WO2022220269A1

WO2022220269A1 - Skin whitening composition

Info

Publication number: WO2022220269A1
Application number: PCT/JP2022/017727
Authority: WO
Inventors: 麻衣子宮▲崎▼; 裕晃飯塚; 敦史山津; 武祚金
Original assignee: 株式会社ファーマフーズ
Priority date: 2021-04-15
Filing date: 2022-04-13
Publication date: 2022-10-20
Also published as: JP2022163974A; JP7089305B1; CN117119910A

Abstract

The present invention provides a whitening agent which is highly safe and also has an excellent whitening effect.　The present invention provides a skin whitening composition containing trehalose as an active ingredient. The present invention also provides a method for improving the brightness of the skin, the method comprising a step for applying a skin whitening composition containing trehalose as an active ingredient.

Description

Skin whitening composition

The present invention relates to a skin whitening composition. Specifically, it relates to a skin whitening composition containing trehalose as an active ingredient.

In addition to sunburn due to UV exposure, pigmentation on the skin such as spots, freckles, and dullness is caused by abnormal turnover of melanin that is excessively produced after the melanin production of pigment cells (melanocytes) is accelerated. It has been known. Since such pigment deposition on the skin is easily recognized from the appearance, it is a major cosmetic concern for many people, and the demand for whitening agents and whitening cosmetics has increased in recent years.

In response to such demand, in recent years, melanin production inhibitors, tyrosinase inhibitors, tyrosinase gene expression inhibitors, α - Whitening agents such as MSH inhibitors and antioxidants have been developed that focus on the mechanism of action that causes pigmentation.

However, the whitening effect of such a whitening agent may cause unwanted side effects at concentrations at which it exerts its action, and there is a demand for the development of a whitening agent that is highly safe and has excellent whitening action.

The present inventors have found that trehalose has a whitening action, and have produced a highly safe skin whitening composition having an excellent whitening action by using this trehalose, and a skin whitening composition using this composition. To provide a method for improving the brightness of

Therefore, according to main aspects of the present invention, the following inventions are provided.
(Item 1)
A skin whitening composition comprising trehalose as an active ingredient.
(Item 2)
The composition according to the preceding items, comprising trehalose at a concentration of at least about 0.001% w/v.
(Item 3)
A composition according to any one of the preceding items, wherein the composition is taken orally or applied to the skin.
(Item 4)
A composition according to any one of the preceding items, wherein the trehalose is taken orally or applied to the skin in an amount of about 1 mg to about 10 g/day.
(Item 5)
A composition according to any one of the preceding items, wherein the composition is taken orally or applied to the skin in combination with glutathione.
(Item 6)
A composition according to any one of the preceding items, wherein at least about 2.5 mg/ml of said trehalose and at least about 0.5 mM of said glutathione are combined and taken orally or applied to the skin.
(Item 7)
The composition according to any one of the above items, which suppresses melanogenesis.
(Item 8)
The composition according to any one of the preceding items, which suppresses tyrosinase expression.
(Item 9)
The composition according to any one of the above items, which is a food or drink, a food additive, a cosmetic, a quasi-drug, or a pharmaceutical.
(Item A1)
1. A method of improving skin brightness, comprising applying a skin lightening composition comprising trehalose as an active ingredient.
(Item A2)
The method of any preceding item, wherein said composition comprises said trehalose at a concentration of at least about 0.001% w/v.
(Item A3)
A method according to any one of the preceding items, wherein said applying comprises oral ingestion and application to the skin surface of said composition.
(Item A4)
A method according to any one of the preceding items, wherein the skin comprises a portion of the skin in which melanin is deposited.
(Item A5)
A method according to any one of the preceding items, wherein said applying step is performed to apply said active ingredient in an amount of about 1 mg to about 10 g/day.
(Item A6)
A method according to any one of the preceding items, wherein the step of applying comprises oral ingestion or application to the skin surface in combination with the composition and glutathione.
(Item A7)
13. The method of any one of the preceding items, wherein the combination of at least about 2.5 mg/ml of said trehalose and at least about 0.5 mM of said glutathione is taken orally or applied to the skin surface.
(Item B1)
A non-therapeutic skin-whitening method comprising the step of applying the skin-whitening composition according to any one of the above items to the skin or orally ingesting it.
(Item C1)
A melanogenesis inhibitor containing trehalose as an active ingredient.
(Item C2)
The inhibitor of any preceding item, comprising trehalose at a concentration of at least about 0.001% w/v.
(Item C3)
An inhibitor according to any one of the preceding items, wherein the inhibitor is taken orally or applied to the skin.
(Item C4)
The inhibitor of any one of the preceding items, wherein the trehalose is taken orally or applied to the skin in an amount of about 1 mg to about 10 g/day.
(Item C5)
The inhibitor according to any one of the preceding items, wherein the composition is taken orally or applied to the skin in combination with glutathione.
(Item C6)
The inhibitor of any one of the preceding items, wherein at least about 2.5 mg/ml of said trehalose and at least about 0.5 mM of said glutathione are ingested orally or applied to the skin in combination.
(Item C7)
The suppressor according to any one of the above items, which suppresses tyrosinase expression.
(Item C8)
A skin whitening composition containing the melanogenesis inhibitor according to any one of the above items. (Item C9)
The composition according to the above items, which is a food or drink, food additive, cosmetic, quasi-drug, or pharmaceutical.

In the present disclosure, it is intended that one or more of the above features may be provided in further combinations in addition to the explicit combinations. Still further embodiments and advantages of the present disclosure will be appreciated by those skilled in the art upon reading and understanding the following detailed description, if necessary.

It should be noted that features and remarkable actions and effects of the present disclosure other than those described above will become clear to those skilled in the art by referring to the following embodiments of the invention and the drawings.

The composition of the present invention can suppress the synthesis of melanin and increase the brightness of the skin. In addition, it is possible to obtain beauty effects such as whitening whether applied to the skin or taken orally. is high.

FIG. 1 is a graph showing the effect of improving skin brightness when a trehalose-containing material is ingested in one embodiment of the present invention. The trehalose-containing substance intake group and the placebo group were compared in skin lightness when ingested daily for 8 weeks (November to December). FIG. 2 is a graph showing comparative results of tyrosinase gene expression in B16 melanoma cells, in one embodiment of the present invention. For each of the MSH group to which MSH was added to stimulate tyrosinase production, the control group to which MSH was not added, and the trehalose group to which MSH and trehalose were added (0.38%, 0.76%, 1%), the tyrosinase gene Expression was compared. FIG. 3 is a graph showing comparison results of melanin production when a trehalose-containing substance alone, a glutathione substance alone, or a combination of a trehalose-containing substance and glutathione were added to B16 mouse melanoma cells in one embodiment of the present invention. Using the MSH group as a positive control and the untreated group as a negative control, 10 or 5 mg/mL as a trehalose-containing substance (3.8 mg/mL trehalose or 1.95 mg/mL trehalose, respectively in terms of trehalose amount), 1 as glutathione or 2 mM was added.

The present disclosure will be described below while showing the best mode. It should be understood that throughout this specification, expressions in the singular also include the concept of the plural unless specifically stated otherwise. Thus, articles in the singular (eg, “a,” “an,” “the,” etc. in the English language) should be understood to include their plural forms as well, unless otherwise stated. Also, it should be understood that the terms used in this specification have the meanings commonly used in the relevant field unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will control.

Definitions of terms and/or basic technical contents particularly used in this specification are explained below as appropriate.

As used herein, "about" means ±10% of the following numerical value.

As used herein, "skin whitening" refers to the prevention and / or improvement of pigmentation, more specifically, hypermelanin production such as spots, dullness, freckles, sunburn, darkening due to skin inflammation and irritation, excessive Refers to prevention and/or improvement of pigmentation symptoms caused by accumulation, abnormal deposition, and the like.

(preferred embodiment)
Preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that a person skilled in the art can make appropriate modifications within the scope of the present disclosure in light of the description in this specification. Also, the following embodiments of the disclosure may be used singly or in combination.

In one aspect of the present invention, there is provided a skin whitening composition containing trehalose as an active ingredient.

Trehalose is a non-reducing disaccharide formed by α-1,1-glycosidic bonding of two molecules of α-glucose, and is naturally present in many animals, plants and microorganisms. Trehalose has isomers of α,α-type structure (α-D-glucopyranosyl α-D-glucopyranoside), α,β-type structure (neotrehalose), and β,β-type structure (isotrehalose). In the present invention, any type can be used, and one type can be used alone or two or more types can be used in appropriate combination. Trehalose has various functions and is widely used as an additive in foods such as a sweetener. At present, it is industrially mass-produced from starch and is readily available as a commercial product. Commercially available trehalose can also be used in the method of the present invention as long as it does not impair the effects of the method of the present invention.

The trehalose used in food can be produced from potato and corn starch, but it is also possible to extract trehalose by culturing large amounts of microorganisms such as yeast.

Although the composition for skin whitening of the present invention is not particularly limited, it can be ingested transdermally or orally.

(food and drink)
In one embodiment of the present invention, when the composition of the present invention is orally ingested or orally administered, it can be used as food and drink or food additives, or it can be used as quasi-drugs or pharmaceuticals. .

In the case of the form of food and drink, the content of trehalose may be an amount that can exhibit the desired effect, and can be appropriately changed according to the type of food and drink and the form of food and drink to which the composition is added. For example, the total content of trehalose relative to the total amount of the composition is preferably about 0.001 to about 10 w/v%, about 0.01 to about 10 w/v%, about 0.1 to about 10 w/v%, More preferably about 0.1 to about 8 w/v%, more preferably about 1 to about 5 w/v%. In one embodiment, the content of trehalose in the compositions of the invention can be, for example, about 0.38 w/v%.

In addition, in one embodiment of the present invention, when the composition of the present invention is in the form of a food or drink, ingredients that are commonly used in food production can be arbitrarily added during the production thereof. Optional ingredients can include, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavors. Carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; sugar alcohols such as erythritol; As flavoring agents, natural flavoring agents (thaumatin, stevia extract, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. In addition, additives such as excipients, binders, disintegrants, lubricants, stabilizers, corrigents, corrigents, pH adjusters and coloring agents that are usually added to foods may be used.

In one embodiment of the present invention, the form of the food and drink may be in the form of liquid, paste, solid, powder, granules, or the like. In yet another embodiment, the composition of the present invention can be a soluble powder and can be contained, added or mixed with any other food or drink such as tablets, hard capsules, jellies, and drinks.

Although there is no particular limitation on the preferred intake amount of the food or drink containing the skin whitening composition containing trehalose of the present invention as an active ingredient, about 0.001 mg to about 10 g per day in terms of trehalose is sufficiently effective. more preferably about 0.01 mg to about 10 g, more preferably about 1 mg to about 10 g, and can be ingested in an amount of about 38 mg per day. This daily amount can be taken at once or divided into several times. In addition to single ingestion, continuous or intermittent ingestion for several weeks to several months is preferred.

(External preparation for skin)
The composition for skin whitening of the present invention can be transdermally administered or applied to the skin as external preparations for skin, such as cosmetics, quasi-drugs, and pharmaceuticals. The dosage form of the composition for external use on skin is not particularly limited, but examples thereof include lotions, emulsifiers such as milky lotions and creams, oil formulations, gel formulations, pack formulations, and the like.

When the composition of the present invention is in the form of an external preparation for skin, the content of trehalose may be any amount that can exhibit the desired effect, depending on the type of cosmetic and the form of the external preparation for skin in which the composition is mixed. For example, the total amount of trehalose relative to the total amount of the composition, preferably about 0.001 to about 10 w/v%, more preferably about 0.01 to about 10 w/v%, More preferably, it can be about 0.1 to about 8 w/v%. In one embodiment, the content of trehalose in the compositions of the invention can be, for example, about 0.38 w/v%.

When the composition of the present invention is in the form of an external preparation for skin, it can optionally contain components other than trehalose that are blended in ordinary external compositions for skin as long as the effects of the present invention are not impaired. Such ingredients include, for example, macadamia nut oil, avocado oil, corn oil, olive oil, rapeseed oil, sesame oil, castor oil, safflower oil, cottonseed oil, jojoba oil, coconut oil, palm oil, liquid lanolin, hydrogenated coconut oil, Oils such as hydrogenated oil, Japanese wax, hydrogenated castor oil, beeswax, candelilla wax, carnauba wax, ivory wax, lanolin, reduced lanolin, hard lanolin, and jojoba wax; liquid paraffin, squalane, pristane, ozokerite, paraffin, ceresin, vaseline, Hydrocarbons such as microcrystalline wax; higher fatty acids such as oleic acid, isostearic acid, lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, and undecylenic acid; cetyl alcohol, stearyl alcohol, isostearyl alcohol, behenyl alcohol, Higher alcohols such as octyldodecanol, myristyl alcohol, cetostearyl alcohol, etc.; Ethylene glycol di-2-ethylhexanoate, neopentyl glycol dicaprate, glyceryl di-2-heptylundecanoate, glyceryl tri-2-ethylhexanoate, trimethylolpropane tri-2-ethylhexanoate, trimethylol triisostearate synthetic ester oils such as propane and pentane erythritol of tetra-2-ethylhexanoate; chain polysiloxanes such as dimethylpolysiloxane, methylphenylpolysiloxane and diphenylpolysiloxane; octamethylcyclotetrasiloxane, decamethylcyclopentasiloxane, Cyclic polysiloxanes such as dodecamethylcyclohexanesiloxane; silicone oils such as modified polysiloxanes such as amino-modified polysiloxane, polyether-modified polysiloxane, alkyl-modified polysiloxane, and fluorine-modified polysiloxane may be used.

In addition, the composition for skin whitening of the present invention can also contain a whitening agent other than trehalose. Examples of such whitening agents include alkylresorcinol, ascorbic acid or derivatives thereof, placental extracts, plant extracts such as saxifrage and adlay, arbutin, kojic acid, glutathione, lactic acid, and cysteine.

In one embodiment, the skin whitening composition containing trehalose as an active ingredient of the present invention is orally ingested or applied to the skin in combination with glutathione to obtain a synergistic effect of the whitening effect of trehalose and the whitening effect of glutathione. can be done. In one embodiment, the composition of the present invention contains at least about 2.5 mg/ml, about 3.0 mg/ml, about 3.5 mg/ml, about 3.8 mg/ml, about 4.0 mg/ml, about 4 .5 mg/ml, about 5.0 mg/ml, about 5.5 mg/ml, about 7.5 mg/ml, about 9.5 mg/ml, about 11.5 mg/ml, about 13.5 mg/ml, about 15. 5 mg/ml, or about 25.5 mg/ml trehalose, and at least about 0.5 mM, about 0.6 mM, about 0.7 mM, about 0.8 mM, about 0.9 mM, about 1 mM, about 1.5 mM, about A synergistic effect can be obtained by oral ingestion or dermal application in combination with 2 mM, about 3 mM, about 4 mM, about 5 mM, about 8 mM, or about 10 mM glutathione. In a preferred embodiment, the skin whitening composition containing trehalose as an active ingredient of the present invention is orally ingested or applied to the skin in combination with at least about 3.8 mg/ml trehalose and at least about 1 mM glutathione, A synergistic effect can be obtained. In another preferred embodiment, the composition of the present invention can achieve a synergistic effect by combining at least about 3.8 mg/ml trehalose and at least about 2 mM glutathione when taken orally or applied dermally.

Trehalose is mainly used as a moisturizing agent for the stratum corneum, and its molecular weight is 342.296 g/mol. It is known that the skin has the property of permeating substances of 500 Da or less (Exp Dermatol. 2000 Jun;9(3):165-9). It is believed that when a skin whitening composition containing the active ingredient is transdermally administered, trehalose permeates the skin, resulting in a whitening effect. Therefore, the composition of the present invention can exert a skin whitening effect and/or a melanogenesis inhibitory effect even when transdermally administered.

The preferred amount of the cosmetic or topical skin preparation containing the skin-whitening composition containing trehalose as an active ingredient of the present invention is not particularly limited. From the viewpoint of sufficiently exhibiting the effect, it is preferable to use about 0.01 mg to about 10 g, further about 0.1 mg to about 10 g, about 1 mg to about 10 g, about 1 mg to about 1000 mg, about 10 mg to about 100 mg. Preferably, it can also be applied in an amount of about 38 mg per day. This daily amount can be applied at once or divided into several applications. In addition to single application, continuous or intermittent application for several weeks to several months is preferred.

(Inhibition of Melanogenesis and Tyrosinase Gene Expression)
In one embodiment of the present invention, the skin-whitening composition of the present invention can suppress melanogenesis both when taken orally and when applied to the skin. In another embodiment, the skin-whitening composition of the present invention can suppress the expression of the tyrosinase gene both when it is orally ingested and when it is applied to the skin.

In one aspect of the present invention, there is provided a method for improving skin brightness, comprising applying a skin-whitening composition containing trehalose as an active ingredient.

The content of trehalose in the composition used in the method for improving the brightness of the skin of the present invention may be any amount that can exhibit the desired effect, and can be appropriately changed according to the site of the skin to which it is applied and the mode of application. For example, the total content of trehalose is preferably about 0.001 to about 10 w/v%, more preferably about 0.01 to about 10 w/v%, still more preferably about 0.01 to about 10 w/v%. It can be from 1 to about 8 w/v %. In one embodiment, the content of trehalose in the compositions of the invention can be, for example, about 0.38 w/v%.

In the method for improving skin brightness of the present invention, the skin whitening composition containing trehalose as an active ingredient can be ingested orally or applied to the skin surface. When applied to the skin, it can be applied to any kind of skin, but the whitening effect of the skin whitening composition of the present invention can be enhanced by applying it to the skin where melanin is deposited. can be obtained efficiently.

In the method of improving the brightness of the skin of the present invention, the amount of the skin whitening composition containing trehalose as an active ingredient is not particularly limited. From the viewpoint of sufficiently exhibiting the effect, it is preferable to use about 0.01 mg to about 10 g, further about 0.1 mg to about 10 g, about 1 mg to about 10 g, about 1 mg to about 1000 mg, about 10 mg to about 100 mg. Preferably, it can also be applied in an amount of about 38 mg per day. This daily amount may be applied at once or divided into several portions. In addition to single application, continuous or intermittent application for several weeks to several months is preferred.

In one embodiment of the present invention, according to the method for improving skin brightness of the present invention, the skin lightening composition containing trehalose as an active ingredient is applied for at least about 8 weeks. The lightness of skin to which the composition is applied is about 0.5%, about 0.7%, about 1%, about 1.5%, about 1.6%, about 1.8%, as compared to skin without skin. The improvement can be about 2%, about 5%, about 8%, about 10%, about 15%, about 20%, about 30%, about 40%, about 60%, about 80%, or about 100%.

In one aspect of the present invention, there is provided a non-therapeutic whitening method comprising the step of applying a skin whitening composition to the skin or orally ingesting it. In this case, as the skin-whitening composition used in the skin-whitening method of the present invention, the skin-whitening composition described elsewhere in this specification can be used.

In another aspect, it is possible to provide a melanogenesis inhibitor containing trehalose as an active ingredient. In this case, the melanogenesis inhibitor of the present invention can be used as a skin whitening composition together with other excipients. Such skin lightening compositions can be used as the skin lightening compositions described elsewhere herein.

In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "or". When we say "within a range" of "two values" herein, the range includes the two values themselves.
All references, such as scientific articles, patents, patent applications, etc., cited herein are hereby incorporated by reference in their entireties to the same extent as if each were specifically set forth.

In the above, the present disclosure has been described by showing preferred embodiments for easy understanding. While the present disclosure will now be described based on the examples, the foregoing description and the following examples are provided for illustrative purposes only and not for the purpose of limiting the present disclosure. Accordingly, the scope of the present disclosure is not limited to the embodiments or examples specifically described herein, but only by the claims.

(Example 1: Effect of improving skin brightness by ingestion of trehalose-containing material)
The effect of improving skin brightness was confirmed when trehalose-containing substances were orally ingested by humans. The test design was a double-blind parallel group test, and the subjects were divided into two groups in advance so that the skin brightness was almost equal. , placebo (control) 100 mg/day orally (N=12). In each group, trehalose-containing or placebo was to be ingested once a day and was ingested daily for 8 weeks (November-December).

For the measurement of skin lightness, the skin color sensor (SCS-1, Moritex Co.) was used to measure the lightness over time at the same locations on both arms at 0, 2, 4, 6, and 8 weeks.

The results are shown in Figure 1. Compared to the placebo group, the trehalose-containing group started to show an improvement in skin brightness after 2 weeks, and the trehalose-containing group showed a 1.6% improvement in skin brightness after 8 weeks compared to the placebo group. I understood it.

(Example 2: Tyrosinase gene expression inhibitory effect by trehalose-containing material)
Using B16 mouse melanoma cells, the effect of trehalose content on tyrosinase gene expression was confirmed.

The following reagents were used.
・ Subculture medium: 10% FBS, 1% P / S, D-MEM (low glucose, Fujifilm 041-29775)
・Sample addition medium (D-MEM/2% FBS): 2% FBS, 1% P/S, D-MEM (low glucose, Fujifilm 041-29775)
・ PBS (-): Either bottle (Fuji Film) or powder (Dulbecco) can be used ・ α-MSH: (Wako, 338-40571) Dissolve in DW filtered to 0.1 mM, 50 μL each in an Eppendorf tube and store at -25°C. Thawed at the time of use and dissolved in D-MEM/2% FBS medium to 100 nM MSH.
・Trehalose-containing material: A necessary amount was weighed out, dissolved by adding 100 nM MSH, D-MEM/2% FBS to 10 mg/mL, and sterilized with a filter before use.・Trehalose: A necessary amount was weighed out, dissolved by adding 100 nM MSH and D-MEM/2% FBS to 10, 7.6, and 3.8 mg/mL, and sterilized with a filter before use. .
・ISOGEN II: Nippon Gene, 311-07361
・Distilled Water for RNA extraction: Nippon Gene, 312-90103
・Iso propanol: Fujifilm, 168-21675
• 75% EtOH: Prepared by mixing EtOH (Wako, 057-00456) and DW for RNA extraction at 3:1.
・PrimeScript RT reagent kit: Takara Bio, RR037A
・TB Green Premix Ex Taq II: Takara Bio, RR820A
- β-actin primer: FASMAC, F sequence: ACTATTGGCAACGAGCGGTT (SEQ ID NO: 1), R sequence: ATGGATGCCACAGGATTCCA (SEQ ID NO: 2)
A solution was prepared by mixing the F primer and the R primer so that each concentration was 5 μM.
・ Tyrosinase primer: FASMAC, F sequence: GCCCAGCATCCTTCTTC (SEQ ID NO: 3)
, R sequence: TAGTGGTCCCTCAGGTGTCC (SEQ ID NO: 4)
A solution was prepared by mixing the F primer and the R primer so that each concentration was 5 μM.

(cell culture/sample addition)
1.0×10 ⁵ cells/mL, 0.5 mL/well were seeded in a 24-well plate, and the next day, the medium was changed to D-MEM/2% FBS. After 4 to 6 hours, a sample dissolved in D-MEM/2% FBS+α-MSH 100 nM (ratio: D-MEM/2% FBS 50 mL+0.1 mM α-MSH 50 μL) was added at 0.5 mL/well. D-MEM/2% FBS containing 100 nM α-MSH was used as a positive control, and D-MEM/2% FBS was used as a negative control. This was cultured for 24 hours.

(RNA extraction)
After washing once with PBS, 0.4 mL/well of ISOGEN II was added and collected in an Eppendorf tube. 0.16 mL of DW for RNA extraction was added to each Eppendorf tube, sandwiched between Eppendorf tubes, vigorously stirred for 15 seconds, and allowed to stand for 5 to 10 minutes. Centrifugation was then performed at 120 x 100 g for 15 minutes at 20°C. 0.5 mL/eppendorf tube of supernatant was collected and added to another eppendorf tube. 0.5 mL/eppendorf tube of isopropanol was added, mixed by inversion, and allowed to stand for 5 to 10 minutes. Centrifugation was then performed at 120 x 100 g for 10 minutes at 20°C.

Decant and add 0.5 mL/eppendorf tube of 75% EtOH. Centrifugation was then performed at 80 x 100 g for 5 minutes at 20°C. It was further decanted and 0.5 mL/eppendorf tube of 75% EtOH was added (2nd time). Centrifugation was then performed at 80 x 100 g for 5 minutes at 20°C. It was also decanted further and air dried upside down for about 20 minutes. 30 μL/eppendorf tube of DW for RNA extraction was added to dissolve the RNA and stored at -80°C.

(cDNA synthesis)
The concentration of RNA was measured using a plate reader, and the RNA solution was added to 8-strip tubes so that the concentration was 200 ng/μL. PrimeScript 1. buffer,2. RT enzyme, 3. dT primers (50 μM), and 4. Random 6mers (100 μM) were mixed so as to be 1:0.25:0.25:0.25:0.25 (μL)/1 sample, and after vortexing, spin down to prepare. After preparing them all together, they were added at 1.75 μL/well.

DW was added so that the total of the mix of RNA solution and PrimeScript and DW was 10 μL, the lid of the 8-tube tube was closed, and after vortexing and spinning down, the mixture was reacted in a thermal cycler (37°C, 15 minutes → 85°C , 15 sec→4° C.). After the reaction, 30 μL/well of DW was added, vortexed, and spun down.

(PCR)
TB green, 5 μM F/R primer mix, and DW were mixed so as to give a sample of 5:0.8:0.2/1, vortexed, and then spun down to prepare. After collectively preparing, 6 μL/well was added to a 96-well plate for PCR. The DW-added cDNA solution was added at 4 µL/well to a 96-well plate for PCR, sealed with a compression film, vortexed, and spun down.

The real-time PCR device was started up and measured, all sample types were unknown, and the cycle was 60°C for 40 cycles. β-actin Ct-Tyrosinase Ct = ΔCt was calculated and 2^(ΔCt) = ΔΔCt value was calculated. The gene expression rate was calculated from each ΔΔCt value, taking the average of the ΔΔCt values of the positive control as the tyrosinase gene expression rate of 100%.

The results are shown in Figure 2. As a result, it was found that tyrosinase gene expression was suppressed when trehalose was added in the presence of MSH, which stimulates tyrosinase production (trehalose 1%, 0.76%, 0.38%). From this, it was found that trehalose suppresses the expression of the tyrosinase gene. In addition, it was found that increasing the concentration of trehalose tended to increase the inhibitory effect on tyrosinase gene expression. It was also expected that

(Example 3: Effect of trehalose-containing substances on melanin production using B16 mouse melanoma cells)
Reagents used The following reagents were used.
・ Subculture medium: 10% FBS, 1% P / S, D-MEM (low glucose, Fujifilm 041-29775)
・Sample addition medium (D-MEM/2% FBS): 2% FBS, 1% P/S, D-MEM (low glucose, Fujifilm 041-29775)
・ PBS (-): Either bottle (Fuji Film) or powder (Dulbecco) can be used ・ α-MSH: (Wako, 338-40571) Dissolve in DW filtered to 0.1 mM, 50 μL each in an Eppendorf tube and store at -25°C. Thawed at the time of use and dissolved in D-MEM/2% FBS medium to 100 nM MSH.
- Trehalose-containing material: As a trehalose-containing material, a product containing 38% trehalose was used. A necessary amount of trehalose-containing material was weighed out and added with 100 nM MSH, D-MEM/2 so as to become 10 or 5 mg/mL (3.8 mg/mL trehalose or 1.95 mg/mL trehalose, respectively, in terms of the amount of trehalose). % FBS was added for dissolution and filter sterilization was performed before use.
・ Glutathione (GSH, reduced form, Wako, 073-02013): Weigh the required amount, add 100 nM MSH, D-MEM/2% FBS to dissolve each to 1 or 2 mM, and filter sterilize. went and used
・ Trypsin solution: Wako, 201-16945
・2N NaOH aqueous solution

Cell Culture/Sample Addition The cells were seeded in a 6-well plate at 1.0×10 ⁵ cells/mL and 2 mL/well, and the next day, the medium was changed to D-MEM/2% FBS. One day later, a sample dissolved in 100 nM of D-MEM/2% FBS+α-MSH (50 mL of D-MEM/2% FBS+50 μL of 0.1 mM α-MSH) was added at 2 mL/well. D-MEM/2% FBS containing 100 nM α-MSH was used as a positive control, and D-MEM/2% FBS was used as a negative control. This was cultured for 24 hours.

Cell Harvest The supernatant was collected in a 15 mL centrifuge tube. 1 mL/well of PBS was added and collected in the same tube. After adding 1 mL/well of trypsin solution and incubating for 2 minutes in a CO ₂ incubator for cell culture, the cell suspension was collected in the same tube. 1 mL/well of PBS was added and collected in the same tube. Centrifugation was then performed at 20° C. and 1500 rpm for 5 minutes. The supernatant was removed with an aspirator, 0.5 mL of PBS was added per centrifugation tube to disperse the cells, and the cells were transferred to an Eppendorf tube. After adding 0.5 mL of PBS per centrifugation tube to the centrifugation tube and co-washing, it was added to the same Eppendorf tube. Eppendorf tubes were run at 20° C. and 2000 rpm for 15 minutes. The supernatant was removed, 0.4 mL of 2N NaOH was added per Eppendorf tube, incubated at 80° C. for 15-20 minutes, and vortexed to completely lyse the cells.

Measurement After allowing the Eppendorf tube to stand still and allowing it to cool to room temperature, 100 μL of the cell lysate was added to each Eppendorf tube in a 96-well plate, and the absorbance at 405 nm was measured using a plate reader. The blank was 2N NaOH. The absorbance of the blank was subtracted from the absorbance of the sample, the average value of the positive control was set as 100% of the amount of melanin production, and the amount of melanin production was calculated from the absorbance value after subtracting the blank of each sample.

The results are shown in Table 1 and FIG. A significant inhibitory effect on melanin production was observed when the trehalose-containing substance and glutathione were added in combination, as compared with the case where the trehalose-containing substance alone or glutathione alone was added. especially when added in combination with 10 mg/ml trehalose containing (trehalose 3.8 mg/mL) and 1 mM glutathione, and in combination with 10 mg/ml trehalose containing (3.8 mg/mL trehalose) and 2 mM glutathione. When it was added, it was possible to confirm a higher inhibitory effect than the theoretical value according to Colby's formula. This indicates that when a trehalose-containing substance and glutathione are added in combination at a specific concentration, a synergistic effect is obtained that is greater than that obtained by simply combining the melanogenesis-suppressing effects of the trehalose-containing substance or glutathione alone. .

(Note)
While the present disclosure has been illustrated using the preferred embodiments thereof, it is understood that the present disclosure is to be construed in scope only by the claims. The patents, patent applications and other publications cited herein are hereby incorporated by reference in their entirety to the same extent as if the content itself were specifically set forth herein. It is understood. This application claims priority to Japanese Patent Application No. 2021-69140 filed on April 15, 2021 with the Japan Patent Office, and the content thereof constitutes the content of this application in its entirety. Also incorporated by reference.

The composition of the present invention can suppress the synthesis of melanin and increase the brightness of the skin. In addition, it is useful in the fields of cosmetics and supplements because it can provide beauty effects such as whitening whether applied to the skin or taken orally.

SEQ ID NOs: 1-4: forward or reverse primers used in Example 1

Claims

A skin whitening composition containing trehalose as an active ingredient.
The composition of claim 1, comprising trehalose at a concentration of at least about 0.001 w/v%.
The composition according to claim 1 or 2, wherein the composition is taken orally or applied to the skin.
The composition according to any one of claims 1 to 3, wherein the trehalose is taken orally or applied to the skin in an amount of about 1 mg to about 10 g/day.
The composition according to any one of claims 1 to 4, wherein the composition is taken orally or applied to the skin in combination with glutathione.
6. The composition of claim 5, wherein at least about 2.5 mg/ml of said trehalose and at least about 0.5 mM of said glutathione are combined and taken orally or applied to the skin.
The composition according to any one of claims 1 to 6, which suppresses melanogenesis.
The composition according to any one of claims 1 to 7, which suppresses tyrosinase expression.
The composition according to any one of claims 1 to 8, which is a food or drink, food additive, cosmetic, quasi-drug, or pharmaceutical.
A method for improving skin brightness, comprising applying a skin-whitening composition containing trehalose as an active ingredient.
The method of claim 10, wherein said composition comprises said trehalose at a concentration of at least about 0.001 w/v%.
The method according to claim 10 or 11, wherein said application includes oral ingestion and application to the skin surface of said composition.
The method according to any one of claims 10 to 12, wherein the skin comprises a portion of the skin on which melanin is deposited.
The method according to any one of claims 10 to 13, wherein said applying step is performed to apply said active ingredient in an amount of about 1 mg to about 10 g/day.
The method according to any one of claims 10 to 14, wherein the step of applying comprises combining the composition and glutathione by oral ingestion or applying to the skin surface.
16. The method of claim 15, wherein at least about 2.5 mg/ml of said trehalose and at least about 0.5 mM of said glutathione are combined and taken orally or applied to the skin surface.
A non-therapeutic whitening method comprising the step of applying the skin whitening composition according to any one of claims 1 to 9 to the skin or orally ingesting it.
A melanin production inhibitor containing trehalose as an active ingredient.
The inhibitor of claim 18, comprising trehalose at a concentration of at least about 0.001 w/v%.
The inhibitor according to claim 18 or 19, wherein the inhibitor is taken orally or applied to the skin.
The inhibitor according to any one of claims 18 to 20, wherein said trehalose is taken orally or applied to the skin in an amount of about 1 mg to about 10 g/day.
The inhibitor according to any one of claims 18 to 21, wherein the composition is taken orally or applied to the skin in combination with glutathione.
23. The inhibitor of claim 22, wherein at least about 2.5 mg/ml of said trehalose and at least about 0.5 mM of said glutathione are ingested orally or applied to the skin in combination.
The inhibitor according to any one of claims 18 to 23, which suppresses tyrosinase expression.
A skin whitening composition containing the melanin production inhibitor according to any one of claims 18 to 24.
The composition according to claim 25, which is food and drink, food additives, cosmetics, quasi-drugs, or pharmaceuticals.