용도
WO2018194261A1 (ko) 4&#39;-o-메틸알피눔 이소플라본의 치료적 용도
WO2023055008A1 (ko) 항비만 활성을 갖는 펩타이드 및 이의 용도
KR20150116410A (ko) 신규 5,6-다이하이드로에르고스테롤 글리코시드 유도체를 포함하는 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22825127

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE