WO2022255738A1 - Ci-1040, azd6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물 - Google Patents

Ci-1040, azd6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물 Download PDF

Info

Publication number
WO2022255738A1
WO2022255738A1 PCT/KR2022/007576 KR2022007576W WO2022255738A1 WO 2022255738 A1 WO2022255738 A1 WO 2022255738A1 KR 2022007576 W KR2022007576 W KR 2022007576W WO 2022255738 A1 WO2022255738 A1 WO 2022255738A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotide sequence
primer sequence
keloid
sequence
Prior art date
Application number
PCT/KR2022/007576
Other languages
English (en)
French (fr)
Inventor
손인석
홍젠유
강은호
류재면
콴후이얀
엘라가미 아메드 아메드 파르모하메드
Original Assignee
주식회사 아론티어
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 아론티어 filed Critical 주식회사 아론티어
Publication of WO2022255738A1 publication Critical patent/WO2022255738A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/166—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating hypertrophic scars and keloids comprising CI-1040 and/or AZD6482 as an active ingredient.
  • the present invention was made by the task identification number 1711096300 and detailed task number 2019M3E5D4066897 under the support of the Ministry of Science and ICT of the Republic of Korea. )", the title of the research project is "Development of an integrated platform for new drug development based on artificial intelligence", the host institution is Arontier Co., Ltd., and the research period is 2019.06.01 - 2021.12.31.
  • a scar is a trace of healing of skin tissue that has been damaged due to disease or trauma.
  • Scars include hypertrophic scars and keloids, which show a raised surface, and they show itchy or stinging symptoms.
  • Keloids are benign tumors in which the connective tissue of the skin proliferates to form hard bumps, and the epidermis becomes thin and looks glossy and red. Keloids often occur on the shoulders, ears, and chest. Hypertrophic scars are hard, the surface is raised more than the surrounding skin, and the surface is red and irregular.
  • both keloids and hypertrophic scars broadly belong to scars and belong to the same spectrum, they are distinct diseases. Both diseases show a protruding or raised aspect of the damaged area, but hypertrophic scars do not go beyond the boundaries of the damaged skin, whereas keloids occur outside the boundaries of the damaged area. In addition, hypertrophic scars may become flattened or reduced in size over time within one or several years, but keloids often spread beyond the existing scar area and continue to grow.
  • Methods currently used for the treatment of hypertrophic scars and keloids include topical steroid injection, suturing after excision, radiation therapy, compression therapy to reduce collagen proliferation by reducing oxygen and blood flow through physical compression, and application of silicone gel sheets or ointments. And laser therapy (Fraxel, CO 2 , V-beam, etc.), but the effect is to the extent of alleviating symptoms or has side effects, so treatment is limited. In particular, these treatments usually have a recurrence rate of 45% to 100%, requiring the development of new therapies (Lim KH, Itinteang T, Davis PF, Tan ST. Stem Cells in Keloid Lesions: A Review. Plast Reconstr Surg Glob Open. 2019 May 16;7(5):e2228.).
  • biomarkers for hypertrophic scars and keloids for which there is currently no standard treatment are known in the art (Suarez, E., Syed, F., Alonso-Rasgado, T. et al. Identification of biomarkers involved in differential profiling of Hypertrophic and keloid scars versus normal skin. Arch Dermatol Res 307, 115-133 (2015). Reference), there is currently no known treatment drug for hypertrophic scars and keloids that can effectively control the expression of the biomarker.
  • drug repurposing or drug repositioning strategy is the repurposing of existing drugs, i.e. repurposing them, given that new drug discovery and development has a high attrition rate, significant cost, and slow pace.
  • This is an increasingly attractive proposition as it can lower overall development costs, shorten development time, and allow the use of compounds with reduced risk factors (Pushpakom, S., Iorio, F., Eyers, P. et al. .Drug repurposing: progress, challenges and recommendations.See Nat Rev Drug Discov 18 , 41-58, 2019.). Therefore, the drug re-creation strategy is being usefully used to discover therapeutic drugs for incurable diseases for which there is no currently established treatment.
  • the present inventors have made intensive research efforts to search for and develop therapeutic agents for fibrotic disorders including hypertrophic scars and keloids, and more specifically, keloid-specific therapeutic agents.
  • biomarkers are selected through RNA sequencing in patients' hypertrophic scars and keloid tissues, and treatment of hypertrophic scars and keloids using the REMEDY method based on big data on the correlation between selected biomarkers, disease genomes and compounds
  • CI-1040 and AZD6482 among the derived candidate drugs can return the expression of the biomarker to normal in vitro , and in an in vivo rat excision wound model, CI-1040 is collagen By finding that reducing the amount of fiber, the present invention was completed.
  • an object of the present invention is to provide a method for screening drugs for preventing or treating keloid or hypertrophic scars.
  • Another object of the present invention is to provide a composition for preventing or treating hypertrophic scars or keloids comprising CI-1040, AZD6482, a pharmaceutically acceptable salt thereof, or a combination thereof as an active ingredient.
  • Another object of the present invention is to provide a composition for diagnosis of keloid or hypertrophic scars.
  • Another object of the present invention is to provide a method for providing information necessary for the diagnosis of keloid or hypertrophic scars.
  • the present invention provides a method for screening a drug for preventing or treating keloids comprising the following steps:
  • step (b) the expression level of one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 and HLA-DRA from the keloid-derived cells passed through step (a) measuring; Among the genes, the expression level of one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 and IGF2BP-1 is reduced compared to the gene expression level in keloid-derived cells in a state in which the drug candidate sample is not contacted.
  • any one or more genes selected from the group consisting of ANGPTL7, APOC1, IL10 and HLA-DRA is increased compared to the gene expression level in keloid-derived cells in a state in which the drug candidate sample is not contacted. It is selected as a drug for preventing or treating keloids.
  • the present inventors have made intensive research efforts to search for and develop therapeutic agents for fibrotic diseases including hypertrophic scars and keloids, and more specifically, keloid-specific therapeutic agents.
  • a biomarker was selected through RNA sequencing in the patient's hypertrophic scar and keloid tissue, and the REMEDY method (Arontier) based on the big data of the correlation between the selected biomarker, the disease genome and the compound, was used.
  • REMEDY method Arontier
  • CI-1040 and AZD6482 among the derived candidates can return the expression of the biomarker to normal in vitro , and in an in vivo rat excisional wound model, CI-1040 is a collagen fiber It was found that the amount of
  • the term 'scar' is a trace of healing of skin tissue that has been damaged due to disease or trauma, and refers to the result of the creation of new connective tissue that fills the defect in normal skin after damage. Scars are the result of biological processes that repair wounds in the skin, other organs and tissues of the body.
  • the term 'scarring' is a part of a natural healing process, and means the end point of wound healing, and aims to seal the skin from the external environment.
  • the term 'normal matured scar' is a trace of healing of skin tissue that has been damaged due to disease or trauma, mainly collagen protein, chondroitin sulphate and a very small number of fibroblasts after damage. It refers to a region in which connective tissue including (connective tissue) is accumulated in an orderly manner in the lower layer of the skin, that is, the dermis.
  • Normal mature scars are referred to herein as Scar or S.
  • the components that make up normal skin tissue may not remodel properly.
  • histamine-secreting mast cells may be excessively formed and cause itching, the number of sebaceous glands may decrease and become dry, and elastin fibers may decrease and become relatively hard. have.
  • scars can mature normally as a part of the natural healing process, but scars can be largely divided into atrophic scars, hypertrophic scars, keloids, etc. due to the reduction of tissue formation that does not recover skin defects after damage or excessive proliferation of fibrous tissue. can be classified.
  • the term 'atrophic scar' refers to a scar in the form of a depression compared to normal skin, in which relatively little connective tissue is formed.
  • Atrophic scars are relatively weak and elongated, and appear with stretch marks or striae distensae. Atrophic scars may appear in some acne scars, and pigment or hair may be lost when atrophic scars occur.
  • hypertrophic scar refers to a scar that is hard, red, and has an irregular surface as a lesion that is raised more than normal skin due to excessive formation of collagen fibers. It does not expand beyond its range and flattens or decreases in size over time, usually within one or several years.
  • hypertrophic scars are referred to as HS or H.
  • the term 'keloid' refers to a benign tumor in which the connective tissue of the skin proliferates pathologically to form a hard bump and the epidermis becomes thin and looks glossy and red. Over time, it is meant to encompass both intralesional and peri-lesional lesions, which often spread beyond the boundaries of the original injury site and continue to grow and spread more widely over time.
  • keloids are referred to as K or Keloids.
  • keloid-derived cells are separated from the subject by the following method.
  • the skin tissue of the keloid area including the intra-lesional and peri-lesional areas of a subject suffering from keloids, more specifically, the dermis is surgically excised using a sterilized scalpel or the like.
  • the resected dermal tissue can be sectioned and used for testing.
  • the sliced tissue may be used after treatment with a collagenase, followed by culturing and homogenization, but is not limited thereto.
  • the above-described homogenization may be specifically performed, for example, using a tissue homogenizer or through repetitive aspiration through a fine needle.
  • the homogenized sample is centrifuged to obtain a cell pellet.
  • the cell pellet is resuspended and cultured in an incubator.
  • the cultured cells are referred to as keloid-derived cells.
  • the keloid-derived cells include one or more stem cells composed of fibroblasts, myofibroblasts, embryonic stem (ESC)-like cells, and mesenchymal stem cells. Including, but not limited to.
  • the keloid-derived cells in the present invention may be fibroblasts. Fibroblasts among keloid-derived cells obtained according to the above method are referred to as keloid fibroblasts (KF).
  • a drug candidate group sample is brought into contact with the keloid-derived cells.
  • the drug candidate sample may include drugs that have been used for prevention or treatment of indications other than those for the prevention or treatment of scars, hypertrophic scars, or keloids, or are under development.
  • a drug candidate group sample each containing 20,000 drugs having one specific chemical structure is brought into contact with the keloid-derived cells.
  • step (b) the expression level of one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 and HLA-DRA from the keloid-derived cells passed through step (a) steps to measure
  • step (a) First, in the keloid-derived cells in contact with the drug candidate sample obtained as a result of step (a), RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 and HLA-DRA selected from the group consisting of The expression level of one or more genes is measured.
  • the expression level of any one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 and IGF2BP-1 among the genes in keloid-derived cells without contact with the drug candidate sample Compared with the gene expression level in keloid-derived cells in a state in which the expression level of one or more genes selected from the group consisting of ANGPTL7, APOC1, IL10, and HLA-DRA is reduced compared to the gene expression level or not contacted with the drug candidate sample In the case of an increased condition, it is selected as a drug for preventing or treating keloids.
  • the expression levels of the RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 and IGF2BP-1 genes are increased in keloids compared to normal mature scars and/or hypertrophic scars, and the expression levels of the ANGPTL7, APOC1, IL10 and HLA-DRA genes are normal mature scars and/or hypertrophic scars.
  • keloids Since it decreases in keloids compared to scars and / or hypertrophic scars, measuring the expression level of any one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 and HLA-DRA By doing so, keloids can be distinguished from normal mature scars and/or hypertrophic scars.
  • keloid-derived Reducing the expression level of one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 and IGF2BP-1 in cells, or selected from the group consisting of ANGPTL7, APOC1, IL10 and HLA-DRA A drug that increases the expression level of one or more genes and has a preventive or therapeutic effect on keloids can be selected.
  • drugs having preventive or therapeutic effects on keloids can be usefully selected from among several drug candidates.
  • the screening method for drugs for preventing or treating keloids of the present invention essentially measures the expression level of at least one of ERICH6B, GOLGA6L1, IL10 and HLA-DRA in step (b).
  • the expression level of the ERICH6B or GOLGA6L1 gene is reduced compared to the gene expression level in keloid-derived cells in a state in which the drug candidate sample is not contacted, or the expression level of the IL10 or HLA-DRA gene is not contacted with the drug candidate sample
  • the condition is increased compared to the gene expression level in keloid-derived cells in the condition, it is selected as a drug for preventing or treating keloid.
  • the expression levels of the ERICH6B and GOLGA6L1 genes are specifically increased in keloid-derived cells, and the expression levels of the IL10 and HLA-DRA genes are specifically decreased in keloid-derived cells, at least among ERICH6B, GOLGA6L1, IL10 and HLA-DRA By essentially measuring the expression level of one or more, it is possible to usefully distinguish keloids from normal mature and hypertrophic scars.
  • the phrase 'specifically increased in keloid-derived cells' indicates a significant difference in gene expression levels between normal mature scar-derived cells and hypertrophic scar-derived cells, which are cells obtained by culturing cells obtained from normal mature scars and hypertrophic scars. While there was no, it means a case where the gene expression level was significantly increased in keloid-derived cells compared to normal mature scar-derived cells and hypertrophic scar-derived cells.
  • the phrase 'specifically reduced in keloid-derived cells' indicates a significant difference in gene expression levels between normal mature scar-derived cells and hypertrophic scar-derived cells, which are cells obtained by culturing cells obtained from normal mature scars and hypertrophic scars. While there was no, it means that the gene expression level was significantly decreased in keloid-derived cells compared to normal mature scar-derived cells and hypertrophic scar-derived cells.
  • keloid-derived Specific to keloid which reduces the expression level of any one or more genes selected from the group consisting of ERICH6B and GOLGA6L1 in cells or increases the expression level of any one or more genes selected from the group consisting of IL10 and HLA-DRA
  • drugs with preventive or therapeutic effects can be selected.
  • RYR2 (Ryanodine receptor 2)' refers to a gene encoding RYR2 protein, a ryanodine receptor found mainly in the sarcoplasmic reticulum of heart muscle.
  • RYR2 protein is one of the components of the calcium channel and is composed of a tetramer of a ryanodine receptor protein that supplies calcium to the heart muscle and a tetramer of the FK506-binding protein 1B. Mutations in the RYR2 gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmia-induced right ventricular dysplasia.
  • ERICH6B glutamate rich 6B or glutamate-rich protein 6B
  • HJMD Hydrophilic Deformation Deformation
  • Ectodermal Dysplasia Ectrodactyly or Macular Dystrophy Syndrome.
  • GOLGA6L1 (golgin A6 family like 1 or golgin subfamily A member 6-like protein 1)' is a gene containing 10 exons located on chromosome 15q11.2 that codes for a protein highly expressed in human testis tissue. it means.
  • the GOLGA6L1 gene is known to be a mutated gene found at a frequency of 60% in patients with cetuximab-sensitive colorectal cancer (Jing C, Wang T, Ma R, Cao H, Wang Z, Liu S, Chen D , Zhang J, Wu Y, Zhang Y, Wu J, Feng J. New genetic variations discovered in KRAS wild-type cetuximab resistant chinese colorectal cancer patients. Mol Carcinog . 2020 May;59(5):478-491.).
  • TGF beta 3 (TGF beta 3, transforming growth factor beta-3)' refers to a gene encoding a protein known as a cytokine involved in cell differentiation, embryogenesis, and development.
  • 'collagen type VIII alpha 1 chain ( COL8A1 )' refers to a gene encoding one of the two alpha chains of type VIII collagen.
  • the COL8A1 protein is a short-chain collagen and is a major constituent of the basement membrane of the corneal endothelium.
  • Type VIII collagen fibrils can be homo- or hetero-trimeric, and alternative splicing transcript variants encoding the same protein have been observed.
  • IGF2BP-1 insulin like growth factor 2 mRNA binding protein 1, IGF2BP1' refers to a gene encoding one of the insulin-like growth factor 2 mRNA-binding protein family.
  • the IGF2BP-1 protein contains four K homology domains and two RNA recognition motifs, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein. It binds to mRNA and regulates its translation.
  • ANGPTL7 angiopoietin like 7, Angiopoietin-related protein 7
  • ANGPTL7 refers to a gene located on chromosome 1p36.22 that encodes a protein widely expressed in the heart and gallbladder.
  • ANGPTL7 is one of eight Angiopoietin-like proteins.
  • ANGPTL7 is known as one of the signature genes associated with cancer-associated extracellular matrix as a biomarker for prognosis and treatment of esophageal squamous cell carcinoma (ESCC) (Zhang H, Shi Q, Yang Z, Wang K, Zhang Z, Huang Z , Cui X, Li F.
  • ESCC esophageal squamous cell carcinoma
  • APOC1 'apolipoprotein C1
  • HDL high density lipoprotein
  • VLDL very low density lipoprotein
  • IL10 'interleukin 10
  • IL10 cytokine refers to a gene encoding a cytokine mainly produced by monocytes and a small amount by lymphocytes.
  • the IL10 cytokine has pleiotropic effects in immunomodulation and inflammation and down-regulates Th1 cytokines, MHC class II Ags and costimulatory molecules in macrophages.
  • IL10 cytokine improves B cell survival, proliferation and antibody production, inhibits the activity of NF-kappa B, and is involved in the regulation of the JAK-STAT signaling pathway.
  • HLA-DRA major histocompatibility complex, class II, DR alpha, or HLA-DRA1
  • Class II molecules are heterodimers composed of alpha and beta chains, both anchored to the membrane.
  • HLA-DRA proteins are expressed on the surface of various antigen-presenting cells, such as B lymphocytes, dendritic cells, and monocytes/macrophages, and play a central role in the response of the immune system to present extracellular proteins, particularly pathogen-derived peptides, to T cells. do.
  • the present invention provides a method for screening a drug for preventing or treating hypertrophic scars, comprising the following steps:
  • step (b) measuring the expression level of one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1, IGF2BP-1, ANGPTL7 and APOC1 from hypertrophic scar-derived cells subjected to step (a);
  • the expression level of one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1 and IGF2BP-1 among the genes is reduced compared to the gene expression level in hypertrophic scar-derived cells in a state in which the drug candidate sample is not contacted, or
  • the expression level of one or more genes selected from the group consisting of ANGPTL7 and APOC1 is increased compared to the gene expression level in hypertrophic scar-derived cells in a state in which the drug candidate group sample is not contacted, it is a drug for preventing or treating hypertrophic scars is chosen
  • the method of separating the hypertrophic scar-derived cells from the subject is the same as that of the keloid-derived cells.
  • the subject may include mice, rats, guinea pigs, rabbits, pigs, cattle, sheep, horses, non-human primates and humans suffering from hypertrophic scars, but is limited thereto It is not.
  • the subject may have normal mature scars, hypertrophic scars and keloids.
  • cells derived from hypertrophic scars can be isolated from humans suffering from hypertrophic scars or from rat excisional wound models.
  • the hypertrophic scar-derived cells include one or more stem cells composed of fibroblasts, myofibroblasts, embryonic stem (ESC)-like cells, and mesenchymal stem cells. Includes, but is not limited to. Specifically, hypertrophic scar-derived cells in the present invention may be fibroblasts.
  • the expression level of one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1, IGF2BP-1, ANGPTL7 and APOC1 is measured in hypertrophic scar-derived cells in contact with the drug candidate sample obtained in step (a).
  • the expression level of any one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1 and IGF2BP-1 was compared with the gene expression level in hypertrophic scar-derived cells without contacting the drug candidate sample. Hypertrophic scar prevention or as a drug for treatment.
  • Hypertrophic scars can be distinguished from normal mature scars by measuring the expression level of any one or more genes selected from the group consisting of IGF2BP-1, ANGPTL7 and APOC1.
  • the gene expression level in hypertrophic scar-derived cells in the non-contact state is compared with the drug candidate sample in contact with the drug candidate sample.
  • the expression level of any one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1 and IGF2BP-1 is reduced, or the expression level of any one or more genes selected from the group consisting of ANGPTL7 and APOC1
  • a drug that has a preventive or therapeutic effect on hypertrophic scars can be selected.
  • a drug having a preventive or therapeutic effect on hypertrophic scars can be usefully selected from among several drug candidates.
  • the screening method for a drug for preventing or treating hypertrophic scars of the present invention includes the same or similar steps as the method for screening a drug for preventing or treating keloids, which is another aspect of the present invention, overlapping to avoid excessive complexity described herein The content is used and its description is omitted.
  • the present invention provides a pharmaceutical composition for preventing or treating hypertrophic scars or keloids comprising CI-1040, AZD6482, a pharmaceutically acceptable salt thereof, or a combination thereof as an active ingredient provides
  • the pharmaceutical composition of the present invention includes candidate drugs derived by performing the method for screening a drug for preventing or treating keloids and the method for screening a drug for preventing or treating hypertrophic scars, which are another aspect of the present invention described above.
  • CI-1040' has a molecular formula of C 17 H 14 ClF 2 IN 2 O 2 and an IUPAC name of 2-[(2-Chloro-4-iodophenyl)amino]- N -(cyclopropylmethoxy)-3,4- A difluorobenzamide, also called PD184352, refers to a selective non-competitive inhibitor of MEK (MKK1, MAPK kinase), which has anticancer activity and inhibits the ERK pathway.
  • MKK1 MAPK kinase
  • the term 'AZD6482' has a molecular formula of C 22 H 24 N 4 O 4 and an IUPAC name of 2-[[(1R)-1-(7-methyl-2-morpholin-4-yl-4-oxopyrido[1, 2-a]pyrimidin-9-yl)ethyl]amino]benzoic acid, (-) 2-[1-(7-methyl-2-(morpholin-4-yl)-4-oxo-4H-pyrido [1,2-a]pyrimidin-9-yl)ethylamino]benzoic acid and 2-[[(1R)-1-[7-methyl-2-(4-morpholinyl)-4-oxo-4H- Also called pyrido[1,2-a]pyrimidin-9-yl]ethyl]amino]-benzoic acid, it refers to a heteroform-selective and potent ATP competitive inhibitor of PI3K ⁇ , which has antithrombotic effects.
  • the term 'pharmaceutically acceptable salts thereof' of the present invention means a desired pharmacological effect, that is, reducing the amount of collagen fibers, or abnormally-regulated expression level of the above-mentioned biomarkers in normal mature scars. It means a salt of the compound CI-1040 or AZD6482 having an effect of preventing or treating hypertrophic scars and keloids by regulating the expression in the direction of expression.
  • AZD6482 and pharmaceutically acceptable salts of AZD6482 are hypertrophic by increasing the expression of one or more genes selected from the group consisting of ANGPTL7 and APOC1 It refers to a salt of a compound having an effect of preventing or treating scars and keloids.
  • These salts include inorganic acids such as hydrogen chloride, hydrogen bromide, and hydrogen iodide; Tylate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptano It can be formed using organic acids such as ate, hexanoate, 2-hydroxyethane sulfate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, tosylate, and undecanoate.
  • inorganic acids such as hydrogen chloride, hydrogen bromide, and hydrogen iodide
  • Tylate butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate,
  • the term 'combination thereof' of the present invention means a composition comprising CI-1040 or a pharmaceutically acceptable salt thereof and AZD6482 or a pharmaceutically acceptable salt thereof.
  • CI-1040 or a pharmaceutically acceptable salt thereof and AZD6482 or a pharmaceutically acceptable salt thereof of the present invention are pharmacologically compatible.
  • the term 'comprising as an active ingredient' of the present invention means including an amount sufficient to achieve the pharmacological efficacy or activity of CI-1040, AZD6482, a pharmaceutically acceptable salt thereof, or a combination thereof of the present invention. It means that various components can be additionally added for drug delivery, stabilization, and formulation.
  • the efficacy of the pharmaceutical composition was verified for hypertrophic scars and keloids based on normal mature scars.
  • hypertrophic scars and keloids are caused by collagen proliferation.
  • 'collagen' is a fibrous protein, also called collagen, and refers to a protein in which three polypeptide molecules, which occupy most of connective tissue such as skin and cartilage, are twisted into a triple helix.
  • the pharmaceutical composition of the present invention reduces the amount of collagen fibers.
  • 'collagen fiber' refers to a fiber made of collagen protein present in a large amount in connective tissue. Collagen proteins secreted from cells form intermolecular cross-links in the intercellular matrix and form fibers, so that when observing the collagen fibers under an electron microscope, horizontal stripes are observed.
  • the pharmaceutical composition of the present invention can return the genomic expression of hypertrophic scars and keloids to the level of genomic expression of normal mature scars.
  • Genomes whose expression is dysregulated in hypertrophic scars and keloids that can be returned to the normal mature scar genome expression level by the pharmaceutical composition of the present invention include RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, One or more genes selected from the group consisting of APOC1, IL10 and HLA-DRA genes are included, but are not necessarily limited thereto.
  • hypertrophic scars are those in which the expression of one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1 and IGF2BP-1 is increased compared to normal mature scars.
  • hypertrophic scars are those in which the expression of one or more genes selected from the group consisting of ANGPTL7 and APOC1 is reduced compared to normal mature scars.
  • hypertrophic scars have increased expression of one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1 and IGF2BP-1 compared to normal mature scars, and ANGPTL7 and APOC1 compared to normal mature scars. The expression of one or more genes selected from the group is decreased.
  • the keloid is an increase in the expression of one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 and IGF2BP-1 compared to normal mature scars.
  • keloid is a decrease in the expression of one or more genes selected from the group consisting of ANGPTL7, APOC1, IL10 and HLA-DRA compared to normal mature scars.
  • the keloid has an increased expression of one or more genes selected from the group consisting of RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 and IGF2BP-1 compared to normal mature scars, ANGPTL7 compared to normal mature scars, A decrease in the expression of one or more genes selected from the group consisting of APOC1, IL10 and HLA-DRA.
  • keloids show increased expression of one or more genes selected from the group consisting of ERICH6B and GOLGA6L1 compared to hypertrophic scars, and one or more genes selected from the group consisting of IL10 and HLA-DRA compared to hypertrophic scars expression is reduced.
  • CI-1040 or a pharmaceutically acceptable salt thereof of the present invention reduces the expression of one or more genes selected from the group consisting of TGFB3, COL8A1 and IGF2BP-1.
  • AZD6482 or a pharmaceutically acceptable salt thereof of the present invention increases the expression of one or more genes selected from the group consisting of ANGPTL7 and APOC1.
  • composition of the present invention is administered in combination with methylprednisolone or a pharmaceutically acceptable salt thereof. In another embodiment of the present invention, the composition of the present invention is administered concurrently or sequentially with methylprednisolone.
  • 'methylprednisolone' has a molecular formula of C 22 H 30 O 6 and is a glucocorticoid receptor agonist-based steroid drug that is currently used as a treatment for keloids. It refers to synthetic corticosteroids with action. Methylprednisolone is also used for the treatment of rheumatoid arthritis, allergic diseases, etc., and serious side effects may occur when continuously used in high doses, so treatment is limited.
  • methylprednisolone of the present invention increases the expression of one or more genes selected from the group consisting of ANGPTL7, APOC1 and HLA-DRA.
  • the pharmaceutical composition of the present invention further comprises a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier of the present invention is commonly used in the art to which the present invention pertains, and is pharmacologically compatible with the active ingredients of the present invention, CI-1040, AZD6482, pharmaceutically acceptable salts thereof, or combinations thereof. compatible
  • Pharmaceutically acceptable carriers that may be further included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto.
  • the pharmaceutical composition of the present invention may further include excipients, stabilizers, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, in addition to the above components.
  • excipients stabilizers, diluents, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like.
  • Suitable pharmaceutically acceptable carriers, vehicles, excipients, stabilizers or diluents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, percutaneous injection ), intracerebral injection, intraspinal injection, etc.
  • the pharmaceutical composition of the present invention can be injected intradermally.
  • the pharmaceutical composition of the present invention can be injected intradermally in one, two, or three places near the wound (wound) site.
  • the pharmaceutical composition of the present invention can be injected intradermally once, twice, three times or four times near the wound site.
  • the pharmaceutical composition of the present invention can be injected near the wound site every 4 days.
  • the pharmaceutical composition of the present invention may be intradermally injected 4 times at 4-day intervals in three places near the wound site.
  • the suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, medical condition, food, administration time, administration route, excretion rate and reaction sensitivity, A ordinarily skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis.
  • the dosage of the pharmaceutical composition of the present invention is preferably 0.0001-1000 mg/kg (body weight) per day.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. or it may be prepared by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet or capsule, and may additionally contain a dispersing agent or stabilizer.
  • the pharmaceutical composition of the present invention can be used for the prevention or treatment of hypertrophic scars and/or keloids.
  • the term 'prevention' as used herein refers to the prevention or protective treatment of a disease or disease state.
  • treatment' as used herein means reduction, suppression, sedation or eradication of a disease state.
  • the present invention provides a composition for diagnosis of keloid or hypertrophic scars comprising at least one pair of primer sequences selected from the following as an active ingredient:
  • ANGPTL7 having the nucleotide sequence of SEQ ID NO: 3 and a reverse primer sequence for ANGPTL7 having the nucleotide sequence of SEQ ID NO: 4;
  • ERICH6B having the nucleotide sequence of SEQ ID NO: 7 and a reverse primer sequence for ERICH6B having the nucleotide sequence of SEQ ID NO: 8;
  • TGFB3 having the nucleotide sequence of SEQ ID NO: 17 and a reverse primer sequence for TGFB3 having the nucleotide sequence of SEQ ID NO: 18;
  • the composition contains as an active ingredient at least one pair of primer sequences selected from the following and is for keloid-specific diagnosis:
  • ERICH6B having the nucleotide sequence of SEQ ID NO: 7 and a reverse primer sequence for ERICH6B having the nucleotide sequence of SEQ ID NO: 8;
  • for keloid-specific diagnosis means a use for selectively diagnosing keloids by distinguishing keloids from normal mature scars and hypertrophic scars.
  • keloids When using the keloid-specific diagnostic composition of the present invention, keloids can be selectively diagnosed from hypertrophic scars. That is, keloids can be distinguished from normal mature scars and hypertrophic scars.
  • the composition comprises at least one pair of primer sequences selected from the following as an active ingredient and is for diagnosis of hypertrophic scars:
  • ANGPTL7 having the nucleotide sequence of SEQ ID NO: 3 and a reverse primer sequence for ANGPTL7 having the nucleotide sequence of SEQ ID NO: 4;
  • TGFB3 having the nucleotide sequence of SEQ ID NO: 17 and a reverse primer sequence for TGFB3 having the nucleotide sequence of SEQ ID NO: 18;
  • composition for diagnosis of keloid or hypertrophic scars is RT-PCR, qRT-PCR, Northern blot, ribonuclease protection assay, in situ hybridization, fluorescence in situ hybridization
  • mRNA expression level of a gene can be quantified or measured through an mRNA quantification method known in the art, such as (Fluorescence In Situ Hybridization).
  • the diagnostic composition according to the present invention measures the mRNA expression level of a gene in normal mature scar tissue, hypertrophic scars and keloids through the qRT-PCR method, and compares them to diagnose hypertrophic scars or keloids or It can provide information necessary for prognostic analysis.
  • a kit for diagnosing hypertrophic scars and/or keloids comprising the composition for diagnosing keloids or hypertrophic scars according to the present invention may be provided.
  • the diagnostic composition of the present invention can be used to provide information necessary for diagnosis or prognostic analysis of hypertrophic scars and/or keloids.
  • the term 'diagnosis or prognosis' refers to determining the susceptibility of a subject to a specific disease or disorder, determining whether an object currently has a specific disease or disorder, or being affected by a specific disease or disorder Determining the prognosis of an affected subject (e.g., predicting the likelihood of recovery for hypertrophic scar and keloid treatment), or therametrics (e.g., monitoring the subject's condition to provide information about treatment efficacy) including doing)
  • composition for diagnosing keloid or hypertrophic scars of the present invention includes forward and reverse primers of genes measured in the method for screening drugs for preventing or treating keloid or hypertrophic scars, which is another aspect of the present invention, excessive complexity described herein In order to avoid, duplicate contents are used, and descriptions thereof are omitted.
  • the present invention provides a method for providing information necessary for diagnosis of keloid or hypertrophic scars, including:
  • the biological sample isolated from the subject of the present invention includes epidermis, basement membrane, dermis, subcutaneous tissue, sweat glands, sweat pores, sebaceous glands, Hair follicles and the like are included, but are not limited thereto.
  • the epidermis includes a stratum basale, a stratum spinosum, a stratum granulosum, a stratum corneum, and a stratum lucidum.
  • the dermis includes connective tissue, collagen fibers, smooth muscle tissue and nerve tissue.
  • the subcutaneous tissue is a loose connective tissue rich in adipose tissue.
  • the biological sample may be cells obtained by culturing cells obtained from a subject.
  • the biological sample of the present invention includes hypertrophic scars and/or keloids, but is not necessarily limited thereto.
  • the biological sample of the present invention may include scar tissue or fibrous tissue formed in organs such as liver, kidney, and lung.
  • a normal control sample of the present invention includes, but is not necessarily limited to, a normal mature scar.
  • a subject of the present invention is a human suffering from keloids.
  • keloid-derived cells can be isolated from humans suffering from keloids.
  • step (b) the expression level of at least one of ERICH6B, GOLGA6L1, IL10 and HLA-DRA is essentially measured, and information necessary for keloid-specific diagnosis is provided:
  • the ERICH6B or GOLGA6L1 gene expression level is increased compared to the gene expression level in the normal control sample, or the IL10 or HLA-DRA gene expression level is decreased compared to the gene expression level in the normal control sample, keloid judged by
  • step (b) the expression level of any one or more genes selected from the group consisting of RYR2, TGFB3, COL8A1 and IGF2BP-1 is increased compared to the level of gene expression in a normal control sample, or If the expression level of any one or more genes selected from the group consisting of , ANGPTL7 and APOC1 is reduced compared to the gene expression level in the normal control sample, it is judged as a hypertrophic scar.
  • the method for providing information necessary for diagnosis of keloid or hypertrophic scars of the present invention uses the composition for diagnosing keloid or hypertrophic scars, which is another aspect of the present invention described above, redundant content is omitted to avoid excessive complexity described herein. It is used, and its description is omitted.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising CI-1040, AZD6482, a pharmaceutically acceptable salt thereof, or a combination thereof according to another aspect described above as an active ingredient.
  • a method for preventing or treating hypertrophic scars or keloids which includes administering to a subject in need thereof.
  • the subject is a mammal.
  • the subject may include mouse, rat, guinea pig, rabbit, dog, cat, pig, cow, sheep, horse, non-human primate, and human, but is not necessarily limited thereto.
  • non-human primates include, but are not necessarily limited to, prosimians, old world monkeys, new world monkeys, and anthropoids.
  • the non-human primates include, but are not necessarily limited to, crab monkeys ( Macaca fascicularis ), rhesus monkeys ( Macaca mulatta ) and marmoset monkeys ( Callithrix jacchus ).
  • the subject may be in a condition suspected of suffering from a hypertrophic scar or keloid.
  • the subject may be in a state of differential diagnosis of hypertrophic scars or keloids from normal mature scars in order to select an appropriate treatment method.
  • the subject may be in a state of differential diagnosis from atrophic scars to hypertrophic scars or keloids in order to select an appropriate treatment method.
  • the subject may be in a state of differential diagnosis from hypertrophic scars to keloids in order to select an appropriate treatment method.
  • the subject may be in a state of being differentially diagnosed with hypertrophic scars from keloids in order to select an appropriate treatment method.
  • the method for preventing or treating hypertrophic scars or keloids of the present invention includes the step of administering the pharmaceutical composition, which is another aspect of the present invention described above, redundant information is used to avoid excessive complexity described herein, omit the description.
  • SEQ ID NO: 1 is a forward primer sequence used in RT-PCR experiments for the RYR2 gene, which is a UU pattern biomarker.
  • SEQ ID NO: 2 is a reverse primer sequence used in the RT-PCR experiment for the RYR2 gene, which is a UU pattern biomarker.
  • SEQ ID NO: 3 is the forward primer sequence used in the RT-PCR experiment for the ANGPTL7 gene, which is a DD pattern biomarker.
  • SEQ ID NO: 4 is the reverse primer sequence used in the RT-PCR experiment for the ANGPTL7 gene, which is a DD pattern biomarker.
  • SEQ ID NO: 5 is a forward primer sequence used in the RT-PCR experiment for the APOC1 gene, which is a DD pattern biomarker.
  • SEQ ID NO: 6 is the reverse primer sequence used in the RT-PCR experiment for the APOC1 gene, which is a DD pattern biomarker.
  • SEQ ID NO: 7 is the forward primer sequence used in the RT-PCR experiment for the ERICH6B gene, which is a FU pattern biomarker.
  • SEQ ID NO: 8 is the reverse primer sequence used in the RT-PCR experiment for the ERICH6B gene, which is a FU pattern biomarker.
  • SEQ ID NO: 9 is the forward primer sequence used in the RT-PCR experiment for the GOLGA6L1 gene, which is a FU pattern biomarker.
  • SEQ ID NO: 10 is the reverse primer sequence used in the RT-PCR experiment for the GOLGA6L1 gene, which is a FU pattern biomarker.
  • SEQ ID NO: 11 is a forward primer sequence used in the RT-PCR experiment for the IL10 gene, which is an FD pattern biomarker.
  • SEQ ID NO: 12 is a reverse primer sequence used in the RT-PCR experiment for the IL10 gene, which is an FD pattern biomarker.
  • SEQ ID NO: 13 is the forward primer sequence used in the RT-PCR experiment for the HLA-DRA gene, which is an FD pattern biomarker.
  • SEQ ID NO: 14 is the reverse primer sequence used in the RT-PCR experiment for the HLA-DRA gene, which is an FD pattern biomarker.
  • SEQ ID NO: 15 is the forward primer sequence used in the RT-PCR experiment for the IGF2BP-1 gene, which is a UF pattern biomarker.
  • SEQ ID NO: 16 is the reverse primer sequence used in the RT-PCR experiment for the IGF2BP-1 gene, which is a UF pattern biomarker.
  • SEQ ID NO: 17 is the forward primer sequence used in the RT-PCR experiment for the TGFB3 gene, which is a UF pattern biomarker.
  • SEQ ID NO: 18 is the reverse primer sequence used in the RT-PCR experiment for the TGFB3 gene, which is a UF pattern biomarker.
  • SEQ ID NO: 19 is the forward primer sequence used in the RT-PCR experiment for the COL8A1 gene, which is a UF pattern biomarker.
  • SEQ ID NO: 20 is the reverse primer sequence used in the RT-PCR experiment for the COL8A1 gene, which is a UF pattern biomarker.
  • SEQ ID NO: 21 is the forward primer sequence used in the RT-PCR experiment for the human GAPDH gene.
  • SEQ ID NO: 22 is the reverse primer sequence used in the RT-PCR experiment for the human GAPDH gene.
  • the present invention provides a method for screening drugs for preventing or treating keloids or hypertrophic scars.
  • the present invention provides a pharmaceutical composition for preventing or treating hypertrophic scars or keloids comprising CI-1040, AZD6482, a pharmaceutically acceptable salt thereof, or a combination thereof as an active ingredient.
  • the present invention provides a composition for diagnosis of keloid or hypertrophic scars.
  • the present invention provides a method for providing information necessary for the diagnosis of keloid or hypertrophic scars.
  • the expression of dysregulated genes in keloids or hypertrophic scars is regulated to return to the direction of gene expression in normal mature scars.
  • a pharmaceutical composition containing CI-1040 and/or AZD6482 which is a drug selected through the screening method, and a pharmaceutically acceptable salt thereof as an active ingredient, in keloid or hypertrophic scars. Since the expression level of abnormally regulated genes can be adjusted to return to normal mature scar gene expression, it can be easily used for the prevention or treatment of keloid and/or hypertrophic scars.
  • hypertrophic scars and keloids can be distinguished from normal mature scars, or keloids can be specifically distinguished from normal mature scars and hypertrophic scars, providing information necessary for diagnosis of hypertrophic scars or keloids How to do it can be useful.
  • Figure 1 shows an outline for preparing transcriptome data for genome-based drug repositioning research.
  • Figure 2 shows a model divided into eight pattern configurations after gene expression analysis of scars, hypertrophic scars, and keloid tissues.
  • S represents a scar
  • H represents a hypertrophic scar
  • K represents a keloid.
  • Figure 3 shows the models divided into 8 pattern configurations after gene expression analysis and 3 groups divided based on cutoffs of 1.33 fold, 1.5 fold and 2 fold.
  • S represents scars
  • HS represents hypertrophic scars
  • K represents keloids
  • N represents the number of genes.
  • Figure 4 shows the results of confirming the mRNA expression changes of hypertrophic scar biomarkers by qRT-PCR after treatment with DMSO, 5 ⁇ M or 50 ⁇ M of CI-1040 in fibroblasts #155, #178 and #559 extracted from patient keloid tissues. . Results showing significant changes in a concentration-dependent manner are highlighted with a blue box.
  • Figure 5 shows the results of confirming the mRNA expression changes of hypertrophic scar biomarkers by qRT-PCR after treatment with DMSO, 10 ⁇ M or 100 ⁇ M AZD6482 in fibroblasts #155, #178, and #559 extracted from patient keloid tissues. Results showing significant changes in a concentration-dependent manner are highlighted in red boxes.
  • Figure 6 shows the results of confirming the mRNA expression changes of hypertrophic scar biomarkers by qRT-PCR after treatment with DMSO, 10 ⁇ M or 100 ⁇ M methylprednisolone in fibroblasts #155, #178 and #559 extracted from patient keloid tissues. Results showing significant changes in a concentration-dependent manner are highlighted in red boxes.
  • Figure 7 shows the outline of the animal test timeline and group classification, drug names and administration concentrations of the rat excisional wound model.
  • H&E staining hematoxylin and eosin staining
  • MTS Masson's Trichrome staining
  • Figure 9 shows the macroscopic appearance of the rat excisional wound model on day 0 (day 0).
  • G1 represents group 1
  • G2 represents group 2
  • G3 represents group 3
  • G4 represents group 4
  • X in G1-X represents an identification number for each rat individual.
  • 11 shows the macroscopic appearance of the rat excisional wound model on day 14.
  • Example 1 Preparation of keloid, hypertrophic scars and scar tissue samples
  • Transcriptome data was prepared as shown in FIG. 1 to conduct a transcriptome-based drug repositioning study for the discovery of candidate drugs for the treatment of hypertrophic scars and keloids.
  • Keloid parts including intralesional and peri-lesional. Referred to as Keloid, K
  • FFPE paraffin-embedded
  • Example 2 Selection of hypertrophic scar and keloid-specific biomarkers
  • RNA sequencing was performed using the keloid, hypertrophic scar, and scar tissue samples obtained in Example 1, and hypertrophic scar and keloid-specific biomarkers were selected by comparative analysis of gene expression data for each tissue.
  • RNA sequencing was performed from the patient-derived tissue samples, and data processing and quantification were performed as follows. Adapter sequences from RNA-seq reads were trimmed out with Cutadapt (version 2.3), along with STAR aligner (version 2.4.2a) and corresponding gene annotations. Aligned with the human reference genome. Aligned reads were quantified at the gene level by HTSeq (version 0.12.4) with "intersection-nonempty" mode. The "intersection-nonempty" mode preferentially assigns genes with more overlap to reads when aligned reads are located in a region shared by multiple genes, assuming that higher base coverage indicates a higher read generation probability. And if there is a sequence specifically corresponding to the transcript sequence of a specific gene, it means a mode that is used for quantification of the above-mentioned gene even if it has a sequence other than some transcript sequence.
  • the expression level of each gene is compared between scars vs. hypertrophic scars and hypertrophic scars vs. keloids compared.
  • Keloid tissue was used as the experimental group, and hypertrophic scars and normal mature scars were used as the control group. Gene expression patterns were observed in the experimental group and the control group, and a gene database specifically expressed in keloid tissue was constructed to conduct gene expression analysis.
  • UU Up-Up
  • UF Up-Flat
  • UD Up-Down
  • FU Flat-Up
  • FF Flat-Flat
  • FD Flat-Down
  • DU Down-Up
  • DF Down-Flat
  • DD Down-Down
  • the Flat-Flat (FF) pattern model was not analyzed.
  • the UU model represents a model in which gene expression is increased in hypertrophic scar tissue compared to scar tissue, and at the same time gene expression is increased in keloid tissue compared to hypertrophic scar tissue. The results are shown in Figure 2.
  • FD and FU models are keloid-specific with increased or decreased gene expression only in K tissues compared to S and H, they are marked as "Keloid Specific", and UD and DU models have increased or decreased gene expression only in HS compared to S and K, resulting in hypertrophy Since it is scar-specific, it is designated as "HyperScar Specific”.
  • the cutoff was based on a 1.33-fold increase or decrease, a 1.5-fold increase or decrease, and a 2-fold increase or decrease in gene expression in the tissue to be analyzed compared to the comparative tissue.
  • the group setting results are shown in FIG. 3 .
  • group 1 has a cutoff of 1.33 times, group 2 is 1.5 times, and group 3 is 2 times, and the number of genes belonging to the 9 models in each group is shown in parentheses (FF is not analyzed), hypertrophy Gene groups for selection of candidate drugs for the prevention or treatment of scars and keloids are marked with red boxes.
  • keloid gene biomarker group No. 1 is an up gene group that is highly expressed by 1.33 times in the order of scar ⁇ HS ⁇ Keloid, and conversely, 1.33 in the order of Keloid ⁇ HS ⁇ scar It was composed of a group of down genes with doubly high expression.
  • 33 genes were derived in the up group (UU) and 198 genes in the down group (DD).
  • keloid gene biomarker group No. 2 is an up gene group that is highly expressed by 1.5 times in the order of scar ⁇ HS ⁇ Keloid, and conversely expressed by 1.5 times in the order of Keloid ⁇ HS ⁇ scar It was composed of a group of down genes that In group 2, 12 genes were derived from the up group (UU) and 64 genes from the down group (DD).
  • keloid gene biomarker group No. 3 is a gene (UU, 2) that is expressed 2 times higher in the order of scar ⁇ HS ⁇ Keloid and 2 times more in Keloid than scar and HS
  • the up group was composed of highly expressed genes (FU, 49), and genes expressed twice as high in the order of Keloid ⁇ HS ⁇ scar (DD, 5) and genes expressed twice more in scar and HS than in Keloid (FD, 165) constituted the down gene group.
  • FU highly expressed genes
  • DD genes expressed twice as high in the order of Keloid ⁇ HS ⁇ scar
  • FD HS than in Keloid
  • low-expressed genes i.e., genes with a read count of less than 3 in 50% or more samples of each tissue group
  • each gene was considered differentially expressed if it changed more than 2-fold in each comparison.
  • the biomarkers selected as observation targets were as follows: RYR2 in the UU pattern; ERICH6B and GOLGA6L1 in the FU pattern; TGFB3, COL8A1 and IGF2BP-1 in the UF pattern; ANGPTL7 and APOC1 in the DD pattern; and IL10 and HLA-DRA in the FD pattern.
  • REMEDY Alontier
  • Example 3 Selection method for keloid treatment candidate drug using REMEDY
  • REMEDY REpurposing MEDIcation
  • the present inventors generated 600,000 signatures by treating 20,000 drugs to 80 different cell lines.
  • the correlation between disease genome expression and these 600,000 signatures is compared with the KS score (Kolmogorov-Smirnov score) to select the top 1000 signatures and clustering analysis is performed with t-Distributed Stochastic Neighbor Embedding (t-SNE) If you do, you can select the final drug that can return the gene expression of the disease to be treated to normal, and this is the REMEDY method.
  • Arontier's REMEDY method based on big data on the correlation between genomes and compounds is described in detail in order to proceed with drug re-creation analysis for preventing or treating keloids with genes derived from groups 1, 2, and 3 described above. used as described above.
  • the present inventors examined hypertrophic scars and keloid biomarker expression in patient-derived keloid fibroblasts in vitro to verify whether the four secondary candidate drugs had keloid preventive or therapeutic effects. As a result of the efficacy verification of the four drugs at the cellular level, the results of the two drugs with verified efficacy and the positive control drug, methylprednisolone, are shown below.
  • the dermis was isolated from a patient suffering from keloids and sectioned into approximately 1 mm 3 fragments using a No. 11 blade. 750 U/ml of Collagenase II (Invitrogens, Carlsbad, Calif.) was added to these fragments and incubated at 37° C. for 4 hours. This mixture was aspirated 4 times through 18G, 21G and 23G needles for each needle. Samples were then centrifuged at 1,500 rpm for 5 minutes. Thereafter, the supernatant was decanted to obtain a cell pellet.
  • Collagenase II Invitrogens, Carlsbad, Calif.
  • Subcultured cells were then placed in serum-free DMEM containing 0.1% bovine serum albumin (BSA, Sigmas, St Louis, Mo.) and antibiotics without phenol red.
  • BSA bovine serum albumin
  • the keloid fibroblasts (KF, Keloid Fibroblast) used in this experiment were limited to 3 to 8 passages. All experiments were performed in duplicate and repeated three times.
  • RNAiso Plus® TaKaRa
  • Applied Biosystems High-capacity cDNA reverse transcription kit
  • An aliquot (1/20) of each cDNA reaction was analyzed by qRT-PCR using the StepOne Real-Time PCR system (Applied Biosystems).
  • the gene-specific primers shown in Table 1 below were mixed with SYBR green PCR master mix (Applied Biosystems).
  • the mRNA levels of 10 biomarker genes and human GAPDH, an endogenous control gene, were determined using a relative standard curve quantitation method. Primer sequences of each gene are shown in Table 1 below.
  • Fibroblasts (#155, #178 and #559) extracted from keloid tissues of three different patients were treated with DMSO, a negative control, and CI-1040, a candidate drug, at 5 ⁇ M and 50 ⁇ M, respectively, 72 hours after the cells were treated. Afterwards, changes in mRNA expression of 10 types of hypertrophic scars and keloid biomarkers were observed through RT-PCR by the method of 4-2 described above. Results for CI-1040 are shown in FIG. 4 .
  • AZD6482 another candidate drug, was also treated with 10 ⁇ M of DMSO, a negative control, and AZD6482, a candidate drug, to fibroblasts (#155, #178, and #559) extracted from keloid tissues of three different individuals, similarly to Example 4-3 above. , 72 hours after each cell treatment at a concentration of 100 ⁇ M, changes in mRNA expression of 10 hypertrophic scars and keloid biomarkers were observed through RT-PCR by the method described in 4-2 above. Results for AZD6482 are shown in FIG. 5 .
  • AZD6482 significantly increased the mRNA expression levels of ANGPTL7 and APOC1 genes, which are DD pattern biomarkers, compared to the control group (see red box in FIG. 5). Both ANGPTL7 and APOC1 genes were increased in a dose-dependent manner in the three fibroblasts.
  • Methylprednisolone a glucocorticoid receptor agonist currently used as a treatment for keloids, was used as a positive control drug. Similar to Example 4-3, fibroblasts (#155, #178 and #559) extracted from keloid tissues of three different individuals were treated with DMSO as a negative control and methylprednisolone as a positive control at concentrations of 10 ⁇ M and 100 ⁇ M. 72 hours after each cell treatment, changes in mRNA expression of 10 hypertrophic scars and keloid biomarkers were observed through RT-PCR by the method of 4-2 described above. The results for methylprednisolone are shown in FIG. 6 .
  • Example 4 In order to verify in vivo the effect of preventing or treating hypertrophic scars and keloids of the drug finally selected in Example 4, the efficacy evaluation center under the New Drug Development Support Division of ChemOn Co., Ltd. test name "Drug in Wound-Induced Spraque-Dawley Rats" An animal experiment was requested with the effect of treating 6 types of wounds other than A”.
  • a rat excision wound model was formed as follows, and histopathological analysis using a microscope slide scanner in Example 6 to be described later and macroscopic using photography in Example 7 to be described below ( macroscopic) appearance analysis was performed. The timeline of animal experiments is shown in FIG. 7 .
  • Group drug dose concentration Group 1 DMSO 100% Group 2 Methylprednisolone 20 mM Group 3 CI-1040 10 mM Group 4 AZD6482 20 mM
  • MTS Masson's Trichrome Stain
  • MT Masson's trichrome
  • SC scab
  • ED epidermis
  • DE dermis
  • CM cutaneous muscle (rhabdomestic muscle attached to the skin)
  • EP epithelium (Epithelium)
  • HF Hair follicle
  • RM test article residual.
  • the ratio occupied by collagen fibers was the lowest at 26.81% in the CI-1040 administration group (G3), which was the negative control DMSO administration group (G1, G3). 46.73%), a statistically significant decrease ( p ⁇ 0.05). There was no statistical difference between the other administration groups (G2, 57.64% and G4, 55.98%) compared to the DMSO administration group (G1).
  • CI-1040 can be usefully used in the treatment of hypertrophic scars and keloids by significantly reducing the content of collagen fibers in excisional wound-induced hypertrophic scars and keloid tissue.
  • FIGS. 10, 11, 12, and 13 are photographs of the rat's back skin on days 7, 14, 21, and 28 after induction of excisional wounds, respectively. .
  • excisional wounds were formed equally in all groups on the rat dorsal skin.
  • the skin on the back of the rats gradually recovered in all groups.
  • G2-6 and G3-15 rats died on the 21st day after induction of excisional wounds, which is considered to be due to respiratory distress due to patch compression, not death caused by the administered drug.
  • the present inventors used REMEDY, a genome-based drug screening platform developed by Arontier Co., Ltd. to recreate drugs for hypertrophic scars and keloids for which there is no established treatment, and used CI-1040 and AZD6482, the active ingredients of the present invention. was selected, and it was confirmed that the pharmaceutical composition containing CI-1040 and/or AZD6482 has a significant preventive or therapeutic effect on hypertrophic scars and keloids in vitro and in vivo .
  • Example 1 samples for RNA sequencing were prepared by isolating normal mature scars, hypertrophic scars, and keloid tissues from patients suffering from keloids, and in Example 2, RNA sequencing was performed to process and quantify data 8 gene expression pattern models were constructed, and 10 hypertrophic scar and keloid biomarker genes were derived based on the 8 gene expression pattern models and 3 cutoffs.
  • Example 3 600,000 signatures were generated from 20,000 drugs by the REMEDY method based on the big data of the correlation between the 10 biomarker genes and drugs identified above, and the expression of genes increased in keloid and / or hypertrophic scar tissue
  • the top 1000 signatures that can be decreased and genes decreased in keloid and/or hypertrophic scar tissue were selected, and primary candidate drugs were selected through clustering analysis with t-SNE and analysis of previous research results, among which drug 4 Species were selected as secondary candidate drugs.
  • Example 4 the positive control drug methylprednisolone and two of the secondary candidate drugs can return the expression of hypertrophic scars and keloid biomarker genes in patient-derived keloid fibroblasts to the expression direction in normal scar tissue
  • the two drugs namely CI-1040 and AZD6482, were finally selected as potential hypertrophic scar and keloid treatment candidate drugs.
  • Example 5 in order to verify the efficacy of the potential hypertrophic scar and keloid treatment candidate drug in vivo , a rat excisional wound model was formed and each drug was injected.
  • Example 6 in the rat excisional wound model, it was confirmed through Marson's tricolor staining that collagen fibers in the excisional wound site were significantly reduced in the CI-1040 administration group (G3) compared to the DMSO administration group (G1), which is a negative control group. , it was confirmed that the wound gradually recovered in the macroscopic appearance of the CI-1040 administration group (G3) and the AZD6482 administration group (G4) through photographic photography.
  • REMEDY a genome-based drug screening platform independently developed by Arontier Co., Ltd., discovers biomarkers for hypertrophic scars and keloids for which there is no standard treatment currently, and detects the expression of the biomarkers in keloids and hypertrophic scar tissue in normal scar tissue. It is useful to select drugs that can modulate the expression direction, and the selected drugs, CI-1040 and/or AZD6482, are significant for the prevention or treatment of hypertrophic scars and/or keloids in patient-derived keloid fibroblasts and excisional wound animal models. Because of their effectiveness, CI-1040 and/or AZD6482 can be usefully used for the prevention or treatment of hypertrophic scars and keloids.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Dermatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 켈로이드 또는 비대흉터 예방 또는 치료용 약물의 스크리닝 방법, CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 또는 켈로이드의 예방 또는 치료용 약제학적 조성물, 켈로이드 또는 비대흉터의 진단용 조성물 및 이를 이용한 켈로이드 또는 비대흉터의 진단에 필요한 정보를 제공하는 방법에 관한 것이다. 본 발명의 CI-1040 및/또는 AZD6482, 이들의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 약제학적 조성물을 이용하는 경우, 켈로이드 및/또는 비대흉터의 예방 또는 치료에 용이하게 사용할 수 있다.

Description

CI-1040, AZD6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물
본 발명은 CI-1040 및/또는 AZD6482를 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물에 관한 것이다.
본 발명은 대한민국 과학기술정보통신부의 지원 하에서 과제고유번호 1711096300 및 세부과제번호 2019M3E5D4066897에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 한국연구재단, 연구사업명은 "인공지능신약개발플랫폼구축사업(R＆D)", 연구과제명은 "인공지능 기반의 신약 개발 통합 플랫폼 개발”, 주관기관은 주식회사 아론티어, 연구기간은 2019.06.01 - 2021.12.31이다.
본 특허출원은 2021년 05월 31일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2021-0070446호에 대하여 우선권을 주장하며, 상기 특허출원의 개시사항은 본원에 참조로서 삽입된다.
흉터(scar)는 질병 또는 외상으로 인해 손상되었던 피부 조직이 치유된 흔적이다. 흉터 중에는 표면이 융기된 양상을 나타내는 비대흉터(hypertrophic scar) 및 켈로이드(keloid)가 포함되는데, 이들은 가렵거나 따가운 증상을 나타낸다. 켈로이드는 피부의 결합조직이 병적으로 증식하여 단단한 융기를 형성하고, 표피가 얇아져서 광택을 띠며 붉게 보이는 양성 종양이며, 켈로이드는 흔히 어깨, 귀, 앞가슴에 발생한다. 비대흉터는 단단하고 표면이 주변 피부보다 융기되어 있으며 붉고 표면이 불규칙하다.
켈로이드와 비대흉터 모두 넓게는 흉터에 속하고 같은 스펙트럼에 있는 질환이지만, 이들은 구별되는 질환이다. 두 질환 모두 손상된 부위가 돌출되는 또는 융기되는 양상을 나타내지만, 비대흉터는 손상된 피부의 경계를 벗어나지 않는 반면, 켈로이드는 손상 부위의 경계를 벗어나 발생하게 된다. 또한, 비대흉터는 1년 또는 수년내에 시간이 지남에 따라 편평해지거나 그 크기가 줄어들 수 있으나, 켈로이드는 오히려 기존 상처범위를 벗어나 지속적으로 성장하여 더 넓게 퍼지는 경우가 흔하다.
비대흉터와 켈로이드의 치료를 위해 현재 사용되는 방법에는 스테로이드 국소 주사, 절제 후 봉합하는 수술 요법, 방사선 요법, 물리적으로 압박하여 산소와 혈류를 감소시켜 콜라겐 증식을 줄이는 압박 요법, 실리콘 겔 시트 또는 연고 도포 및 레이저 요법(프락셀, CO2, V-beam 등)이 있으나, 그 효과가 증상을 완화하는 정도이거나 부작용이 있어 치료에 제한적이다. 특히, 이러한 치료는 보통 45% 내지 100%의 재발율을 나타내 새로운 치료법의 개발이 필요하다(Lim KH, Itinteang T, Davis PF, Tan ST. Stem Cells in Keloid Lesions: A Review. Plast Reconstr Surg Glob Open. 2019 May 16;7(5):e2228. 참조).
비대흉터 및 켈로이드를 포함하는 섬유성 질환(fibrotic disorder)에 대한 치료에는 현재 표준화된 가이드라인이 없고, 켈로이드에 대한 유효성을 검증하는 대규모의 양질의 연구 또한 없다(Betarbet U, Blalock TW. Keloids: A Review of Etiology, Prevention, and Treatment. J Clin Aesthet Dermatol. 2020 Feb;13(2):33-43. Epub 2020 Feb 1; 및 Mutalik S. Treatment of keloids and hypertrophic scars. Indian J Dermatol Venereol Leprol. 2005 Jan-Feb;71(1):3-8. 참조). 따라서, 현재까지 정립된 비대흉터와 켈로이드 치료 방법이 없어, 이들의 치료 약물 개발이 필요한 실정이다.
현재 표준 치료법이 없는 비대흉터 및 켈로이드에 대한 다수의 바이오마커가 당업계에 공지되어 있으나(Suarez, E., Syed, F., Alonso-Rasgado, T.　et al.　Identification of biomarkers involved in differential profiling of hypertrophic and keloid scars versus normal skin.　Arch Dermatol Res　307,　115-133 (2015). 참조), 상기 바이오마커의 발현을 효과적으로 조절할 수 있는 비대흉터 및 켈로이드의 치료 약물은 현재 알려진 바 없다.
한편, 신약 발견 및 개발은 감손율(attrition rate)이 높고, 상당한 비용이 들며, 속도가 느리다는 것을 감안하면, 약물 재창출(drug repurposing 또는 drug repositioning) 전략은 기존 약물의 재창출, 즉 용도 변경으로 전체 개발 비용을 낮출 수 있고 개발 시간을 단축시킬 수 있으며, 위험 요소가 제거된 화합물을 사용할 수 있어 점점 더 매력적인 제안이 되고 있다(Pushpakom, S., Iorio, F., Eyers, P. et al. Drug repurposing: progress, challenges and recommendations. Nat Rev Drug Discov 18, 41-58, 2019. 참조). 따라서, 약물 재창출 전략은 현재 정립된 치료법이 없는 난치성 질환의 치료 약물을 발굴하는 데 유용하게 사용되고 있다.
본 발명자들은 비대흉터 및 켈로이드를 포함하는 섬유성 질환(fibrotic disorder)의 치료제, 더욱 구체적으로 켈로이드 특이적 치료제를 탐색 및 개발하고자 예의 연구 노력하였다. 그 결과, 환자의 비대흉터 및 켈로이드 조직에서 RNA 시퀀싱을 통해 바이오마커를 선정하고, 선정된 바이오마커인 질병 유전체와 화합물의 상호관계 빅데이터에 기반으로 한 REMEDY 방법을 이용하여 비대흉터 및 켈로이드의 치료 약물을 도출하여, 도출된 후보 약물 중 CI-1040 및 AZD6482가 in vitro에서 상기 바이오마커의 발현을 정상으로 돌려 놓을 수 있으며, in vivo 랫드 절제 창상 모델(rat excision wound model)에서 CI-1040가 콜라겐 섬유의 양을 감소시킴을 규명함으로써, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 켈로이드 또는 비대흉터 예방 또는 치료용 약물의 스크리닝 방법을 제공하는 것이다.
본 발명의 다른 목적은 CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 또는 켈로이드의 예방 또는 치료용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 켈로이드 또는 비대흉터의 진단용 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 켈로이드 또는 비대흉터의 진단에 필요한 정보를 제공하는 방법을 제공하는 것이다.
본 발명의 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 켈로이드 예방 또는 치료용 약물의 스크리닝 방법을 제공한다:
(a) 대상(subject)으로부터 분리된 켈로이드 유래 세포에 약물 후보군 시료를 접촉시키는 단계; 및
(b) 단계(a)를 거친 켈로이드 유래 세포로부터 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정하는 단계; 상기 유전자 중 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 감소된 상태이거나, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 증가된 상태인 경우, 켈로이드 예방 또는 치료용 약물로 선택된다.
본 발명자들은 비대흉터 및 켈로이드를 포함하는 섬유성 질환의 치료제, 더욱 구체적으로 켈로이드 특이적 치료제를 탐색 및 개발하고자 예의 연구 노력하였다. 그 결과, 환자의 비대흉터 및 켈로이드 조직에서 RNA 시퀀싱을 통해 바이오마커를 선정하고, 선정된 바이오마커인 질병 유전체와 화합물의 상호관계 빅데이터에 기반으로 한 REMEDY 방법(아론티어 사)을 이용하여 비대흉터 및 켈로이드의 치료 약물을 도출하여, 도출된 후보 약물 중 CI-1040 및 AZD6482가 in vitro에서 상기 바이오마커의 발현을 정상으로 돌려 놓을 수 있으며, in vivo 랫드 절제 창상 모델에서 CI-1040가 콜라겐 섬유의 양을 감소시킴을 규명하였다.
본 발명에서는 비대흉터 및 켈로이드 모델 특이적 유전자 발현량 변화 검출에 기반한 2만개의 약물과의 상호관계 빅데이터를 분석함으로써, 비대흉터 및 켈로이드의 잠재적 치료 약물을 선정할 수 있었다.
본 명세서에서 용어 '흉터'란, 질병 또는 외상으로 인해 손상되었던 피부 조직이 치유된 흔적으로, 손상 후 정상적인 피부에 생긴 결손을 메우는 새로운 결합 조직의 생성 결과를 의미한다. 흉터는 피부, 다른 기관 및 신체의 조직에서 상처를 복구하는 생물학적 과정의 결과이다.
본 명세서에서 용어 '흉터 형성(scarring)'이란, 자연스러운 치유 과정의 일부분으로, 상처 치유의 종점을 의미하며, 외부 환경으로부터 피부를 봉합하는 것을 목적으로 한다.
본 명세서에서 용어 '정상적인 성숙 흉터(normal matured scar)'란, 질병 또는 외상으로 인해 손상되었던 피부 조직이 치유된 흔적으로, 손상 후 주로 콜라겐 단백질, 콘드로이틴 황산(chondroitin sulphate) 및 아주 적은 수의 섬유아세포를 포함하는 결합 조직(connective tissue)이 피부의 하부층, 즉 진피(dermis)에 질서 있게 축적된 부위를 의미한다. 본 명세서에서는 정상적인 성숙 흉터를 Scar 또는 S로 지칭하였다. 정상적인 성숙 흉터에서는 정상 피부 조직을 구성하는 구성 요소가 제대로 재형성되지 않을 수 있다. 예를 들어, 정상적인 성숙 흉터에서는 히스타민을 분비하는 비만 세포(mast cell)가 과도하게 형성되어 가려움증을 유발할 수 있고, 피지선의 수가 감소하여 건조하게 될 수 있으며, 엘라스틴 섬유가 감소하여 상대적으로 단단해질 수 있다.
흉터는 상술한 바와 같이 자연스러운 치유 과정의 일부분으로서 정상적으로 성숙될 수 있지만, 손상 후 피부 결손을 회복하지 못하는 조직 형성의 감소나 섬유 조직의 과다 증식에 따라 흉터는 위축성 흉터, 비대흉터, 켈로이드 등으로 크게 분류될 수 있다.
본 명세서에서 용어 '위축성 흉터(atrophic scar)'란, 결합 조직이 비교적 적게 형성되어 정상 피부에 비해 움푹 파인 형태의 흉터를 의미한다. 위축성 흉터는 상대적으로 약하고 늘어나며, 튼살(strech marks 또는 striae distensae)과 함께 나타난다. 일부 여드름 흉터에서 위축성 흉터가 나타날 수 있고, 위축성 흉터 발생시 색소나 머리카락을 잃을 수 있다.
본 명세서에서 용어 '비대흉터(hypertrophic scar)'란, 비후성 반흔이라고도 불리며 콜라겐 섬유의 과다 형성에 의해 발생하여 정상 피부보다 융기된 병변으로 단단하고 붉으며 표면이 불규칙한 흉터를 의미하며, 원래 상처 범위를 벗어나 범위가 확대되지 않고 대개 1년 또는 수년내에 시간이 지남에 따라 편평해지거나 그 크기가 줄어든다. 본 명세서에서 비대흉터는 HS 또는 H로 지칭하였다.
본 명세서에서 용어 '켈로이드(keloid)'란, 피부의 결합조직이 병적으로 증식하여 단단한 융기를 형성하고, 표피가 얇아져서 광택을 띠며 붉게 보이는 양성종양으로, 흔히 어깨, 귀, 앞가슴에 발생하며, 시간이 지남에 따라 기존 손상 부위의 경계를 벗어나 시간이 지남에 따라 지속적으로 성장하여 더 넓게 퍼지는 경우가 흔한, 병변내(intralesional) 및 병변-주위(peri-lesional)를 모두 포괄하는 의미이다. 본 명세서에서 켈로이드를 K 또는 Keloid로 지칭하였다.
본 명세서에서 정상적인 성숙 흉터, 비대흉터 및 켈로이드는 병태생리학적으로 서로 구별되는 상이한 흉터이다.
이하 본 발명의 켈로이드 예방 또는 치료용 약물의 스크리닝 방법의 일 실시예에 따른 각 단계를 단계별로 상세히 설명한다.
(a) 대상(subject)으로부터 분리된 켈로이드 유래 세포에 약물 후보군 시료를 접촉시키는 단계
먼저, 켈로이드 유래 세포를 대상으로부터 다음과 같은 방법으로 분리한다. 켈로이드를 앓고 있는 대상의 병변내 및 병변-주위를 포함하는 켈로이드 부위의 피부 조직을, 보다 상세하게는 진피를 멸균된 스칼펠(scalpel) 등을 이용하여 외과적으로 절제한다.
구체적인 일 실시예에서, 절제된 진피 조직은 절편화하여 시험에 사용할 수 있다. 절편화된 조직은 콜라겐분해효소로 처리한 후, 배양 및 균질화 단계를 거쳐 이용할 수 있으나, 이에 제한되는 것은 아니다. 상술한 균질화는 구체적으로 예를 들면, 조직 균질기(tissue homogenizer)를 사용하거나, 미세 바늘을 통한 반복적인 흡인 과정을 통해 이루어질 수 있다. 균질화된 샘플을 원심분리하여 세포 펠렛(cell pellet)을 얻는다. 세포 펠렛을 재현탁시키고 인큐베이터에서 배양한다. 본 발명에서는 상기 배양된 세포를 켈로이드 유래 세포로 지칭한다.
상기 켈로이드 유래 세포에는 섬유아세포(fibroblast), 근섬유모세포(myofibroblast), 배아 줄기-유사 세포(embryonic stem (ESC)-like cells) 및 중간엽줄기세포(mesenchymal stem cell)으로 이루어진 1종 이상의 줄기 세포가 포함되나, 이에 제한되는 것은 아니다. 구체적으로, 본 발명에서 켈로이드 유래 세포는 섬유아세포일 수 있다. 상기 방법에 따라 수득한 켈로이드 유래 세포 중 섬유아세포를 켈로이드 섬유아세포(Keloid Fibroblast, KF)로 지칭한다.
그 다음, 상기 켈로이드 유래 세포에 약물 후보군 시료를 접촉한다. 상기 약물 후보군 시료에는 기존에 흉터, 비대흉터 또는 켈로이드의 예방 또는 치료용이 아닌 다른 적응증(indication)에 대한 예방 또는 치료용으로 사용되고 있거나, 개발 중인 약물이 포함될 수 있다. 구체적으로, 한 개의 특정된 화학구조를 가진 약물 2만개를 각각 포함하는 약물 후보군 시료를 상기 켈로이드 유래 세포와 접촉한다.
(b) 단계(a)를 거친 켈로이드 유래 세포로부터 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정하는 단계
우선, 상기 (a) 단계의 결과로 얻은 약물 후보군 시료와 접촉한 켈로이드 유래 세포에서 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정한다.
유전자의 발현량 측정 결과, 상기 유전자 중 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 감소된 상태이거나, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 증가된 상태인 경우, 켈로이드 예방 또는 치료용 약물로 선택된다.
상기 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1 유전자의 발현량은 정상적인 성숙 흉터 및/또는 비대흉터 대비 켈로이드에서 증가하고, 상기 ANGPTL7, APOC1, IL10 및 HLA-DRA 유전자의 발현량은 정상적인 성숙 흉터 및/또는 비대흉터 대비 켈로이드에서 감소하므로, RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정함으로써, 정상적인 성숙 흉터 및/또는 비대흉터로부터 켈로이드를 구별할 수 있다.
보다 중요하게는, 본 발명에 따른 켈로이드 예방 또는 치료용 약물의 스크리닝 방법을 사용하는 경우, 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 약물 후보군 시료를 접촉시킨 켈로이드 유래 세포에서 상기 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 감소시키거나, 상기 ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 증가시키는, 켈로이드에 대한 예방 또는 치료 효과가 있는 약물을 선별할 수 있다.
따라서, 본 발명에 따른 켈로이드 예방 또는 치료용 약물의 스크리닝 방법을 이용하면, 여러 약물 후보군 중에서 켈로이드에 대한 예방 또는 치료 효과가 있는 약물을 유용하게 선택할 수 있다.
본 발명의 일 구현예에 있어서, 본 발명의 켈로이드 예방 또는 치료용 약물의 스크리닝 방법은 상기 단계 (b)에서 ERICH6B, GOLGA6L1, IL10 및 HLA-DRA 중 적어도 하나 이상의 발현량을 필수적으로 측정하는 것을 특징으로 한다. 상기 유전자 중 ERICH6B 또는 GOLGA6L1 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 감소된 상태이거나, IL10 또는 HLA-DRA 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 증가된 상태인 경우, 켈로이드 예방 또는 치료용 약물로 선택된다.
상기 ERICH6B 및 GOLGA6L1 유전자의 발현량은 켈로이드 유래 세포에서 특이적으로 증가하고, IL10 및 HLA-DRA 유전자의 발현량은 켈로이드 유래 세포에서 특이적으로 감소하므로, ERICH6B, GOLGA6L1, IL10 및 HLA-DRA 중 적어도 하나 이상의 발현량을 필수적으로 측정함으로써, 정상적인 성숙 흉터와 비대흉터로부터 켈로이드를 유용하게 구별할 수 있다.
본 명세서에서 문구 '켈로이드 유래 세포에서 특이적으로 증가한다'는 정상적인 성숙 흉터 및 비대흉터로부터 수득한 세포를 배양한 세포인 정상적인 성숙 흉터 유래 세포 및 비대흉터 유래 세포 사이에서는 유전자 발현량에 유의한 차이가 없었는 반면, 정상적인 성숙 흉터 유래 세포 및 비대흉터 유래 세포 대비 켈로이드 유래 세포에서 유전자 발현량이 유의하게 증가한 경우를 의미한다.
본 명세서에서 문구 '켈로이드 유래 세포에서 특이적으로 감소한다'는 정상적인 성숙 흉터 및 비대흉터로부터 수득한 세포를 배양한 세포인 정상적인 성숙 흉터 유래 세포 및 비대흉터 유래 세포 사이에서는 유전자 발현량에 유의한 차이가 없었는 반면, 정상적인 성숙 흉터 유래 세포 및 비대흉터 유래 세포 대비 켈로이드 유래 세포에서 유전자 발현량이 유의하게 감소한 경우를 의미한다.
보다 중요하게는, 본 발명에 따른 켈로이드 예방 또는 치료용 약물의 스크리닝 방법을 사용하는 경우, 약물 후보군 시료를 접촉시키지 않은 상태의 켈로이드 유래 세포에서의 유전자 발현량과 비교하여 약물 후보군 시료를 접촉시킨 켈로이드 유래 세포에서 상기 ERICH6B 및 GOLGA6L1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 감소시키거나, 상기 IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 증가시키는, 켈로이드에 특이적으로 예방 또는 치료 효과가 있는 약물을 선별할 수 있다.
본 명세서에서 'RYR2 (Ryanodine receptor 2)'는 주로 심장 근육의 근소포체(sarcoplasmic reticulum)에서 발견되는 리아노딘 수용체인 RYR2 단백질을 암호화하는 유전자를 의미한다. RYR2 단백질은 칼슘 채널의 구성 요소 중 하나로서, 칼슘을 심장 근육에 공급하는 리아노딘 수용체 단백질의 사량체와 FK506 결합 단백질 1B의 사량체로 구성된다. RYR2 유전자의 돌연변이는 스트레스-유발 다형성 심실 빈맥 및 부정맥 유발 우심실 이형성증과 연관이 있다.
본 명세서에서 'ERICH6B (glutamate rich 6B 또는 glutamate-rich protein 6B)'는 인간 정소(testis) 조직에서 제한적으로 많이 발현되는 세포내 단백질을 코딩하고 염색체 13q14.13에 위치하며 15개의 엑손을 포함하는 유전자를 의미한다. ERICH6B 유전자는 HJMD(Hypotrichosis, Congenital, with Juvenile Macular Dystrophy), 외배엽 이형성증(Ectodermal Dysplasia), 외전증(Ectrodactyly) 또는 황반 이영양증 증후군(Macular Dystrophy Syndrome)과 연관이 있는 것으로 알려져 있다.
본 명세서에서 'GOLGA6L1 (golgin A6 family like 1 또는 golgin subfamily A member 6-like protein 1)'은 인간 정소 조직에서 많이 발현되는 단백질을 코딩하는 염색체 15q11.2에 위치하는 10개의 엑손을 포함하는 유전자를 의미한다. GOLGA6L1 유전자는 세툭시맙-내성(cetuximab-sensitive) 대장암 환자에서 60%의 빈도로 발견되는 돌연변이 유전자로 알려져 있다(Jing C, Wang T, Ma R, Cao H, Wang Z, Liu S, Chen D, Zhang J, Wu Y, Zhang Y, Wu J, Feng J. New genetic variations discovered in KRAS wild-type cetuximab resistant chinese colorectal cancer patients. Mol Carcinog. 2020 May;59(5):478-491. 참조).
본 명세서에서 'TGFB3 (TGF beta 3, transforming growth factor beta-3)'는 세포 분화, 배아 발생 및 발달에 관여하는 사이토카인으로 알려진 단백질을 암호화하는 유전자를 의미한다.
본 명세서에서 'COL8A1 (collagen type VIII alpha 1 chain)'은 VIII형 콜라겐의 두 알파 사슬 중 하나를 암호화하는 유전자를 의미한다. COL8A1 단백질은 단쇄 콜라겐이고 각막 내피의 기저막을 이루는 주요 구성 성분이다. VIII형 콜라겐 피브릴은 동종- 또는 이종-삼량체일 수 있고, 동일 단백질을 암호화하는 선택적 스플라이싱 전사 변이체가 관찰되었다.
본 명세서에서 'IGF2BP-1 (insulin like growth factor 2 mRNA binding protein 1, IGF2BP1)'은 인슐린-유사 성장 인자 2 mRNA-결합 단백질 패밀리 중 하나를 암호화하는 유전자를 의미한다. IGF2BP-1 단백질은 4개의 K 상동성 도메인 및 2개의 RNA 인식 모티프를 포함하며, 인슐린-유사 성장 인자 2, 베타-액틴 및 베타-트랜스듀신 반복-함유 단백질(beta-transducin repeat-containing protein) 등의 mRNA에 결합하여 이의 번역을 조절한다.
본 명세서에서 'ANGPTL7 (angiopoietin like 7, Angiopoietin-related protein 7)'는 심장, 담낭에서 광범위하게 발현하는 단백질을 암호화하는 염색체 1p36.22에 위치한 유전자를 의미한다. ANGPTL7는 8개의 안지오포이에틴-유사 단백질(Angiopoietin-like proteins) 중 하나이다. ANGPTL7는 식도편평상피암(ESCC)의 예후 및 치료에 대한 바이오마커로서 암-연관 세포외 기질과 관련된 시그니처 유전자 중 하나로 공지되어 있다(Zhang H, Shi Q, Yang Z, Wang K, Zhang Z, Huang Z, Cui X, Li F. An Extracellular Matrix-Based Signature Associated With Immune Microenvironment Predicts the Prognosis and Therapeutic Responses of Patients With Oesophageal Squamous Cell Carcinoma. Front Mol Biosci. 2021 Mar 18;8:598427. 참조).
본 명세서에서 'APOC1 (apolipoprotein C1)'은 아포지질단백질(apolipoprotein) C1 패밀리 중 하나를 암호화하는 유전자로, 주로 간에서 발현되며 단핵구가 대식세포로 분화될 때 활성화되는 유전자를 의미한다. APOC1 단백질은 HDL(high density lipoprotein) 및 VLDL(very low density lipoprotein) 대사에서 중요한 역할을 하며, 혈장에서 콜레스테릴 에스테르 전달 단백질(cholesteryl ester transfer protein)을 억제하는 것으로 알려져 있다.
본 명세서에서 'IL10 (interleukin 10)'은 주로 단핵구에 의해 생산되고 소량 림프구에 의해 생산되는 사이토카인을 암호화하는 유전자를 의미한다. IL10 사이토카인은 면역조절 및 염증에서 다면발현효과(pleiotropic effect)를 가지며, 대식세포에서 Th1 사이토카인, MHC 클래스 II Ags 및 공동자극 분자를 하향-조절한다. 또한, IL10 사이토카인은 B 세포의 생존, 증식 및 항체 생산을 향상시키며, NF-kappa B의 활성을 억제하고 JAK-STAT 신호 전달 경로의 조절에 관여한다.
본 명세서에서 'HLA-DRA (major histocompatibility complex, class II, DR alpha, 또는 HLA-DRA1)'는 HLA 클래스 II 알파 체인 파라로그(paralogues) 중 하나를 암호화하는 유전자를 의미한다. 클래스 II 분자는 모두 막에 고정되어 있는, 알파 및 베타 체인으로 구성된 이종이량체이다. HLA-DRA 단백질은 B 림프구, 수지상세포 및 단핵구/대식세포와 같은 다양한 항원 제시 세포의 표면에서 발현되어, 면역계에서 세포외 단백질, 특히 병원체-유래 펩타이드를 T 세포에 제시하는 반응에서 중심적인 역할을 한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음 단계를 포함하는 비대흉터 예방 또는 치료용 약물의 스크리닝 방법을 제공한다:
(a) 대상으로부터 분리된 비대흉터 유래 세포에 약물 후보군 시료를 접촉시키는 단계; 및
(b) 단계(a)를 거친 비대흉터 유래 세포로부터 RYR2, TGFB3, COL8A1, IGF2BP-1, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정하는 단계; 상기 유전자 중 RYR2, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 비대흉터 유래 세포에서의 유전자 발현량과 비교하여 감소된 상태이거나, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 비대흉터 유래 세포에서의 유전자 발현량과 비교하여 증가된 상태인 경우, 비대흉터 예방 또는 치료용 약물로 선택된다.
상기 비대흉터 유래 세포를 대상으로부터 분리하는 방법은 상기 켈로이드 유래 세포의 것과 동일하다. 상기 대상은 비대흉터를 앓고 있는 마우스(mouse), 랫드(rat), 기니피그, 토끼, 돼지, 소, 양, 말, 비-인간 영장류(non-human primate) 및 인간이 포함될 수 있으나, 이에 제한되는 것은 아니다. 상기 대상은 정상적인 성숙 흉터, 비대흉터 및 켈로이드를 가지고 있을 수 있다. 구체적으로, 본 발명에서는 비대흉터를 앓고 있는 인간으로부터 또는 랫드 절제 창상 모델로부터 비대흉터 유래 세포를 분리할 수 있다.
상기 비대흉터 유래 세포에는 섬유아세포(fibroblast), 근섬유모세포(myofibroblast), 배아 줄기-유사 세포(embryonic stem (ESC)-like cells) 및 중간엽줄기세포(mesenchymal stem cell)으로 이루어진 1종 이상의 줄기 세포가 포함되나, 이에 제한되는 것은 아니다. 구체적으로, 본 발명에서 비대흉터 유래 세포는 섬유아세포일 수 있다.
상기 (a) 단계의 결과로 얻은 약물 후보군 시료와 접촉한 비대흉터 유래 세포에서 RYR2, TGFB3, COL8A1, IGF2BP-1, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정한다.
유전자의 발현량 측정 결과, 상기 RYR2, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 비대흉터 유래 세포에서의 유전자 발현량과 비교하여 감소된 상태이거나, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 약물 후보군 시료를 접촉시키지 않은 상태의 비대흉터 유래 세포에서의 유전자 발현량과 비교하여 증가된 상태인 경우, 비대흉터 예방 또는 치료용 약물로 선택된다.
상기 RYR2, TGFB3, COL8A1 및 IGF2BP-1 유전자의 발현량은 정상적인 성숙 흉터 대비 비대흉터에서 증가하고, 상기 ANGPTL7 및 APOC1 유전자의 발현량은 정상적인 성숙 흉터 대비 비대흉터에서 감소하므로, RYR2, TGFB3, COL8A1, IGF2BP-1, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정함으로써, 정상적인 성숙 흉터로부터 비대흉터를 구별할 수 있다.
보다 중요하게는, 본 발명에 따른 비대흉터 예방 또는 치료용 약물의 스크리닝 방법을 사용하는 경우, 약물 후보군 시료를 접촉시키지 않은 상태의 비대흉터 유래 세포에서의 유전자 발현량과 비교하여 약물 후보군 시료를 접촉시킨 비대흉터 유래 세포에서 상기 RYR2, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 감소시키거나, 상기 ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 증가시키는, 비대흉터에 대한 예방 또는 치료 효과가 있는 약물을 선별할 수 있다.
따라서, 본 발명에 따른 비대흉터 예방 또는 치료용 약물의 스크리닝 방법을 이용하면, 여러 약물 후보군 중에서 비대흉터에 대한 예방 또는 치료 효과가 있는 약물을 유용하게 선택할 수 있다.
본 발명의 비대흉터 예방 또는 치료용 약물의 스크리닝 방법은 본 발명의 다른 일 양태인 켈로이드 예방 또는 치료용 약물의 스크리닝 방법과 동일 및 유사한 단계를 포함하므로, 본 명세서 기재의 과도한 복잡성을 피하기 위해 중복되는 내용을 원용하며, 그 기재를 생략한다.
본 발명의 또 다른 일 양태에 따르면, 본 발명은 CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 또는 켈로이드의 예방 또는 치료용 약제학적 조성물을 제공한다.
본 발명의 약제학적 조성물은 상술한 본 발명의 다른 일 양태인 켈로이드 예방 또는 치료용 약물의 스크리닝 방법 및 비대흉터 예방 또는 치료용 약물의 스크리닝 방법의 실시에 의해 도출된 후보 약물들을 포함한다.
본 명세서에서 용어 'CI-1040'는 분자식은 C17H14ClF2IN2O2 이고 IUPAC 명은 2-[(2-Chloro-4-iodophenyl)amino]-N-(cyclopropylmethoxy)-3,4-difluorobenzamide이며, PD184352라고도 불리는 MEK(MKK1, MAPK kinase)의 선택적 비-경쟁적 억제제를 의미하며, 이는 항암 활성이 있고, ERK 경로를 억제한다. CI-1040은 다음과 같은 화학식 1로 표시될 수 있다.
[화학식 1]
Figure PCTKR2022007576-appb-img-000001
본 명세서에서 용어 'AZD6482'는 분자식은 C22H24N4O4 이고 IUPAC 명은 2-[[(1R)-1-(7-methyl-2-morpholin-4-yl-4-oxopyrido[1,2-a]pyrimidin-9-yl)ethyl]amino]benzoic acid이며, (-) 2-[1-(7-메틸-2-(모르폴린-4-일)-4-옥소-4H-피리도[1,2-a]피리미딘-9-일)에틸아미노]벤조산 및 2-[[(1R)-1-[7-메틸-2-(4-모르폴린일)-4-옥소-4H-피리도[1,2-a]피리미딘-9-일]에틸]아미노]-벤조산이라고도 불리는 PI3Kβ의 이형체-선택적이고 강력한 ATP 경쟁적 억제제를 의미하며, 이는 항혈전 효과가 있다. AZD6482는 다음과 같은 화학식 2로 표시될 수 있다.
[화학식 2]
Figure PCTKR2022007576-appb-img-000002
본 발명의 용어 '이들의 약제학적으로 허용 가능한 염'이란, 소망하는 약리학적 효과, 즉 콜라겐 섬유의 양을 감소시키거나, 또는 상술한 바이오마커의 이상-조절된 발현량을 정상적인 성숙 흉터에서의 발현 방향으로 조절함으로써 비대흉터 및 켈로이드의 예방 또는 치료 효과를 가지는 CI-1040 또는 AZD6482 화합물의 염을 의미하는 것으로, CI-1040 및 CI-1040의 약제학적으로 허용 가능한 염은 TGFB3, COL8A1 및 IGF2BP-1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자의 발현을 감소시키는 효과를 가지고, AZD6482 및 AZD6482의 약제학적으로 허용 가능한 염은 ANGPTL7 및 APOC1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자의 발현을 증가시킴으로써 비대흉터 및 켈로이드의 예방 또는 치료 효과를 가지는 화합물의 염을 의미한다. 이러한 염은 염화수소, 브로민화수소, 아이오딘화수소 등의 무기산, 아세테이트, 아디페이트, 알기네이트, 아스파르테이트, 벤조에이트, 벤젠술포네이트, p-톨루엔설포네이트, 비설페이트, 설파메이트, 설페이트, 나프틸레이트, 부티레이트, 시트레이트, 캄포레이트, 캄포설포네이트, 시클로펜탄프로피오네이트, 디글루코네이트, 도데실설페이트, 에탄설포네이트, 푸마레이트, 글루코헵타노에이트, 글리세로포스페이트, 헤미설페이트, 헵타노에이트, 헥사노에이트, 2-히드록시에탄설페이트, 락테이트, 말리에이트, 메탄설포네이트, 2-나프탈렌설포네이트, 니코티네이트, 옥살레이트, 토실레이트, 운데카노에이트 등의 유기산을 이용하여 형성될 수 있다.
본 발명의 용어 '이들의 조합'이란, CI-1040 또는 이의 약제학적으로 허용 가능한 염과 AZD6482 또는 이의 약제학적으로 허용 가능한 염을 포함하는 조성물을 의미한다. 본 발명의 CI-1040 또는 이의 약제학적으로 허용 가능한 염과 AZD6482 또는 이의 약제학적으로 허용 가능한 염은 약리학적으로 양립 가능하다.
본 발명의 용어 '유효성분으로 포함하는'이란, 본 발명의 CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염 또는 이들의 조합의 약리학적 효능 또는 활성을 달성하는 데 충분한 양을 포함하는 것을 의미하며, 약물의 전달, 안정화 및 제제화를 위하여 다양한 성분이 부가적으로 첨가될 수 있는 것을 포함하는 의미이다.
본 발명에서는 정상적인 성숙 흉터를 기준으로 하여 비대흉터 및 켈로이드에서 약제학적 조성물의 약효를 검증하였다.
본 발명의 다른 일 구현예에 있어서, 비대흉터 및 켈로이드는 콜라겐 증식에 의한 것이다.
본 명세서에서 용어 '콜라겐(collagen)'이란, 교원질이라고도 불리는 섬유 단백질로 피부, 연골 등 결합 조직의 대부분을 차지하는 폴리펩타이드 세 분자가 서로 삼중 나선으로 꼬인 형태의 단백질을 의미한다.
본 발명의 다른 일 구현예에 있어서, 본 발명의 약제학적 조성물은 콜라겐 섬유의 양을 감소시킨다.
본 명세서의 용어 '콜라겐 섬유(collagen fiber)'란, 결합 조직에 많이 존재하는 콜라겐 단백질로 이루어진 섬유를 의미한다. 세포로부터 분비된 콜라겐 단백질이 세포간질에서 분자간 가교를 형성하고 섬유상을 이루므로, 콜라겐 섬유의 전자현미경 관찰시 가로줄 무늬가 관찰된다.
본 발명의 약제학적 조성물은 비대흉터 및 켈로이드의 유전체 발현을 정상적인 성숙 흉터의 유전체 발현 수준으로 돌려 놓을 수 있다.
본 발명의 약제학적 조성물이 정상적인 성숙 흉터의 유전체 발현 수준으로 돌려 놓을 수 있는 비대흉터 및 켈로이드에서 발현이 이상 조절되는(dysregulated) 유전체에는 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 유전자로 이루어진 군으로부터 선택되는 1종 이상의 유전자가 포함되나, 반드시 이에 제한되는 것은 아니다.
본 발명의 일 구현예에 있어서, 비대흉터는 정상적인 성숙 흉터 대비 RYR2, TGFB3, COL8A1 및 IGF2BP-1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 증가한 것이다.
본 발명의 일 구현예에 있어서, 비대흉터는 정상적인 성숙 흉터 대비 ANGPTL7 및 APOC1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 감소한 것이다.
본 발명의 다른 일 구현예에 있어서, 비대흉터는 정상적인 성숙 흉터 대비 RYR2, TGFB3, COL8A1 및 IGF2BP-1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 증가하고, 정상적인 성숙 흉터 대비 ANGPTL7 및 APOC1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 감소한 것이다.
본 발명의 일 구현예에 있어서, 켈로이드는 정상적인 성숙 흉터 대비 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 증가한 것이다.
본 발명의 일 구현예에 있어서, 켈로이드는 정상적인 성숙 흉터 대비 ANGPTL7, APOC1, IL10및 HLA-DRA으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 감소한 것이다.
본 발명의 다른 일 구현예에 있어서, 켈로이드는 정상적인 성숙 흉터 대비 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 증가하고, 정상적인 성숙 흉터 대비 ANGPTL7, APOC1, IL10및 HLA-DRA으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 감소한 것이다.
본 발명의 일 구현예에 있어서, 켈로이드는 비대흉터 대비 ERICH6B 및 GOLGA6L1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 증가하고, 비대흉터 대비 IL10 및 HLA-DRA으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현이 감소한 것이다.
본 발명의 일 구현예에 있어서, 본 발명의 CI-1040 또는 이의 약제학적으로 허용 가능한 염은 TGFB3, COL8A1 및 IGF2BP-1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현을 감소시킨다.
본 발명의 일 구현예에 있어서, 본 발명의 AZD6482 또는 이의 약제학적으로 허용 가능한 염은 ANGPTL7 및 APOC1으로 이루어진 군으로부터 선택되는 1종 이상의 유전자 발현을 증가시킨다.
본 발명의 다른 일 구현예에 있어서, 본 발명의 조성물은 메틸프레드니솔론 또는 이의 약제학적으로 허용 가능한 염과 병용 투여된다. 본 발명의 또 다른 일 구현예에 있어서, 본 발명의 조성물은 메틸프레드니솔론과 동시에 또는 순차적으로 병용 투여된다.
본 발명의 용어, '메틸프레드니솔론(methylprednisolone)'은 분자식이 C22H30O6이고 현재 켈로이드의 치료약으로 사용되고 있는 글루코코르티코이드 수용체 작용제(glucocorticoid receptor agonist) 계열인 스테로이드 약물로, 항염증작용과 면역억제작용이 있는 합성 부신피질 호르몬제를 의미한다. 메틸프레드니솔론은 류마티스성 관절염, 알레르기성 질환 등의 치료에도 사용되며, 지속적으로 고용량 사용시 심각한 부작용이 발생할 수 있어, 치료에 제한적이다.
본 발명의 다른 일 구체예에 있어서, 본 발명의 메틸프레드니솔론은 ANGPTL7, APOC1 및 HLA-DRA로 이루어진 군으로부터 선택되는 1종 이상의 유전자의 발현을 증가시킨다.
본 발명의 다른 일 구현예에 있어서, 본 발명의 약제학적 조성물은 약제학적으로 허용 가능한 담체를 추가로 포함한다.
본 발명의 약제학적으로 허용 가능한 담체는 본 발명이 속하는 기술분야에서 통상적으로 사용되는 것으로 본 발명의 유효성분인 CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염 또는 이들의 조합과 약리학적으로 양립 가능하다.
본 발명의 약제학적 조성물에 추가로 포함될 수 있는 약제학적으로 허용 가능한 담체에는 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일 등이 포함되나, 이에 한정되는 것은 아니다.
본 발명의 약제학적 조성물은 상기 성분들 이외에 부형제, 안정제, 희석제, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용 가능한 담체, 운반체, 부형제, 안정제 또는 희석제는 Remington's Pharmaceutical Sciences(19th ed., 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 정맥내(intravenous) 주입, 피하(subcutaneous) 주입, 근육(intramuscular) 주입, 복강(intraperitoneal) 주입, 경피(percutaneous) 투여, 뇌내(intracerebral) 주입, 척수내(intraspinal) 주입 등으로 투여할 수 있다.
본 발명의 바람직한 일 구현예에 있어서, 본 발명의 약제학적 조성물은 피내(intradermal)로 주입될 수 있다. 본 발명의 구체적인 일 구현예에 있어서, 본 발명의 약제학적 조성물은 창상(상처) 부위 근처에 한 곳, 두 곳, 또는 세 곳에 피내로 주입될 수 있다. 본 발명의 바람직한 다른 일 구현예에 있어서, 본 발명의 약제학적 조성물은 창상 부위 근처에 1회, 2회, 3회 또는 4회에 걸쳐 피내 주입될 수 있다. 본 발명의 구체적인 다른 일 구현예에 있어서, 본 발명의 약제학적 조성물은 4일 간격으로 창상 부위 근처에 주입될 수 있다. 본 발명의 보다 구체적인 일 구현예에 있어서, 본 발명의 약제학적 조성물은 창상 부위 근처 세 곳에 4일 간격으로 각각 4회에 걸쳐 피내 주입될 수 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 한편, 본 발명의 약제학적 조성물의 투여량은 바람직하게는 1일 당 0.0001-1000 mg/kg(체중)이다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 약제학적 조성물은 비대흉터 및/또는 켈로이드의 예방 또는 치료에 사용될 수 있다. 본 명세서의 용어 '예방'은 질환 또는 질환 상태의 방지 또는 보호적인 치료를 의미한다. 본 명세서의 용어 '치료'는 질환 상태의 감소, 억제, 진정 또는 근절을 의미한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음에서 선택되는 적어도 한 쌍의 프라이머 서열을 유효성분으로 포함하는 켈로이드 또는 비대흉터의 진단용 조성물을 제공한다:
서열번호 1의 뉴클레오타이드 서열을 가지는 RYR2에 대한 정방향 프라이머 서열 및 서열번호 2의 뉴클레오타이드 서열을 가지는 RYR2에 대한 역방향 프라이머 서열;
서열번호 3의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 정방향 프라이머 서열 및 서열번호 4의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 역방향 프라이머 서열;
서열번호 5의 뉴클레오타이드 서열을 가지는 APOC1에 대한 정방향 프라이머 서열 및 서열번호 6의 뉴클레오타이드 서열을 가지는 APOC1에 대한 역방향 프라이머 서열;
서열번호 7의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 정방향 프라이머 서열 및 서열번호 8의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 역방향 프라이머 서열;
서열번호 9의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 정방향 프라이머 서열 및 서열번호 10의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 역방향 프라이머 서열;
서열번호 11의 뉴클레오타이드 서열을 가지는 IL10에 대한 정방향 프라이머 서열 및 서열번호 12의 뉴클레오타이드 서열을 가지는 IL10에 대한 역방향 프라이머 서열;
서열번호 13의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 정방향 프라이머 서열 및 서열번호 14의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 역방향 프라이머 서열;
서열번호 15의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 정방향 프라이머 서열 및 서열번호 16의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 역방향 프라이머 서열;
서열번호 17의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 정방향 프라이머 서열 및 서열번호 18의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 역방향 프라이머 서열; 또는
서열번호 19의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 정방향 프라이머 서열 및 서열번호 20의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 역방향 프라이머 서열.
본 발명의 일 구현예에 있어서, 상기 조성물은 다음에서 선택되는 적어도 한 쌍의 프라이머 서열을 유효성분으로 포함하며 켈로이드 특이적 진단용이다:
서열번호 7의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 정방향 프라이머 서열 및 서열번호 8의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 역방향 프라이머 서열;
서열번호 9의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 정방향 프라이머 서열 및 서열번호 10의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 역방향 프라이머 서열;
서열번호 11의 뉴클레오타이드 서열을 가지는 IL10에 대한 정방향 프라이머 서열 및 서열번호 12의 뉴클레오타이드 서열을 가지는 IL10에 대한 역방향 프라이머 서열; 또는
서열번호 13의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 정방향 프라이머 서열 및 서열번호 14의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 역방향 프라이머 서열.
본 발명의 용어, "켈로이드 특이적 진단용"은 정상적인 성숙 흉터 및 비대흉터로부터 켈로이드를 구별하여 켈로이드를 선별적으로 진단하기 위한 용도를 의미한다.
본 발명의 켈로이드 특이적 진단용 조성물을 이용하는 경우, 비대흉터로부터 켈로이드를 선별적으로 진단할 수 있다. 즉, 정상적인 성숙 흉터 및 비대흉터로부터 켈로이드를 구별할 수 있다.
본 발명의 일 구현예에 있어서, 상기 조성물은 다음에서 선택되는 적어도 한 쌍의 프라이머 서열을 유효성분으로 포함하며 비대흉터의 진단용이다:
서열번호 1의 뉴클레오타이드 서열을 가지는 RYR2에 대한 정방향 프라이머 서열 및 서열번호 2의 뉴클레오타이드 서열을 가지는 RYR2에 대한 역방향 프라이머 서열;
서열번호 3의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 정방향 프라이머 서열 및 서열번호 4의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 역방향 프라이머 서열;
서열번호 5의 뉴클레오타이드 서열을 가지는 APOC1에 대한 정방향 프라이머 서열 및 서열번호 6의 뉴클레오타이드 서열을 가지는 APOC1에 대한 역방향 프라이머 서열;
서열번호 15의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 정방향 프라이머 서열 및 서열번호 16의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 역방향 프라이머 서열;
서열번호 17의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 정방향 프라이머 서열 및 서열번호 18의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 역방향 프라이머 서열; 또는
서열번호 19의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 정방향 프라이머 서열 및 서열번호 20의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 역방향 프라이머 서열.
본 발명에 따른 켈로이드 또는 비대흉터의 진단용 조성물은 RT-PCR, qRT-PCR, 노던 블롯(Northern blot), 리보뉴클레아제 보호 분석(ribonuclease protection assay), 현장혼성화(In Situ Hybridization), 형광현장혼성화(Fluorescence In Situ Hybridization) 등 당업계에 공지된 mRNA 정량 방법을 통해 유전자의 mRNA 발현 수준을 정량하거나 측정할 수 있다.
본 발명의 바람직한 일 구현예에 있어서, 본 발명에 따른 진단용 조성물은 qRT-PCR 방법을 통해 유전자의 mRNA 발현 수준을 정상적인 성숙 흉터 조직, 비대흉터 및 켈로이드에서 측정하여 이를 비교해 비대흉터 또는 켈로이드의 진단 또는 예후 분석에 필요한 정보를 제공할 수 있다.
본 발명에 따른 상기 켈로이드 또는 비대흉터의 진단용 조성물을 포함하는 비대흉터 및/또는 켈로이드의 진단용 키트를 제공할 수 있다.
본 발명의 진단용 조성물은 비대흉터 및/또는 켈로이드의 진단 또는 예후 분석에 필요한 정보를 제공하기 위해 사용될 수 있다. 본 명세서의 용어 '진단 또는 예후'는 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)(예컨대, 비대흉터 및 켈로이드 치료에 대한 회복 가능성 예측)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)를 포함한다.
본 발명의 켈로이드 또는 비대흉터의 진단용 조성물은 본 발명의 다른 일 양태인 켈로이드 또는 비대흉터의 예방 또는 치료용 약물의 스크리닝 방법에서 측정한 유전자의 정방향 및 역방향 프라이머를 포함하므로, 본 명세서 기재의 과도한 복잡성을 피하기 위해 중복되는 내용을 원용하며, 그 기재를 생략한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 다음을 포함하는 켈로이드 또는 비대흉터의 진단에 필요한 정보를 제공하는 방법을 제공한다:
(a) 대상으로부터 분리된 생물학적 시료와 정상 대조군 시료를 상술한 본 발명에 따른 켈로이드 또는 비대흉터의 진단용 조성물과 접촉시키는 단계; 및
(b) RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정하는 단계; 상기 유전자 중 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 증가된 상태이거나, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 감소된 상태인 경우, 켈로이드 또는 비대흉터로 판단한다.
본 발명의 일 구현예에 있어서, 본 발명의 대상으로부터 분리된 생물학적 시료는 표피(epidermis), 기저막(basement membrane), 진피(dermis), 피하조직(subcutaneous tissue), 땀샘, 땀샘구멍, 피지샘, 모낭 등이 포함되나 이에 제한되는 것은 아니다. 상기 표피에는 기저층(stratum basale), 가시층(stratum spinosum), 과립층(stratum granulosum), 각질층(stratum corneum) 및 투명층(stratum　lucidum)이 포함된다. 상기 진피에는 결합조직, 콜라겐 섬유, 평활근 조직 및 신경조직이 포함된다. 상기 피하조직은 지방조직이 풍부한 성긴 결합조직이다. 상기 생물학적 시료는 대상으로부터 수득한 세포를 배양한 세포일 수 있다.
본 발명의 또 다른 일 구현예에 있어서, 본 발명의 생물학적 시료는 비대흉터 및/또는 켈로이드를 포함하나, 반드시 이에 제한되는 것은 아니다.
본 발명의 다른 일 구현예에 있어서, 본 발명의 생물학적 시료는 간, 신장, 폐 등의 기관(organ)에 형성된 흉터 조직 또는 섬유성 조직을 포함할 수 있다.
본 발명의 추가적인 일 구현예에 있어서, 본 발명의 정상 대조군 시료는 정상적인 성숙 흉터를 포함하나, 반드시 이에 제한되는 것은 아니다.
본 발명의 대상은 켈로이드를 앓고 있는 인간이다. 본 발명에서는 켈로이드를 앓고 있는 인간으로부터 켈로이드 유래 세포를 분리할 수 있다.
본 발명의 일 구현예에 있어서, 상기 단계 (b)에서 ERICH6B, GOLGA6L1, IL10 및 HLA-DRA 중 적어도 하나 이상의 발현량을 필수적으로 측정하는 것을 특징으로 하며 켈로이드 특이적 진단에 필요한 정보를 제공한다: 상기 유전자 중 ERICH6B 또는 GOLGA6L1 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 증가된 상태이거나, IL10 또는 HLA-DRA 유전자의 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 감소된 상태인 경우, 켈로이드로 판단한다.
즉, 상술한 켈로이드 특이적 진단에 필요한 정보를 이용하는 경우, 정상적인 성숙 흉터 및 비대흉터로부터 켈로이드를 감별하는 데에 유용하다.
본 발명의 일 구현예에 있어서, 상기 단계 (b)에서 RYR2, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 증가된 상태이거나, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 감소된 상태인 경우, 비대흉터로 판단한다.
본 발명의 켈로이드 또는 비대흉터의 진단에 필요한 정보를 제공하는 방법은 상술한 본 발명의 다른 일 양태인 켈로이드 또는 비대흉터의 진단용 조성물을 이용하므로, 본 명세서 기재의 과도한 복잡성을 피하기 위해 중복되는 내용을 원용하며, 그 기재를 생략한다.
본 발명의 여전히 다른 일 양태에 따르면, 본 발명은 상술한 다른 일 양태에 따른 CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염, 또는 이들의 조합을 유효성분으로 포함하는 약제학적 조성물을 이를 필요로 하는 대상(subject)에게 투여하는 단계를 포함하는 비대흉터 또는 켈로이드의 예방 또는 치료 방법을 제공한다.
본 발명의 일 구현예에 있어서, 상기 대상(subject)은 포유동물이다. 상기 대상에는 마우스, 랫드, 기니피그, 토끼, 개, 고양이, 돼지, 소, 양, 말, 비-인간 영장류(non-human primate) 및 인간이 포함될 수 있으나, 반드시 이에 제한되는 것은 아니다. 상기 비-인간 영장류에는 원원류(prosimians), 구세계 원숭이(old world monkeys), 신세계 원숭이(new world monkeys) 및 유인원(anthropoid)이 포함되나, 반드시 이에 제한되는 것은 아니다. 상기 비-인간 영장류에는 게잡이원숭이(Macaca fascicularis), 붉은털원숭이(Macaca mulatta) 및 마모셋원숭이(Callithrix jacchus)가 포함되나, 반드시 이에 제한되는 것은 아니다.
상기 대상은 비대흉터 또는 켈로이드를 앓고 있는 것으로 의심되는 상태일 수 있다. 상기 대상은 적절한 치료 방법의 선택을 위해 정상적인 성숙 흉터로부터 비대흉터 또는 켈로이드로 감별 진단을 받은 상태일 수 있다. 상기 대상은 적절한 치료 방법의 선택을 위해 위축성 흉터로부터 비대흉터 또는 켈로이드로 감별 진단을 받은 상태일 수 있다. 상기 대상은 적절한 치료 방법의 선택을 위해 비대흉터로부터 켈로이드로 감별 진단을 받은 상태일 수 있다. 상기 대상은 적절한 치료 방법의 선택을 위해 켈로이드로부터 비대흉터로 감별 진단을 받은 상태일 수 있다.
본 발명의 비대흉터 또는 켈로이드의 예방 또는 치료 방법은 상술한 본 발명의 다른 일 양태인 약제학적 조성물을 투여하는 단계를 포함하므로, 본 명세서 기재의 과도한 복잡성을 피하기 위해 중복되는 내용을 원용하며, 그 기재를 생략한다.
서열에 대한 간단한 설명
서열번호 1은 UU 패턴 바이오마커인 RYR2 유전자에 대한 RT-PCR 실험에 사용된 정방향(forward) 프라이머 서열이다.
서열번호 2는 UU 패턴 바이오마커인 RYR2 유전자에 대한 RT-PCR 실험에 사용된 역방향(reverse) 프라이머 서열이다.
서열번호 3은 DD 패턴 바이오마커인 ANGPTL7 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 4는 DD 패턴 바이오마커인 ANGPTL7 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 5는 DD 패턴 바이오마커인 APOC1 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 6은 DD 패턴 바이오마커인 APOC1 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 7은 FU 패턴 바이오마커인 ERICH6B 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 8은 FU 패턴 바이오마커인 ERICH6B 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 9는 FU 패턴 바이오마커인 GOLGA6L1 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 10은 FU 패턴 바이오마커인 GOLGA6L1 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 11은 FD 패턴 바이오마커인 IL10 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 12는 FD 패턴 바이오마커인 IL10 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 13은 FD 패턴 바이오마커인 HLA-DRA 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 14는 FD 패턴 바이오마커인 HLA-DRA 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 15는 UF 패턴 바이오마커인 IGF2BP-1 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 16은 UF 패턴 바이오마커인 IGF2BP-1 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 17은 UF 패턴 바이오마커인 TGFB3 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 18은 UF 패턴 바이오마커인 TGFB3 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 19는 UF 패턴 바이오마커인 COL8A1 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 20은 UF 패턴 바이오마커인 COL8A1 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
서열번호 21은 인간 GAPDH 유전자에 대한 RT-PCR 실험에 사용된 정방향 프라이머 서열이다.
서열번호 22는 인간 GAPDH 유전자에 대한 RT-PCR 실험에 사용된 역방향 프라이머 서열이다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 켈로이드 또는 비대흉터의 예방 또는 치료용 약물의 스크리닝 방법을 제공한다.
(b) 본 발명은 CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 또는 켈로이드의 예방 또는 치료용 약제학적 조성물을 제공한다.
(c) 본 발명은 켈로이드 또는 비대흉터의 진단용 조성물을 제공한다.
(d) 본 발명은 켈로이드 또는 비대흉터의 진단에 필요한 정보를 제공하는 방법을 제공한다.
(e) 본 발명의 켈로이드 또는 비대흉터의 예방 또는 치료용 약물의 스크리닝 방법을 이용하는 경우, 켈로이드 또는 비대흉터에서 이상 조절된(dysregulated) 유전자의 발현을 정상적인 성숙 흉터의 유전자 발현 방향으로 돌려놓도록 조절할 수 있는 약물을 선택할 수 있고, 상기 스크리닝 방법을 통해 선택한 약물인 CI-1040 및/또는 AZD6482, 이들의 약제학적으로 허용 가능한 염을 유효성분으로 포함하는 약제학적 조성물을 이용하는 경우, 켈로이드 또는 비대흉터에서 이상 조절된 유전자의 발현량을 정상적인 성숙 흉터의 유전자 발현으로 돌려놓도록 조절할 수 있어, 켈로이드 및/또는 비대흉터의 예방 또는 치료에 용이하게 사용할 수 있다. 또한, 발명의 진단용 조성물을 이용하는 경우, 정상적인 성숙 흉터로부터 비대흉터 및 켈로이드를 구별하거나, 정상적인 성숙 흉터 및 비대흉터로부터 켈로이드를 특이적으로 구별할 수 있으므로, 비대흉터 또는 켈로이드의 진단에 필요한 정보를 제공하는 방법에 유용하게 사용될 수 있다.
도 1은 유전체 기반 약물 재창출 연구를 위한 전사체(Transcriptome) 데이터 준비를 위한 개요를 나타낸다.
도 2는 흉터, 비대흉터 및 켈로이드 조직의 유전자 발현 분석 후 8가지 패턴 구성으로 나눈 모델을 나타낸다. S는 흉터(scar), H는 비대흉터(hypertrophic scar) 및 K는 켈로이드(keloid)를 나타낸다.
도 3은 유전자 발현 분석 후 8가지 패턴 구성으로 나눈 모델과 컷오프(cutoff) 1.33배, 1.5배 및 2배에 근거로 나눈 3가지 그룹을 나타낸다. S는 흉터, HS는 비대흉터 및 K는 켈로이드를 나타내고, N은 유전자 수를 나타낸다.
도 4는 환자 켈로이드 조직에서 적출한 섬유아세포 #155, #178 및 #559에 DMSO, 5 μM 또는 50 μM의 CI-1040 처리 후 비대흉터 바이오마커의 mRNA 발현 변화를 qRT-PCR로 확인한 결과를 나타낸다. 파란색 박스로 농도-의존적으로 유의한 변화를 보인 결과를 강조 표기하였다.
도 5는 환자 켈로이드 조직에서 적출한 섬유아세포 #155, #178 및 #559에 DMSO, 10 μM 또는 100 μM의 AZD6482 처리 후 비대흉터 바이오마커의 mRNA 발현 변화를 qRT-PCR로 확인한 결과를 나타낸다. 붉은색 박스로 농도-의존적으로 유의한 변화를 보인 결과를 강조 표기하였다.
도 6은 환자 켈로이드 조직에서 적출한 섬유아세포 #155, #178 및 #559에 DMSO, 10 μM 또는 100 μM의 메틸프레드니솔론 처리 후 비대흉터 바이오마커의 mRNA 발현 변화를 qRT-PCR로 확인한 결과를 나타낸다. 붉은색 박스로 농도-의존적으로 유의한 변화를 보인 결과를 강조 표기하였다.
도 7은 랫드 절제 창상 모델의 동물실험 타임라인과 그룹 분류, 약물 이름 및 투여 농도의 개요를 나타낸다.
도 8은 조직병리학적 분석 결과로 헤마톡실린 및 에오신 염색(H&E 염색)과 MTS(Masson's Trichrome staining) 사진을 나타내며, 하단의 표에는 콜라겐 섬유(collagen fiber)가 차지하는 비율(%)을 나타낸다.
도 9는 랫드 절제 창상 모델의 0일차(day 0) 거시적 외관(macroscopic appearance)을 나타낸다. G1은 그룹 1, G2는 그룹 2, G3는 그룹 3 및 G4는 그룹 4를 나타내고, G1-X에서 X는 랫드 개체별 식별번호를 나타낸다.
도 10은 랫드 절제 창상 모델의 7일차(day 7) 거시적 외관을 나타낸다.
도 11은 랫드 절제 창상 모델의 14일차(day 14) 거시적 외관을 나타낸다.
도 12는 랫드 절제 창상 모델의 21일차(day 21) 거시적 외관을 나타낸다. DEATH는 폐사를 나타낸다.
도 13은 랫드 절제 창상 모델의 28일차(day 28) 거시적 외관을 나타낸다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1: 켈로이드, 비대흉터 및 흉터 조직 샘플의 준비
비대흉터 및 켈로이드 치료용 후보 약물 발굴을 위한 전사체 기반 약물 재창출 연구를 수행하기 위해 전사체 데이터를 도 1과 같이 준비하였다.
도 1에 나타낸 바와 같이, 삼성서울병원 피부과로부터 입수한 환자의 켈로이드 부위(병변내(intralesional) 및 병변-주위(peri-lesional)를 포함함. Keloid, K로 지칭함), 비대흉터(hypertrophic scar, HS 또는 H로 지칭함) 및 정상적인 성숙 흉터(normal matured scar, Scar 또는 S로 지칭함) 조직을 각각 채취하여 총 21개의 FFPE(formalin-fixed, paraffin-embedded) 샘플을 준비하였다. 준비한 FFPE 샘플에서 다음의 RNA 시퀀싱(RNA sequencing, TruSeq) 실험을 진행하였다.
실시예 2: 비대흉터 및 켈로이드 특이적 바이오마커의 선정
상기 실시예 1에서 얻은 켈로이드, 비대흉터 및 흉터 조직 샘플을 이용하여 RNA 시퀀싱을 진행하고, 조직별 유전자 발현 데이터를 비교 분석하여 비대흉터 및 켈로이드 특이적 바이오마커를 선정하였다.
2-1: RNA 시퀀싱 데이터 처리 및 정량 방법
상기 환자 유래 조직 샘플로부터 RNA 시퀀싱을 진행하고 데이터 처리 및 정량을 다음과 같이 진행하였다. RNA-seq 판독(read)의 어댑터 서열(adaptor sequence)을 Cutadapt(버전 2.3)으로 제거하였고(trimmed out), STAR 얼라이너(STAR aligner, 버전 2.4.2a) 및 해당 유전자 주석(gene annotation)과 함께 인간 레퍼런스 지놈과 정렬하였다. 정렬된 판독(aligned read)은 "intersection-nonempty" 모드와 함께 HTSeq(버전 0.12.4)에 의해 유전자 수준에서 정량화되었다. 상기 "intersection-nonempty"모드는 더 높은 염기 범위가 더 높은 판독 생성 확률을 나타낸다고 가정할 때, 정렬된 판독이 여러 유전자가 공유하고 있는 부위에 위치하는 경우 더 많이 중첩되는 유전자를 우선적으로 판독에 할당하며 특정 유전자의 전사서열(transcript sequence)에 특이적으로 해당하는 서열이 있으면 일부 전사서열이 아닌 서열을 가지고 있더라도 상기된 유전자의 정량에 사용하는 모드를 의미한다.
2-2: 유전자 발현 패턴 모델 디자인 방법
상술한 2-1에서 RNA 시퀀싱 데이터 정량 후, 흉터, 비대흉터 및 켈로이드조직에서의 유전자 발현 패턴을 분류하기 위해, 흉터 대(vs.) 비대흉터 및 비대흉터 대 켈로이드를 비교하여 각 유전자의 발현 수준을 비교하였다.
켈로이드 조직은 실험군으로 하였고, 비대흉터 및 정상적인 성숙 흉터는 대조군으로 하였다. 상기 실험군과 대조군을 대상으로 하여 유전자 발현 양상을 관찰하고 켈로이드 조직에서 특이적으로 발현되는 유전자 데이터 베이스를 구축하여 유전자 발현 분석을 진행하였다.
2개의 비교에 따라, 즉, 흉터 대 비대흉터 및 비대흉터 대 켈로이드 비교에 따라, 모든 유전자는 9개의 발현 패턴(Up-Up, Up-Flat, Up-Down, Flat-Up, Flat-Flat, Flat-Down, Down-Up, Down-Flat 및 Down-Down)으로 분류되었다. 흉터 대 비대흉터 및 비대흉터 대 켈로이드의 유전자 발현을 비교하여, 유전자의 발현 증가는 up, 발현 변화 없음은 flat, 발현 감소는 down으로 표기하였다. 본 발명에서 UU = Up-Up, UF = Up-Flat, UD = Up-Down, FU = Flat-Up, FF = Flat-Flat, FD = Flat-Down, DU = Down-Up, DF = Down-Flat 및 DD = Down-Down을 의미하며, Flat-Flat (FF) 패턴 모델은 분석하지 않았다. 예를 들어, UU 모델은 흉터 조직과 비교시 비대흉터 조직에서 유전자 발현이 증가하고, 이와 동시에 비대흉터 조직과 비교시 켈로이드 조직에서 유전자 발현이 증가한 모델을 나타낸다. 결과는 도 2에 나타내었다.
2-3 유전자 발현 패턴 모델
도 2에 나타낸 바와 같이, 유전자 발현 분석 결과, 켈로이드(K), 비대흉터(H) 및 흉터(S) 조직의 유전자 발현을 분석하여, 상술하였듯이 총 9가지 패턴으로 구성할 수 있었고, 세 조직 사이에서 유전자 발현 변화가 없는 패턴인 Flat-Flat (FF) 모델의 분석은 더 이상 진행하지 않았다. 따라서, 8가지 유전자 발현 패턴 모델로 구성하였다.
또한, UU 모델과 DD 모델은 흉터(S), 비대흉터(HS) 및 켈로이드(K) 조직 순서로 유전자의 발현이 차츰 증가 또는 감소하였므로, 도 2의 해당 그래프 하단에 "Gradient"로 표기하였다. UF 모델과 DF 모델은 S 조직과 비교하여 HS 및 K 조직 모두에서 유전자의 발현이 증가 또는 감소하였으로, 도 2의 해당 그래프 하단에"Both Keloid & HyperScar"로 표기하였다. FD 및 FU 모델은 S 및 H 대비 K 조직에서만 유전자 발현이 증가하거나 감소하여 켈로이드 특이적이므로, "Keloid Specific"으로 표기하였고, UD 및 DU 모델은 S 및 K 대비 HS에서만 유전자 발현이 증가하거나 감소하여 비대흉터 특이적이므로, "HyperScar Specific"으로 표기하였다.
2-4: 컷오프 및 8가지 패턴 모델에 근거한 3가지 그룹의 설정 및 바이오마커 유전자의 도출
상기 2-3에서 설명한 8가지 유전자 발현 패턴 모델과 컷오프(cutoff)를 근거로 하여 3가지 그룹을 설정하였다. 컷오프는 비교 조직 대비 분석 대상 조직의 유전자 발현이 1.33배 증가 또는 감소한 경우, 1.5배 증가 또는 감소한 경우 및 2배 증가 또는 감소한 경우를 기준으로 하였다. 그룹 설정 결과는 도 3에 나타내었다.
도 3에 나타낸 바와 같이, 그룹 1은 컷오프가 1.33배, 그룹 2는 1.5배 및 그룹 3은 2배이며, 각 그룹 내 9가지 모델에 속하는 유전자 수를 괄호 안에 나타내고(FF는 분석 안함), 비대흉터 및 켈로이드의 예방 또는 치료용 후보 약물 선정을 위한 유전자 그룹을 붉은색 박스로 표기하였다.
구체적으로, 도 3의 좌측 표 '그룹 1'에 나타낸 바와 같이, 켈로이드 유전자 바이오마커 그룹 1번은 scar < HS < Keloid 순으로 1.33배씩 높게 발현하는 up 유전자 그룹과, 반대로 Keloid < HS < scar순으로 1.33배씩 높게 발현하는 down 유전자 그룹으로 구성되었다. 그룹 1에서 up 그룹(UU)에는 33개 유전자, down 그룹(DD)에는 198개 유전자가 도출되었다.
도 3의 가운데 표 '그룹 2'에 나타낸 바와 같이, 켈로이드 유전자 바이오마커 그룹 2번은 scar < HS < Keloid 순으로 1.5배씩 높게 발현하는 up 유전자 그룹과, 반대로 Keloid < HS < scar 순으로 1.5배씩 높게 발현하는 down 유전자 그룹으로 구성되었다. 그룹 2에서 up 그룹(UU)에는 12개 유전자, down 그룹(DD)은 64개 유전자가 도출되었다.
도 3의 우측 표 '그룹 3'에 나타낸 바와 같이, 켈로이드 유전자 바이오마커 그룹 3번은 scar < HS < Keloid 순으로 2배씩 높게 발현하는 유전자(UU, 2개)와 scar 및 HS 보다 Keloid에서 2배 더 높게 발현되는 유전자(FU, 49개)로 up 그룹은 구성되었고, Keloid < HS < scar 순으로 2배씩 높게 발현하는 유전자(DD, 5개)와 Keloid보다 scar 및 HS 에서 2배 더 높게 발현되는 유전자(FD, 165개)로 down 유전자 그룹을 구성하였다. 그룹 3에서 up 그룹(UU 및 FU)은 총 51개 유전자, down 그룹(FD 및 DD)은 총 170개 유전자를 도출할 수 있었다.
2-5: 상이하게 발현된 유전자 동정 방법
상기 2-4의 3가지 그룹에서 노이즈를 제거하기 위해서, 낮게 발현되는 유전자(즉, 각 조직 그룹의 50% 이상의 샘플에서 판독 횟수가 3 미만인 유전자)는 필터링하였다. 필터링 후, 각 유전자가 각 비교에서 2배 이상 변화하는 경우 각 유전자를 상이하게 발현된 것으로 간주하였다.
2-6: 관찰 표적으로 선별된 바이오마커 유전자
상기 실시예 2-5에서 상이하게 발현된 유전자 동정 결과, 관찰 표적으로 선별된 바이오마커는 다음과 같다: UU 패턴에서는 RYR2; FU 패턴에서는 ERICH6B 및 GOLGA6L1; UF 패턴에서는 TGFB3, COL8A1 및 IGF2BP-1; DD 패턴에서는 ANGPTL7 및 APOC1; 및 FD 패턴에서는 IL10 및 HLA-DRA. 약물 재창출을 위해, 상기 선별된 비대흉터 및 켈로이드에 대한 바이오마커 유전자와 이들의 치료 후보 약물의 상호관계를 다음의 실시예에서 REMEDY(아론티어 사) 방법을 이용하여 분석하였다.
실시예 3: REMEDY를 이용한 켈로이드 치료 후보 약물 선출 방법
약물 재창출을 위해서 주식회사 아론티어에서는 유전체와 화합물의 상호관계 빅데이터(big data)에 기반으로 한 다음과 같은 'REMEDY (REpurposing MEDIcation)'라고 지칭한 방법을 사용하였다.
한 개의 특정된 화학구조를 가진 약물을 한 종류의 세포에 처리하였을 때 약물 처리전과 후의 유전체 발현의 변화 값을 구하고, 이를 시그니처(signature)라고 표현하였다. 본 발명자들은 2만개의 약물을 80여종의 부동한 세포주(cell line)에 처리하여 60만개의 시그니처를 생성하였다. 질병 유전체 발현과 이 60만개의 시그니처와의 연관성을 KS 점수(Kolmogorov-Smirnov score)로 비교하여 상위 1000개의 시그니처를 선별하고 t-SNE(t-Distributed Stochastic Neighbor Embedding)로 클러스터링(clustering) 분석을 수행하면, 치료하고자 하는 질병 유전체 발현을 정상으로 돌려 놓을 수 있는 최종약물을 선택할 수 있게 되는데, 이것이 REMEDY 방법이다.
상술한 그룹 1, 2 및 3에서 도출된 유전자를 가지고 켈로이드 예방 또는 치료용 약물 재창출 분석을 진행하기 위해, 유전체와 화합물의 상호관계에 대한 빅데이터를 기반으로 한 ㈜아론티어의 REMEDY 방법을 상술한 바와 같이 사용하였다.
간략하게, 1, 2 및 3의 유전자 그룹을 각각 60만개의 시그니처와의 연관성을 KS 점수(Kolmogorov-Smirnov score)로 비교하여 그룹 1, 2 및 3번의 UU 혹은 FU 유전자 발현을 감소시키고 DD 혹은 FD 유전자 발현을 증가시킬 수 있는 상위 1000개의 시그니처를 선별하였고, 이를 가지고 t-SNE (t-Distributed Stochastic Neighbor Embedding)로 클러스터링 같은 통계적 분석과 선행 연구결과 분석(Suarez, E., Syed, F., Alonso-Rasgado, T.　et al.　Identification of biomarkers involved in differential profiling of hypertrophic and keloid scars versus normal skin.　Arch Dermatol Res　307,　115-133 (2015). 참조)을 통해 켈로이드에서의 이상-조절된 유전자 발현을 정상으로 복귀시킬 것으로 기대하는 후보 약물을 1차로 선정하였다. 1차로 선정된 후보 약물 중 2차 후보 약물 4종을 선행문헌 분석을 통해 선택하고, 하기 실시예에서 in vitro에서 약효 검증 실험을 수행하였다.
실시예 4: 켈로이드 섬유아세포에서 후보 약물별 켈로이드 바이오마커 발현 조사
본 발명자들은 상기 2차 후보 약물 4종이 켈로이드 예방 또는 치료 효과가 있는지 검증하기 위해 환자 유래 켈로이드 섬유아세포에서 비대흉터 및 켈로이드 바이오마커 발현을 in vitro에서 조사하였다. 세포 수준에서 약물 4종의 약효 검증 결과, 약효가 검증된 약물 2종 및 양성 대조 약물인 메틸프레드니솔론의 결과를 다음에 나타내었다.
4-1: 켈로이드 섬유아세포의 준비 방법
켈로이드를 앓고 있는 환자로부터 진피를 분리하고 11번 블레이드(no. 11 blade)를 사용하여 대략 1 mm3 단편으로 절편화하였다. 콜라겐분해효소 II(Collagenase II, Invitrogens, Carlsbad, CA) 750 U/ml를 이들 단편에 첨가하고, 37℃에서 4시간 동안 인큐베이션하였다. 이 혼합물은 각 바늘에 대해 18G, 21G 및 23G 바늘을 통해 4회 흡인되었다. 그 다음, 샘플을 1,500 r.p.m에서 5분 동안 원심분리하였다. 그 후, 상층액(supernatant)을 따라 내고 세포 펠렛(cell pellet)을 얻었다.
세포를 5 ml의 DMEM 배양 배지와 함께 25 cm2 눈금의 팔콘 T-25 플라스크(Becton-Dickinson, Franklin Lakes, NJ)에 넣었다. 상기 배지에는 10% 소태아혈청(fetal bovine serum, FBS, Hyclones, Taurange, New Zealand)과 항생제-항진균제(Gibcos, Carlsbad, CA)가 포함되어 있다. 배양 세포는 5% CO2가 있는 37℃의 가습 인큐베이터에서 보관되었다. 상기 배지는 섬유아세포 성장이 밀집(confluence)에 도달할 때까지 3일 간격으로 교체되었다. 섬유아세포가 충분히 성장하면, 인산염-완충 식염수(phosphate-buffered saline, PBS) 중 0.05% 트립신(Gibcos)을 사용하여 세포를 계대배양(sub-culture)하거나 75 cm2 팔콘 T-75 플라스크(Becton-Dickinson, Bedford, MA)에 계대하였다.
이어서, 계대 배양된 세포를 페놀 레드는 함유하지 않고 0.1% 소혈청알부민(bovine serum albumin, BSA, Sigmas, St Louis, MO) 및 항생제를 함유하는 무-혈청(serum-free) DMEM에 넣었다. 이 실험에 사용된 켈로이드 섬유아세포(KF, Keloid Fibroblast)는 3회 내지 8회의 계대(passage)로 제한되었다. 모든 실험은 이중으로 수행되었으며, 3회 반복되었다.
4-2: 정량적 실시간 중합효소연쇄반응 방법
상기 4-1에서 준비된 켈로이드 섬유아세포에서 상기 2-6에서 선별된 비대흉터 및 켈로이드 바이오마커 10종의 발현 수준을 상기 후보 약물 2종이 미치는 영향을 조사하기 위해, 정량적 실시간 중합효소연쇄반응(Quantitative real-time polymerase chain reaction, qRT-PCR)을 다음과 같이 수행하였다. RNAiso Plus® (TaKaRa)를 사용하여 총 RNA를 추출한 다음, 제조업체의 프로토콜에 따라 고-성능 cDNA 역전사 키트(High-capacity cDNA reverse transcription kit, Applied Biosystems)를 사용하여, cDNA 합성에 0.5 μg의 총 RNA를 사용하였다. StepOne Real-Time PCR 시스템(Applied Biosystems)을 사용하여 각 cDNA 반응의 분주액(aliquot)(1/20)을 qRT-PCR로 분석하였다.
하기 표 1에 나타낸 유전자-특이적 프라이머를 SYBR 그린 PCR 마스터 믹스(SYBR green PCR master Mix, Applied Biosystems)와 혼합하였다. 바이오마커 유전자 10종 및 내부 대조 유전자(endogenous control gene)인 인간 GAPDH의 mRNA 수준은 상대적 표준 곡선 정량법(relative standard curve quantitation method)을 사용하여 결정되었다. 각 유전자의 프라이머 서열은 다음의 표 1에 나타내었다.
Primer name F/R Primer sequence (5'to 3') 서열번호
RYR2-3 fw Forward CAACGAGGACTTGAAGCACA 1
qhRYR2-3 rv Reverse CTTGGCTTCTTCCTCACCAG 2
ANGPTL7-fw Forward CTGCACAGACTCCAACCTCA 3
ANGPTL7-rv Reverse AAGTCTTCTGGGCGGATTTT 4
APOC1-fw Forward GTCCTGGTGGTGGTTCTGTC 5
APOC1-rv Reverse TGTCCTCCAGTGTGTTTCCA 6
ERICH6B-fw Forward GCCCATCTCCTTGAAAATCA 7
ERICH6B-rv Reverse GGTGCCCAGGTTTAAACAAA 8
GOLGA6L1-2 fw Forward GCCCTAAGGAGGGAGCTAGA 9
GOLGA6L1-2 rv Reverse CCTCTCCTTCCAACTGCTTG 10
IL10-fw Forward TTACCTGGAGGAGGTGATGC 11
IL10-rv Reverse GGGAAGAAATCGATGACAGC 12
HLA-DRA-fw Forward AGACAAGTTCACCCCACCAG 13
HLA-DRA-rv Reverse CCTGCAGTCGTAAACGTCCT 14
IGF2BP-1-fw Forward CTGAAGATCCTGGCCCATAA 15
IGF2BP-1-rv Reverse AAGGTCTTGCAACGAGGAGA 16
TGFB3-fw Forward GGTTTTCCGCTTCAATGTGT 17
TGFB3-rv Reverse CCTCTGCTCATTCCGCTTAG 18
COL8A1-fw Forward ATAGGTGCCCCAGGAATAGG 19
COL8A1-rv Reverse TGGGTCCAGGAAAACCAATA 20
Human GAPDH-fw Forward GAGTCAACGGATTTGGTCGT 21
Human GAPDH-rv Reverse GACAAGCTTCCCGTTCTCAG 22
4-3: CI-1040에 의한 비대흉터 및 켈로이드 바이오마커 발현 변화 결과
부동한 3명의 환자 켈로이드 조직에서 적출한 섬유아세포(#155, #178 및 #559)에 음성 대조군인 DMSO와 후보 약물 CI-1040을 5 μM, 50 μM 농도로 각각 세포에 처리한 후 72시간 지난 뒤, 비대흉터 및 켈로이드 바이오마커 10종의 mRNA 발현 변화를 상술한 4-2의 방법으로 RT-PCR를 통하여 관찰하였다. CI-1040에 대한 결과는 도 4에 나타내었다.
도 4에 나타낸 바와 같이, CI-1040는 세 가지 섬유아세포에서 UF 패턴 바이오마커인 COL8A1 유전자를 대조군에 비해 현저히 감소시키는 것을 관찰할 수 있었다(도 4의 파란색 박스 참조).
4-4: AZD6482에 의한 비대흉터 및 켈로이드 바이오마커 발현 변화 결과
또 다른 후보 약물인 AZD6482 또한 상기 실시예 4-3과 유사하게, 부동한 3명의 켈로이드 조직에서 적출한 섬유아세포(#155, #178 및 #559)에 음성 대조군인 DMSO와 후보 약물 AZD6482를 10 μM, 100 μM 농도로 각각 세포에 처리한 후 72시간 지난 뒤 비대흉터 및 켈로이드 바이오마커 10종의 mRNA 발현 변화를 상술한 4-2의 방법으로 RT-PCR를 통하여 관찰하였다. AZD6482에 대한 결과는 도 5에 나타내었다.
도 5에 나타낸 바와 같이, AZD6482는 DD 패턴 바이오마커인 ANGPTL7 및 APOC1 유전자의 mRNA 발현 수준을 대조군에 비하여 현저히 증가시키는 것을 관찰할 수 있었다(도 5의 붉은색 박스 참조). 세 가지 섬유아세포에서 ANGPTL7 및 APOC1 유전자는 모두 농도 의존적(dose-dependent)으로 증가하였다.
4-5: 메틸프레드니솔론에 의한 비대흉터 및 켈로이드 바이오마커 발현 변화 결과
현재 켈로이드의 치료약으로 사용되고 있는 글루코코르티코이드 수용체 작용제(glucocorticoid receptor agonist) 계열인 메틸프레드니솔론을 양성 대조 약물로 사용하였다. 상기 실시예 4-3과 유사하게, 부동한 3명의 켈로이드 조직에서 적출한 섬유아세포(#155, #178 및 #559)에 음성 대조군인 DMSO와 양성 대조군인 메틸프레드니솔론을 10 μM, 100 μM 농도로 각각 세포에 처리한 후 72시간 지난 뒤 비대흉터 및 켈로이드 바이오마커 10종의 mRNA 발현 변화를 상술한 4-2의 방법으로 RT-PCR를 통하여 관찰하였다. 메틸프레드니솔론에 대한 결과는 도 6에 나타내었다.
도 6에 나타낸 바와 같이, 메틸프레드니솔론 10 μM 및 100 μM 처리가 DD 패턴 바이오마커인 ANGPTL7 및 APOC1과 FD 패턴 바이오마커인 HLA-DRA의 mRNA 발현 수준을 대조군에 비하여 현저히 증가시키는 것을 관찰할 수 있었다.
4-6: 최종 선택된 약물
상술한 실시예 1 내지 4로부터 켈로이드 치료 후보 약물 4종(데이터 기재 안함) 중 약물 2종, CI-1040와 AZD6482를 최종적으로 잠재적 켈로이드 치료 후보 약물로 선택할 수 있었다. 비대흉터 및 켈로이드에 대한 약효가 있는지 in vivo에서 검증하기 위해서, 이하에서는 상기 최종 치료 후보 약물로서 선택된 CI-1040 및 AZD6482와 양성 대조 약물로서 메틸프레드니솔론을 사용하였다.
실시예 5: 랫드 절제 창상 모델 연구 방법
상기 실시예 4에서 최종적으로 선택된 약물의 비대흉터 및 켈로이드 예방 또는 치료 효과를 in vivo에서 검증하기 위해서 ㈜켐온(ChemOn) 신약개발지원본부 산하 유효성평가센터에 시험명 "창상 유발 Spraque-Dawley 랫드에서 Drug A 외 6종의 창상 치료 효과"로 동물실험을 의뢰하였다. 다음과 같이 랫드 절제 창상 모델(rat excision wound model)을 형성하였고, 후술될 실시예 6에서 현미경 슬라이드 스캐너(microscope slide scanner)를 이용한 조직병리학적 분석과 후술될 실시예 7에서 사진촬영을 이용한 거시적(macroscopic) 외관 분석이 수행되었다. 동물실험의 타임라인은 도 7에 나타내었다.
도 7의 타임라인 중 0일차(day 0)에서, 창상(wound)을 형성하기 위해서, 창상 형성 전에 SD 랫드(Sprague-Dawley rat)를 이소플루란(isoflurane)으로 마취하였다. 이발기(clipper)로 배부 털을 제모하고 알코올 솜으로 소독하였다. 일회용 생검 펀치(biopsy punch)를 이용하여 등쪽 피부에 구멍을 내어 8 mm 너비(원형 면적 = 50 mm2)의 절제(excision) 창상을 형성하였다. 절제 창상 유발 후 사진촬영을 실시하였다. 사진촬영은 0일차, 7일차(day 7), 14일차(day 14), 21일차(day 21) 및 28일차(day 28)에 실시하였다.
도 7에 나타낸 바와 같이, 절제 창상 처치 14일 후, 대상(subject)을 4개의 그룹(n = 5)으로 나누어 4일마다 약물을 피내(intradermal) 주사하였다. 하기 표 2에 정리한 바와 같이, 그룹 1(Group 1, G1)의 랫드에게 100% DMSO를 주입하고(비히클만 주입한 음성 대조군), 그룹 2(Group 2, G2)의 랫드에게는 20 mM의 메틸프레드니솔론을 주사하였다(양성 대조군). 그룹 3(Group 3, G3)의 랫드에게는 10 mM의 CI-1040를 주사하였고, 그룹 4(Group 4, G4)의 랫드에게는 20 mM의 AZD6482를 주사하였다. 상기 약물들은 150 μl의 DMSO에 용해시켰다.
그룹 약물 투여 농도
Group 1 DMSO 100%
Group 2 Methylprednisolone 20 mM
Group 3 CI-1040 10 mM
Group 4 AZD6482 20 mM
구체적으로, 각 약물을 함유하는 용액의 50 μl 부피를 절제 부위 주변의 상이한 세 가지 위치에 피내 주사하였다. 피부에 4회 주사(14일차, 18일차, 22일차 및 26일차)하고 최초 절제 창상 처치로부터 29일 후 분석하였다. 조직병리학적 분석을 위해 피부 조직 절편을 얻고 마슨 삼색 염색(MTS, Masson's Trichrome Stain)으로 다음과 같이 염색하였다.
실시예 6: CI-1040에 의한 절제 창상 부위의 콜라겐 섬유 감소 효과
켈로이드 치료에서 특징적 지표인 콜라겐 섬유의 함유량 감소는 켈로이드의 효과적인 치료 결과로 해석된다. 동물실험 29일째(즉, 최초 절제 창상 처치로부터 29일차)에 약물 투여 부위를 적출하여 다음과 같이 마슨 삼색 염색(MTS) 방법을 이용하여 콜라겐 섬유의 함유량을 현미경 사진을 통해 측정하였다.
6-1: 마슨 삼색 염색 방법
피부 조직 절편을 얻어 ㈜켐온(Chemon.Inc.)의 마슨 삼색 염색 방법으로 염색하였다. MTS로 염색된 슬라이드는 슬라이드 스캐너를 사용하여 검사하고 ImageJ 소프트웨어를 사용하여 콜라겐 섬유(%) 비율을 나타내는 파란색의 강도로 측정하였다. 콜라겐 섬유(%) 비율은 정상 진피와 비교하여 창상 부위 아래에서 측정되었다. 각 그룹에서 창상 부위 아래 콜라겐 섬유(%) 비율의 평균은 정상 진피의 콜라겐 섬유 대비 백분율로 표현하였다. 결과는 도 8에 나타내었다.
도 8에서 MT는 마슨 삼색(Masson's trichrome), SC는 딱지(Scab), ED는 표피(Epidermis), DE는 진피(Dermis), CM은 피근(Cutaneous muscle, 피부에 부착되는 횡문근), EP는 상피(Epithelium), HF는 모낭(Hair follicle) 및 RM은 잔존 시험 물질(test article residual)을 의미한다.
6-2: 마슨 삼색 염색 결과
도 8의 MT 염색 사진과 하단의 표에 나타낸 바와 같이, 조직병리학적 분석 결과, CI-1040 투여군(G3)에서 콜라겐 섬유가 차지하는 비율이 26.81%로 가장 낮았고, 이는 음성 대조군인 DMSO 투여군(G1, 46.73%)과 비교하여 통계학적으로 유의하게 감소한 결과이다(p < 0.05). 그 외 투여군(G2, 57.64% 및 G4, 55.98%)은 DMSO 투여군(G1)과 비교하여 통계학적인 차이는 없었다.
상기 결과와 같이, 본 발명자들은 CI-1040가 절제 창상 유발 비대흉터 및 켈로이드 조직에서 콜라겐 섬유의 함유량을 유의하게 감소시킴으로써 비대흉터와 켈로이드 치료에 유용하게 사용될 수 있음을 입증하였다.
실시예 7: 랫드 절제 창상 모델의 거시적 외관
상술하였듯이, 절제 창상 유발 후 상처의 외관을 거시적(macroscopic)으로 관찰하기 위해 사진촬영을 실시하였다. 사진촬영은 0일차, 7일차, 14일차, 21일차 및 28일차에 실시하였다. 각 랫드 사진 아래 식별문자에서 G1은 그룹 1, G2는 그룹 2, G3는 그룹 3 및 G4는 그룹 4를 나타내며, G1-X에서 X는 랫드 개체별 식별번호를 나타낸다. 예를 들어, G1-3은 그룹 1의 3번 랫드이다. 동물실험 과정 동안 동일 번호가 동일 개체에게 할당되어 유지되었다. 절제 창상 유발 후 시간에 따른 거시적 외관 사진은 도 9 내지 도 13에 나타내었다.
도 9는 절제 창상 유발 당일인 0일차에, 도 10, 도 11, 도 12 및 도 13은 각각 절제 창상 유발 후 7일차, 14일차, 21일차 및 28일차에 랫드 등쪽 피부를 사진촬영한 이미지이다. 0일차에 랫드 등쪽 피부에 절제 창상이 모든 그룹에서 동일하게 형성되었음을 확인하였다. 절제 창상 유발 후 7일차 및 14일차에 랫드 등쪽 피부가 모든 그룹에서 점차 회복되는 것을 확인할 수 있었다. 절제 창상 유발 후 21일차에 G2-6와 G3-15 랫드가 폐사하였는데, 이는 투여 약물에 의한 폐사가 아닌, 첩포 압박으로 인한 호흡 곤란으로 폐사한 것으로 간주된다.
절제 창상 유발 후 28일차에 그룹 2에서 창상 면적(wound area, mm2)이 다른 그룹 대비 넓어 가장 더디게 아물었고, 다른 그룹에서는 창상 면적에서 차이가 없었음을 확인할 수 있었다.
결론
본 발명자들은 적립된 치료법이 없는 비대흉터 및 켈로이드에 대한 약물 재창출을 위해 아론티어(주)에서 자체 개발한 유전체 기반 약물 스크리닝 플랫폼인 REMEDY를 이용하여, 본 발명의 유효성분인 CI-1040 및 AZD6482를 선출하고 CI-1040 및/또는 AZD6482를 포함하는 약제학적 조성물이 in vitro 및 in vivo에서 비대흉터 및 켈로이드의 예방 또는 치료 효과가 유의하게 있음을 확인하였다.
보다 상세하게는, 실시예 1에서는 켈로이드를 앓고 있는 환자로부터 정상적인 성숙 흉터, 비대흉터 및 켈로이드 조직을 분리하여 RNA 시퀀싱을 위한 샘플을 준비하였고, 실시예 2에서는 RNA 시퀀싱을 수행하여 데이터를 처리 및 정량하여 8가지의 유전자 발현 패턴 모델로 구성하고, 상기 8가지의 유전자 발현 패턴 모델과 3가지의 컷오프를 근거로 비대흉터 및 켈로이드 바이오마커 유전자 10종을 도출하였다.
실시예 3에서는 상기 확인한 10종의 바이오마커 유전자와 약물의 상호관계 빅테이터에 기반한 REMEDY 방법으로 2만개의 약물에서 60만개의 시그니처를 생성하였고, 켈로이드 및/또는 비대흉터 조직에서 증가한 유전자의 발현은 감소시키고 켈로이드 및/또는 비대흉터 조직에서 감소한 유전자는 증가시킬 수 있는 상위 1000개의 시그니처를 선별하였으며, t-SNE로 클러스터링 분석과 선행 연구결과 분석을 통해 1차 후보 약물을 선정하고, 그 중 약물 4종을 2차 후보 약물로 선정하였다.
실시예 4에서는 양성 대조 약물인 메틸프레드니솔론과 2차 후보 약물 중 2종이 환자 유래 켈로이드 섬유아세포에서 비대흉터 및 켈로이드 바이오마커 유전자의 발현을 정상 흉터 조직에서의 발현 방향으로 복귀시킬 수 있음을 in vitro에서 확인하고, 상기 약물 2종, 즉 CI-1040 및 AZD6482를 최종적으로 잠재적 비대흉터 및 켈로이드 치료 후보 약물로 선택하였다.
실시예 5에서는 in vivo에서 상기 잠재적인 비대흉터 및 켈로이드 치료 후보 약물의 약효를 검증하기 위해 랫드 절제 창상 모델을 형성하여 상기 약물을 각각 주입하였다. 실시예 6에서는 상기 랫드 절제 창상 모델에서 음성 대조군인 DMSO 투여군(G1) 대비 CI-1040 투여군(G3)에서 절제 창상 부위의 콜라겐 섬유가 유의하게 감소하였음을 마슨 삼색 염색을 통해 확인하였으며, 실시예 7에서는 사진촬영을 통해 거시적 외관상 CI-1040 투여군(G3) 및 AZD6482 투여군(G4)에서 상처가 점차 회복됨을 확인하였다.
따라서, ㈜아론티어에서 자체 개발한 유전체 기반 약물 스크리닝 플랫폼인 REMEDY는 현재 표준 치료법이 없는 비대흉터 및 켈로이드에 대한 바이오마커를 발굴하고, 켈로이드 및 비대흉터 조직에서 상기 바이오마커의 발현을 정상 흉터 조직의 발현 방향으로 조절할 수 있는 약물을 선출하는 데 유용하며, 선출된 약물인 CI-1040 및/또는 AZD6482가 환자 유래 켈로이드 섬유아세포와 절제 창상 동물 모델에서 비대흉터 및/또는 켈로이드의 예방 또는 치료에 유의한 효과가 있으므로, CI-1040 및/또는 AZD6482는 비대흉터 및 켈로이드의 예방 또는 치료에 유용하게 사용될 수 있다.
한편, REMEDY 방법을 이용하면, 현재 정립된 치료법이 없는 난치성 질환의 바이오마커 및 이의 잠재적 치료 약물을 용이하게 발굴할 수 있고, 이를 통해 발굴된 치료 약물의 효능을 검증함으로써, 난치성 질환의 예방 또는 치료에 용이하게 사용될 수 있다.

Claims (7)

  1. CI-1040, AZD6482, 이들의 약제학적으로 허용 가능한 염, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 또는 켈로이드의 예방 또는 치료용 약제학적 조성물.
  2. 다음에서 선택되는 적어도 한 쌍의 프라이머 서열을 유효성분으로 포함하는 켈로이드 또는 비대흉터의 진단용 조성물:
    서열번호 1의 뉴클레오타이드 서열을 가지는 RYR2에 대한 정방향 프라이머 서열 및 서열번호 2의 뉴클레오타이드 서열을 가지는 RYR2에 대한 역방향 프라이머 서열;
    서열번호 3의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 정방향 프라이머 서열 및 서열번호 4의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 역방향 프라이머 서열;
    서열번호 5의 뉴클레오타이드 서열을 가지는 APOC1에 대한 정방향 프라이머 서열 및 서열번호 6의 뉴클레오타이드 서열을 가지는 APOC1에 대한 역방향 프라이머 서열;
    서열번호 7의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 정방향 프라이머 서열 및 서열번호 8의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 역방향 프라이머 서열;
    서열번호 9의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 정방향 프라이머 서열 및 서열번호 10의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 역방향 프라이머 서열;
    서열번호 11의 뉴클레오타이드 서열을 가지는 IL10에 대한 정방향 프라이머 서열 및 서열번호 12의 뉴클레오타이드 서열을 가지는 IL10에 대한 역방향 프라이머 서열;
    서열번호 13의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 정방향 프라이머 서열 및 서열번호 14의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 역방향 프라이머 서열;
    서열번호 15의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 정방향 프라이머 서열 및 서열번호 16의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 역방향 프라이머 서열;
    서열번호 17의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 정방향 프라이머 서열 및 서열번호 18의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 역방향 프라이머 서열; 또는
    서열번호 19의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 정방향 프라이머 서열 및 서열번호 20의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 역방향 프라이머 서열.
  3. 제2항에 있어서, 상기 조성물은 다음에서 선택되는 적어도 한 쌍의 프라이머 서열을 유효성분으로 포함하며 켈로이드 특이적 진단용인, 조성물:
    서열번호 7의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 정방향 프라이머 서열 및 서열번호 8의 뉴클레오타이드 서열을 가지는 ERICH6B에 대한 역방향 프라이머 서열;
    서열번호 9의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 정방향 프라이머 서열 및 서열번호 10의 뉴클레오타이드 서열을 가지는 GOLGA6L1에 대한 역방향 프라이머 서열;
    서열번호 11의 뉴클레오타이드 서열을 가지는 IL10에 대한 정방향 프라이머 서열 및 서열번호 12의 뉴클레오타이드 서열을 가지는 IL10에 대한 역방향 프라이머 서열; 또는
    서열번호 13의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 정방향 프라이머 서열 및 서열번호 14의 뉴클레오타이드 서열을 가지는 HLA-DRA에 대한 역방향 프라이머 서열.
  4. 제2항에 있어서, 상기 조성물은 다음에서 선택되는 적어도 한 쌍의 프라이머 서열을 유효성분으로 포함하며 비대흉터의 진단용인, 조성물:
    서열번호 1의 뉴클레오타이드 서열을 가지는 RYR2에 대한 정방향 프라이머 서열 및 서열번호 2의 뉴클레오타이드 서열을 가지는 RYR2에 대한 역방향 프라이머 서열;
    서열번호 3의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 정방향 프라이머 서열 및 서열번호 4의 뉴클레오타이드 서열을 가지는 ANGPTL7에 대한 역방향 프라이머 서열;
    서열번호 5의 뉴클레오타이드 서열을 가지는 APOC1에 대한 정방향 프라이머 서열 및 서열번호 6의 뉴클레오타이드 서열을 가지는 APOC1에 대한 역방향 프라이머 서열;
    서열번호 15의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 정방향 프라이머 서열 및 서열번호 16의 뉴클레오타이드 서열을 가지는 IGF2BP-1에 대한 역방향 프라이머 서열;
    서열번호 17의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 정방향 프라이머 서열 및 서열번호 18의 뉴클레오타이드 서열을 가지는 TGFB3에 대한 역방향 프라이머 서열; 또는
    서열번호 19의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 정방향 프라이머 서열 및 서열번호 20의 뉴클레오타이드 서열을 가지는 COL8A1에 대한 역방향 프라이머 서열.
  5. 다음을 포함하는 켈로이드 또는 비대흉터의 진단에 필요한 정보를 제공하는 방법:
    (a) 대상으로부터 분리된 생물학적 시료와 정상 대조군 시료를 제2항 내지 제4항 중 어느 한 항의 진단용 조성물과 접촉시키는 단계; 및
    (b) RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1, IGF2BP-1, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량을 측정하는 단계; 상기 유전자 중 RYR2, ERICH6B, GOLGA6L1, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 증가된 상태이거나, ANGPTL7, APOC1, IL10 및 HLA-DRA 로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 감소된 상태인 경우, 켈로이드 또는 비대흉터로 판단한다.
  6. 제5항에 있어서, 상기 단계 (b)에서 ERICH6B, GOLGA6L1, IL10 및 HLA-DRA 중 적어도 하나 이상의 발현량을 필수적으로 측정하는 것을 특징으로 하며 켈로이드 특이적 진단에 필요한 정보를 제공하는 것인, 방법: 상기 유전자 중 ERICH6B 또는 GOLGA6L1 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 증가된 상태이거나, IL10 또는 HLA-DRA 유전자의 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 감소된 상태인 경우, 켈로이드로 판단한다.
  7. 제5항에 있어서, 상기 단계 (b)에서 RYR2, TGFB3, COL8A1 및 IGF2BP-1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 증가된 상태이거나, ANGPTL7 및 APOC1로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 발현량이 정상 대조군 시료에서의 유전자 발현량과 비교하여 감소된 상태인 경우, 비대흉터로 판단한다.
PCT/KR2022/007576 2021-05-31 2022-05-27 Ci-1040, azd6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물 WO2022255738A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210070446A KR20220161993A (ko) 2021-05-31 2021-05-31 Ci-1040, azd6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물
KR10-2021-0070446 2021-05-31

Publications (1)

Publication Number Publication Date
WO2022255738A1 true WO2022255738A1 (ko) 2022-12-08

Family

ID=84324342

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/007576 WO2022255738A1 (ko) 2021-05-31 2022-05-27 Ci-1040, azd6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물

Country Status (2)

Country Link
KR (1) KR20220161993A (ko)
WO (1) WO2022255738A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040136975A1 (en) * 2002-03-22 2004-07-15 Duesbery Nicholas S Anthrax lethal factor inhibits tumor growth and angiogenesis
KR20170081962A (ko) * 2016-01-05 2017-07-13 한양대학교 산학협력단 켈로이드 또는 비후성 반흔 예방 또는 치료용 조성물
WO2020201073A1 (en) * 2019-03-29 2020-10-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of keloid, hypertrophic scars and/or hyperpigmentation disorders

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040136975A1 (en) * 2002-03-22 2004-07-15 Duesbery Nicholas S Anthrax lethal factor inhibits tumor growth and angiogenesis
KR20170081962A (ko) * 2016-01-05 2017-07-13 한양대학교 산학협력단 켈로이드 또는 비후성 반흔 예방 또는 치료용 조성물
WO2020201073A1 (en) * 2019-03-29 2020-10-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of keloid, hypertrophic scars and/or hyperpigmentation disorders

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MATSUMOTO NORIKO M., AOKI MASAYO, OKUBO YURI, KUWAHARA KOSUKE, EURA SHIGEYOSHI, DOHI TERUYUKI, AKAISHI SATOSHI, OGAWA REI: "Gene Expression Profile of Isolated Dermal Vascular Endothelial Cells in Keloids", FRONTIERS IN CELL AND DEVELOPMENTAL BIOLOGY, vol. 8, no. 658, pages 1 - 12, XP093012044, DOI: 10.3389/fcell.2020.00658 *
ZHANG DAN, LI BO, ZHAO MUXIN: "Therapeutic Strategies by Regulating Interleukin Family to Suppress Inflammation in Hypertrophic Scar and Keloid", FRONTIERS IN PHARMACOLOGY, vol. 12, no. 667763, pages 1 - 11, XP093012041, DOI: 10.3389/fphar.2021.667763 *

Also Published As

Publication number Publication date
KR20220161993A (ko) 2022-12-07

Similar Documents

Publication Publication Date Title
WO2017078440A1 (ko) 신경세포 손실 예방 및 재생 효능을 가지는 펩티드 및 이를 포함하는 조성물
WO2015060673A1 (ko) 전립선 비대증 치료 및 예방용 조성물
WO2016137162A1 (ko) 청력 손상 방어용 펩타이드 및 이를 포함하는 조성물
WO2016190660A1 (ko) 신규 펩티드 및 이를 포함한 조성물
WO2012064146A2 (ko) Ｇｋｎ １을 함유하는 항암용 조성물
WO2021107644A1 (ko) 항암 효과 증진을 위한 ERRγ 억제제를 유효성분으로 포함하는 조성물의 용도
WO2020055166A1 (ko) 벤즈히드릴 티오 아세트아미드 화합물을 유효성분으로 포함하는 섬유화 질환의 치료용 조성물
WO2023003417A1 (ko) Kras 돌연변이 특이적 저해제 및 이를 포함하는 암 예방 또는 치료용 조성물
WO2022255738A1 (ko) Ci-1040, azd6482, 또는 이들의 조합을 유효성분으로 포함하는 비대흉터 및 켈로이드의 예방 또는 치료용 약제학적 조성물
WO2020117031A2 (en) Composition and method for inhibiting amyloid beta accumulation and/or aggregation
WO2018074682A1 (ko) 항비만 및 항당뇨 효능을 갖는 펩타이드 및 이의 용도
WO2018026212A2 (ko) 섬유증 질환 모델의 제조방법 및 섬유증 질환 모델의 용도
US20130059303A1 (en) Cdkn2a as a prognostic marker in bladder cancer
WO2009151304A2 (ko) 에이케이에이피일이를 함유하는 조성물 및 동물 모델로서 에이케이에이피일이 돌연변이 제브라피쉬의 용도
WO2022114881A1 (ko) 벤즈브로마론을 포함하는 상처 또는 흉터의 예방 또는 치료용 약학 조성물
WO2019143145A1 (ko) 레졸빈 d2를 유효성분으로 함유하는 피부 염증 치료용 조성물
WO2020091463A1 (ko) 분리된 미토콘드리아를 포함하는 건병증 예방 또는 치료용 약학 조성물
WO2020085548A1 (ko) 특발성 폐섬유증 예방 또는 치료용 재조합 단백질 및 이를 포함하는 특발성 폐섬유증 예방 또는 치료용 조성물
WO2023282688A1 (ko) 산화스트레스 저항성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
WO2021221447A1 (ko) 암 치료를 위한 활성 안드로겐 수용체 길항제의 용도
WO2016018090A1 (ko) 혈관신생촉진용 펩타이드 및 이의 용도
WO2020071665A2 (ko) 세포의 텔로미어를 신장시키는 조성물 및 그 제조방법
WO2015111971A1 (ko) Gpr119 리간드를 유효성분으로 포함하는 비알콜성 지방간 질환의 예방 또는 치료용 약학적 조성물
WO2017164486A1 (ko) Tesk1 억제제를 포함하는 항암제 내성 억제용 조성물 및 tesk1 억제제의 스크리닝 방법
WO2020111325A1 (ko) Plk1의 활성 억제제를 유효성분으로 포함하는 암 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22816397

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22816397

Country of ref document: EP

Kind code of ref document: A1