WO2022204429A1 - Microglial gene silencing using double-stranded sirna - Google Patents

Microglial gene silencing using double-stranded sirna Download PDF

Info

Publication number
WO2022204429A1
WO2022204429A1 PCT/US2022/021789 US2022021789W WO2022204429A1 WO 2022204429 A1 WO2022204429 A1 WO 2022204429A1 US 2022021789 W US2022021789 W US 2022021789W WO 2022204429 A1 WO2022204429 A1 WO 2022204429A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotides
length
gene
sense strand
antisense strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/021789
Other languages
English (en)
French (fr)
Inventor
Daniel Curtis
Aimee Jackson
Benjamin ANDREONE
Bruno GODINHO
Qingmin Chen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Atalanta Therapeutics Inc
Original Assignee
Atalanta Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Atalanta Therapeutics Inc filed Critical Atalanta Therapeutics Inc
Priority to AU2022246147A priority Critical patent/AU2022246147A1/en
Priority to CN202280036538.0A priority patent/CN117835986A/zh
Priority to CA3214657A priority patent/CA3214657A1/en
Priority to EP22776672.2A priority patent/EP4313070A4/en
Priority to US18/283,671 priority patent/US20240200063A1/en
Priority to JP2023558983A priority patent/JP2024512612A/ja
Publication of WO2022204429A1 publication Critical patent/WO2022204429A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/51Physical structure in polymeric form, e.g. multimers, concatemers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/52Physical structure branched
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • dsRNA double-stranded RNA
  • siRNAs Short interfering RNAs
  • Microglia are a type of glial cell found in the central nervous system (CNS). Microglia are an essential component of the CNS immune system; however, microglia with dysregulated genes can also be a source of disease. For example, a disease state may precipitate as a result of overactive microglial genes or genes with reduced expression and/or activity in microglia. Therefore, silencing of effector genes or pathway regulatory genes may be needed to restore normal gene network function and ameliorate the disease state. Thus, there remains a need for new and improved therapeutics capable of permeating microglial cells and silencing microglial genes in order to restore genetic and biochemical pathway activity in microglia from a disease state towards a normal healthy state.
  • the invention features a method of delivering a branched small interfering RNA (siRNA) molecule to a microglial cell in a subject in need of microglial gene silencing.
  • the method may include administering the branched siRNA molecule to the subject (e.g., to the central nervous system of the subject).
  • the subject has been diagnosed as having a disease associated with expression of a dysregulated microglial gene or dysregulated microglial gene pathway. In some embodiments, the subject has been diagnosed as having a disease associated with expression and/or activity of a dysregulated microglial gene (e.g., altered expression and/or activity of a wild-type or mutated microglial gene).
  • a dysregulated microglial gene e.g., altered expression and/or activity of a wild-type or mutated microglial gene.
  • the dysregulated microglial gene exhibits increased expression and/or activity in microglial cells of the subject as compared to the expression and/or activity of the microglial gene in microglial cells of a reference subject. In some embodiments, the dysregulated microglial gene exhibits reduced expression and/or activity in microglial cells of the subject as compared to the expression and/or activity of the microglial gene in microglial cells of a reference subject.
  • the microglial gene is a positive regulator of a gene for which increased expression and/or activity relative to the level of expression and/or activity observed in a reference subject is associated with a disease state.
  • the microglial gene is a negative regulator of a gene for which decreased expression and/or activity relative to the level of expression and/or activity observed in a reference subject is associated with a disease state.
  • the microglial gene is a splice isoform of a gene for which overexpression of the splice isoform relative to the expression of the splice isoform in a reference subject is associated with a disease state.
  • the disease is a neuroinflammatory disease or a neurodegenerative disease.
  • the disease is Alzheimer’s disease.
  • the disease is Amyotrophic Lateral Sclerosis.
  • the disease is Parkinson’s disease.
  • the disease is frontotemporal dementia.
  • the disease is Huntington’s disease.
  • the disease is multiple sclerosis. In some embodiments, the disease is progressive supranuclear palsy.
  • the dysregulated microglial gene is selected from the group consisting of ABCA7, ABI3, ADAM10, APOC1 , APOE, AXL, BIN1 , C1QA, C3, C90RF72, CASS4, CCL5, CD2AP, CD33, CD68, CLPTM1 , CLU, CR1 , CSF1 , CST7, CTSB, CTSD, CTSL, CXCL10, CXCL13, DSG2, ECHDC3, EPHA1 , FABP5, FERMT2, FTH1 , GNAS, GRN, HBEGF, HLA-DRB1 , HLA-DRB5, IFIT1 , IFIT3, IFITM3, IFNAR1 , IFNAR2, IGF1 , IL10RA, IL1A, IL1 B, IL1RAP, INPP5D, ITGAM, ITGAX, LILRB4, LPL, MEF2C, MMP12, MS4A4A, MS4A6
  • the subject is a mammal (e.g., a human).
  • the branched siRNA is administered to the subject intrathecally, intracerebroventricularly, or intrastriatally.
  • the siRNA molecule is di-branched. In some embodiments, the siRNA molecule is tri-branched. In some embodiments, the siRNA molecule is tetra-branched.
  • the siRNA comprises (i) an antisense strand having complementarity to a portion of one or more of genes selected from the group consisting of APOE, BIN1 , C1 QA, C3,
  • the siRNA includes (i) an antisense strand having complementarity to a portion of a gene encoding a positive regulator of a gene for which increased expression and/or activity (relative, e.g., to the level of expression and/or activity observed in a reference subject) is associated with a disease state.
  • the siRNA includes (i) an antisense strand having complementarity to a portion of a gene encoding a negative regulator of a gene for which decreased expression and/or activity (relative, e.g., to the level of expression and/or activity observed in a reference subject) is associated with a disease state.
  • the siRNA includes (i) an antisense strand having complementarity to a splice isoform of a gene for which overexpression of the splice isoform relative to the expression of the splice isoform in a reference subject is associated with a disease state.
  • the siRNA may also include (ii) a sense strand having complementarity to the antisense strand.
  • the antisense strand has complementarity (e.g., at least 85% complementarity, such as 85% complementarity, 86% complementarity, 87% complementarity, 88% complementarity, 89% complementarity, 90% complementarity, 91% complementarity, 92% complementarity, 93% complementarity, 94% complementarity, 95% complementarity, 96% complementarity, 97% complementarity, 98% complementarity, 99% complementarity, or 100% complementarity) to a portion of at least 10 contiguous nucleotides of an mRNA molecule encoding one or more of the above genes.
  • complementarity e.g., at least 85% complementarity, such as 85% complementarity, 86% complementarity, 87% complementarity, 88% complementarity, 89% complementarity, 90% complementarity, 91% complementarity, 92% complementarity, 93% complementarity, 94% complementarity, 95% complementarity, 96% complementarity, 97% complementarity, 9
  • the antisense strand may have complementarity to a portion of 10 contiguous nucleotides, 11 contiguous nucleotides, 12 contiguous nucleotides, 13 contiguous nucleotides, 14 contiguous nucleotides, 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, 20 contiguous nucleotides, 21 contiguous nucleotides, 22 contiguous nucleotides, 23 contiguous nucleotides, 24 contiguous nucleotides, 25 contiguous nucleotides, 26 contiguous nucleotides, 27 contiguous nucleotides, 28 contiguous nucleotides, 29 contiguous nucleotides, 30 contiguous nucleotides, 31 contiguous nucleotides, 32 contiguous nucleotides 33 contiguous nucleotides
  • the antisense strand has complementarity (e.g., at least 85% complementarity, such as 85% complementarity, 86% complementarity, 87% complementarity, 88% complementarity, 89% complementarity, 90% complementarity, 91% complementarity, 92% complementarity, 93% complementarity, 94% complementarity, 95% complementarity, 96% complementarity, 97% complementarity, 98% complementarity, 99% complementarity, or 100% complementarity) to a portion of from 10 to 50 contiguous nucleotides of an mRNA molecule encoding one or more of the above genes.
  • complementarity e.g., at least 85% complementarity, such as 85% complementarity, 86% complementarity, 87% complementarity, 88% complementarity, 89% complementarity, 90% complementarity, 91% complementarity, 92% complementarity, 93% complementarity, 94% complementarity, 95% complementarity, 96% complementarity, 97% complementarity,
  • the antisense strand may have complementarity to a portion of from 11 contiguous nucleotides to 45 contiguous nucleotides, from 12 contiguous nucleotides to 40 contiguous nucleotides, from 13 contiguous nucleotides to 35 contiguous nucleotides, from 14 contiguous nucleotides to 30 contiguous nucleotides, from 15 contiguous nucleotides to 29 contiguous nucleotides, from 16 contiguous nucleotides to 28 contiguous nucleotides, from 17 contiguous nucleotides to 27 contiguous nucleotides, from 18 contiguous nucleotides to 26 contiguous nucleotides, or from 19 contiguous nucleotides to 22 contiguous nucleotides of an mRNA molecule encoding one or more of the above genes.
  • the antisense strand comprises a region represented by the following chemical formula, in the 5'-to-3' direction:
  • each A is, independently, a 2’-0-methyl (2'-0-Me) ribonucleoside
  • each B is, independently, a 2'-fluoro-ribonucleoside
  • each P is, independently, an internucleoside linkage selected from a phosphodiester linkage and a phosphorothioate linkage
  • n is an integer from 1 to 5 (e.g., 1 , 2, 3, 4, or 5)
  • m is an integer from 1 to 5 (e.g., 1 , 2, 3, 4, or 5)
  • q is an integer between 1 and 15 (1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15).
  • the antisense strand has a structure represented by Formula A-l, wherein Formula A-l is, in the 5’-to-3’ direction:
  • Formula A-l wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ;
  • the antisense strand has a structure represented by Formula A1 , wherein Formula A1 is, in the 5’-to-3’ direction:
  • A represents a 2’-0-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the antisense strand has a structure represented by Formula A-ll, wherein Formula A-ll is, in the 5’-to-3’ direction:
  • Formula A-ll wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ;
  • antisense strand has a structure represented by Formula A2, wherein Formula A2 is, in the 5’-to-3’ direction:
  • A represents a 2’-0-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the sense strand has a structure represented by Formula S-lll, wherein Formula S-lll is, in the 5’-to-3’ direction:
  • F is represented by the formula (C-P 2 ) 3 -D-P 1 -C-P 1 -C, (C-P 2 ) 3 -D-P 2 -C-P 2 -C, (C-P 2 ) 3 -D-P 1 -C-P 1 -D, or (C- P 2 ) 3 -D-P 2 -C-P 2 -D;
  • A’, C, D, P 1 , and P 2 are as defined in Formula II; and m is an integer from 1 to 7 (e.g., 1 , 2, 3, 4, 5, 6, or 7).
  • the sense strand has a structure represented by Formula S1 , wherein Formula S1 is, in the 5’-to-3’ direction:
  • Formula S1 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S2, wherein Formula S2 is, in the 5’-to-3’ direction:
  • the sense strand has a structure represented by Formula S3, wherein Formula S3 is, in the 5’-to-3’ direction:
  • Formula S3 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S4, wherein Formula S4 is, in the 5’-to-3’ direction:
  • Formula S4 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the antisense strand has a structure represented by Formula A-IV, wherein Formula A-IV is, in the 5’-to-3’ direction:
  • the antisense strand has a structure represented by Formula A3, wherein Formula A3 is, in the 5’-to-3’ direction:
  • the sense strand has a structure represented by Formula S-V, wherein Formula S-V is, in the 5’-to-3’ direction:
  • F is represented by the formula D-P 1 -C-P 1 -C, D-P 2 -C-P 2 -C, D-P 1 -C-P 1 -D, or D-P 2 -C-P 2 -D;
  • A’, C, D, P 1 and P 2 are as defined in Formula IV; and m is an integer from 1 to 7 (e.g., 1 , 2, 3, 4, 5, 6, or 7).
  • the sense strand has a structure represented by Formula S5, wherein Formula S5 is, in the 5’-to-3’ direction:
  • Formula S5 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S6, wherein Formula S6 is, in the 5’-to-3’ direction:
  • Formula S6 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S7, wherein Formula S7 is, in the 5’-to-3’ direction:
  • Formula S7 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S8, wherein Formula S8 is, in the 5’-to-3’ direction:
  • the antisense strand has a structure represented by Formula A- VI, wherein Formula A- VI is, in the 5’-to-3’ direction:
  • I is an integer from 1 to 7 (e.g., 1 , 2, 3, 4, 5, 6, or 7).
  • the antisense strand has a structure represented by Formula A4, wherein Formula A4 is, in the 5’-to-3’ direction:
  • Formula A4 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S-VII, wherein Formula S-VII is, in the 5’-to-3’ direction:
  • the sense strand has a structure represented by Formula S9, wherein Formula S9 is, in the 5’-to-3’ direction:
  • Formula S9 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the antisense strand also has a 5’ phosphorus stabilizing moiety at the 5’ end of the antisense strand.
  • the sense strand also has a 5’ phosphorus stabilizing moiety at the 5’ end of the sense strand.
  • each 5’-phosphorus stabilizing moiety is, independently represented by any one of Formula l-VIII: wherein Nuc represents a nucleobase, such as adenine, uracil, guanine, thymine, or cytosine, and R represents optionally substituted alkyl, optionally substituted alkenyl, or optionally substituted alkynyl (e.g., optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, or optionally substituted C2-C6 alkynyl), phenyl, benzyl, hydroxy, or hydrogen.
  • Nuc represents a nucleobase, such as adenine, uracil, guanine, thymine, or cytosine
  • R represents optionally substituted alkyl, optionally substituted alkenyl, or optionally substituted alkynyl (e.g., optionally substituted C1-C6 alkyl, optionally substituted C2-C
  • Z is (E)-vinylphosphonate as represented in Formula III.
  • n is from 1 to 4. In some embodiments, n is from 1 to 3. In some embodiments, n is from 1 to 2. In some embodiments, n is 1.
  • m is from 1 to 4. In some embodiments, m is from 1 to 3. In some embodiments, m is from 1 to 2. In some embodiments, m is 1.
  • n and m are each 1.
  • 50% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 60% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 70% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 80% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 90% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 10% or less of the internucleoside linkages are phosphodiester linkages or phosphorothioate linkages. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the internucleoside linkages are phosphodiester linkages or phosphorothioate linkages.
  • 100% of the internucleoside linkages are phosphodiester linkages or phosphorothioate linkages.
  • 9 internucleoside linkages are phosphodiester linkages or phosphorothioate linkages.
  • the length of the antisense strand is between 10 and 30 nucleotides (e.g., 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), 15 and 25 nucleotides (e.g., 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides,
  • the length of the antisense strand is 20 nucleotides. In some embodiments, the length of the antisense strand is 21 nucleotides. In some embodiments, the length of the antisense strand is 22 nucleotides. In some embodiments, the length of the antisense strand is 23 nucleotides. In some embodiments, the length of the antisense strand is 24 nucleotides. In some embodiments, the length of the antisense strand is 25 nucleotides. In some embodiments, the length of the antisense strand is 26 nucleotides. In some embodiments, the length of the antisense strand is 27 nucleotides.
  • the length of the antisense strand is 28 nucleotides. In some embodiments, the length of the antisense strand is 29 nucleotides. In some embodiments, the length of the antisense strand is 30 nucleotides.
  • the siRNA molecules of the branched compound are joined to one another by way of a linker (e.g., an ethylene glycol oligomer, such as tetraethylene glycol). In some embodiments, the siRNA molecules of the branched compound are joined to one another by way of a linker between the sense strand of one siRNA molecule and the sense strand of the other siRNA molecule.
  • a linker e.g., an ethylene glycol oligomer, such as tetraethylene glycol
  • the siRNA molecules are joined by way of linkers between the antisense strand of one siRNA molecule and the antisense strand of the other siRNA molecule. In some embodiments, the siRNA molecules of the branched compound are joined to one another by way of a linker between the sense strand of one siRNA molecule and the antisense strand of the other siRNA molecule.
  • the length ofthe sense strand is between 12 and 30 nucleotides (e.g., 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), or 14 and 18 nucleotides (e.g., 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, or 18 nucleotides). In some embodiments, the length of the sense strand is 15 nucleotides.
  • the length of the sense strand is 16 nucleotides. In some embodiments, the length of the sense strand is 17 nucleotides. In some embodiments, the length of the sense strand is 18 nucleotides. In some embodiments, the length of the sense strand is 19 nucleotides. In some embodiments, the length of the sense strand is 20 nucleotides. In some embodiments, the length of the sense strand is 21 nucleotides. In some embodiments, the length of the sense strand is 22 nucleotides. In some embodiments, the length of the sense strand is 23 nucleotides. In some embodiments, the length of the sense strand is 24 nucleotides.
  • the length of the sense strand is 25 nucleotides. In some embodiments, the length of the sense strand is 26 nucleotides. In some embodiments, the length of the sense strand is 27 nucleotides. In some embodiments, the length of the sense strand is 28 nucleotides. In some embodiments, the length of the sense strand is 29 nucleotides. In some embodiments, the length of the sense strand is 30 nucleotides.
  • 4 internucleoside linkages are phosphorothioate linkages.
  • the antisense strand is 18 nucleotides in length and the sense strand is
  • the antisense strand is 18 nucleotides in length and the sense strand is
  • the antisense strand is 18 nucleotides in length and the sense strand is
  • the antisense strand is 18 nucleotides in length and the sense strand is
  • the antisense strand is 18 nucleotides in length and the sense strand is
  • the antisense strand is 19 nucleotides in length and the sense strand is
  • the antisense strand is 19 nucleotides in length and the sense strand is
  • the antisense strand is 19 nucleotides in length and the sense strand is
  • the antisense strand is 19 nucleotides in length and the sense strand is
  • the antisense strand is 19 nucleotides in length and the sense strand is
  • the antisense strand is 19 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 20 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 21 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 22 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 23 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 24 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 25 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 26 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 27 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 28 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 29 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the antisense strand is 30 nucleotides in length and the sense strand is
  • the invention features a branched siRNA molecule including a sense strand and an antisense strand, wherein the antisense strand includes a region having complementarity to a segment of contiguous nucleotides within a gene selected from the group consisting of APOE, BIN1 , C1QA, C3, C90RF72, CCL5, CD33, CLU/APOJ, CR1 , CXCL10, CXCL13, IFIT1 , IFIT3, IFITM3, IFNAR1 , IFNAR2, IL10RA, IL1A, IL1B, IL1RAP, INPP5D, ITGAM, MEF2C, MMP12, NLRP3, NOS2, PILRA,
  • PLCG2, PTK2B, SLC24A4, TBK1 , and TNF are examples of TNF.
  • the antisense strand has complementarity to a portion of a gene encoding a positive regulator of a gene for which increased expression and/or activity relative to the level of expression and/or activity observed in a reference subject is associated with a disease state.
  • the antisense strand has complementarity to a portion of a gene encoding a negative regulator of a gene for which decreased expression and/or activity relative to the level of expression and/or activity observed in a reference subject is associated with a disease state.
  • the antisense strand has complementarity to a splice isoform of a gene for which overexpression of the splice isoform relative to the expression of the splice isoform in a reference subject is associated with a disease state.
  • the sense strand has complementarity to the antisense strand.
  • the siRNA molecule is di-branched. In some embodiments, the siRNA molecule is tri-branched. In some embodiments, the siRNA molecule is tetra-branched.
  • the antisense strand of the branched siRNA has the following Formula in the 5'-to-3' direction:
  • m is an integer from 1 to 5 (e.g., 1 , 2, 3, 4, or 5); and q is an integer between 1 and 15 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15).
  • the antisense strand has a structure represented by Formula A-l, wherein Formula A-l is, in the 5’-to-3’ direction:
  • Formula A-l wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ;
  • the antisense strand has a structure represented by Formula A1 , wherein Formula A1 is, in the 5’-to-3’ direction:
  • A represents a 2’-0-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the antisense strand has a structure represented by Formula A-ll, wherein Formula A-ll is, in the 5’-to-3’ direction:
  • Formula A-ll wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ;
  • antisense strand has a structure represented by Formula A2, wherein Formula A2 is, in the 5’-to-3’ direction:
  • A represents a 2’-0-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the sense strand has a structure represented by Formula S-lll, wherein Formula S-lll is, in the 5’-to-3’ direction:
  • F is represented by the formula (C-P 2 ) 3 -D-P 1 -C-P 1 -C, (C-P 2 ) 3 -D-P 2 -C-P 2 -C, (C-P 2 ) 3 -D-P 1 -C-P 1 -D, or (C- P 2 ) 3 -D-P 2 -C-P 2 -D;
  • A’, C, D, P 1 , and P 2 are as defined in Formula II; and m is an integer from 1 to 7 (e.g., 1 , 2, 3, 4, 5, 6, or 7).
  • the sense strand has a structure represented by Formula S1 , wherein Formula S1 is, in the 5’-to-3’ direction:
  • Formula S1 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S2, wherein Formula S2 is, in the 5’-to-3’ direction:
  • the sense strand has a structure represented by Formula S3, wherein Formula S3 is, in the 5’-to-3’ direction:
  • Formula S3 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S4, wherein Formula S4 is, in the 5’-to-3’ direction:
  • Formula S4 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the antisense strand has a structure represented by Formula A-IV, wherein Formula A-IV is, in the 5’-to-3’ direction:
  • the antisense strand has a structure represented by Formula A3, wherein Formula A3 is, in the 5’-to-3’ direction:
  • the sense strand has a structure represented by Formula S-V, wherein Formula S-V is, in the 5’-to-3’ direction:
  • F is represented by the formula D-P 1 -C-P 1 -C, D-P 2 -C-P 2 -C, D-P 1 -C-P 1 -D, or D-P 2 -C-P 2 -D;
  • A’, C, D, P 1 and P 2 are as defined in Formula IV; and m is an integer from 1 to 7 (e.g., 1 , 2, 3, 4, 5, 6, or 7).
  • the sense strand has a structure represented by Formula S5, wherein Formula S5 is, in the 5’-to-3’ direction:
  • Formula S5 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S6, wherein Formula S6 is, in the 5’-to-3’ direction:
  • Formula S6 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S7, wherein Formula S7 is, in the 5’-to-3’ direction:
  • Formula S7 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S8, wherein Formula S8 is, in the 5’-to-3’ direction:
  • the antisense strand has a structure represented by Formula A- VI, wherein Formula A- VI is, in the 5’-to-3’ direction:
  • I is an integer from 1 to 7 (e.g., 1 , 2, 3, 4, 5, 6, or 7).
  • the antisense strand has a structure represented by Formula A4, wherein Formula A4 is, in the 5’-to-3’ direction:
  • Formula A4 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand has a structure represented by Formula S-VII, wherein Formula S-VII is, in the 5’-to-3’ direction:
  • the sense strand has a structure represented by Formula S9, wherein Formula S9 is, in the 5’-to-3’ direction:
  • Formula S9 wherein A represents a 2’-0-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the antisense strand also has a 5’ phosphorus stabilizing moiety at the 5’ end of the antisense strand.
  • the sense strand also has a 5’ phosphorus stabilizing moiety at the 5’ end of the sense strand.
  • each 5’-phosphorus stabilizing moiety is, independently, represented by any one of Formula l-VIII: wherein Nuc represents a nucleobase, such as adenine, uracil, guanine, thymine, or cytosine, and R represents optionally substituted alkyl, optionally substituted alkenyl, or optionally substituted alkynyl (e.g., optionally substituted C1 -C6 alkyl, optionally substituted C2-C6 alkenyl, or optionally substituted C2- C6 alkynyl), phenyl, benzyl, hydroxy, or hydrogen.
  • Nuc represents a nucleobase, such as adenine, uracil, guanine, thymine, or cytosine
  • R represents optionally substituted alkyl, optionally substituted alkenyl, or optionally substituted alkynyl (e.g., optionally substituted C1 -C6 alkyl, optionally substituted
  • Z is (E)-vinylphosphonate as represented in Formula III.
  • each P is independently selected from phosphodiester and phosphorothioate.
  • n is from 1 to 4 (e.g., 1 , 2, 3, or 4), 1 to 3 (e.g., 1 , 2, or 3), or 1 to 2. In some embodiments, n is 1.
  • m is from 1 to 4 (e.g., 1 , 2, 3, or 4), 1 to 3 (e.g., 1 , 2, or 3), or 1 to 2. In some embodiments, m is 1.
  • n and m are each 1.
  • 50% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%,
  • ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 60% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
  • ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 70% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 80% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 90% or more of the ribonucleotides in the antisense strand are 2'-0-Me ribonucleotides (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the ribonucleotides in the antisense strand may be 2'-0-Me ribonucleotides).
  • 10% or less of the internucleoside linkages are phosphodiester linkages or phosphorothioate. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the internucleoside linkages are phosphodiester linkages or phosphorothioate. In some embodiments, 100% of the internucleoside linkages are phosphodiester linkages or phosphorothioate.
  • the length of the antisense strand is between 10 and 30 nucleotides (e.g., 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), 15 and 25 nucleotides (e.g., 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides,
  • the length of the antisense strand is 21 nucleotides. In some embodiments, the length of the antisense strand is 22 nucleotides. In some embodiments, the length of the antisense strand is 23 nucleotides. In some embodiments, the length of the antisense strand is 24 nucleotides. In some embodiments, the length of the antisense strand is 25 nucleotides. In some embodiments, the length of the antisense strand is 26 nucleotides. In some embodiments, the length of the antisense strand is 27 nucleotides. In some embodiments, the length of the antisense strand is 28 nucleotides. In some embodiments, the length of the antisense strand is 29 nucleotides. In some embodiments, the length of the antisense strand is 30 nucleotides.
  • 9 internucleoside linkages are phosphorothioate.
  • the sense strand of the branched siRNA has the following formula in the
  • Y is a hydrophobic moiety (e.g., cholesterol, vitamin D, or tocopherol);
  • n is an integer from 1 to 5 (1 , 2, 3, 4, or 5);
  • m is an integer from 1 to 5 (1 , 2, 3, 4, or 5); and
  • q is an integer between 1 and 15 (1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15).
  • Y is cholesterol
  • Y tocopherol In some embodiments, Y tocopherol.
  • L is an ethylene glycol oligomer.
  • L is tetraethylene glycol
  • each P is independently selected from phosphodiester and phosphorothioate.
  • n is from 1 to 4 (e.g., 1 , 2, 3, or 4), 1 to 3 (e.g., 1 , 2, or 3), or 1 to 2. In some embodiments, n is 1.
  • m is from 1 to 4 (e.g., 1 , 2, 3, or 4), 1 to 3 (e.g., 1 , 2, or 3), or 1 to 2. In some embodiments, m is 1.
  • n and m are each 1.
  • 10% or less of the ribonucleosides are 2'-0-Me ribonucleoside.
  • At least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the ribonucleosides are 2'-0-Me ribonucleoside.
  • 10% or less of the internucleoside linkages are phosphodiester linkages or phosphorothioate linkages. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the internucleoside linkages are phosphodiester linkages or phosphorothioate linkages. In some embodiments, 100% of the internucleoside linkages are phosphodiester linkages or phosphorothioate linkages.
  • the length ofthe sense strand is between 12 and 30 nucleotides (e.g., 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 , nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), or 14 and 18 nucleotides (e.g., 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides).
  • 14 and 18 nucleotides e.g., 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18
  • the length ofthe sense strand is 16 nucleotides. In some embodiments, the length ofthe sense strand is 17 nucleotides. In some embodiments, the length ofthe sense strand is 18 nucleotides. In some embodiments, the length ofthe sense strand is 19 nucleotides. In some embodiments, the length ofthe sense strand is 20 nucleotides. In some embodiments, the length of the sense strand is 21 nucleotides. In some embodiments, the length ofthe sense strand is 22 nucleotides. In some embodiments, the length ofthe sense strand is 23 nucleotides. In some embodiments, the length ofthe sense strand is 24 nucleotides.
  • the length ofthe sense strand is 25 nucleotides. In some embodiments, the length of the sense strand is 26 nucleotides. In some embodiments, the length of the sense strand is 27 nucleotides. In some embodiments, the length of the sense strand is 28 nucleotides. In some embodiments, the length of the sense strand is 29 nucleotides. In some embodiments, the length of the sense strand is 30 nucleotides.
  • 4 internucleoside linkages are phosphorothioate.
  • the invention features a method of treating a subject diagnosed as having a disease associated with expression of a dysregulated microglial gene (e.g., wild-type or mutated microglial gene), the method includes administering to the subject the branched siRNA molecule of any one of the above aspects or embodiments.
  • a dysregulated microglial gene e.g., wild-type or mutated microglial gene
  • the dysregulated microglial gene is selected from the group consisting of ABCA7, ABI3, ADAM10, APOC1 , APOE, AXL, BIN1 , C1QA, C3, C90RF72, CASS4, CCL5, CD2AP, CD33, CD68, CLPTM1 , CLU, CR1 , CSF1 , CST7, CTSB, CTSD, CTSL, CXCL10, CXCL13, DSG2, ECHDC3, EPHA1 , FABP5, FERMT2, FTH1 , GNAS, GRN, HBEGF, HLA-DRB1 , HLA-DRB5, IFIT1 , IFIT3, IFITM3, IFNAR1 , IFNAR2, IGF1 , IL10RA, IL1A, IL1B, IL1RAP, INPP5D, ITGAM, ITGAX, LILRB4, LPL, MEF2C, MMP12, MS4A4A, MS4A6
  • the dysregulated microglial gene exhibits increased expression and/or activity in microglial cells of the subject as compared to the expression and/or activity of the same gene in microglial cells of a reference subject.
  • the dysregulated microglial gene exhibits reduced expression and/or activity in microglial cells of the subject as compared to the expression and/or activity of the same gene in microglial cells of a reference subject.
  • the administering of the branched siRNA molecule to the subject results in silencing of gene in the subject.
  • the silencing of a gene comprises silencing any one of the genes selected from the group consisting of APOE, BIN1 , C1QA, C3, C90RF72, CCL5, CD33, CLU/APOJ, CR1 , CXCL10, CXCL13, IFIT1 , IFIT3, IFITM3, IFNAR1 , IFNAR2, IL10RA, IL1A, IL1B, IL1RAP, INPP5D,
  • ITGAM ITGAM, MEF2C, MMP12, NLRP3, NOS2, PILRA, PLCG2, PTK2B, SLC24A4, TBK1 , and TNF.
  • silencing of a gene comprises silencing of a positive regulator of a gene for which increased expression and/or activity relative to the level of expression and/or activity observed in a reference subject is associated with a disease state.
  • silencing of a gene comprises silencing of a negative regulator of a gene for which decreased expression and/or activity relative to the level of expression and/or activity observed in a reference subject is associated with a disease state.
  • silencing of a gene comprises silencing of a splice isoform of a gene for which overexpression of the splice isoform relative to the expression of the splice isoform in a reference subject is associated with a disease state.
  • the subject is a human.
  • nucleic acids refers to RNA or DNA molecules consisting of a chain of ribonucleotides or deoxyribonucleotides, respectively.
  • therapeutic nucleic acid refers to a nucleic acid molecule (e.g., ribonucleic acid) that has partial or complete complementarity to, and interacts with, a disease-associated target mRNA and mediates silencing of expression of the mRNA.
  • carrier nucleic acid refers to a nucleic acid molecule (e.g., ribonucleic acid) that has sequence complementarity with, and hybridizes with, a therapeutic nucleic acid.
  • 3' end refers to the end of the nucleic acid that contains an unmodified hydroxyl group at the 3' carbon of the ribose ring.
  • nucleoside refers to a molecule made up of a heterocyclic base and its sugar.
  • nucleotide refers to a nucleoside having a phosphate group on its 3' or 5' sugar hydroxyl group.
  • siRNA refers to small interfering RNA duplexes that induce the RNA interference (RNAi) pathway.
  • siRNA molecules can vary in length (generally, between 18-30 base pairs) and contain varying degrees of complementarity to their target mRNA.
  • siRNA includes duplexes of two separate strands, as well as single strands that optionally form hairpin structures comprising a duplex region.
  • antisense strand refers to the strand of the siRNA duplex that contains some degree of complementarity to the target gene.
  • sense strand refers to the strand of the siRNA duplex that contains complementarity to the antisense strand.
  • nucleotide analog or altered nucleotide or altered nucleotide refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides.
  • exemplary nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide yet retain the ability of the nucleotide analog to perform its intended function.
  • the term “metabolically stabilized” refers to RNA molecules that contain ribonucleotides that have been chemically modified from 2'-hydroxyl groups to 2'-0-methyl groups.
  • phosphorothioate refers to the phosphate group of a nucleotide that is modified by substituting one or more of the oxygens of the phosphate group with sulfur.
  • ethylene glycol chain refers to a carbon chain with the formula ((CH 2 OH) 2 ).
  • alkyl refers to a saturated hydrocarbon group. Alkyl groups may be acyclic or cyclic and contain only C and H when unsubstituted. When an alkyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described; thus, for example, “butyl” is meant to include n-butyl, sec-butyl, and /so-butyl.
  • alkyl examples include ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like. In some embodiments, alkyl may be substituted.
  • Suitable substituents that may be introduced into an alkyl group include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.
  • alkenyl may be substituted.
  • Suitable substituents that may be introduced into an alkenyl group include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.
  • alkynyl refers to an acyclic or cyclic unsaturated hydrocarbon group having at least one site of acetylenic unsaturation (i.e., having at least one moiety of the formula CoC). Alkynyl groups contain only C and H when unsubstituted. When an alkynyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described; thus, for example, “pentynyl” is meant to include n-pentynyl, sec-pentynyl, /so-pentynyl, and fe/f-pentynyl.
  • alkynyl examples include -CoCH and -CoC-CH3. In some embodiments, alkynyl may be substituted. Suitable substituents that may be introduced into an alkynyl group include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.
  • phenyl denotes a monocyclic arene in which one hydrogen atom from a carbon atom of the ring has been removed.
  • a phenyl group can be unsubstituted or substituted with one or more suitable substituents, wherein the substituent replaces an H of the phenyl group.
  • benzyl refers to monovalent radical obtained when a hydrogen atom attached to the methyl group of toluene is removed.
  • a benzyl generally has the formula of phenyl-CH 2 -.
  • a benzyl group can be unsubstituted or substituted with one or more suitable substituents.
  • the substituent may replace an H of the phenyl component and/or an H of the methylene (-CH 2 -) component.
  • amide refers to an alkyl or aromatic group that is attached to an amino-carbonyl functional group.
  • nucleoside and “internucleotide” refer to the bonds between nucleosides and nucleotides, respectively.
  • triazol refers to heterocyclic compounds with the formula (C2H3N3), having a five-membered ring of two carbons and three nitrogens, the positions of which can change resulting in multiple isomers.
  • terminal group refers to the group at which a carbon chain or nucleic acid ends.
  • lipophilic amino acid refers to an amino acid comprising a hydrophobic moiety (e.g., an alkyl chain or an aromatic ring).
  • antiagomiRs refers to nucleic acids that can function as inhibitors of miRNA activity.
  • glycos refers to chimeric antisense nucleic acids that contain a central block of deoxynucleotide monomers sufficiently long to induce RNase H cleavage.
  • the deoxynucleotide block is flanked by ribonucleotide monomers or ribonucleotide monomers containing modifications.
  • mixturemers refers to nucleic acids that are comprised of a mix of locked nucleic acids (LNAs) and DNA.
  • guide RNAs refers to nucleic acids that have sequence complementarity to a specific sequence in the genome immediately or 1 base pair upstream of the protospacer adjacent motif (PAM) sequence as used in CRISPR/Cas9 gene editing systems.
  • PAM protospacer adjacent motif
  • guide RNAs may refer to nucleic acids that have sequence complementarity (e.g., are antisense) to a specific messenger RNA (mRNA) sequence.
  • mRNA messenger RNA
  • a guide RNA may also have sequence complementarity to a “passenger RNA” sequence of equal or shorter length, which is identical or substantially identical to the sequence of mRNA to which the guide RNA hybridizes.
  • target of delivery refers to the organ or part of the body that is desired to deliver the branched oligonucleotide compositions to.
  • branched siRNA refers to a compound containing two or more double- stranded siRNA molecules covalently bound to one another.
  • Branched siRNA molecules may be “di- branched,” also referred to herein as “di-siRNA,” wherein the siRNA molecule comprises 2 siRNA molecules covalently bound to one another, e.g., by way of a linker.
  • Branched siRNA molecules may be “tri-branched,” also referred to herein as “tri-siRNA,” wherein the siRNA molecule comprises 3 siRNA molecules covalently bound to one another, e.g., by way of a linker.
  • Branched siRNA molecules may be “tetra-branched,” also referred to herein as “tetra-siRNA,” wherein the siRNA molecule comprises 4 siRNA molecules covalently bound to one another, e.g., by way of a linker.
  • the term “5' phosphorus stabilizing moiety” refers to a terminal phosphate group that includes phosphates as well as modified phosphates (e.g., phosphorothioates, phosphodiesters, phosphonates).
  • the phosphate moiety can be located at either terminus but is preferred at the 5'- terminal nucleoside.
  • the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R’), or alkyl where R’ is H, an amino protecting group, or unsubstituted or substituted alkyl.
  • the 5' and or 3' terminal group can comprise from 1 to 3 phosphate moieties that are each, independently, unmodified (di- or tri-phosphates) or modified.
  • the term “between X and Y” is inclusive of the values of X and Y.
  • “between X and Y” refers to the range of values between the value of X and the value of Y, as well as the value of X and the value of Y.
  • amino acid refers to a molecule containing amine and carboxyl functional groups and a side chain specific to the amino acid.
  • the amino acid is chosen from the group of proteinogenic amino acids.
  • the amino acid is an L-amino acid or a D-amino acid.
  • the amino acid is a synthetic amino acid (e.g., a beta-amino acid).
  • internucleotide linkages provided herein comprising, e.g., phosphodiester and phosphorothioate, comprise a formal charge of -1 at physiological pH, and that said formal charge will be balanced by a cationic moiety, e.g., an alkali metal such as sodium or potassium, an alkali earth metal such as calcium or magnesium, or an ammonium or guanidinium ion.
  • a cationic moiety e.g., an alkali metal such as sodium or potassium, an alkali earth metal such as calcium or magnesium, or an ammonium or guanidinium ion.
  • the phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21 , Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11 (5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11 (2):77-85, and U.S.
  • Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs.
  • a proper Watson- Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.”
  • Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.
  • percent (%) sequence complementarity with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity.
  • a given nucleotide is considered to be “complementary” to a reference nucleotide as described herein if the two nucleotides form canonical Watson-Crick base pairs.
  • Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs.
  • a proper Watson-Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.”
  • Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared.
  • the percent sequence complementarity of a given nucleic acid sequence, A, to a given nucleic acid sequence, B, is calculated as follows:
  • a query nucleic acid sequence is considered to be “completely complementary” to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.
  • gene silencing refers to the suppression of gene expression, e.g., transgene, heterologous gene and/or endogenous gene expression, which may be mediated through processes that affect transcription and/or through processes that affect post-transcriptional mechanisms.
  • gene silencing occurs when an RNAi molecule initiates the inhibition or degradation of the mRNA transcribed from a gene of interest in a sequence-specific manner via RNA interference, thereby preventing translation of the gene's product.
  • overactive disease driver gene refers to a microglial gene having increased activity and/or expression that contributes to or causes a disease state in a subject (e.g., a human).
  • the disease state may be caused or exacerbated by the overactive disease driver gene directly or by way of an intermediate gene(s).
  • negative regulator refers to a microglial gene that negatively regulates (e.g., reduces or inhibits) the expression and/or activity of another microglial gene or set of genes (e.g., dysregulated microglial gene ordysregulated microglial gene pathway).
  • positive regulator refers to a microglial gene that positively regulates (e.g., increases or saturates) the expression and/or activity of another microglial gene or set of microglial genes (e.g., dysregulated microglial gene ordysregulated microglial gene pathway).
  • phosphate moiety refers to a terminal phosphate group that includes phosphates as well as modified phosphates.
  • the phosphate moiety can be located at either terminus but is preferred at the 5'-terminal nucleoside.
  • the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R’) or alkyl where R’ is H, an amino protecting group or unsubstituted or substituted alkyl.
  • the 5' and or 3' terminal group can comprise from 1 to 3 phosphate moieties that are each, independently, unmodified (di or tri-phosphates) or modified.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions that function similarly.
  • backbone covalent internucleoside
  • modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • the term “reference subject” refers to a healthy control subject of the same or similar, e.g., age, sex, geographical region, and/or education level as a subject treated with a composition of the disclosure.
  • a healthy reference subject is one that does not suffer from a disease associated with expression of a dysregulated microglial gene or a dysregulated microglial gene pathway.
  • a healthy reference subject is one that does not suffer from a disease associated with altered (e.g., increased or decreased) expression and/or activity of a microglial gene.
  • the terms “treat,” “treated,” or “treating” mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results.
  • Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease.
  • Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
  • ABCA7 refers to the gene encoding Phospholipid-transporting ATPase ABCA7.
  • the terms “ABCA7” and “Phospholipid-transporting ATPase ABCA7” include wild-type forms of the ABCA7 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type ABCA7.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • SEQ ID NO: 1 is a wild-type gene sequence encoding ABCA7 protein, and is shown below:
  • ABSI3 refers to the gene encoding ABI gene family member 3.
  • the terms “ABI3” and “ABI gene family member 3” include wild-type forms of the ABI3 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type ABI3.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • SEQ ID NO: 2 is a wild-type gene sequence encoding ABI3 protein, and is shown below:
  • GTGCAGCCCACATT GG ACCCC AG ACACCCCT CTGCAGCC ATT G ACT GCAACTT GTTCTTT
  • ADAM10 refers to the gene encoding ADAM Metallopeptidase Domain 10.
  • the terms “ADAM10” and " ADAM Metallopeptidase Domain 10" include wild-type forms of the ADAM10 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type ADAM10.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type ADAM 10 nucleic acid sequence e.g., SEQ ID NO: 3, NCBI Reference Sequence: NM_001110.3.
  • SEQ ID NO: 3 is a wild-type gene sequence encoding ADAM10 protein, and is shown below:
  • AACTTCT G AGG AAAAAACGT AC AACTTC AGCT G AAAAAAAT ACTTGT C AG CTTT AT ATT C AG ACT G A
  • CTCGACC ACCT CAAC ATT GG AG ACATC ACTT GCC AAT GT ACAT ACCTT GTTATATGCAG ACAT GT ATT
  • AAAATTTTTCCG CT CTT AATT AAAAATT ACT GTTT AATT G AC AT ACT C AG GAT AAC AG AG AAT G GTG G
  • APOC1 and Apolipoprotein C1 include wild-type forms of the APOC1 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type APOC1 .
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type APOC1 nucleic acid sequence e.g.,
  • SEQ ID NO: 4 NCBI Reference Sequence: NM_001645).
  • SEQ ID NO: 4 is a wild-type gene sequence encoding APOC1 protein, and is shown below:
  • APOE refers to the gene encoding Apolipoprotein E.
  • the terms “APOE” and “Apolipoprotein E” include wild-type forms of the APOE gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type APOE.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type APOE nucleic acid sequence e.g., SEQ ID NO: 5, ENA accession number M12529.
  • SEQ ID NO: 5 is a wild-type gene sequence encoding APOE protein, and is shown below:
  • AXL refers to the gene encoding Tyrosine-protein kinase receptor UFO.
  • the terms “AXL” and “Tyrosine-protein kinase receptor UFO” include wild-type forms of the AXL gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type AXL.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • SEQ ID NO: 6 is a wild-type gene sequence encoding AXL protein, and is shown below: GCTGGGCAAAGCCGGTGGCAAGGGCCTCCCCTGCCGCTGTGCCAGGCAGGCAGTGCCAAA
  • BIN refers to the gene encoding Myc box-dependent-interacting protein 1.
  • BIN and Myc box-dependent-interacting protein 1 include wild-type forms of the BIN1 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type BIN1.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type BIN1 nucleic acid sequence e.g., SEQ ID NO: 7, ENA accession number AF004015
  • SEQ ID NO: 7 is a wild-type gene sequence encoding BIN1 protein, and is shown below:
  • C1QA refers to the gene encoding Complement C1q A Chain.
  • C1QA and Complement C1q A Chain include wild-type forms of the C1 QA gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type C1QA.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type C1QA nucleic acid sequence e.g., SEQ ID NO: 8, NCBI Reference Sequence: NM_015991 .3
  • SEQ ID NO: 8 is a wild-type gene sequence encoding C1QA protein, and is shown below:
  • C3 refers to the gene encoding Complement C3.
  • C3 and Complement C3 include wild-type forms of the C3 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type C3.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type C3 nucleic acid sequence e.g., SEQ ID NO: 9, NCBI Reference Sequence: NM_000064.3
  • SEQ ID NO: 9 is a wild-type gene sequence encoding C3 protein, and is shown below:
  • C9orf72 refers to the gene encoding Guanine nucleotide exchange C9orf72.
  • the terms “C9orf72” and “Guanine nucleotide exchange C9orf72” include wild-type forms of the C9orf72 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type C9orf72.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • SEQ ID NO: 10 is a wild-type gene sequence encoding C9orf72 protein, and is shown below:
  • AAAG G AAG AAT ATGG ATG CAT AAG G AAAG AC AAG AAAAT GTCC AG AAG ATT AT CTT AG AA
  • CASS4 refers to the gene encoding Cas scaffolding protein family member 4.
  • the terms “CASS4” and “Cas scaffolding protein family member 4" include wild-type forms of the CASS4 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type CASS4.
  • nucleic acids having at least 70% sequence identity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identity, or more
  • a wild-type CASS4 nucleic acid sequence e.g., SEQ ID NO: 11 , ENA accession number AJ276678.
  • SEQ ID NO: 11 is a wild-type gene sequence encoding CASS4 protein, and is shown below:
  • CCL5 refers to the gene encoding C-C motif chemokine 5.
  • CCL5 and C-C motif chemokine 5" include wild-type forms of the CCL5 gene, as well as variants (e.g., splice variants and polymorphisms) of wild-type CCL5.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Epidemiology (AREA)
  • Psychology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2022/021789 2021-03-24 2022-03-24 Microglial gene silencing using double-stranded sirna Ceased WO2022204429A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2022246147A AU2022246147A1 (en) 2021-03-24 2022-03-24 Microglial gene silencing using double-stranded sirna
CN202280036538.0A CN117835986A (zh) 2021-03-24 2022-03-24 使用双链siRNA进行小胶质基因沉默
CA3214657A CA3214657A1 (en) 2021-03-24 2022-03-24 Microglial gene silencing using double-stranded sirna
EP22776672.2A EP4313070A4 (en) 2021-03-24 2022-03-24 Microglial gene silencing using double-stranded siRNA
US18/283,671 US20240200063A1 (en) 2021-03-24 2022-03-24 Microglial gene silencing using double-stranded sirna
JP2023558983A JP2024512612A (ja) 2021-03-24 2022-03-24 二本鎖siRNAを使用したミクログリア遺伝子サイレンシング

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163165518P 2021-03-24 2021-03-24
US63/165,518 2021-03-24

Publications (1)

Publication Number Publication Date
WO2022204429A1 true WO2022204429A1 (en) 2022-09-29

Family

ID=83397877

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/021789 Ceased WO2022204429A1 (en) 2021-03-24 2022-03-24 Microglial gene silencing using double-stranded sirna

Country Status (7)

Country Link
US (1) US20240200063A1 (cg-RX-API-DMAC7.html)
EP (1) EP4313070A4 (cg-RX-API-DMAC7.html)
JP (1) JP2024512612A (cg-RX-API-DMAC7.html)
CN (1) CN117835986A (cg-RX-API-DMAC7.html)
AU (1) AU2022246147A1 (cg-RX-API-DMAC7.html)
CA (1) CA3214657A1 (cg-RX-API-DMAC7.html)
WO (1) WO2022204429A1 (cg-RX-API-DMAC7.html)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118374495A (zh) * 2024-03-28 2024-07-23 深圳脑健生物技术有限公司 一种抑制NLRP3基因表达的siRNA及其前体和应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10799591B2 (en) * 2016-01-31 2020-10-13 University Of Massachusetts Branched oligonucleotides

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2556272T3 (es) * 2004-11-18 2016-01-14 The Board Of Trustees Of The University Of Illinois Constructos de ARNsi multicistrónico para inhibir tumores
PL3277814T3 (pl) * 2015-04-03 2020-11-30 University Of Massachusetts Związki oligonukleotydowe ukierunkowane na mrna huntingtyny
JP2022528487A (ja) * 2019-03-29 2022-06-13 ユニバーシティ・オブ・マサチューセッツ C9orf72のオリゴヌクレオチドベースの調節
WO2021026490A1 (en) * 2019-08-08 2021-02-11 Mpeg La, L.L.C. Cns targeting with multimeric oligonucleotides
KR20220047989A (ko) * 2019-08-09 2022-04-19 유니버시티 오브 매사추세츠 Snp를 표적화하는 화학적으로 변형된 올리고뉴클레오타이드

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10799591B2 (en) * 2016-01-31 2020-10-13 University Of Massachusetts Branched oligonucleotides

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ALTERMAN ET AL.: "A divalent siRNA chemical scaffold for potent and sustained modulation of gene expressio n throughout the central nervous system", NAT. BIOTECHNOL., vol. 37, no. 8, August 2019 (2019-08-01), pages 884 - 894, XP036850007, DOI: 10.1038/s41587-019-0205-0 *
BONHAM LUKE W., SIRKIS DANIEL W., YOKOYAMA JENNIFER S.: "The transcriptional landscape of microglial genes in aging and neurodegenerative disease", FRONT. IMMUNOL., vol. 10, no. 1170, 4 June 2019 (2019-06-04), pages 1 - 17, XP085870060 *
FERNANDEZ CELIA G., HAMBY MARY E., MCREYNOLDS MORGAN L., RAY WILLIAM J.: "The role of APOE4 in disrupting homeostatic functions of astrocytes and microglia in aging and Alzheimer's disease", FRONT. AGING NEUROSCI., vol. 11, no. 14, 11 February 2019 (2019-02-11), pages 1 - 18, XP055974858 *
GAO ET AL.: "Transcriptional regulation of homeostatic and disease-associated-microglial genes by IRF1, LXRp, and CEBPa", GLIA, vol. 67, no. 10, October 2019 (2019-10-01), pages 1958 - 1975, XP071740511 *
LEE J.-K., CHUNG J., MCALPINE F. E., TANSEY M. G.: "Regulator of G-protein signaling-10 negatively regulates NF-KB in microglia and neuroprotects dopaminergic neurons in hemiparkinsonian rats", J. NEUROSCI., vol. 31, no. 33, 17 August 2011 (2011-08-17), pages 11879 - 11888, XP055974864 *
MOUMNÉ LARA, BETUING SANDRINE, CABOCHE JOCELYNE: "Multiple aspects of gene dysregulation in Huntington's disease", FRONT. NEUROL., vol. 4, no. 127, 23 October 2013 (2013-10-23), pages 1 - 10, XP055974877 *
MRAK ET AL.: "Interleukin-1 and the immunogenetics of Alzheimer disease", J. NEUROPATHOL. EXP. NEUROL., vol. 59, no. 6, June 2000 (2000-06-01), pages 471 - 476, XP009019231 *
See also references of EP4313070A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118374495A (zh) * 2024-03-28 2024-07-23 深圳脑健生物技术有限公司 一种抑制NLRP3基因表达的siRNA及其前体和应用

Also Published As

Publication number Publication date
JP2024512612A (ja) 2024-03-19
AU2022246147A1 (en) 2023-11-09
CN117835986A (zh) 2024-04-05
US20240200063A1 (en) 2024-06-20
EP4313070A4 (en) 2025-06-11
CA3214657A1 (en) 2022-09-29
EP4313070A1 (en) 2024-02-07

Similar Documents

Publication Publication Date Title
US20240182892A1 (en) Double-stranded sirna having patterned chemical modifications
US20240287526A1 (en) Compositions and methods for delivering therapeutic oligonucleotides to the central nervous system
WO2022204429A1 (en) Microglial gene silencing using double-stranded sirna
US20250109402A1 (en) Compositions and methods for treatment of pain
WO2026026776A1 (zh) 抑制APP基因表达的siRNA及其缀合物和应用
US20260098264A1 (en) Compositions and methods for treatment of neurological disorders
WO2024073589A2 (en) Compositions and methods for treatment of neuroinflammatory diseases
AU2023354010A1 (en) Compositions and methods for treatment of neurodegenerative diseases
US20250243492A1 (en) Compositions and methods for treatment of prion diseases
US20250346897A1 (en) Compositions and methods for treatment of microsatellite dna expansion disorders
US20260098269A1 (en) Compositions and methods for treatment of neuroinflammatory diseases
US20260098265A1 (en) Compositions and methods for treatment of spinocerebellar ataxias
CA3241122A1 (en) Compositions and methods for treatment of epilepsies

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22776672

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3214657

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023558983

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU2022246147

Country of ref document: AU

Ref document number: 2022246147

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2022776672

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022776672

Country of ref document: EP

Effective date: 20231024

ENP Entry into the national phase

Ref document number: 2022246147

Country of ref document: AU

Date of ref document: 20220324

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202280036538.0

Country of ref document: CN