WO2021026490A1

WO2021026490A1 - Cns targeting with multimeric oligonucleotides

Info

Publication number: WO2021026490A1
Application number: PCT/US2020/045480
Authority: WO
Inventors: Jonathan Miles Brown; Kristin K. H. Neuman
Original assignee: Mpeg La, L.L.C.
Priority date: 2019-08-08
Filing date: 2020-08-07
Publication date: 2021-02-11

Abstract

The present disclosure relates to multimeric oligonucleotides and methods of administering them to a subject. The multimeric oligonucleotides have a molecular weight and/or size configured to increase in vivo bioavailability and/or in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo bioavailability or in vivo activity, as the case may be, of the same subunit when administered in monomeric form.

Description

CNS TARGETING WITH MULTIMERIC OLIGONUCLEOTIDES

FIELD OF THE INVENTION

[0001] The present disclosure relates to oligonucleotide-based therapeutics. More specifically, the present disclosure relates to multimeric therapeutic oligonucleotides for targeting cells and tissues of the central nervous system (CNS).

BACKGROUND

[0002] Oligonucleotides are now a well-established class of therapeutics with multiple applications and ongoing clinical trials. However, many factors still limit oligonucleotide therapeutics, for example, the delivery of the oligonucleotide to a target cell and the subsequent internalization of the oligonucleotide into the target cell or tissue in sufficient quantities to achieve a desired therapeutic effect. Deliver}_' of oligonucleotide therapeutics to cells and tissues of the CNS, present similar challenges.

[0003] In an attempt to address these deliver}' and internalization limitations, many parties have investigated lipid nanoparticles (LNPs, e.g., lipid spheroids including positively charged lipids to neutralize the negative charge of the oligonucleotide and to facilitate target cell binding and internalization). While LNPs can in some cases facilitate delivery and internalization, they suffer from major drawbacks, for example poor targeting and toxicity, resulting in a narrowed therapeutic window.

[0004] Although individual oligonucleotide therapeutic agents are quite large molecules compared to traditional drugs, they are nonetheless small enough to be easily excreted via the kidney. This is a major problem as the amount of therapeutic material reaching the target cells is consequently reduced.

[0005] In order to minimalize excretion of the oligonucleotide via the kidney one approach has been to maximize the number of phosphorothioate internucieotide linkages in the molecule Phosphorothioate groups were originally introduced to reduce cleavage by nucleases but were found to promote binding to proteins. Because the affinity of phosphorothioate oligonucleotides for proteins is length-dependent but largely sequence- independent (Stein CA, et al. Biochemistry'. 1993, 32:4855—4861), oligonucleotides containing a large proportion of such groups bind to proteins circulating in the blood, thereby increasing the effective molecular size of the oligonucleotide and decreasing the rate of excretion via the kidney. However, the use of a high number of phosphorothioate groups has many drawbacks. For example, phosphorothioate oligonucleotides of the appropriate length can block the binding of biologically relevant proteins to their natural receptors resulting in toxic side effects (Stein, CA. J Clin Invest. 2001 Sep 1; 108(5): 641–644). Hence, the facilitation of protein binding that is an advantage of high levels of thiophosphorylation is simultaneously a major disadvantage. Increased toxicity and reduction of gene silencing was also observed when phosphorothioates have been applied to siRNAs (Lam et al., Mol Ther Nucleic Acids, 2015, 4(9): e252; Chiu et al., RNA, 2003, 9: 1034–1048; Amarzguioui et al., Nucleic Acids Res, 2003, 31: 589–595; Choung et al., Biochem Biophys Res Commun, 2006, 342: 919–927). [0006] Thus, the use of high levels of phosphorothioate groups to minimize losses of oligonucleotides via kidney filtration is inapplicable to siRNAs and similar double- stranded molecules (such as miRNAs and saRNAs), and is limited to a subset of antisense oligonucleotides, although even there it would be desirable in some instances to minimize the use of phosphorothioates. [0007] Another challenge in the delivery of oligonucleotides to the CNS, including the brain and spinal column involves distribution. It has been reported that siRNAs conjugated to hydrophobic ligands are retained near the brain injection site (NATURE BIOTECHNOLOGY, Vol. 37, August 2019, 884-894 at 884). [0008] It follows, therefore, that there is a need for a method to increase the bioavailability and bioactivity of all classes of oligonucleotide therapeutics for delivery to the CNS. SUMMARY OF THE DISCLOSURE [0009] The present disclosure relates to compositions and related methods to increase the biological activity in a subject of an oligonucleotide therapeutic agent when administered to the CNS for the treatment of diseases and disorders of genetic origin. The disclosure is applicable to all types of oligonucleotide therapeutics, including for example siRNAs, miRNAs and saRNAs, as well as antisense oligonucleotides, which include the classic single stranded antisense oligonucleotides (ASOs) as well as splice switching oligonucleotides (SSOs). [0010] The present disclosure provides a multimeric oligonucleotide comprising a number of oligonucleotide therapeutic agents (each of which is a “subunit”) wherein each of the subunits is joined to another subunit by a covalent linker, and wherein the biological activity of at least one subunit within the multimeric oligonucleotide is increased relative to the activity of the subunit alone (i.e., a monomeric form of the subunit). In one embodiment, the increase in bioactivity is independent of the phosphorothioate content of the subunit or the multimer. In other embodiments, the multimeric oligonucleotide may contain one or more double- stranded subunits, or may contain four or more subunits overall, or may have a molecular weight of at least about 45 kD. The improved and advantageous properties of the multimers according to the disclosure may be described in terms of increased in vivo activity. The relative increase in in vivo bioactivity of at least one subunit in the multimer as compared to the corresponding monomer may be in the range of 2-10 times and higher that of the corresponding monomer; for example, the relative increase may be 2, 5, 10, or more times that of the corresponding monomer.

[0011] The present disclosure al so relates to new synthetic intermediates and methods of synthesizing the multimeric oligonucleotides. The present disclosure also relates to methods of using the multimeric oligonucleotides, for example in reducing gene expression, biological research, treating or preventing medical conditions, and/or to produce new or altered phenotypes.

[0012] In one aspect, the disclosure provides a multimeric oligonucleotide comprising subunits ......, wherein: each of the subunits independently comprises a single- or a double-stranded oligonucleotide, and each of the subunits ....... is joined to another subunit by a covalent linker ·; the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or to a target region of the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to descrea.se its clearance from the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form, and each subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS. [0013] In an embodiment, the multimeric oligonucleotide comprises at least one subunit that binds to or is active against a biomarker or biomarker precursor whose concentration or activity is higher or lower compared to a healthy cell.

[0014] In an embodiment, the multimeric oligonucleotide comprises at least one subunit that binds to or is active against a biomarker or biomarker precursor in a neuron or a glial cell.

[0015] In an embodiment, the multimeric oligonucleotide comprises at least one subunit with complementarity to an mRNA that is overexpressed in a CNS cell. In a further embodiment, the subunit is an siRNA, a rniRNA, or an antisense oligonucleotide

[0016] In an embodiment, the multimeric oligonucleotide comprises at least one subunit that activates expression of an mRNA that is underexpressed in a CNS cell. In a further embodiment, the subunit is an saRNA.

[0017] In an embodiment, the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS.

[0018] In an embodiment, the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or throughout a desired region of the CNS.

[0019] In an embodiment, the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form.

[0020] In an embodiment, the molecular weight of the multimeric oligonucleotide is at least about 45 kD.

[0021] In an embodiment, the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the subunit or multimeric oligonucleotide.

[0022] In an embodiment, the multimeric oligonucleotide comprises 2 or more subunits .......

[0023] In an embodiment, the multimeric oligonucleotide comprises two, three, four, five, six, seven, eight, nine, or ten subunits

[0024] In an embodiment, the multimeric oligonucleotide comprises three subunits. [0025] In an embodiment, the multimeric oligonucleotide comprises four subunits.

[0026] In an embodiment, the multimeric oligonucleotide comprises five subunits.

[0027] In an embodiment, the multimeric oligonucleotide comprises six subunits

[0028] In an embodiment, at least two subunits ...... are substantially different.

In an embodiment, all of the subunits are substantially different.

[0029] In an embodiment, at least two subunits ...... are substantially the same or are identical. In an embodiment, all of the subunits ------- are substantially the same or are identical.

[0030] In an embodiment, the multimeric oligonucleotide comprises a hetero- rnultimer of six or more subunits ·· - --, wherein at least two subunits ...... are substantially different.

[0031] In an embodiment, each subunit ------- independently comprises 10-30,

17-27, 19-26, or 20-25 nucleotides in length.

[0032] In an embodiment, one or more subunits are double-stranded.

[0033] In an embodiment, one or more subunits are single-stranded

[0034] In an embodiment, the subunits comprise a combination of single- stranded and double-stranded oligonucleotides.

[0035] In an embodiment, one or more nucleotides within an oligonucleotide comprises an RNA, a DNA, or an artificial or non-natural nucleic acid analog.

[0036] In an embodiment, at least one of the subunits comprise RNA.

[0037] In an embodim ent, at least one of the subunits comprises a siRNA, a saRNA, or a miRNA.

[0038] In an embodiment, at least one of the subunits comprises an antisense oligonucleotide.

[0039] In an embodiment, at least one of the subunits comprises a double- stranded siRNA.

[0040] In an embodiment, two or more siRNA subunits are joined by covalent linkers attached to the sense strands of the siRNA.

[0041] In an embodiment, two or more siRNA subunits are joined by covalent linkers attached to the antisense strands of the siRNA. [0042] In an embodiment, two or more siRNA subunits are joined by covalent linkers attached to the sense strand of a first siRNA and the antisense strand of a second siRNA.

[0043] In an embodiment, one or more of the covalent linkers ● comprise a cleavable covalent linker

[0044] In an embodiment, the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.

[0045] In an embodiment, the cleavable covalent linker is cleavable under intracellular conditions.

[0046] In an embodiment, one or more of the covalent linkers comprise a noncleavable linker.

[0047] In an embodiment, at least one covalent linker comprises a disulfide bond or a compound of Formula (I):

wherein: S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each R₁ comprises a C₂- C₁₀ alkyl, alkoxy, or aryl group; R₂ comprises a thiopropionate or disulfide group; and each X comprises

pound of Formula (I) comprises

wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit.

[0049] In an embodiment, the compound of Formula (I) comprises

, wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit. [0050] In an embodiment, the compound of Formula (I) comprises

wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit

[0051] In an embodiment, the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (

, wherein: each Ri comprises a C₂-C₁₀ alkyl, an alkoxy, or an aryl group; and R₂ comprises a thiopropionate or disulfide group.

[0052] In an embodiment, one or more of the covalent linkers · comprise a nucleotide linker.

[0053] In an embodiment, the nucleotide linker comprises 2-6 nucleotides.

[0054] In an embodiment, the nucleotide linker comprises dinucleotide linker.

[0055] In an embodiment, each covalent linker ● is the same.

[0056] In an embodiment, the covalent linkers · comprise two or more different covalent linkers.

[0057] In an embodiment, at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 3’ end of a second subunit

[0058] In an embodiment, at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 5’ end of a second subunit.

[0059] In an embodiment, at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the 3’ end of a second subunit.

[0060] In an embodiment, at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the 5’ end of a second subunit.

[0061] In an embodiment, the multimeric oligonucleotide further comprises one or more targeting ligands.

[0062] In an embodiment, at least one of the subunits is a targeting ligand.

[0063] In an embodiment, the targeting ligand targets a ceil or tissue of the CNS. [0064] In an embodiment, the targeting ligand is selected from the group consisting of a phospholipid, an aptamer, a peptide, an antigen-binding protein, folate and other folate receptor-binding ligands, mannose and other mannose receptor-binding ligands, and an immunostimulant.

[0065] In an embodiment, the peptide is selected from the group consisting of, APRPG, cNGR (CNGRCVSGCAGRC), F3

(KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and iRGD (CRGDKGPDC).

[0066] In an embodiment, the anti gen -bin ding protein is an ScFv or a VHH.

[0067] In an embodiment, the irnrnunostimulant comprises a CpG oligonucleotide.

[0068] In an embodiment, the targeting ligand targets a neuron or a glial cell.

[0069] In an embodiment, the targeting ligand is an aptamer.

[0070] In an embodiment, the multimeric oligonucleotide is at least 75%, 80%,

85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure.

[0071] In an embodiment, the multimeric oligonucleotide is formulated for in vivo CNS administration.

[0072] In an embodiment, the multimeric oligonucleotide is formulated for in vivo intrathecal injection.

[0073] In an embodiment, the multimeric oligonucleotide is formulated for in vivo intratumoral injection.

[0074] In an embodiment, the multimeric oligonucleotide is formulated for in vivo injection into the tumor microenvironment.

[0075] In an embodiment, the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

[0076] In an embodiment, the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 5-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

[0077] In an embodiment, the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 10-fold increase relative to in vivo activity of the same subunit when administered in monomeric form. [0078] In an embodiment, the mRNA overexpressed in a CNS cell comprises mRNA encoding an oncogene.

[0079] In an embodiment, the mRNA overexpressed in a cancer ceil comprises mRNA encoded by an immune checkpoint gene.

[0080] In an embodiment, the mRNA expressed in a cancer-targeting immune cell comprises mRNA encoded by an immune checkpoint gene.

[0081] In an embodiment, at least one subunit within the multimeric oligonucleotide is an SSO for the treatment of a neurodegenerative disease.

[0082] In an embodiment, at least one subunit within the multi meric oligonucleotide is an siRNA with complementarity to huntingtin mRNA.

[0083] In an embodiment, each of the subunits within the multimeric oligonucleotide, independently, are an siRNA with complementarity to huntingtin mRNA.

[0084] In an embodiment, each of the subunits within the multimeric oligonucleotide is complementary to the same region of the huntingtin mRNA.

[0085] In an embodiment, one or more subunits within the multimeric oligonucleotide are complementary to different regions of the huntingtin mRNA.

[0086] In an embodiment, at least one subunit within the multi meric oligonucleotide is an siRNA with complementarity to a cyclophilin B (Ppib) mRNA or to an apolipoprotein E (ApoE) mRNA.

[0087] In an embodiment, at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to an EGFR mRNA.

[0088] In an embodiment, the multimeric oligonucleotide comprises 3 or more subunits.

[0089] In an embodiment, the multimeric oligonucleotide does not comprise a branched structure wherein at least one of the covalent linkers joins three or more monomeric subunits.

[0090] In an embodiment, i) the decreased clearance of the multimeric oligonucleotide from the CNS, and/or ii) the enhanced distribution of the multimeric oligonucleotide throughout the CNS or throughout a desired region of the CNS; and/or iii) the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphor othioate content in the multiineric oligonucleotide and/or in any given subunit. [0091] In another aspect, the disclosure provides a method of delivering a multimeric oligonucleotide to a subject in need thereof, the method comprising administration of an effective amount of the multimeric oligonucleotide to the subject, the multimeric oligonucleotide comprising subunits wherein: each of the subunits . independently comprises a single- or a double-stranded oligonucleotide, and each of the subunits is j oined to another subunit by a covalent linker ● ; the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or to a target region of the CNS relative to an oligonucleotide administered in monomeric form, and/or the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multim eric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; and each subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

[0092] In an embodiment, the multimeric oligonucleotide comprises at least one subunit that binds to or is active against a biomarker or biomarker precursor whose concentration or activity is higher or lower compared to a healthy cell.

[0093] In an embodiment, the multimeric oligonucleotide comprises at least one subunit that binds to or is active against a biomarker or biomarker precursor in a neuron or glial cell

[0094] In an embodiment, the multimeric oligonucleotide comprises at least one subunit with complementarity to an rnRNA that is overexpressed in a CNS cell. In a further embodiment, the subunit is an siRNA, a miRNA, or an antisense oligonucleotide

[0095] In an embodiment, the multimeric oligonucleotide comprises at least one subunit that activates expression of an rnRNA that is underexpressed in a CNS cell. In a further embodiment, the subunit is an saRNA.

[0096] In an embodiment, the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS.

[0097] In an embodiment, the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CND or throughout a desired region of the CNS. [0098] In an embodiment, the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity or one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form.

[0099] In an embodiment, the molecular weight of the multimeric oligonucleotide is at least about 45 kD.

[00100] In an embodiment, the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the multimeric oligonucleotide.

[00101] In an embodiment, the multimeric oligonucleotide comprises 2 or more subunits .......

[00102] In an embodiment, the multimeric oligonucleotide comprises two, three, four, five, six, seven, eight, nine, or ten subunits · ......

[00103] In an embodiment, the multimeric oligonucleotide comprises three subunits.

[00104] In an embodiment, the multimeric oligonucleotide comprises four subunits.

[00105] In an embodiment, the multimeric oligonucleotide comprises five subunits.

[00106] In an embodiment, the multimeric oligonucleotide comprises six subunits

[00107] In an embodiment, at least two subunits · .....·. are substantially different. In an embodiment, all of the subunits are substantially different.

[00108] In an embodiment, at least two subunits ...... are substantially the same or are identical. In an embodiment, all of the subunits ...... are substantially the same or are identical.

[00109] In an embodiment, the multimeric oligonucleotide comprises a hetero- multimer of six or more subunits . , wherein at least two subunits . are sub stand ally different.

[00110] In an embodiment, each subunit ------- independently comprises 10-30,

17-27, 19-26, or 20-25 nucleotides in length.

[00111] In an embodiment, one or more subunits are double- stranded.

[00112] In an embodiment, one or more subunits are single-stranded. [00113] In an embodiment, the subunits comprise a combination of single- stranded and double-stranded oligonucleotides.

[00114] In an embodiment, one or more nucleotides within an oligonucleotide comprises an RNA, a DNA, or an artificial or non-natural nucleic acid analog.

[00115] In an embodiment, at least one of the subunits comprise RNA.

[00116] In an embodiment, at least one of the subunits comprises a siRNA, a saRNA, or a miRNA.

[00117] In an embodiment, at least one of the subunits comprises an antisense oligonucleotide.

[00118] In an embodiment, at least one of the subunits comprises a double- stranded siRNA.

[00119] In an embodiment, two or more siRNA subunits are joined by covalent linkers attached to the sense strands of the siRNA.

[00120] In an embodiment, two or more siRNA subunits are joined by covalent linkers attached to the antisense strands of the siRNA.

[00121] In an embodiment, two or more siRNA subunits are joined by covalent linkers attached to the sense strand of a first siRNA and the antisense strand of a second siRNA

[00122] In an embodiment, one or more of the covalent linkers ● comprise a cleavable covalent linker.

[00123] In an embodiment, the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond

[00124] In an embodiment, the cleavable covalent linker is cleavable under intracellular conditions.

[00125] In an embodiment, one or more of the covalent linkers comprise a noncleavable linker.

[00126] In an embodiment, at least one covalent linker comprises a disulfide bond or a compound of Formula (I):

wherein: S is attached by a covalent bond or by a linker to the 3 ’ or 5 ’ terminus of a subunit; each R comprises a C_2- C10 alkyl, alkoxy, or aryl group; R2 comprises a thiopropionate or disulfide group; and

[00127] In an embodiment, the compound of Formula (I) comprises

[00128] In an embodiment, the compound of Formula (I) comprises

[00129] In an embodiment, the compound of Formula (I) comprises

, and wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit

[00130] In an embodiment, the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (

, wherein: each Ri comprises a C2-C10 alkyl, an alkoxy, or an aryl group; and R₂ comprises a thiopropionate or disulfide group.

[00131] In an embodiment, one or more of the covalent linkers · comprise a nucleotide linker.

[00132] In an embodiment, the nucleotide linker comprises 2-6 nucleotides.

[00133] In an embodiment, the nucleotide linker comprises dinucleotide linker. [00134] In an embodiment, each covalent linker ● is the same.

[00135] In an embodiment, the covalent linkers ● comprise two or more different covalent linkers.

[00136] In an embodiment, at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 3’ end of a second subunit.

[00137] In an embodiment, at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 5’ end of a second subunit

[00138] In an embodiment, at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the 3’ end of a second subunit.

[00139] In an embodiment, at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the S’ end of a second subunit.

[00140] In an embodiment, the muitimeric oligonucleotide further comprises one or more targeting ligands.

[00141] In an embodiment, at least one of the subunits is a targeting ligand.

[00142] In an embodiment, the targeting ligand targets a cell or tissue of the CNS.

[00143] In an embodiment, the targeting ligand is selected from the group consisting of a phospholipid, an aptamer, a peptide, an antigen-binding protein, folate and other folate receptor-binding ligands, mannose and other mannose receptor-binding ligands, and an immunostimulant.

[00144] In an embodiment, the peptide is selected from the group consisting of, APRPG, cNGR (CNGRCVSGCAGRC), F3

(KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and IRGD (CRGDKGPDC).

[00145] In an embodiment, the antigen-binding protein is an ScFv or a VHH.

[00146] In an embodiment, the immunostimulant comprises a CpG oligonucleotide.

[00147] In an embodiment, the targeting ligand targets a neuron or glial cell.

[00148] In an embodiment, the targeting ligand is an aptamer.

[00149] In an embodiment, the multimeric oligonucleotide is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure.

[00150] In an embodiment, the multimeric oligonucleotide is formulated for in vivo CNS administration. [00151] In an embodiment, the multimeric oligonucleotide is formulated for in vivo intrathecal injection.

[00152] In an embodiment, the multimeric oligonucleotide is formulated for in vivo intratumoral injection.

[00153] In an embodiment, the multimeric oligonucleotide is formulated for in vivo injection into the tumor microenvironment

[00154] In an embodiment, the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

[00155] In an embodiment, the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 5-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

[00156] In an embodiment, the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 10-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

[00157] In an embodiment, the mRNA overexpressed in a cancer cell comprises mRNA encoding an oncogene.

[00158] In an embodiment, the mRNA overexpressed in a cancer cell comprises mRNA encoded by an immune checkpoint gene.

[00159] In an embodiment, the mRNA expressed in a cancer- targeting immune cell comprises mRNA encoded by an immune checkpoint gene.

[00160] In an embodiment, at least one subunit within the multimeric oligonucleotide is an SSO for the treatment of a neurodegenerative disease.

[00161] In an embodiment, at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to huntingtin mRNA.

[00162] In an embodiment, each of the subunits within the multimeric oligonucleotide, independently, are an siRNA with complementarity to huntingtin mRNA.

[00163] In an embodiment, each of the subunits within the multimeric oligonucleotide is complementary to the same region of the huntingtin mRNA.

[00164] In an embodiment, one or more subunits within the multimeric oligonucleotide are complementary to different regions of the huntingtin mRNA. [00165] In an embodiment, at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to a cyclophiiin B (Ppib) rnRNA or to an apolipoprotein E (ApoE) rnRNA.

[00166] In an embodiment, at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to an EGFR rnRNA

[00167] In an embodiment, the multimeric oligonucleotide comprises 3 or more subunits

[00168] In an embodiment, the multimeric oligonucleotide does not comprise a branched structure wherein at least one of the covalent linkers joins three or more monomeric subunits

[00169] In an embodiment, i) the decreased cl earance of the multimeric oligonucleotide from the CNS; and/or ii) the enhanced distribution of the multimeric oligonucleotide throughout the CNS or throughout a desired region of the CNS; and/or iii) the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the multimeric oligonucleotide and/or in any given subunit.

[00170] These and other advantages of the present technology will be apparent when reference is made to the accompanying drawings and the following description

[00171] While the disclosure comprises embodiments in many different forms, there are shown in the drawings and will herein be described in detail several specific embodiments with the understanding that the present disclosure is to be considered as an exemplifi cation of the principles of the technology and is not intended to limit the disclosure to the embodiments illustrated.

BRIEF DESCRIPTION OF THE DRAWINGS

[00172] FIG 1 is a depiction of a series of homomultimers from 1- to 8-mer to be administered subcutaneously and evaluated as described in Example 12.

[00173] FIG. 2 represents a schematic diagram (Scheme 1) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 19.

[00174] FIG. 3 represents a schematic diagram (Scheme 2) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 20. [00175] FIG. 4 represents a schematic diagram (Scheme 3) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 21.

[00176] FIG. 5 represents a schematic diagram (Scheme 4) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 22.

[00177] While the disclosure comprises embodiments in many different forms, there are shown in the drawings and will herein be described in detail several specific embodiments with the understanding that the present disclosure is to be considered as an exemplification of the principles of the technology and is not intended to limit the disclosure to the embodiments illustrated.

DETAILED DESCRIPTION

[00178] The disclosures of any patents, patent applications, and publications referred to herein are hereby incorporated by reference in their entireties into this application in order to more fully describe the state of the art known to those skilled therein as of the date of the disclosure described and claimed herein

[00179] The present disclosure relates to compounds and methods of administering said compounds to a subject with a disease of the CNS, or to a subject in order to prevent a disease of the CNS. The compounds are multimeric oligonucleotides having monomeric subunits joined by covalent linkers. The multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution, decrease clearance, and/or increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to distribution, clearance and/or in vivo activity, respectively, of the same subunit when administered in monomeric form. The multimeric oligonucleotide may have a molecular weight of at least about 45 kD. The present disclosure also relates to the multimeric oligonucleotide and methods of synthesizing the multimeric oligonucleotide. The present disclosure relates to methods of delivering multimeric oligonucleotides to a cell or tissue of the CNS. For example, whereas a typical siRNA (e.g., double-stranded monomer) may have a molecular weight of about 15 kD, an oligonucleotide multimer according to the disclosure may have a molecular weight of at least about 45 kD and have a relatively enhanced distribution throughout the CNS, decreased clearance from the CNS, and/or increased in vivo activity, relatively to the corresponding monomer. The improved and advantageous properties of the multirners according to the disclosure can be described in terms of increased in vivo circulation half- life. They may also be described in terms of increased in vivo activity, or increased bioactivity. Increased bioactivity may be represented byincreased or decreased levels of a target protein or mRNA after administration of the multimeric oligonucleotide. The increased bioactivity produced by the multimeric oligonucleotide may be observed relative to a corresponding monomeric oligonucleotide; for example, a multimeric oligonucleotide administered via the IV route may achieve better bioactivity (e.g., a higher level of increase or reduction of the target mRNA or protein) compared to a corresponding monomeric oligonucleotide administered via the IV route.

[00180] When combined with a targeting ligand, the multimeric oligonucleotide can also deliver a higher payload per ligand/receptor binding event than the monomeric equivalent. The present disclosure also relates to methods of treating diseases and disorders of the CNS using the multimeric oligonucleotides.

Methods of Administering Multimeric Oligonucleotide to a Subject

[00181] In various aspects, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, the method comprising administering an effective amount of the multimeric oligonucleotide to the subject, the multimeric oligonucleotide comprising subunits wherein: each of the subunits ...... is independently a single or double-stranded oligonucleotide, and each of the subunits is joined to another subunit by a covalent linker ●; the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution, decrease clearance, and/or increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to distribution, clearance and/or in vivo activity, respectively, of the same subunit when administered in monomeric form.

In some respects, the molecular weight of the multimeric oligonucleotide may be at least about 45 kD.

[00182] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the number of subunits contained in the multimeric oligonucleotide is m, m being an integer selected to enable the multimeric oligonucleotide to have the molecular weight and/or size configured to enhance distribution, decrease clearance, and/or increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to distribution, clearance, and/or in vivo activity, respectively, of the same subunit when administered in monomeric form. In various aspects, m is (i) ³ 2; (ii) ³ 3; (iii) ³ 4; (iv) ³ 4 and < 17; (v) ³ 4 and < 8, or (vi) 4, 5, 6, 7, or 8.

[00183] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the multimeric oligonucleotide comprises Structure 21:

(Structure 21) and n is an integer ³ 0.

[00184] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the subunits are single- stranded ol igonucl eoti de s .

[00185] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein n is ³ 1.

[00186] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the subunits are double- stranded oligonucleotides.

[00187] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein: when n = 0, the clearance of the multimeric oligonucleotide is decreased relative to that of a monomeric subunit and/or a dimeric subunit ^. ...... of the multimeric oligonucleotide; and when n ³ 1, the clearance of the multimeric oligonucleotide is decreased relative to that of a monomeric subunit a dimeric subunit ^....... , and/or a trimeric subunit ....... of the multimeric oligonucleotide.

Methods of Measuring Decreased Clearance of Multimeric Oligonucleotide

[00188] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance results in increased in vivo circulation half-life of the multimeric oligonucleotide.

[00189] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance is determined by measuring the in vivo circulation half-life of the muitimeric oligonucleotide after administering the muitimeric oligonucleotide to the subject. [00190] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance is determined by measuring the time required for the serum concentration of the multimeric oligonucleotide to decrease to a predetermined value. The predetermined value can be 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of the administered dose.

[00191] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance is determined by measuring the serum concentration of the multimeric oligonucleotide at a predetermined time after administering the multimeric oligonucleotide to the subject.

[00192] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance is determined by measuring the area under a curve of a graph representing serum concentration of the multimeric oligonucleotide over time after administering the multimeric oligonucleotide to the subject.

Effects of Decreased Clearance of Multimeric Oligonucleotide Administered to Subjects

[00193] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance increases in vivo bioavailability of the multimeric oligonucleotide.

[00194] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance increases in vivo cellular uptake of the multimeric oligonucleotide.

[00195] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, in which the decreased clearance increases in vivo therapeutic index/ratio of the multimeric oligonucleotide

[00196] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the measured parameter has a sigmoidal relationship with respect to the number of subunits in a monomeric, dimeric, trim eric and higher number multimeri c oligonucleotides.

[00197] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the measured parameter for the multimeric oligonucleotide and each of its subunits starting with a monomeric subunit, when plotted, define a sigmoidal curve.

Multimeric Oligonucleotides

[00198] In various aspects, the disclosure provides a multi meric oligonucleotide comprising subunits -------, wherein each of the subunits ------- is independently a single or double-stranded oligonucleotide, and each of the subunits . is joined to another subunit by a covalent linker ● .

[00199] In some embodiments, at least one subunit -------comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS. In some embodiments, at least one subunit comprises an oligonucleotide that binds to oris active against a biomarker or biomarker precursor whose concentration or activity is higher or lower compared to a healthy cell. In some embodiments, at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a neuron or a glial cell. In some embodiments, at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a glial cell.

[00200] In some embodiments, at least one subunit comprises an oligonucleotide with complementarity to an mRNA that is over-expressed in a CNS cell. In some embodiments, at least one subunit comprises an oligonucleotide that activates expression of an mRNA that is under-expressed in a CNS cell. In some embodiments, at least one subunit - ----- - comprises a single-stranded oligonucleotide that is active against a biomarker or biomarker precursor in a cell or tissue of the CNS. In some embodiments, all of the subunits ------ - in the multimeric oligonucleotide comprise a single-stranded oligonucleotide that is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

[00201] In some embodiments, at least one subunit ------- comprises a double- stranded oligonucleotide that comprises an active strand and an inactive passenger strand. In some embodiments, all of the subunits in the multimeric oligonucleotide comprise double-stranded oligonucleotides, each of which comprises an active strand and an inactive passenger strand. [00202] In some embodiments, each subunit independently contains fewer than 5 phosphorothioate groups, fewer than 4 phosphorothioate groups, or fewer than 3 phosphorothioate groups.

[00203] In some embodiments, each subunit ------- independently comprises less than 75% chemically modified nucleotides. In some embodiments, each subunit . independently comprises less than 80% chemically modified nucleotides.

[00204] In some embodiments, at least one subunit . is different from another subunit In some embodiments, all of the subunits - ----- - are different.

[00205] In one aspect, the disclosure provides a multi meric oligonucleotide comprising one or more chemically modified nucleotides, but does not contain three identical chemical modifications on three consecutive nucleotides.

[00206] In one aspect, the multimeric oligonucleotide does not include a double- stranded subunit ------- having a sense and an antisense strand, wherein the sense and antisense strands comprise Structure F: sense strand: 5' n_{p -} N_{a -} (XXX)i - N_{b -} YYY - N_{b -} (ZZZ)j - N_a - n_q 3' antisense: 3' n_p' - N_a' - (X'X'X’)k - NV - UΎΎ' - N_b' - (Z'Z'Z')i - N_a' - n_q 5' wherein i, j, k, and 1 are each independently 0 or 1; p, p', q, and q' are each independently 0-6; each N_a and N_a' independently represents an oligonucleotide sequence comprising 0- 25 modified nucleotides, each sequence comprising at least two differently modified nucleotides, each N_b and N_b' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n_p', n_p, n_q', and n_q independently represents an overhang nucleotide or may not be present, and XXX, YYY, ZZZ, C'C'C', UΎΎ', and Z'Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucl eoti des.

[00207] In some embodiments, the multimeric oligonucleotide does not include a double-stranded subunit - ----- - having a sense and an antisense strand, wherein the sense and antisense strands comprise Structure FI:

5' n_{p -} N_{a -} YYY - N_{a -} n_q 3'

3' n_p' - Na' - UΎU - N_a' - n_q’ 5’ wherein each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of X, Y and Z may be the same or different from each other. In some embodiments, the multimeric oligonucleotide does not include a double-stranded subunit - having a sense and an antisense strand, wherein the sense and antisense strands comprise Structure F2:

5' n_{p -} N_{a -} YYY - N_{b -} ZZZ - N_{a -} n_q 3'

3' iip¹ - N_{a -} UΎT - N_b' - Z'Z'Z' - N_{a -} n_q' 5' each N_b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleo-tides. Each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleo-tides. Each of X, Y and Z may be the same or different from each other.

[00208] In some embodiments, the multimeric oligonucleotide does not include a double-stranded subunit having a sense and an antisense strand, wherein the sense and antisense strands comprise Structure F3:

5' n_{p -} Na - XXX - N_{b -} YYY - N_{a -} n_q 3'

3' iip¹ - N_a’ - XX’X' - N_b' - YYY - N_{a -} n_q’ 5' each N_b, N_b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N_a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of X, Y and Z may be the same or different from each other.

[00209] In some embodiments, the multimeric oligonucleotide does not include a double-stranded subunit ...... having a sense and an antisense strand, wherein the sense and antisense strands comprise Structure F4:

5' n_{p -} N_{a -} XXX - N_{b -} YYY - N_{b -} ZZZ - N_{a -} n_q 3’

3' lip' - N_{a -} X'X’X' - N_b' - YYY - N_b' - Z'Z'Z' - N_a' - n_q’ 5' each N_b, N_b ’ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N_a, N_a ' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N_a, N_a N_b and N_b ' independently comprises modifications of alternating pattern.

Each of X, Y and Z may be the same or different from each other.

[00210] In some embodiments, the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or to a target region of the CNS relative to an oligonucleotide administered in monomeric form;

[00211] In some embodiments, the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS relative to an oligonucleotide administered in monomeric form; and/or [00212] In some embodiments, the multimerie oligonucleotide has a molecular weight and/or size configured to increase in vivo acti vity of one or more subunits within the multimerie oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form.

[00213] In some respects, the molecular weight of the multimerie oligonucleotide is at least about 45 kD.

[00214] In one aspect, the disclosure provides a multimerie oligonucleotide wherein the number of subunits contained in the multimerie oligonucleotide is m, m being an integer selected to enable the multimerie oligonucleotide to have the molecular weight and/or size configured to decrease its clearance due to glomerular filtration and/or configured to increase in vivo activity of one or more subunits within the multimerie oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form. In various aspects, m is (i) ³ 2, (ii) ³ 3; (iii) ³ 4, (iv) ³ 4 and < 17; (v) ³ 4 and < 8; or (vi) 4, 5, 6, 7, or 8. In other aspects, each subunit comprises an oligonucleotide with complementarity to an mRNA overexpressed in a cell within the CNS, including but not limited to a neuron and/or a glial cell.

[00215] In one aspect, the disclosure provides a multimerie oligonucleotide comprising Structure 21:

(Structure 21) wherein at least one of the subunits - ----- - comprises a single strand having one of the covalent linkers ● joined to its 3’ terminus and another of the covalent linkers joined to its 5’ terminus, and n is an integer ³ 0.

[00216] In one aspect, the disclosure provides a multimerie oligonucleotide in which each subunit ------- is 15-30, 17-27, 19-26, or 20-25 nucleotides in length.

[00217] In one aspect, the disclosure provides a multimerie oligonucleotide wherein n ³ 1 and n < 17.

[00218] In one aspect, the disclosure provides a multimerie oligonucleotide in which n ³ 1 and n < 5.

[00219] In one aspect, the disclosure provides a multimerie oligonucleotide in which n is 1, 2, 3, 4, or 5.

[00220] In one aspect, the disclosure provides a multimerie oligonucleotide wherein each subunit is a double-stranded RNA and n ³ 1. [00221] In one aspect, the disclosure provides a multimeric oligonucleotide in which each subunit is a single-stranded oligonucleotide.

[00222 ] In one aspect, the disclosure provides a multi meric oligonucleotide in which each subunit is a double-stranded oligonucleotide.

In one aspect, the disclosure provides a multi meric oligonucleotide in which the subunits comprise a combination of single-stranded and double-stranded oligonucleotides.

[00223] In some embodiments, all of the oligonucleotide subunits - ----- - are the same. In some embodiments, at least one oligonucleotide subunit - ----- - is different from another oligonucleotide subunit - In other embodiments, all of the subunits

------- _are different.

[00224] In one aspect, the disclosure provides a multimeric oligonucleotide in which each subunit is an RNA, a DNA, or an artificial or non-natural nucleic acid analog.

[00225] In one aspect, the disclosure provides a multimeric oligonucleotide in which each subunit is a RNA.

[00226] In one aspect, the disclosure provides a multimeric oligonucleotide in which each subunit is a siRNA, a saRNA, or a miRNA.

[00227] In one aspect, the disclosure provides a multi meric oligonucleotide in which each subunit is a double-stranded siRNA and each of the covalent linkers joins sense strands of the siRNA.

[00228] In one aspect, the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide comprises a homo-multimer of substantially identical subunits -

[00229] In one aspect, the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide comprises a hetero-multimer of two or more substantially different subunits ------.

[00230] In one aspect, the disclosure provides a multi meric oligonucleotide in which the multimeric oligonucleotide is at least 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% pure.

[00231] In one aspect, the disclosure provides a multimeric oligonucleotide wherein each subunit . is independently a double-stranded oligonucleotide - , and wherein n is an integer ³ 1. [00232] In one aspect, the disclosure provides a multimeric oligonucleotide wherein each subunit ------- is independently a double-stranded oligonucleotide wherein n is an integer ³ 0, or n is an integer ³ 1, and wherein each covalent linker ● is on the same strand;

(Structure 54), wherein d is an integer ³ 0, or d is an integer ³ 1.

[00233] In one aspect, the disclosure provides a multimeric oligonucleotide comprising Structure 22 or 23;

(Structure 22)

(Structure 23) where each ------- is a double-stranded oligonucleotide, each ● is a covalent linker joining adjacent double-stranded oligonucleotides, f is an integer ³ 1, and g is an integer ³ 0

[00234] In one aspect, the disclosure provides a plurality of a multimeric oligonucleotide wherein substantially all of the multimeric oligonucleotides have a predetermined value of n and/or predetermined molecular weight.

[00235] In one aspect, the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide further comprises a targeting ligand or functional moiety as described below in the section “Conjugates, Functional Moieties, Delivery Vehicles and Targeting Ligands” (hereinafter, collectively, “a Functional Moiety” or “FM”). In some embodiments, the multimeric oligonucleotide may be represented by Structure A;.

FM FM FM wherein each of the subunits is independently a single- or double-stranded oligonucleotide, each of the subunits . is joined to another subunit by a covalent linker ●, n is greater than or equal to zero, and FM may independently be a functional moiety, a targeting ligand, or absent. In some embodiments, at least two of the FMs are present. [00236] In one aspect, the disclosure provides a multimeric oligonucleotide in which n is I, 2, or 3. In another aspect, the disclosure provides a multimeric oligonucleotide in which n is 4, 5, 6, 7, 8, 9, or 10.

[00237] In one aspect, the disclosure provides a multimeric oligonucleotide in which at least one of the subunits is a Functional Moiety or FM

[00238] In one aspect, at least one terminus of a multimeric oligonucleotide is covalently bound to a Functional Moiety or FM.

[00239] In one aspect, at least one internal subunit of a multimeric oligonucleotide is covalently bound to a Functional Moiety or FM.

[00240] In one aspect, at least one terminus of the multimeric oligonucleotide is covalentl y bound to a Functional Moiety or FM and at least one internal subunit of the multimeric oligonucleotide is covalently bound to a Functional Moiety or FM.

[00241] In one aspect, each of the termini of the multimeric oligonucleotide is covalently bound, respectively, to a Functional Moiety, and each of the internal subunits of the multimeric oligonucleotide are covalently bound, respectively, to a Functional Moiety or FM.

[00242] In some embodiments, at least one of FMs that are present in the multimeric oligonucleotide is different from any other FM that is present in the oligonucleotide.

[00243] In some embodiments, all of FM that are present in the multimeric oligonucleotide are the same.

[00244] In some embodiments, each FM that is present in the multimeric oligonucleotide is different from any other FM that is present in the oligonucleotide. Thus all the FMs are different.

Linkers

[00245] In one aspect, the disclosure provides a multimeric oligonucleotide in which one or more of the covalent linkers · comprise a cleavable covalent linker and include nucleotide linkers. Nucleotide linker is a linker that contains one or more nucleotides and it can be chosen such that it does not carry out any other designated function. [00246] In one aspect, the disclosure provides a multimeric oligonucleotide in which the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.

[00247] In one aspect, the disclosure provides a multimeric oligonucleotide in which the cleavable covalent linker is cleavable under intracellular conditions

[00248] In one aspect, the disclosure provides a multimeric oligonucleotide in which each covalent linker · is the same

[00249] In one aspect, the disclosure provides a multimeric oligonucleotide in which all of the covalent linker ● are the different.

[00250] In one aspect, the disclosure provides a multimeric oligonucleotide in which the covalent linkers · comprise two or more different covalent linkers. In other words, at least one of the covalent linkers · is different from another covalent linker.

[00251] In one aspect, the disclosure provides a multimeric oligonucleotide in which each covalent linker ● joins two monomeric subunits

[00252] In one aspect, the disclosure provides a multimeric oligonucleotide in which at least one covalent linker · joins three or more monomeric subunits

Method of Synthesis of Multimeric Oligonucleotide

[00253] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 51:

(Structure 51) wherein each is a single-stranded oligonucleotide, each ● is a covalent linker joining adjacent single-stranded oligonucleotides, and a is an integer ³ 1, the method comprising the steps of:

(i) reacting

(Structure 52) and (Structure 53), wherein is a linking moiety, R1 is a chemical group capable of reacting with the linking moiety ^u , b and c are each independently an integer ³ 0, b and c cannot both simultaneously be zero, and b + c = a, thereby forming Structure 51 :

(Structure 51), and (ii) optionally annealing Structure 51 :

(Structure 51) with complementary single- stranded oligonucleotides - , thereby forming Structure 54:

(Structure 54).

[00254] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 54:

(Structure 54) wherein each - is a single-stranded oligonucleotide, each · is a covalent linker joining adjacent single-stranded oligonucleotides, and a ³ 1, the method comprising the steps of:

(i) annealing Structure 51 :

(Structure 51) with complementary single- stranded oligonucleotides thereby forming Structure 54:

(Structure 54).

[00255] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 100

(Structure 100), wherein each . is independently a single-stranded oligonucleotide, each is independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the steps of: a) reacting Structure 98

(Structure 98) with Structure

(Structure 99), wherein: a, a’, b, b’, c, c’, d and d’ are each independently 0 or 1, and R₁ and R₂ are chemical moieties capable of reacting directly or indirectly to form a covalent linker ●, thereby forming Structure 100

[00256] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 102

(Structure 102), wherein each - is independently a single- stranded oligonucleotide, each 211111111112 is independently a double-stranded oligonucleotide, each _ is independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure

100

with Structure 101 , wherein: a is 1, and a’, a”, b, b’, b”, c, c’, c”, d, d’, and d” are each independently 0 or 1, thereby forming Structure 102

[00257] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 103

(Structure 103), wherein each - is independently a single-stranded oligonucleotide, each ZZZZG is independently a double-stranded oligonucleotide, each „„„„„„ is independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure

100

with Structure 101 , wherein: a’ is 1 5 and a, a”, b, b’, b”, c, c’, c”, d, d’, and d” are each independently 0 or 1, thereby forming Structure 105

[00258] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 104

(Structure 104), wherein each

is independently a single- stranded oligonucleotide, each

is independently a double-stranded oligonucleotide, each is independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure

103

, and a’ are 1, and a”, a’”, b, b’, b”, b’”, c, c’, c”, c’”, d, d’, d”, and d’” are each independently 0 or 1, thereby forming Structure 104

[00259] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 107

(Structure 107), wherein each

is independently a single-stranded oligonucleotide, each

is independently a double-stranded oligonucleotide, each _ _ is independently a single or double-stranded oligonucleotide, and each » is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure 103

w t tructure , w ere n: a and d” are 1, and a, a”, a’”, b, b’, b”, b”’, c, c’, c”, c”’, d, d’, and d’” are each independently 0 or 1, thereby forming Structure 107

[00260] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Stmcture 108

(Structure 108), wherein each — — — is independently a single- stranded oligonucleotide, each is independently a double-stranded oligonucleotide, each is

independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure

, wherein: a, a’, b, b’, c, c’, d, and d’ are each independently 0 or 1, thereby forming Stmcture 108

[00261] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 111

(Structure 111), wherein each ------ is independently a single-stranded oligonucleotide, each Z is independently a double-stranded oligonucleotide, each ...... is independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure

108

with Structure 1112 wherein: d is l, and a, a’, a”, b, b’, b”, c, c’, c”, d’ and d” are each independently 0 or l, thereby forming Structure 111

[00262] In various aspects, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 113

(Structure 113), wherein each - is independently a single-stranded oligonucleotide, each is independently a double-stranded oligonucleotide, each is

independently a single or double-stranded oligonucleotide, , and each ● is a covalent linker joining adjacent oligonucleotides, the method comprising the step of annealing Structure 108

with Structure 112 , wherein: d’ is 1, and a, a’, a”, b, IV, b”, c, c’, c”, d and d” are each independently 0 or 1, thereby forming Structure 113

[00263] In one aspect, the method further comprises annealing one or more single- stranded oligonucleotides — — with a complementary single-stranded oligonucleotide

- i_n Structure 98 to Structure 113, thereby forming a double-stranded oligonucleotide

.

[00264] In various aspects, the disclosure provides a method of synthesizing a

multimeric oligonucleotide comprising Structure 114

(Structure 114), wherein each is independently a single or double-stranded oligonucleotide, and each ● is a covalent linker joining adjacent oligonucleotides, the

Ri method comprising reacting Structure 115

(Structure 115) with

Structure 116

b (Structure 116), wherein: R1 and R₂ are chemical moieties capable of reacting directly or indirectly to form a covalent linker ●, a and b are each independently an integer ³ 0, with the proviso that the sum of a and b is ³ 4, thereby

forming Structure 114

[00265] In one aspect, Structure 115 and/or Structure 116 further comprise one or more targeting ligands. In an embodiment, the targeting ligand is a terminal targeting ligand.

[00266] In one aspect, a is an integer of 4, 5, 6, 7, 8, 9, or 10. In another aspect, b is an integer of 4, 5, 6, 7, 8, 9, or 10.

[00267] In all of the foregoing manufacturing methods, each

/ and ...... comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue in the CNS; and/or binds to or is active against a biomarker or biomarker precursor whose concentration or activity is higher or lower compared to a healthy cell; and/or binds to or is active against a biomarker or biomarker precursor in a neuron and/or a glial cell; and/or is an oligonucleotide with complementarity to an mRNA that is overexpressed in a CNS cell; and/or is an oligonucleotide that activates expression of an mRNA that is underexpressed in a CNS cell

Subjects

[00268] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof. Examples of subjects include, but are not limited to, mammals, such as primates, rodents, and agricultural animals. Examples of a primate subject includes, but is not limited to, a human, a chimpanzee, and a rhesus monkey. Examples of a rodent subject includes, but is not limited to, a mouse and a rat. Examples of an agricultural animal subject includes, but is not limited to, a cow, a sheep, a lamb, a chicken, and a pig. In certain embodiments, the subject is a human subject with CNS disease or disorder and the subject is administered a therapeutically effective amount of the multimeric oligonucleotide of the disclosure to treat the disease or disorder. In other embodiments, the human subject is administered an effective amount of the multimeric oligonucleotide of the disclosure to prevent or inhibit the CNS disease or disorder. [00269] Mouse glomerular filtration rate (GFR) can be about 0.15-0.25 ml/min. Human GFR can be about 1.8 m!/min/kg (Mahmood I: (1998) Interspecies scaling of renally secreted drugs. Life Sci 63:2365-2371).

[00270] Mice can have about 1.46 ml of blood. Therefore, the time for glomerular filtration of total blood volume in mice can be about 73 minutes (1.46/0.2). Humans can have about 5 liters of blood and weigh about 70 kg. Therefore, the time for glomerular filtration of total blood volume in humans can be 39.7 mins [5000/126(1.8*70)].

[00271] A person of ordinary skill in the art would recognize that different species can have different rates of clearance by glomerular filtration, at least for the above reasons. A person of ordinary skill in the art can infer that a ratio of rate of clearance by glomerular filtration between human and mouse times can be about 1:5 or 1 :6. In other words, the rate of clearance of a certain substance (e.g., a particular oligonucleotide) by humans can be 5-6 times slower than that of a mouse.

[00272] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the in vivo circulation half-life is measured between 30 and 120 minutes after administering the multimeric oligonucleotide to the subject.

[00273] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the predetermined time is between 30 and 120 minutes after administering the multimeric oligonucleotide to the subject.

[00274] In one aspect, the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the area under the curve is calculated based on serum concentration of the multimeric oligonucleotide between x and y minutes after administering the multimeric oligonucleotide to the subject. In some embodiments, x can be 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 75, 90, 120, 180, 240, or 300 minutes and y can be 90, 120, 180, 240, 300, 360, 420, 480, 540, 600, 720, 840, 960, 1080, 1200, 1320, 1440, or 1600 minutes. For example, the time range can be 30-120 minutes, 1-1600 minutes, or 300-600 minutes.

[00275] In one aspect, the disclosure provides a multimeric oligonucleotide or a method for increasing in vivo circulation half-life of the multimeric oligonucleotide, wherein the multimeric oligonucleotide is not formulated in a nanoparticle (NP) or a lipid nanoparticle (LNP).

[00276] The present disclosure also relates to multimeric oligonucleotides having improved pharmacodynamics and/or pharmacokinetics. For example, the multimeric oligonucleotides (e.g., multimeric oligonucleotide including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more siRNA) can have increased in vivo circulation half-life and/or increased in vivo activity, relative to that of the individual monomeric subunits. When conjugated to a targeting ligand, the multimeric oligonucleotide can also deliver a higher oligonucleotide payload per ligand/receptor binding event than the monomeric equivalent. The present disclosure also relates to new synthetic intermediates and methods of synthesizing the multimeric oligonucleotides. The present disclosure also relates to methods of using the multimeric oligonucleotides, for example in reducing gene expression, biological research, treating or preventing medical conditions, and/or to produce new or altered phenotypes

[00277] Various features of the disclosure are discussed, in turn, below.

Nucleic Acids

[00278] In various embodiments, the nucleic acid or oligonucleotide is RNA,

DNA, or comprises an artificial or non-natural nucleic acid analog. In various embodiments, the nucleic acid or oligonucleotide is single-stranded. In various embodiments, the nucleic acid or oligonucleotide is double-stranded (e.g., antiparallel double-stranded).

[00279] In various embodiments, the nucleic acid or oligonucleotide is RNA, for example an antisense RNA (aRNA), CRISPR RNA (crRNA), long noncoding RNA (IncRNA), microRNA (rniRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), messenger RNA (mRNA), short hairpin RNA (shRNA), small activating (saRNA), or ribozyme.

[00280] In one embodiment, the RNA is siRNA. For example, each double- stranded oligonucleotide is an siRNA and/or has a length of 15-30 base pairs.

[00281] In various embodiments, the nucleic acid or oligonucleotide is an aptamer.

[00282] siRNA (small interfering RNA) is a short double-stranded RNA normally composed of 19-22 nucleic acids, the sense strand of which has a nucleic acid sequence identical to that of a region of a target messenger RNA (mRNA) of a gene in order to suppress expression of that gene by decomposing the mRNA (Elbashir, S. M., Harborth, J., Lendeckel, W., Ya!cin, A., Weber, K , and Tuschl, T. (2001) Duplexes of 21- nucleotide RNAs mediate RNA interference in cultured mammalian ceils. Nature 411: 494-8).

[00283] Another class of nucleic acid, useful in the methods of the disclosure, are miRNAs. MiRNAs are non-coding RNAs that play key roles in post-transcriptional gene regulation. miRNA can regulate the expression of 30 % of all mammalian protein- encoding genes. Specific and potent gene silencing by double-stranded RNA (RNAi) was discovered, plus additional small noncoding RNA (Canver, M.C. et ah, Nature (2015)). Pre-miRNAs are short stem loops ~70 nucleotides in length with a 2-nucleotide 3'- overhang that are exported, into the mature 19-25 nucleotide duplexes. The miRNA strand with lower base pairing stability (the guide strand) can be loaded onto the RNA- induced silencing complex (RISC). The passenger guide strand can be functional but is usually degraded. The mature miRNA tethers RISC to partly complementary sequence motifs in target mRNAs predominantly found within the 3’ untranslated regions (UTRs) and induces posttranscriptional gene silencing (Bartel, D.P. Cell, 136: 215-233 (2009); Saj, A. & Lai, E.C. Curr Opin Genet Dev, 21: 504-510 (2011)). MiRNAs mimics are described for example, in US Patent No. 8,765,709.

[00284] In some embodiments, the RNA can be short hairpin RNA (shRNA), for example, as described in US Patent Nos. 8,202,846 and 8,383,599

[00285] In some embodiments, the RNA can be CRISPR RNA (crRNA), for example, CRISPR array of Type V can be processed into short mature crRNAs of 42-44 nucleotides in length, with each mature crRNA beginning with 19 nucleotides of direct repeat followed by 23-25 nucleotides of spacer sequence. Alternatively, mature crRNAs in Type II systems can start with 20-24 nucleotides of spacer sequence followed by about 22 nucleotides of direct repeat. CRISPR systems are described for example, in US Patent No. 8,771,945, Jinek et ah, Science, 337(6096): 816-821 (2012), and International Patent Application Publication No. WO 2013/176772.

[00286] In various embodiments, the nucleic acid or oligonucleotide is 15-30, 17- 27, 19-26, 20-25, 40-50, 40-150, 100-300, 1000-2000, or up to 10000 nucleotides in length.

[00287] In various embodiments, the oligonucleotide is double- stranded and complementary. Complementarity can be 100 % complementary, or less than 100 % complementary where the oligonucleotide nevertheless hybridizes and remains double- stranded under relevant conditions (e.g., physiologically relevant conditions). For example, a double-stranded oligonucleotide can be at least about 80, 85, 90, or 95 % complementary.

[00288] In some embodiments, RNA is long noncoding RNA (IncRNA), IncRNAs are a large and diverse class of transcribed RNA molecules with a length of more than 200 nucleotides that do not encode proteins. IncRNAs are thought to encompass nearly 30,000 different transcripts in humans, hence IncRNA transcripts account for the major part of the non-coding transcriptome (see, e.g., Derrien et al ., The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression. Genome Res, 22(9): 1775-89 (2012)).

[00289] In yet other embodiments, RNA is messenger RNA (mRNA). mRNA and its application as a delivery method for in-vivo production of proteins, is described, for example, in International Patent Application Publication No. WO 2013/151736.

[00290] In other embodiments, RNA can be small activating (saRNA) (e.g., as described in Chappell et al.. Nature Chemical Biology, 11: 214-220 (2015)), or ribozyme (Doherty et al., Ann Rev Biophys Biomo Struct, 30: 457-475 (2001)).

[00291] In some embodiments, the nucleic acid or oligonucleotide is DNA, for example an antisense DNA (aDNA) (e.g., antagomir) or antisense gapmer. Examples of aDNA, including gapmers and multi mers, are described for example in Subramanian et al, Nucleic Acids Res, 43(19): 9123-9132 (2015) and International Patent Application Publication No. WO 2013/040429. Examples of antagomirs are described for example, in US Patent No. 7,232,806.

[00292] In various embodiments, the oligonucleotide has a specific sequence, for example any one of the sequences disclosed herein.

[00293] A general procedure for oligonucleotide synthesis is provided in the examples below. Other methods that can be adapted for use with the disclosure are known in the art.

Modifications to Nucleic Acids

[00294] In various embodiments, the nucleic acid or oligonucleotide further comprises a chemical modification. The chemical modification can comprise a modified nucleoside, modified backbone, modified sugar, or modified terminus. [00295] Modifications include phosphorus-containing linkages, which include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3’alkylene phosphonates and chiral phosphonates, phosphinates, phosphorami dates comprising 3 ’-amino phosphoramidate and aminoaikyiphosphoramidates, thionophosphoramidates, thionoalkyiphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’.

[00296] In various embodiments, the oligonucleotides contained in the multimeric oligonucleotide may comprise one or more phosphorothioate groups. The oligonucleotides may comprise 1-3 phosphorothioate groups at the 5’ end. The oligonucleotides may comprise 1-3 phosphorothioate groups at the 3’ end. The oligonucleotides may comprise 1-3 phosphorothioate groups at the 5’ end and the 3’ end. In various embodiments, each oligonucleotide contained in the mu!timer may comprise 1- 10 total phosphorothioate groups. In certain embodiments, each oligonucleotide may comprise fewer than 10, fewer than 9, fewer than 8, fewer than 7, fewer than 6, fewer than 5, fewer than 4, or fewer than 3 total phosphorothioate groups. In certain embodiments, the oligonucleotides contained in the multimer may possess increased in vivo activity with fewer phosphorothioate groups relative to the same oligonucleotides in monomeric form with more phosphorothioate groups.

[00297] The oligonucleotides contained in the multimeric oligonucleotides of this disclosure may be modified using various strategies known in the art to produce a variety of effects, including, e.g., improved potency and stability in vitro and in vivo. Among these strategies are: artificial nucleic acids, e.g., 2’-0-methyl-substituted RNA; 2’-fluro- 2’deoxy RNA, peptide nucleic acid (PNA); morpholinos; locked nucleic acid (LNA); Unlocked nucleic acids (UNA); bridged nucleic acid (BNA); glycol nucleic acid (GNA) ; and threose nucleic acid (TNA); or more generally, nucleic acid analogs, e.g., bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA but have alterations in one or more of the phosphate backbone, sugar, or nucleobase portions of the naturally-occurring molecule. Typically, analogue nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases, which can pair with all four canon bases. Examples of phosphate-sugar backbone analogues include PNA. Morpholino-based oligomeric compounds are described in Braasch et al, Biochemistry, 41(14): 4503-4510 (2002) and US Patent Nos. 5,539,082; 5,714,331; 5,719,262; and 5,034,506.

[00298] In the manufacturing methods described herein, some of the oligonucleotides are modified at a terminal end by substitution with a chemical functional group. The substitution can be performed at the 3’ or 5’ end of the oligonucleotide, and is preferably performed at the 3’ ends of both the sense and antisense strands of the monomer, but is not always limited thereto. The chemical functional groups may include, e.g , a sulfhydryl group (-SH), a carboxyl group (-COOH), an amine group (-NH2), a hydroxy group (-OH), a formyl group (-CHO), a carbonyl group (-CO-), an ether group (- O ), an ester group (-COO-), a nitro group (-NO_2.), an azide group (-N₃), or a sulfonic acid group (-SO₃H).

[00299] The oligonucleotides contained in the multimeric oligonucleotides of this disclosure may be modified to also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. Modified nuc!eobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5 -Me pyrimidines, particularly 5- methylcytosine (also referred to as 5-methyl-2’ deoxyeytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosy! HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2- (imidazolylaJkyJ)adenine, 2-(aminoalklyamino)adenine or other heterosub stituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluradl, 8- azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, and 2,6-diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, pp 75-77 (1980); Gebeyehu et al, Nucl. Acids Res, 15: 4513 (1997). A “universal” base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1 2 °C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, pp 276-278 (1993) and are aspects of base substitutions. Modified nucleobases can include other synthetic and natural nucleobases, such as 5 -methyl cytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2- thiouraeii, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8- halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-m ethyl adenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Hydroxy group ( — OH) at a terminus of the nucleic acid can be substituted with a functional group such as sulfhydryl group (- — SH), carboxyl group ( — COOH) or amine group (---NH₂). The substitution can be performed at the 3’ end or the 5’ end.

Linkers

[00300] In various aspect and embodiments of the disclosure, one or more oligonucleotides may be conjugated to one or more additional oligonucleotides or targeting ligands. The oligonucleotides and targeting ligands may be conjugated via any means known in the art, including, but is not limited to, covalent bonds, ionic bonds, hydrogen bonds, and magnetic linkage.

[00301] In various aspects and embodiments of the disclosure, oligonucleotides are linked covalently. Linkers may be cleavable (e.g., under intracellular conditions, to facilitate oligonucleotide delivery and/or action) or non-cleavable. Although generally described below and in the Examples in the context of linkers using nucleophile- electrophile chemistry', other chemistries and configurations are possible. And, as will be understood by those having ordinary skill, various linkers, including their composition, synthesis, and use are known in the art and may be adapted for use with the di sclosure.

[00302] In various embodiments, a covalent linker can comprise the reaction product of nucleophilic and electrophilic groups. For example, a covalent linker can comprise the reaction product of a thiol and maleimide, a thiol and vinylsulfone, a thiol and pyridyldisulfide, a thiol and iodoacetamide, a thiol and acrylate, an azide and aikyne, or an amine and carboxyl group. As described herein, one of these groups is connected to an oligonucleotide (e.g., thiol (-SH) functionalization at the 3’ or 5’ end) and the other group is encompassed by a second molecule (e.g., linking agent) that ultimately links two oligonucleotides (e.g., maleimide in DTME).

[00303] In various embodiments, a covalent linker can comprise an unmodified di nucleotide linkage or a reaction product of thiol and maleimide. [00304] In various embodiments, a covalent linker can comprise a nucleotide linker of 2-6 nucleotides in length.

[00305] In various embodiments, a covalent linker can comprise a disulfide bond or a compound of Formula (I):

wherein:

S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each R1 is independently a C₂-C₁₀ alkyl, alkoxy, or aryl group, R₂ is a thiopropionate or disulfide group, and each X is independently selected from:

[00306] In certain embodiments, the compound of Formula (I) is

[00307] In certain embodiments, the compound of Formula (I) is

[00308] In certain embodiments, the compound of Formula (I) is

wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit. [00309] In various embodiments, the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (II):

each R1 is independently a C2-C10 alkyl, alkoxy, or aryl group; and R2 is a thiopropionate or disulfide group.

[00310] In various embodiments, two or more linkers of a multimeric oligonucleotide can comprise two orthogonal types of bio-cleavable linkages. In a preferred embodiment, the two orthogonal bio-cleavable linkages can comprise an unmodified di-nucleotide and a reaction product of thiol and maleimide.

[00311] In various embodiments, the nucleic acid or oligonucleotide is connected to the linker via a phosphodiester or thiophosphodiester (e.g., R1 in Structure 1 recited below is a phosphodiester or thiophosphodiester). In various embodiments, the nucleic acid or oligonucleotide is connected to the linker via a C1-8 alkyl, C2-8 alkenyl, C2-8 aikyny!, heterocycly!, aryl, and heteroaryl, branched alkyl, aryl, halo-aryl, and/or other carbon-based connectors. In various embodiments, the nucleic acid or oligonucleotide is connected to the linker via a C2-C10 , C3-C6, or C6 alkyl (e.g., R₂ in Structure 1 recited below is a C₂-C₁₀ , C3-C6, or C6 alkyl). In a preferred embodiment, the nucleic acid or oligonucleotide is connected to the linker via a C6 alkyl. Alternatively, these moieties (e.g , R1 and/or R2 in Structure l recited below) are optional and a direct linkage is possible.

[00312] In various embodiments, the nucleic acid or oligonucleotide is connected to the linker via the reaction product of a thiol and maleimide group (e.g., A in Structure 1 is the reaction product of a thiol and maleimide group). Preferred linking agents utilizing such chemistry include DTME (dithiobismaleimidoethane), BM(PEG)2 (1,8- bis(maleimido)di ethylene glycol), BM(PEG)3 (1,11 -bismaleimido-tri ethyleneglycol), BMOE (bismaleimidoethane), BMH (bismaleimidohexane), or BMB (1,4- bismaleimidobutane).

[00313] Again, the Examples are illustrative and not limiting. In various embodiments, oligonucleotides can be linked together directly, via functional end- substitutions, or indirectly by way of a linking agent. In various embodiments, the oligonucleotide can be bound directly to a linker (e.g., R1 and R₂ of Structure 1 are absent). Such bonding can be achieved, for example, through use of 3’-thionucleosides, which can be prepared according to the ordinary skill in the art. See, e.g., Sun et al. “Synthesis of 3’-thioribonucleosides and their incorporation into oligoribonucleotides via phosphoramidite chemistry” RNA. 1997 Nov;3(ll): 1352-63. In various embodiments, the linking agent may be a non-ionic hydrophilic polymer such as polyethyleneglycol (PEG), polyvinylpyrolidone and polyoxazoline, or a hydrophobic polymer such as PLGA and PL A.

[00314] A polymer linking agent used as a mediator for a covalent bond may be non-ionic hydrophilic polymers including PEG, Pluronic, polyvinylpyrolidone, polyoxazoline, or copolymers thereof; or one or more biocleavable polyester polymers including poly-L-lactic acid, poly-D-lactic acid, poly-D,L-lactic acid, poly-glycolic acid, poly-D-lactic-co-glycolic acid, poly-L-lactic-co-glycoJic acid, poly-D,L-lactic-co- glycolic acid, poiycaprolactone, polyvaierolactone, polyhydroxybutyrate, po!yhydroxyvalerate, or copolymers thereof, but is not always limited thereto.

[00315] The linking agent may have a molecular weight of 100-10,000 Daltons. Examples of such linking agent include dithio-bis-maleimidoethane (DIME), 1,8-bis- maleimidodiethyleneglycol (BM(PEG)2), tris-(2-maleimidoethyl)-amine (TMEA), tri- succinimidyl ami notriacetate (TSAT), 3-arm-poly(ethylene glycol) (3 -arm PEG), maleimide, N-hydroxysuccinimide (NHS), vinyl sulfone, iodoacetyl, nitrophenyl azide, isocyanate, pyridyldisulfide, hydrazide, and hydroxyphenyl azide

[00316] A linking agent having cleavable bonds (such as a reductant bond that is cleaved by the chemical environment of the cytosol) or a linking agent having non- cleavable bonds can be used herein. For example, the linking agent of the foregoing aspects of present disclosure can have non-cleavable bonds such as an amide bond or a urethane bond. Alternatively, the linking agent of the foregoing aspects of the present disclosure can have cleavable bonds such as an acid cleavable bond (e.g., a covalent bond of ester, hydrazone, or acetal), a reductant cleavable bond (e.g., a disulfide bond), a bio cleavable bond, or an enzyme cleavable bond (e.g., a peptide bond). In one embodiment, the cleavable covalent linker is cleavable under intracellular conditions. Additionally, any linking agent available for drug modification can be used in the foregoing aspects of the disclosure without limitation. [00317] Further, combinations of functional groups and linking agents may include: (a) where the functional groups are amino and thiol, the linking agent may be Succinimidyl 3-(2-pyridyldithio)propionate, or Succinimydyl 6-([3(2- pyiidyldithio)propioamido]hexanoate; (b) where the functional group is amino, the linking agent may be 3,3’dithiodipropionic acid di-(N-succinimidyl ester), Dithio- bisfethyl lH-imidazole-1-carboxylate), or Dithio-bis(ethyl lH-imidazole-l-carboxylate); (c) where the functional groups are amino and alkyne, the linking agent may be Sulfo-N- succinimidyl3-[[2-(p-azidosalicylamido)ethyl]-1,3'-dithio]propionate; and (d) where the functional group y is thiol, the linking agent is dithio-bis-maleimidoethane (DTME); 1,8- Bis-maleimidodiethyleneglycol (BM(PEG)2); or dithiobisfsulfosuccinimidyl propionate) (DTSSP).

[00318] In the foregoing methods of preparing compounds, an additional step of activating the functional groups can be included. Compounds that can be used in the activation of the functional groups include but are not limited to 1 -ethyl-3, 3- dimethy!aminopropyl carbodiimide, imidazole, N-hydroxysuccinimide, dichlorohexylcarbodiimide, N-beta-Maleimidopropionic acid, N-beta-maleimidopropyl succinimide ester or N-Succinimidyi 3-(2-pyridyldithio)propionate.

Monomeric Intermediate Compounds

[00319] In various aspects, the disclosure provides an oligonucleotide coupled to a covalent linker, which can be used, for example, in the synthesis of multimeric oligonucleotides having predetermined sizes and compositions.

[00320] In one aspect, the disclosure provides a compound according to Structure

1:

X - R 1 - R₂ - A - R3 - B (Structure 1 ) wherein:

X is a nucleic acid bonded to R1 through its 3’ or 5’ terminus;

Rl is a derivative of phosphoric acid, a derivative of thiophosphoric acid, a sulfate, amide, glycol, or is absent; R2 is a C2-C10 alkyl, alkoxy, or aryl group, or is absent;

A is the reaction product of a nucleophile and an electrophile;

R3 is a C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide; and B is a nucleophile or electrophile (e.g., a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group).

[00321] In one aspect, the disclosure provides a compound according to Structure

2:

(Structure 2) wherein:

X is a nucleic acid bonded to R1 via a phosphate or derivative thereof, or thiophosphate or derivative thereof at its 3’ or 5’ terminus; each III is independently a C2-C10 alkyl, alkoxy, or aryl group; and R2 is a thiopropionate or disulfide group.

[00322] In one aspect, the disclosure provides a compound according to Structure 3:

X - R1 - R2 - A - R3 - B (Structure 3) wherein:

X is a nucleic acid bonded to R1 through its 3’ or 5’ terminus; R1 is a derivative of phosphoric acid such as phosphate, phosphodiester, phosphotriester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like, a sulfate, amide, glycol, or is absent; R2 is a C2-C10 alkyl, alkoxy, or aryl group, or is absent;

A is the reaction product of a first and a second reactive moiety,

R3 is an C2-C10 alkyl, alkoxy, aryl, alkyl dithio group, ether, thioether, thiopropionate, or disulfide; and

B is a third reactive moiety.

[00323] In various aspects, the disclosure also provides methods for synthesizing an oligonucleotide coupled to a covalent linker. [00324] In one aspect, the disclosure provides a method for synthesizing a compound according to Structure I (or adapted for synthesizing a compounds according to Structure 2 or 3), the method comprising: reacting a functionalized nucleic acid X - R1 - R2 - A' and a covalent linker A" - R3 - B, wherein A' and A" comprise a nucleophile and an electrophile, in a dilute solution of X - R1 - R2 - A' and with a stoichiometric excess of A" - R3 - B, thereby forming the compound X - R1 - R2 - A - R3 - B (Structure 1), wherein:

X is a nucleic acid bonded to R1 through its 3’ or 5' terminus;

Rl a phosphodiester, thiophosphodiester, sulfate, amide, glycol, or is absent; R2 is a C2-C10 alkyl, alkoxy, or aryl group, or is absent;

A is the reaction product of a nucleophile and an electrophile;

R3 is a C2-C10 alkyl, alkoxy, aryl, alkyl dithio group, ether, thioether, thiopropionate, or disulfide, and

B is a nucleophile or electrophile (e.g., a thiol, maleimide, vinyJsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group).

[00325] The method can further comprise the step of synthesizing the functionalized nucleic acid X - R1 - R2 - A', wherein A' comprises a thiol (-SH) by (i) introducing the thiol during solid phase synthesis of the nucleic acid using phosphoramidite oligomerization chemistry or (ii) reduction of a disulfide introduced during the solid phase synthesis.

[00326] In various embodiments, the method for synthesizing the compound of Structure 1 further comprises synthesizing the compound of Structure 2.

[00327] The oligonucleotide coupled to a covalent linker can include any one or more of the features described herein, including in the Examples. For example, the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples. Example 1 provides an example methodology for generating thiol terminated oligonucleotides. Example 2 provides an example methodology for preparing an oligonucleotide coupled to a linker.

[00328] In various embodiments, the method for synthesizing the compound of Structure 1, 2 or 3 is carried out under conditions that substantially favor the formation of Structure 1, 2 or 3 and substantially prevent dimerization of X. The conditions can improve the yield of the reaction (e.g., improve the purity of the product).

[00329] In various embodiments, the method for synthesizing the compound of Structure 1, 2 or 3, the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A" - R3 - B is carried out at a X - R1 - R2 - A' concentration of below about 1 niM, 500 mM, 250 mM, 100 mM, or 50 mM. Alternatively, the X - R1 - R2 - A' concentration can be about 1 mM, 500 mM, 250 mM, 100 mM, or 50 mM

[00330] In various embodiments, the method for synthesizing the compound of Structure 1, 2 or 3, the step of reacting the functionalized nucleic acid X - R1 - R2 - A and the covalent linker A" - R3 - B is carried out with a molar excess of A" - R3 - B of at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 100. Alternatively, the molar excess of A" - R3 - B can be about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 100.

[00331] In various embodiments, the method for synthesizing the compound of Structure 1, 2 or 3, the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A" - R3 - B is carried out at a pH of below about 7, 6, 5, or 4. Alternatively, the pH can be about 7, 6, 5, or 4.

[00332] In various embodiments, the method for synthesizing the compound of Structure 1, 2 or 3, the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A" - R3 - B is carried out in a solution comprising water and a water miscible organic co-solvent. The water miscible organic co-solvent can comprise DMF (dimethylformamide), NMP (N-methyl-2-pyrrolidone), DMSO (dimethyl sulfoxide), or acetonitrile. The water miscible organic co-solvent can comprise about 10, 15, 20, 25, 30, 40, or 50 %V (v/v) of the solution.

[00333] In various embodiments, the compound is isolated or substantially pure. For example, the compound can be at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure. In one embodiment, the compound is about 85-95 % pure. Likewise, the methods for synthesizing the compounds and compositions according to the disclosure can result in a product that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure. In one embodiment, the product is about 85-95 % pure. Preparations can be greater than or equal to 50 % pure; preferably greater than or equal to 75 % pure; more preferably greater than or equal to 85 % pure; and still more preferably, greater than or equal to 95 % pure. [00334] As used herein, the term about is used in accordance with its plain and ordinary meaning of approximately. For example, “about X” encompasses approximately the value X as stated, including similar amounts that are within the measurement error for the value of X or amounts that are approximately the same as X and have essentially the same properties as X.

[00335] As used herein, isolated includes compounds that are separated from other, unwanted substances. The isolated compound can be synthesized in a substantially pure state or separated from the other components of a crude reaction mixture, except that some amount of impurities, including residual amounts of other components of the crude reaction mixture, may remain. Similarly, pure or substantially pure means sufficiently free from impurities to permit its intended use (e.g , in a pharmaceutical formulation or as a material for a subsequent chemical reaction). X % pure means that the compound is X % of the overall composition by relevant measure, which can be for example by analytical methods such as HPLC.

Dimeric Compounds and Intermediates

[00336] In various aspects, the disclosure provides dimeric oligonucleotides. These compounds include homodimers (e.g , two oligonucleotides that are substantially the same, for example targeting the same gene in vivo) and heterodimers (e.g., two oligonucleotides that are substantially different, for example different sequences or targeting different genes in vivo)

[00337] In one aspect, the disclosure provides an isolated compound according to Structure 4: (Structure 4)

wherein: each _ is a double-stranded oligonucleotide designed to react with the same molecular target in vivo , and

• is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, and having the structure - R1 - R2 - A - R3 - A - R2 - R1 - wherein: each R1 is a derivative of phosphoric acid such as phosphate, phosphodiester, phosphotri ester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like, a sulfate, amide, glycol, or is absent; each R2 is independently a C2-C10 alkyl, alkoxy, or aryl group, or is absent; each A is independently the reaction product of a nucleophile and an electrophile, and

R3 is a C2-C10 alkyl, alkoxy, aryl, alkyl dithio group, ether, thioether, thiopropionate, or disulfide

[00338] In one aspect, the disclosure provides an isolated compound according to Structure 5: (Structure 5)

wherein: is a first single-stranded oligonucleotide

is a second single-stranded oligonucleotide having a different sequence from the first, and

• is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, and having the structure - R1 - R2 - A - R3 - A - R2 - R1 - wherein: each R1 is a derivative of phosphoric acid such as phosphate, phosphodi ester, phosphotriester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like, a sulfate, amide, glycol, or is absent; each R2 is independently a C2-C10 alkyl, alkoxy, or aryl group, or is absent; each A is independently the reaction product of a thiol and maleimide, a thiol and vinylsulfone, a thiol and pyridyl disulfide, a thiol and iodoacetamide, a thiol and acrylate, an azide and alkyne, or an amine and carboxyl group, and

R3 is an C2-C10 alkyl, alkoxy, aryl, alkyl dithio group, ether, thioether, thiopropionate, or disulfide

[00339] In one aspect, the disclosure provides an isolated compound according to

Structure 6:

(Structure 6) wherein: is a first double-stranded oligonucleotide

is a second double-stranded oligonucleotide having a different sequence from the

first, and

• is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, and having the structure - R1 - R2 - A - R3 - A - R2 - R1 - wherein: each R1 is a derivative of phosphoric acid such as phosphate, phosphodi ester, phosphotri ester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotri ester, thiophosphoramidate and the like, a sulfate, amide, glycol, or is absent; each R2 is independently a C2-C10 alkyl, alkoxy, or aryl group, or is absent; each A is independently the reaction product of a thiol and maleimide, a thiol and vinylsu!fone, a thiol and pyridyldisulfide, a thiol and iodoacetamide, a thiol and acrylate, an azide and alkyne, or an amine and carboxyl group, and

R3 is an C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide.

[00340] In one aspect, the disclosure provides an isolated compound according to Structure 11 :

(Structure 11) wherein: is a double-stranded oligonucleotide,

is a single-stranded oligonucleotide, and

• is a covalent linker joining single strands of adjacent single-stranded oligonucleotides.

[00341] In various aspects, the disclosure provides methods for synthesizing dimeric oligonucleotides.

[00342] In one aspect, the disclosure provides a method for synthesizing a compound of Structure 5 :

(Structure 5) wherein . is a first single-stranded oligonucleotide,

is a second single- stranded oligonucleotide having a different sequence from the first, and ● is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, the method compri sing the steps of: (i) reacting a first single-stranded oligonucleotide

R₁ with a bifunctional linking moiety °, wherein R1 is a chemical group capable of reacting with

under conditions that produce the mono-substituted product

;

(ii) reacting with a second single-stranded oligonucleotide

wherein R2 is a chemical group capable of reacting with

, thereby forming

[00343] The method can further comprise the step of annealing complementary

and L

to yield Structure 6:

(Structure 6).

[00344] In one aspect, the disclosure provides a method for synthesizing an isolated compound of Structure 4:

(Structure 4) wherein each - is a double-stranded oligonucleotide and · is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, the method comprising the steps of:

(i) reacting a first single-stranded oligonucleotide

with a bifunctional linking moiety O, wherein R1 is a chemical group capable of reacting with®, thereby forming a mono-substituted product

;

(ii) reacting with a second single-stranded oligonucleotide

, wherein R2 is a chemical group capable of reacting with ° , thereby forming a single-stranded dimer ,

(iii) annealing single-stranded oligonucleotides, at the same time or sequentially, thereby forming

[00345] In one aspect, the disclosure provides a method for synthesizing an isolated compound of Structure 4:

- (Structure 4) wherein each

is a double-stranded oligonucleotide and ● is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, the method comprising the steps of:

(i) forming

by:

(a) annealing a first single-stranded oligonucleotide

and a second single- stranded oligonucleotide

, thereby forming , and reacting with a third single-stranded oligonucleotide wherein R1 and R2 are chemical

moieties capable of reacting directly or indirectly to form a covalent linker ·, thereby forming ; or

(b) reacting the second single-stranded oligonucleotide

and the third single-stranded oligonucleotide , thereby forming nd

annealing the first single-stranded oligonucleotide - an

, thereby forming

(ii) annealing

a fourth single- stranded oligonucleotid

thereby forming

.

[00346] This methodology can be adapted for synthesizing an isolated compound according to

(Structure 11), for example by omitting step (ii).

[00347] In one aspect, the disclosure provides a method for synthesizing an

isolated compound of Structure 4: (Structure 4) wherein each

is a double-stranded oligonucleotide and * is a covalent linker joining single strands of adjacent single-stranded oligonucleotides at their 3’ or 5’ termini, the method comprising the steps of:

(a) annealing a first single-stranded oligonucleotide - and a second single- stranded oligonucleotide

, thereby forming

(b) annealing a third single-stranded oligonucleotide

and _a fourth single-stranded oligonucleotide - . thereby forming

;

(c) reacting

_ancj R₂ wherein Ill and R2 are chemical moieties capable of reacting directly or indirectly to form a covalent linker ·, thereby forming

[00348] As with the other compounds and compositions according to the disclosure, dimeric compounds and intermediates can include any one or more of the features described herein, including in the Examples. For example, the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples.

[00349] Example 3 provides an example methodology for preparing dimerized oligonucleotides and Example 4 provides an example methodology for annealing single- stranded oligonucleotides to form double-stranded oligonucleotides. [00350] In various embodiments, R1, R2 , and the bifunctional linking moiety ° can form a covalent linker * as described and shown herein. For example, in various embodiments, R1 and R2 can each independently comprise a reactive moiety, for example an electrophile or nucleophile. In one embodiment, R1 and R2 can each independently be selected from the group consisting of a thiol, maieimide, vinylsulfone, pyiidyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, and carboxyl group. In various embodiments, the bifunctionai linking moiety O comprises two reactive moieties that can be sequentially reacted according to steps (i) and (ii) above, for example a second electrophile/nucleophile that can be reacted with an electrophile/nucleophile in R1 and R2. Examples of bifunctionai linking moieties include, but are not limited to, DIME, BM(PEG)2, BM(PEG)3, BMQE, BMH, or BMB.

[00351] These, as well as all other synthetic methods of the disclosure, can further comprise the step of adding a targeting ligand to the molecule. Example 6 provides an example methodology for adding a targeting ligand. Additional methods for adding targeting ligands are known in the art and can be adapted for the present disclosure by those skilled in the art.

Multimeric Compounds and Intermediates

[00352] In various aspects, the disclosure provides multimeric (n³2) oligonucleotides, including defined tri -conjugates and defined tetra-conjugates.

[00353] In one aspect, the disclosure provides a compound according to Structure 7 or 8:

(Structure 8) wherein: each - is a double-stranded oligonucleotide, each · is a covalent linker joining single strands of adjacent single- stranded oligonucleotides, and m is an integer ³ 1 and n is an integer ³ 0.

[00354] In one aspect, the disclosure provides a compound according to Structure 12, 13, 14, or 15:

(Structure 15) wherein: each is a double-stranded oligonucleotide, each

is a single- stranded oligonucleotide, each · is a covalent linker joining single strands of adjacent single-stranded oligonucleotides, and m is an integer ³ 1 and n is an integer ³ 0.

[00355] In various aspects, the disclosure provides methods for synthesizing multimeric (n³2) defined multi -conjugate oligonucleotides, including defined tri- conjugates and defined tetra-conjugates.

[00356] In one aspect, the disclosure provides a method for synthesizing a compound according to Structure 7 or 8:

(Structure 8) wherein: each is a double-stranded oligonucleotide, each ● is a covalent linker

joining single strands of adjacent single-stranded oligonucleotides, and m is an integer ³ 1 and n is an integer ³ 0, the method comprising the steps of:

(i) forming by:

, thereby forming

and reacting

with a third single-stranded oligonucleotide

, wherein R1 and R2 are chemical moieties capable of reacting directly or indirectly to form a covalent linker ●, thereby forming

; or (b) reacting the second single-stranded oligonucleotide

and the third single-stranded oligonucleotide

thereby forming

, and annealing the first single-stranded oligonucleotide and thereby

forming

(ii) annealing

a second single- stranded dimer

thereby forming

and, optionally, annealing one or more additional single-stranded dimers

to

thereby forming,

wherein m is an integer ³ 1 and n is an integer ³ 0, and

(iii) annealing a fourth single-stranded oligonucleotide to the product of step (ii), thereby forming structure 7 or 8.

[00357] In one aspect, the disclosure provides a method for synthesizing a compound according to Structure 7 or 8:

(Structure 8) wherein: each is a double-stranded oligonucleotide, each ● is a covalent linker joining single strands of adjacent single-stranded oligonucleotides, and m is an integer ³ 1 and n is an integer ³ 0, the method comprising the steps of:

(i) annealing a first single-stranded oligonucleotide . and a first single-stranded dimer

, thereby forming

(ii) annealing

a second single-stranded dimer

- thereby forming

and, optionally, annealing one or more additional

- - single-stranded dimers to — thereby forming,

wherein m is an integer ³ 1 and n is an integer ³ 0; and (iii) annealing a second single-stranded oligonucleotide

to the product of step (ii), thereby forming structure 7 or 8. [00358] In one aspect the disclosure provides a method for synthesizing a compound of

Structure 9:

(Structure 9), wherein each

is a double-stranded oligonucleotide, each ● is a covalent linker joining single strands of adjacent single-stranded oligonucleotides, the method comprising the steps of:

(i) forming

by:

(a) annealing a first single-stranded oligonucleotide

a second single-stranded oligonucleotide

, thereby forming

, and reacting with a third

single-stranded oligonucleotide

, wherein R1 and R2 are chemical moieties capable of reacting directly or indirectly" to form a covalent linker ·, thereby forming ; or

(b) reacting the second single-stranded oligonucleotide

and the third single-stranded oligonucleotide thereby" forming -

, and annealing the first single-

stranded oligonucleotide

and , thereby_" forming

gle-stranded dimer {hereby forming

(iii) annealing

and a fourth single-stranded oligonucleotide

thereby_" forming

[00359] In one aspect, the disclosure provides a method for synthesizing a compound of Structure 10: - (Structure 10), wherein each

is a double-stranded oligonucleotide, each ● is a covalent linker joining single strands of adjacent single-stranded oligonucleotides, the method comprising the steps of: (i) forming -

* by:

_ thereby forming i , and reacting

^Ri

with a third single-stranded oligonucleotide

, wherein RI and R2 are chemical moieties capable of reacting directly or indirectly to form a covalent linker ● , thereby forming

· ; or

(b) reacting the second single-stranded oligonucleotide

and the third single- stranded oligonucleotide

. thereby forming - ● - , and annealing the first single-stranded oligonucleotide thereby forming

(ii) annealing and a single-stranded dimer

, thereby forming

(iii) annealing

and a second single-stranded dimer

, thereby forming

- - -.

(iv) annealing

and a fourth single-stranded oligonucleotide , thereby forming

As with the other compounds and compositions according to the disclosure, dimeric compounds and intermediates can include any one or more of the features described herein, including in the Examples. For example, the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples.

[00360] Example 7 provides an example methodology for preparing various oligonucleotide precursors useful in the syntheses above. Example 7 provides an example methodology for preparing various oligonucleotide rnul timers, which are also useful in the syntheses above.

[00361] In various embodiments, R1, R2, and the bifunctional linking moiety ® can form a covalent linker * as described and shown herein. For example, in various embodiments, R1 and R2 can each independently comprise a reactive moiety, for example an electrophile or nucleophile. In one embodiment, R1 and R2 can each independently be selected from the group consisting of a thiol, maleimide, vinylsulfone, pyridyl disulfide, iodoacetamide, acrylate, azide, alkyne, amine, and carboxyl group. In various embodiments, the bifunctional linking moiety O comprises two reactive moieties that can be sequentially reacted according to steps (i) and (ii) above, for example a second electrophile/nucleophile that can be reacted with an electrophile/nucleophile in R1 and R2. Examples of bifunctional linking moieties ⁰ include, but are not limited to, DTME, BM(PEG)2, BM(PEG)3, BMOE, BMH, or BMB.

[00362] In various embodiments comprising two or more covalent linkers · (e.g., in Structures 7-16), the linkers are all the same. Alternatively, the compound or composition can comprise two or more different covalent linkers · . [00363] In various embodiments, each - · - may independently comprise two sense or two antisense oligonucleotides. For example, in the case of siRNA, a -

may comprise two active strands or two passenger strands.

[00364] In various embodiments, each

may independently comprise one sense and one antisense oligonucleotide. For example, in the case of siRNA, a

may comprise one active strand and one passenger strand.

[00365] In various embodiments, the compound or composition comprises a homo- multimer of substantially identical double-stranded oligonucleotides. The substantially identical double-stranded oligonucleotides can each comprise an siRNA targeting the same molecular target in vivo.

[00366] In various embodiments, the compound or composition comprises a hetero-multimer of two or more substantially different double-stranded oligonucleotides. The substantially different double-stranded oligonucleotides can each comprise an siRNA targeting different genes.

Oligonucleotides Having increased Circulation Half-Life and/or Activity in vivo

[00367] The disclosure provides multimeric oligonucleotides having increased circulation half-life and/or activity in vivo , as well as compositions including the multimeric oligonucleotides and methods for their synthesis and use.

[00368] In various aspects, the disclosure provides a multimeric oligonucleotide comprising Structure 21:

(Structure 21) wherein each monomeric subunit . is independently a single or double-stranded oligonucleotide, each · is a covalent linker joining adjacent monomeric subunits

. , and m is an integer ³ 0 selected to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits

. and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits - wherein each subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

[00369] In various aspects, the disclosure provides a method for increasing in vivo circulation half-life and/or in vivo activity of one or more oligonucleotides, the method comprising administering to a subject the one or more oligonucleotides in the form of a multimeric oligonucleotide comprising Structure 21:

(Structure 21) wherein each monomeric subunit . is independently a single or double- stranded oligonucleotide, each ● is a covalent linker joining adjacent monomeric subunits - , and m is an integer ³ 0 selected to (a) increase in vivo circulation half- life of the multimeric oligonucleotide relative to that of the individual monomeric subunits .. and/or (h) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits . .

[00370] In various embodiments, the increase is relative to the circulation half-life and/or activity of a monomeric subunit of the multimeric oligonucleotide. Circulation half-life (and its relationship to other properties such as glomerular filtration) is discussed in further detail in the Oligonucleotide Uptake and Clearance section. In various embodiments, the in vivo circulation half-life increases by a factor of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, or 1,000. The in vivo circulation half-life can increase by a factor of at least 2. The in vivo circulation half-life can increase by a factor of at least 10. In various embodiments, the increase in in vivo activity is measured as the ratio of in vivo activity at W. In vari ous embodiments, the in vivo activity increases by a factor of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, or 1,000. The in vivo activity can increase by a factor of at least 2. The in vivo activity can increase by a factor of at least 10. In one embodiment, the increase is in a mouse. In one embodiment, the increase is in a human.

[00371] In various embodiments, m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.

[00372] In various embodiments, each of the monomeric subunits . comprises an siRNA and each of the covalent linkers joins sense strands of the siRNA.

[00373] In various embodiments, each of the covalent linkers · joins two monomeric subunits . .

[00374] In various embodiments, at least one of the covalent linkers · joins three or more monomeric subunits . .

[00375] In various embodiments, each monomeric subunit ------- is independently a double-stranded oligonucleotide , m is 1, and each covalent

linker ● is on the same strand: (Structure 28)_.

[00376] In various embodiments, each monomeric subunit . is independently a double-stranded oligonucleotide - , and m is 2:

.

[00377] In various embodiments, each monomeric subunit . is independently a double-stranded oligonucleotide - , and m is 2, and each covalent

linker ● is on the same strand:

(Structure 33)_.

[00378] In various embodiments, each monomeric subunit . is independently a double-stranded oligonucleotide - and m is 3, 4, 5, 6, 7, 8, 9, 10,

11, or 12.

[00379] In various embodiments, each monomeric subunit — . is independently a double-stranded oligonucleotide

, m is 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, and each covalent linker ● is on the same strand.

[00380] In various embodiments, each monomeric subunit . is independently a double-stranded oligonucleotide

, and m is ³ 13.

[00381] In various embodiments, each monomeric subunit . is independently a double-stranded oligonucleotide , m is ³ 13, and each covalent

linker · is on the same strand.

[00382] In various embodiments, Structure 21 is Structure 22 or 23:

(Structure 23) where each

is a double-stranded oligonucleotide, each · is a covalent linker joining adjacent double-stranded oligonucleotides, m is an integer ³ 1, and n is an integer ³ 0. [00383] In various embodiments, Structure 21 is not a structure disclosed in PCT/TJS2016/037685.

[00384] In various embodiments, each oligonucleotide . is a single-stranded oligonucleotide.

[00385] In various embodiments, each oligonucleotide ....... is a double- stranded oligonucleotide.

[00386] In various embodiments, the oligonucleotides ....... comprise a combination of single and double-stranded oligonucleotides.

[00387] In various embodiments, the multimeric oligonucleotide comprises a linear structure wherein each of the covalent linkers · joins two monomeric subunits

[00388] In various embodiments, the multimeric oligonucleotide comprises a branched structure wherein at least one of the covalent linkers · joins three or more monomeric subunits ........ For example, Structure 21 could be

monomeric subunit . is independently a single-stranded oligonucleotide — — - . In some such embodiments, m

; m is 4 ture 40); or m is 5

(Structure 37). In some such embodiments, m is 6, 7, 8, 9, 10, 11, or 12. In some such embodiments, m is an integer ³ 13 In one such embodiment, at least one single-stranded oligonucleotide

- is an antisense oligonucleotide. In one such embodiment, each single-stranded oligonucleotide — — - is independently an antisense oligonucleotide.

In various embodiments, the multimeric oligonucleotide comprises a homo-multimer of substantially identical oligonucleotides. The substantially identical oligonucleotides can be siRNAs targeting the same molecular target in vivo. The substantially identical oligonucleotides can be miRNAs targeting the same molecular target in vivo. The substantially identical oligonucleotides can be antisense oligonucleotides targeting the same molecular target in vivo. The substantially identical oligonucleotides can be a combination of siRNA, miRNA, and/or antisense RNA targeting the same molecular target in vivo.

[00391] In various embodiments, the multimeric oligonucleotide comprises a hetero-mul timer of two or more substantially different oligonucleotides. The substantially different oligonucleotides can be siRNAs targeting different molecular targets in vivo.

The substantially different oligonucleotides can be miRNAs targeting different molecular targets in vivo. The substantially different oligonucleotides can be antisense oligonucleotides targeting different molecular targets in vivo. The substantially different oligonucleotides can be a combination of siRNA, miRNA, and/or antisense RNA targeting different molecular targets in vivo.

[00392] Polymer linkers such as polyethylene glycol (PEG) have been used in attempts to increase the circulati on half-life of certain drugs. Such approaches can have drawbacks, including “diluting” the therapeutic agent (e.g., less active agent per unit mass). The present disclosure can be distinguished from such approaches. For example, in various embodiments, the multimeric oligonucleotide does not comprise PEG. In various embodiments, the multimeric oligonucleotide does not comprise a polyether compound. In various embodiments, the multimeric oligonucleotide does not comprise a polymer other than the oligonucleotides.

[00393] Nanoparticles (NP), such as lipid nanoparticles (LNP) have been used in attempts to increase the circulation half-life of certain drugs. Such approaches can have drawbacks, including increased toxicity (e.g., from cationic lipids). The present disclosure can be distinguished from such approaches. For example, in various embodiments, the multimeric oligonucleotide is not formulated in an NP or LNP.

[00394] Phosphorothioate groups have been used in attempts to increase the circulation half-life of certain drugs. Such approaches can have the drawbacks, including low'er activity (e.g , due to oligonucleotide/plasma protein aggregation). The present disclosure can be distinguished from such approaches. For example, in various embodiments, the multimeric oligonucleotide does not comprise a phosphorothioate.

[00395] In various embodiments, the multimeric oligonucleotide further comprises one or more targeting ligands. In various embodiments, the multimeric oligonucleotide consists essentially of Structure 21 and an optional targeting ligand. The multimeric oligonucleotide can use any of the targeting ligands discussed herein (see, e.g., the Targeting Ligands section below). In various embodiments, a targeting ligand is conjugated to an oligonucleotide subunit, and/or to a linker between adjacent oligonucleotide subunits. In various embodiments, a targeting ligand can be conjugated to an oligonucleotide through its 3’ or 5’ terminus.

[00396] The multimeric oligonucleotide can use any of the linkers discussed herein (see, e.g., the Linkers section above). In various embodiments, each covalent linker · is the same. In various embodiments, the multimeric oligonucleotide comprises two or more different covalent linkers · . In various embodiments, one or more of · comprises a cleavable covalent linker Cleavable linkers can be particularly advantageous in some situations. For example, intracellular cleavage can convert a single multimeric oligonucleotide into multiple biologically active oligonucleotides after cellular targeting and entry (e.g., a single siRNA construct can deliver four or more active siRNA), increasing potency and decreasing undesired side effects

[00397] In various embodiments, one or more of · comprises nucleotide linker (e.g., a cleavable nucleotide linker such as UUU). Alternatively, in some embodiments, the multimeric oligonucleotide expressly excludes nucleotide linkers.

[00398] In various embodiments, the compound is isolated or substantially pure. For example, the compound can be at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure. In one embodiment, the compound is about 85-95 % pure. Likewise, the methods for synthesizing the compounds and compositions according to the disclosure can result in a product that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure. In one embodiment, the product is about 85-95 % pure. Preparations can be greater than or equal to 50 % pure; preferably greater than or equal to 75 % pure; more preferably greater than or equal to 85 % pure; and still more preferably, greater than or equal to 95 % pure

[00399] In various embodiments, each oligonucleotide is RNA, DNA, or comprises an artificial or non-natural nucleic acid analog. In various embodiments, at least one oligonucleotide is an siRNA, miRNA, or antisense oligonucleotide. Various other possible oligonucleotides and substitutions are discussed, for example, in the Nucleic Acids section above.

[00400] In various embodiments, each oligonucleotide is 15-30, 17-27, 19-26, or 20-25 nucleotides in length. In various embodiments, the nucleic acid or oligonucleotide is 15-30, 17-27, 19-26, 20-25, 40-50, 40-150, 100-300, 1000-2000, or up to 10000 nucleotides in length

1004011 In various embodiments, the multimeric oligonucleotides comprising structure 21 have a molecular weight of at least about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 kD. In various embodiments, the multimeric oligonucleotides comprising structure 21 have a molecular weight of at least about 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, or 70-75 kD.

Molecular weight can include everything conjugated to the multimeric oligonucleotide, such a targeting ligands and linkers.

[00402] Although the multimeric oligonucleotides comprising Structure 21 can be synthesized by various methods (e.g., those described herein for making tetrameric or greater multimers), certain results may call for specific methodologies. For example, the following method (as well as those shown in Example 22) is designed to efficiently produce multimers having each covalent linker ● on the same strand.

[00403] For example, in one aspect, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising structure 34:

(Structure 34) wherein each - is a single- stranded oligonucleotide and each ● is a covalent linker joining adjacent single-stranded oligonucleotides, the method comprising the steps of:

(i) reacting

, wherein ° is a linking moiety and Ri is a chemical group capable of reacting with the linking moiety O , thereby forming

(Structure 34), and

[00404] (ii) optionally annealing

(Structure 34) with complementary single-stranded oligonucleotides, thereby forming (Structure 28)_.

[00405] For example, in one aspect, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising structure 35:

(Structure 35) wherein each

is a single- stranded oligonucleotide and each ● is a covalent linker joining adjacent single-stranded oligonucleotides, the method comprising the steps of: (i) reacting

, wherein ° is a linking moiety and Ri is a chemical group capable of reacting with the linking moiety

° , thereby forming

(Structure 35), and

(ii) optionally annealing (Structure

35) with complementary single-stranded oligonucleotides, thereby forming

(Structure 36)_.

[00406] For example, in one aspect, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising structure 37:

(Structure 37) wherein each is a single-stranded oligonucleotide and each · is a covalent linker joining adjacent single-stranded oligonucleotides, the method comprising the steps of:

(i) reacting

and

, wherein O is a linking moiety and R· is a chemical group capable of reacting with the linking moiety ° , thereby forming

(Structure 37), and

(ii) optionally annealing

(Structure 37) with complementary single-stranded oligonucleotides, thereby forming

(Structure 38).

[00407] The disclosure also provides methods for synthesizing single-stranded multimeric oligonucleotides, for example wherein m is 2 ; m is 4

(Structure 40); m is 6, 7, 8, 9, 10,

11, or 12; or m is ³ 13 (see Example 22 below).

[00408] The multimeric compounds can include any one or more of the features disclosed herein. For example, the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary⁷, description, or Examples. Likewise, the compounds can be prepared in an of the compositions (e.g., for experimental or medical use) shown in the summary⁷, description, or Examples. Illustrative examples are provided in th Q Pharmaceutical Compositions section below⁷. Oligonucleotide Uptake and Clearance

[00409] The bioavailability of a dmg in the blood stream can be characterized as the balance between target cell uptake versus kidney clearance. From a practical perspective, in vivo circulation half-life and/or in vivo activity are good proxies for kidney clearance/glomerular filtration because they can be readily quantified and measured and because their improvement (e.g., increase) can correlate with improved pharmacodynamics and/or pharmacokinetics.

[00410] The uptake rate of a therapeutic agent such as an oligonucleotide (ONT) in the blood is a function of a number of factors, which can be represented as: Rate of Uptake = f {(ONT Concentration) x (Rate Blood Flow) x (Receptor Copy Number/cell) x (Number of Cells) x (equilibrium dissociation constant KD) X (Internalization Rate)} For a given ligand/receptor pair, the Copy Number, KD, Number of cells and Internalization Rate will be constant. This can explain why the GalNAc li gand system is so effective for hepatocytes - it targets the ASGP receptor, which is present at high copy number. The KD of some ASGP/Ga!NAc variants is in the nanomolar range and the internalization rate is very high.

[00411] However, effective targeting is also dependent on the ONT concentration, which rapidly decreases over time due to clearance from the blood stream. The rate of clearance of a therapeutic can be represented as: Rate of Clearance = f {(Blood Flow' Rate) x (Kidney Filtration Rate) x (Other clearance mechanisms)}. The resulting concentration of ONT at time t can be represented as: (ONT Concentration^ = f {(Initial Concentration) - (Rate of Clearance x t)}

[00412] In humans, clearance is mainly due to glomerular filtration in the kidney.

In general, molecules less than about 45 kD have a half-life of about 30 minutes. In mice, the rate of clearance is even faster, the circulation half-life being about 5 minutes.

Without wishing to be bound by any particular theory, it is believed that the disclosure can reduce glomerular filtration using specifically configured multimeric oligonucleotides (e.g., specific composition, size, weight, etc.), leading to a lower rate of clearance, resulting in a higher concentration of ONT in circulation at a given time t (e.g., increased serum half-life, higher overall uptake, and higher activity).

[00413] Again, without wishing to bound by any particular theory, actual glomerular filtration rates can be difficult to measure directly. For example, compounds that pass through the glomerular capillaries are readily absorbed by cells such as tubular epithelial cells, which can retain compounds like siRNA for significant periods of time (see, e.g., Henry, S. P et al; Toxicology, 301, 13-20 (2012) and van de Water, F.M et al; Drug metabolism and Disposition, 34, No 8, 1393-1397 (2006)). In addition, absorbed compounds can be metabolized to breakdown products, which are then secreted in urine. Thus, the concentration (e.g., in urine) of a therapeutic agent such as an siRNA at a specific time point may not necessarily be representative of the glomerular filtration rate. However, serum half-life, which is related to glomerular filtration and which is directly measurable, may be considered to be a suitable proxy for glomerular filtration.

[00414] Table 1 below shows the dramatic effect increasing the circulation half- life (ti_/2) of a component can have on the resulting concentration of the component at time t:

Table 1 - Effect of increasing circulation half-life (fi_/2) on concentration at time t.

Values are presentee as % initial dose at time t.

[00415] Thus, increasing the half-life of a component by a factor of 2 increases its residual concentration at 2 hours by a factor of 4. Increasing the half-life by a factor of four leads to even more dramatic improvements in residual concentration - by factors of eight and greater than sixty at 2 and 4 hours, respectively.

[00416] A typical siRNA (e.g., double-stranded monomer) has a molecular weight of about 15kD. A siRNA tetramer according to the disclosure can have a molecular weight of about 60 kD. Without wishing to be bound by any particular theory, it is believed that such multimers (tetramers, pentamers, etc.) can be configured to have a molecular size and/or weight resulting in decreased glomerular filtration in vivo. Such multimers would have an increased circulation half-life. Thus, multimers according to the disclosure can be configured to have increased in vivo circulation half-life and/or increased in vivo activity, relative to that of the individual monomeric subunits. Further, if directed by a suitable targeting ligand the multimer (e.g., tetramer) would deliver many (e.g., four) times the payload per ligand/receptor binding event than the monomeric equivalent. In combination, these effects can lead to a dramatic increase in the bio availability and uptake of the therapeutic agent. This can be especially advantageous in cases where some combination of the copy number, KD, number of target ceils and internalization rate of a given ligand/receptor pair are sub-optimal.

[00417] Accordingly, the multimeric oligonucleotide has a structure selected to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits. For example, the multimeric oligonucleotide can have a molecular size and/or weight configured for this purpose.

Pharmaceutical Compositions

[00418] In various aspects, the disclosure provides pharmaceutical compositions including any one or more of the compounds or compositions described above. As used herein, pharmaceutical compositions include compositions of matter, other than foods, that can be used to prevent, diagnose, alleviate, treat, or cure a disease. Similarly, the various compounds or compositions according to the disclosure should be understood as including embodiments for use as a medicament and/or for use in the manufacture of a medicament.

[00419] A pharmaceutical composition can include a compound or composition according to the disclosure and a pharmaceutically acceptable excipient. As used herein, an excipient can be a natural or synthetic substance formulated alongside the active ingredient. Excipients can be included for the purpose of long-term stabilization, increasing volume (e.g., bulking agents, fillers, or diluents), or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating drug absorption, reducing viscosity, or enhancing solubility. Excipients can also be useful manufacturing and distribution, for example, to aid in the handling of the active ingredient and/or to aid in vitro stability (e.g., by preventing denaturation or aggregation). As will be understood by those skilled in the art., appropriate excipient selection can depend upon various factors, including the route of administration, dosage form, and active ingredient(s).

[00420] Oligonucleotides can be delivered locally or systemicaily, and the pharmaceutical compositions of the disclosure can vary accordingly. For example, administration is not necessarily limited to any particular delivery system and may include, without limitation, parenteral (including subcutaneous, intravenous, intramedullary, intraarticular, intramuscular, intraperitoneal), CNS injection, including, but not limited to, intrathecal, intraparenchymal, intrastriatal, intracerebroventicular. Administration to an individual may occur in a single dose or in repeat administrations, and in any of a variety of physiologically acceptable salt forms, and/or with an acceptable pharmaceutical carrier and/or additive as part of a pharmaceutical composition. Physiologically acceptable formulations and standard pharmaceutical formulation techniques, dosages, and excipients are well known to persons skilled in the art (see, e.g , Physicians’ Desk Reference (PDR®) 2005, 59th ed., Medical Economics Company,

2004; and Remington: The Science and Practice of Pharmacy, eds Gennado et al. 21th ed , Lippincott, Williams & Wilkins, 2005).

[00421] Pharmaceutical compositions can include an effective amount of the compound or composition according to the disclosure. As used herein, effective amount can be a concentration or amount that results in achieving a particular stated purpose, or more amount means an amount adequate to cause a change, for example in comparison to a placebo. Where the effective amount is a therapeutically effective amount, it can be an amount adequate for therapeutic use, for example and amount sufficient to prevent, diagnose, alleviate, treat, or cure a disease. An effective amount can be determined by- methods known in the art. An effective amount can be determined empirically, for example by human clinical trials. Effective amounts can also be extrapolated from one animal (e.g , mouse, rat, monkey, pig, dog) for use in another animal (e.g., human), using conversion factors known in the art. See, e.g., Freireich et al., Cancer Chemother Reports 5Q(4):219-244 (1966).

Conjugates, Functional Moieties, Delivery Vehicles and Targeting Ligands

[00422] In various aspects, the multimeric oligonucleotides may comprise one or more conjugates, functional moieties, deliver}_' vehicles, and targeting ligands. The various conjugated moieties are designed to augment or enhance the activity or function of the multimeric oligonucleotide.

[00423] In various aspects, the discl osure provides any one or more of the compounds or compositions described above formulated in a delivery vehicle. For example, the delivery vehicle can be a lipid nanoparticle (LNP), exosome, microvesicle, or viral vector. [00424] In various aspects, the disclosure provides any one or more of the compounds or compositions described above and further comprising a targeting ligand or functional moiety. The targeting ligand may target a cancer cell and/or a cancer-targeting immune cell, such as a T cell. For example, the targeting ligand comprises a lipophilic moiety, such as a phospholipid, aptamer, peptide, antigen-binding protein, small molecules, vitamins, cholesterol, tocopherol, folate and other folate receptor-binding ligands, mannose and other mannose receptor-binding ligands, 2-[3-(1,3- dicarboxypropyl)-ureido]pentanedioic acid (DUPA), anisamide, or an immunostimulant.

[00425] The peptide targeting ligand may comprise tumor-targeting peptides, such as APRPG, cNGR (CNGRCVSGCAGRC), F3

(KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and iRGD (CRGDKGPDC).

[00426] The antigen-binding protein may comprise a single chain variable fragment (ScFv) or a Vi 111 antigen-binding protein.

[00427] The lipophilic moiety may be a ligand that includes a cationic group. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3). Other lipophilic moieties include cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1 ,3 -Bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3 -propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.

[00428] In various aspects, the targeting ligand or functional moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides and nucleoside analogs, endocannabinoids, and vitamins (e.g , a fatty acid selected from the group consisting of cholesterol, Lithocholic acid (LCA), Eicosapentaenoic acid (EPA), Doeosahexaenoic acid (DHA), DHA with a phosphocholine head group, and Docosanoie acid (DC A), a vitamin selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof, or a vitamin selected from the group consisting of retinoic acid and alpha-tocopheryJ succinate.

[00429] The endosomal escape moiety may be used to facilitate endosomal escape of a multimeric oligonucleotide that has been endocytosed by a cell. Endosomal escape moieties are generally lipid-based or amino acid-based, but may comprise other chemical entities that disrupt an endosome to release the multimeric oligonucleotide. Examples of EEMs include, but are not limited to, chloroquine, peptides and proteins with motifs containing hydrophobic amino acid R groups, and influenza virus hemagglutinin (HA2). Further EEMs are described in Lonn et ah, Scientific Reports, 6: 32301, 2016.

[00430] The immunostimulant may be a CpG oligonucleotide, for example, the CpG oligonucleotides of TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: x) or GGT GC A T C G A T GC A GGGGG (SEQ ID NO: x).

[00431] The multimeric oligonucleotides of the disclosure may comprise one or more targeting ligands. The multimeric oligonucleotides of the disclosure may comprise two or more distinct targeting ligands, e.g., a phospholipid targeting ligand and a peptide targeting ligand on a single multimeric oligonucleotide molecule. The targeting ligand can be bound (e.g., directly) to the nucleic acid, for example through its 3’ or 5’ terminus. In some embodiments, two targeting ligands are conjugated to the oligonucleotide, where one ligand is conjugated through the 3’ terminus and the other ligand is conjugated through the 5’ terminus of the oligonucleotide. One or more targeting ligands can be conjugated to the sense strand or the anti-sense strand of the oligonucleotide, or both the sense-strand and the anti-sense strand. Additional examples that may be adapted for use with the disclosure are discussed below.

[00432] As will be understood by those skilled in the art, regardless of biological target or mechanism of action, therapeutic oligonucleotides must overcome a series of physiological hurdles to access the target cell in an organism (e.g., animal, such as a human, in need of therapy). For example, a therapeutic oligonucleotide generally must avoid clearance in the bloodstream, enter the target cell type, and then enter the cytoplasm, all without eliciting an undesirable immune response. This process is generally considered inefficient, for example, 95 % or more of siRNA that enters the endosome in vivo may be degraded in lysosomes or pushed out of the cell without affecting any gene silencing.

[00433] To overcome these obstacles, scientists have designed numerous drug delivery vehicles. These vehicles have been used to deliver therapeutic RNAs in addition to small molecule drugs, protein drugs, and other therapeutic molecules. Drug deliver}- vehicles have been made from materials as diverse as sugars, lipids, lipid-like materials, proteins, polymers, peptides, metals, hydrogels, conjugates, and peptides. Many drug deli very vehicles incorporate aspects from combinati ons of these groups, for example, some drug delivery vehicles can combine sugars and lipids. In some other examples, drugs can be directly hidden in ‘cell like’ materials that are meant to mimic cells, while in other cases, drugs can be put into, or onto, cells themselves. Drug delivery vehicles can be designed to release drugs in response to stimuli such as pH change, biomolecule concentration, magnetic fields, and heat

[00434] Much work has focused on delivering oligonucleotides such as siRNA to the liver. The dose required for effective siRNA delivery to hepatocytes in vivo has decreased by more than 10,000 fold in the last ten years - whereas delivery vehicles reported in 2006 could require more than 10 mg/kg siRNA to target protein production, with new delivery vehicles target protein production can now be reduced after a systemic injection of 0.001 mg/kg siRNA. The increase in oligonucleotide delivery efficiency can be attributed, at least in part, to developments in delivery vehicles.

[00435] Another important advance has been an increased understanding of the way helper components influence delivery. Helper components can include chemical structures added to the primary drug delivery system. Often, helper components can improve particle stability or delivery to a specific organ. For example, nanoparticles can be made of lipids, but the delivery mediated by these lipid nanoparticles can be affected by the presence of hydrophilic polymers and/or hydrophobic molecules. One important hydrophilic polymer that influences nanoparticle delivery is poiy(ethylene glycol). Other hydrophilic polymers include non-ionic surfactants. Hydrophobic molecules that affect nanoparticle delivery⁷ include cholesterol, l-2-Distearoyl-sn-glyerco-3-phosphocholine (DSPC), l-2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 1,2-dioleoyl- 3-trimethylammonium-propane (DOTAP), and others.

[00436] Drug delivery systems have also been designed using targeting ligands or conjugate systems. For example, oligonucleotides can be conjugated to cholesterols, sugars, peptides, and other nucleic acids, to facilitate delivery⁷ into hepatocytes and/or other ceil types. Such conjugate systems may facilitate delivery into specific cell types by binding to specific receptors.

[00437] One skilled in the art will appreciate that known delivery vehicles and targeting ligands can generally be adapted for use according to the present disclosure. Examples of delivery vehicles and targeting ligands, as well as their use, can be found in: Sahay, G., et al. Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling. Nat Biotechnol, 31 : 653-658 (2013); Wittrup, A., et al. Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown. Nat Biotechnol (2015); Whitehead, K.A., Langer, R. & Anderson, D.G. Knocking down barriers: advances in siRNA delivery. Nature reviews. Drug Discovery, 8: 129-138 (2009); Kanasty, R., Dorkin, J.R., Vegas, A. & Anderson, D. Delivery materials for siRNA therapeutics. Nature Materials, 12: 967-977 (2013), Tibbitt, M.W., Dahlman, J.E, & Langer, R. Emerging Frontiers in Drug Delivery_'. J Am Chem Soc, 138: 704-717 (2016); Akinc, A., et at. Targeted delivery of RNAi therapeutics with endogenous and exogenous ligand-based mechanisms. Molecular therapy: the journal of the American Society of Gene Therapy 18, 1357-1364 (2010); Nair, J.K., et al. Multivalent A^?- acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi- mediated gene silencing. J Am Chem Soc, 136: 16958-16961 (2014); Ostergaard, M.E., et al. Efficient Synthesis and Biological Evaluation of 5’-GalNAc Conjugated Antisense Oligonucleotides. Bioconjugate chemistry (2015); Sehgal, A., et al. An RNAi therapeutic targeting antithrombin to rebalance the coagulation system and promote hemostasis in hemophilia. Nature Medicine, 21: 492-497 (2015); Semple, S.C., et al. Rational design of cationic lipids for siRNA delivery Nat Biotechnol, 28: 172-176 (2010); Maier, M.A., et al. Biodegradable lipids enabling rapidly eliminated lipid nanoparticles for systemic delivery of RNAi therapeutics. Molecular therapy: the journal of the American Society of Gene Therapy, 21: 1570-1578 (2013); Love, K.T., et al. Lipid-like materials for low- dose, in vivo gene silencing. ProcNat Acad USA, 107: 1864-1869 (2010); Akinc, A., et al. A combinatorial library of lipid-like materials for delivery of RNAi therapeutics. Nat Biotechnol, 26: 561-569 (2008); Eguchi, A., et al. Efficient siRNA delivery_' into primary cells by a peptide transduction domain-dsRNA binding domain fusion protein. Nat Biotechnol, 27: 567-571 (2009); Zuckerman, J.E., et al. Correlating animal and human phase Ia/Ib clinical data with CALAA-01, a targeted, polymer-based nanoparticle containing siRNA. Proc Nat Acad USA, 111: 11449-11454 (2014); Zuckerman, J.E. & Davis, M.E. Clinical experiences with systemically administered siRNA-based therapeutics in cancer. Nature Reviews. Drug Discovery', 14: 843-856 (2015); Hao, J., et al. Rapid Synthesis of a Lipocationic Polyester Library_' via Ring-Opening Polymerization of Functional Valerolactones for Efficacious siRNA Delivery. J Am Chem Soc, 29: 9206- 9209 (2015); Siegwart, D.J., et al. Combinatorial synthesis of chemically diverse core shell nanoparticles for intracellular delivery_'. Proc Nat Acad USA, 108: 12996-13001 (2011); Dahlman, J.E., et al. In vivo endothelial siRNA delivery using polymeric nanoparticles with low molecular weight. Nat Nano 9, 648-655 (2014); Soppimath, K.S., Aminabhavi, T.M., Kulkami, A.R & Rudzinski, W.E. Biodegradable polymeric nanoparticles as drug delivery devices. Journal of controlled release: official journal of the Controlled Release Society 70, 1-20 (2001), Kim, H.J., et al. Precise engineering of siRNA delivery vehicles to tumors using polyion complexes and gold nanoparticles. ACS Nano, 8: 8979-8991 (2014); Krebs, M.D., Jeon, O. & Alsberg, E. Localized and sustained delivery of silencing RNA from macroscopic biopolymer hydrogels. J Am Chem Soc 131, 9204-9206 (2009); Zimmermann, T.S., et al. RNAi-mediated gene silencing in non human primates. Nature, 441: 111-114 (2006), Dong, Y., et al. Lipopeptide nanoparticles for potent and selective siRNA deliver}_' in rodents and nonhuman primates. Proc Nat Acad USA, 111: 3955-3960 (2014), Zhang, Y., et al. Lipid-modified aminoglycoside derivatives for in vivo siRNA delivery. Advanced Materials, 25: 4641-4645 (2013); Molinaro, R., et al. Biomimetic proteolipid vesicles for targeting inflamed tissues. Nat Mater (2016); Hu, C.M., et al. Nanoparticle biointerfacing by platelet membrane cloaking. Nature, 526: 118-121 (2015); Cheng, R., Meng, F., Deng, C., Klok, H.-A. & Zhong, Z. Dual and multi-stimuli responsive polymeric nanoparticles for programmed site-specific drug delivery. Biomaterials, 34: 3647-3657 (2013); Qiu, Y. & Park, K. Environment-sensitive hydrogels for drug delivery. Advanced Drug Delivery Reviews,

64, Supplement, 49-60 (2012); Mui, B.L., et al. Influence of Polyethylene Glycol Lipid Desorption Rates on Pharmacokinetics and Pharmacodynamics of siRNA Lipid Nanoparticles. Mol Ther Nucleic Acids 2, e!39 (2013); Draz, M.S., et al. Nanoparticle- Mediated Systemic Delivery of siRNA for Treatment of Cancers and Viral Infections. Theranostics, 4: 872-892 (2014); Otsuka, H., Nagasaki, Y. & Kataoka, K. PEGylated nanoparticles for biological and pharmaceutical applications. Advanced Drug Delivery Reviews, 55: 403-419 (2003); Kauffman, K.J., et al. Optimization of Lipid Nanoparticle Formulations for mRNA Delivery in vivo with Fractional Factorial and Definitive Screening Designs Nano Letters, 15: 7300-7306 (2015); Zhang, S., Zhao, B., Jiang, H., Wang, B. & Ma, B. Cationic lipids and polymers mediated vectors for delivery of siRNA. Journal of Controlled Release 123, 1-10 (2007); Ilium, L. & Davis, S.S. The organ uptake of intravenously administered colloidal particles can be altered using a non-ionic surfactant (Poloxamer 338). FEES Leters, 167: 79-82 (1984), Feigner, P.L., et al. Improved Cationic Lipid Formulations for In vivo Gene Therapy. Annals of the New York Academy of Sciences, 772: 126-139 (1995), Meade, B.R. & Dowdy, S.F. Exogenous siRNA delivery using peptide transduction domains/cell penetrating peptides. Advanced Drug Delivery Reviews, 59: 134-140 (2007); Endoh, T. & Ohtsuki, T. Cellular siRNA delivery using cell -penetrating peptides modified for endosomal escape.

Advanced Drug Delivery Reviews, 61: 704-709 (2009), and Lee, H., et al. Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery. Nat Nano, 7: 389-393 (2012).

[00438] In various embodiments, the compounds and compositions of the disclosure can be conjugated to or delivered with other chemical or biological moieties, including, e.g., biologically active moieties. A biologically active moiety is any molecule or agent that has a biological effect, preferably a measurable biological effect. Chemical or biological moieties include, e.g , proteins, peptides, amino acids, nucleic acids (including, e.g., DNA, RNA of all types, RNA and DNA aptamers, antisense oligonucleotides, and antisense miRNA inhibitors), targeting ligands, carbohydrates, polysaccharides, lipids, organic compounds, and inorganic chemical compounds.

[00439] As used herein, the term targeting ligand can include a moiety that can be made accessible on the surface of a nanoparticle or as part of a delivery conjugate (e.g., multi-conjugate oligonucleotide, multimeric oligonucleotide) for the purpose of delivering the payload of the nanoparticle or delivery conjugate to a specific target, such as a specific bodily tissue or cell type, for example, by enabling cell receptor attachment of the nanoparticle or delivery' conjugate. Examples of suitable targeting ligands include, but are not limited to, cell specific peptides or proteins (e.g., transferrin, and monoclonal antibodies), aptamers, cell growth factors, vitamins (e.g., folic acid), monosaccharides (e.g., galactose and mannose), polysaccharides, arginine-glycine-aspartic acid (RGD), a rabies virus peptide, transferrin receptor ligands, anti-receptor ligands, or other ligands making use of a transferrin receptor-mediated transeytotic route across the vascular endothelium, and ligands targeting integrins, e.g., RGD (6518-6548 NUCLEIC ACIDS Research, 2016, Vol. 44, No. 14, at 6522 and 6533). The ligand may be incorporated into the foregoing compounds of the disclosure using a variety of techniques known in the art, such as via a covalent bond such as a disulfide bond, an amide bond, or an ester bond, or via a non-covalent bond such as biotin-streptavidin, or a metal-ligand complex.

[00440] Additional biologically active moieties within the scope of the disclosure are any of the known gene editing materials, including for example, materials such as oligonucleotides, polypeptides and proteins involved in CRISPR/Cas systems, TALES, TALENs, and zinc finger nucleases (ZFNs).

[00441] In various embodiments, the compounds and compositions of the disclosure can be encapsulated in a carrier material to form nanoparticles for intracellular delivery. Known carrier materials include cationic polymers, lipids or peptides, or chemical analogs thereof. Jeong et al., BIOCONJUGATE CHEM., Vol. 20, No. 1, pp. 5- 14 (2009). Examples of a cationic lipid include dioieyl phosphatidyl ethanolamine, cholesterol dioieyl phosphatidylcholine, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N- tri methyl ammonium chloride (DOTMA), 1 ,2-dioleoyioxy-3-(trimethylammonio)propane (DOTAP), 1 ,2-dioleoyl-3 -(4’ -trimethyl-ammonio)butanoyl-sn-glycerol(DOTB), 1 ,2- diacyl-3-dimethylammonium-propane (DAP), 1 ,2-diacyl-3-trimethylammonium-propane (TAP), 1 ,2-diacyl-sn-glycerol-3-ethylphosphocholin, 3 beta-[N-(N’,N’- dimethylaminoethane)-carbamoyl]cholesterol (DC-Cholesterol), dimethyldioctadecylammonium bromide (DDAB), and copolymers thereof. Examples of a cationic polymer include polyethyleneimine, polyamine, polyvinylamine, polyialkylamine hydrochloride), polyamidoamine dendrimer, diethylaminoethyl-dextran, polyvinylpyrrolidone, chitin, chitosan, and poly(2-dimethylamino)ethyl methacrylate. In one embodiment, the carrier contains one or more acylated amines, the properties of which may be better suited for use in vivo as compared to other known carrier materials.

[00442] In one embodiment, the carrier is a cationic peptide, for example KALA (a cationic fusogenic peptide), polylysine, polyglutamic acid or protamine. In one embodiment, the carrier is a cationic lipid, for example dioieyl phosphatidylethanolamine or cholesterol dioieyl phosphatidylcholine. In one embodiment, the carrier is a cationic polymer, for example polyethyleneimine, polyamine, or polyvinylamine.

[00443] In various embodiments, the compounds and compositions of the disclosure can be encapsulated in exosomes. Exosomes are cell-derived vesicles having diameters between 30 and 100 ntn that are present in biological fluids, including blood, urine, and cultured medium of cell cultures. Exosomes, including synthetic exsosomes and exosome mimetics can be adapted for use in drug delivery according to the skill in the art. See, e.g., “A comprehensive overview of exosomes as drug delivery vehicles - endogenous nanocarriers for targeted cancer therapy” Bioehim Biophys Acta. 1846(l):75-87 (2014); “Exosomes as therapeutic drug carriers and delivery vehicles across biological membranes: current perspectives and future challenges” Acta Pharmaceutica Sinica B, Available online 8 March 2016 (In Press); and “Exosome mimetics: a novel class of drug delivery systems” International Journal of Nanomedicine, 7: 1525-1541 (2012).

[00444] In various embodiments, the compounds and composi ti ons of the disclosure can be encapsulated in microvesicles. Microvesicles (sometimes called, circulating microvesicles, or microparticles) are fragments of plasma membrane ranging from 100 run to 1000 run shed from almost all cell types and are distinct from smaller intracellularly generated extracellular vesicles known as exosomes. Microvesicles play a role in intercellular communication and can transport mRNA, miRNA, and proteins between cells. Microvesicles, including synthetic microvesicles and microvesicle mimetics can be adapted for use in drug delivery according to the skill in the art. See, e.g., “Microvesicle- and exosome-mediated drug delivery enhances the cytotoxicity of Paelitaxel in autologous prostate cancer cells” Journal of Controlled Release, 220: 727- 737 (2015); “Therapeutic Uses of Exosomes” J Circ Biomark, 1:0 (2013).

[00445] In various embodiments, the compounds and compositions of the disclosure can be delivered using a viral vector. Viral vectors are tools commonly used by molecular biologists to deliver genetic material into cells. This process can be performed inside a living organism (in vivo) or in cell culture (in vitro). Viral vectors can be adapted for use in drug delivery according to the skill in the art. See, e.g., “Viruses as nanomaterials for drug delivery” Methods Mo\ Biol, 26: 207-21 (2011); “Viral and nonviral delivery⁷ systems for gene delivery” Adv Biomed Res, 1:27 (2012); and “Biological Gene Delivery Vehicles: Beyond Viral Vectors” Molecular Therapy, 17(5): 767-777 (2009).

[00446] General procedures for LNP formulation and characterization are provided in the Examples below, as are working examples of LNP formulations and other in vitro and in vivo tests. Other methods are known in the art and can be adapted for use with the present disclosure by those of ordinary skill.

Methods of Treatment or Reducing Gene Expression

[00447] In various aspects, the disclosure provides methods for using multimeric oligonucleotides for the treatment of cancer.

[00448] In one aspect, the disclosure provides a method for treating a subject comprising administering an therapeutically effective amount of a compound or composition according to the disclosure to a subject in need thereof. In such therapeutic embodiments, the oligonucleotide will be a therapeutic oligonucleotide, for example an siRNA or miRNA. The therapeutic oligonucleotide will target a therapeutically relevant gene or gene product, such as one or mRNA molecules that encode an oncogene.

[00449] In this, and other embodiments, the compositions and compounds of the disclosure can be administered in the form of a pharmaceutical composition, in a delivery vehicle, or coupled to a targeting ligand.

[00450] In one aspect, the disclosure provides a method for silencing or reducing gene expression comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof. In such therapeutic embodiments, the oligonucleotide will be an oligonucleotide that silences or reduces gene expression, for example an siRNA or antisense oligonucleotide.

[00451] Similarly, the disclosure provides a method for silencing or reducing expression of two or more genes comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof, wherein the compound or composition comprises oligonucleotides targeting two or more genes. The compound or composition can comprise oligonucleotides targeting two, three, four, or more genes.

[00452] In one aspect, the disclosure provides a method for delivering two or more oligonucleotides to a cell per targeting ligand binding event comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof, wherein the compound or compositi on comprises a targeting ligand.

[00453] In one aspect, the disclosure provides a method for delivering a predetermined stoichiometric ratio of two or more oligonucl eotides to a cell comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof, wherein the compound or composition comprises the predetermined stoichiometric ratio of two or more oligonucleotides.

[00454] As used herein, subject includes a cell or organism subject to the treatment or administration. The subject can be an animal, for example a mammal such a laboratory animal (mouse, monkey) or veterinary patient, or a primate such as a human. Without limitation, a subject in need of the treatment or administration can include a subject having a disease (e.g., that may be treated using the compounds and compositions of the disclosure) or a subject having a condition (e.g , that may be addressed using the compounds and compositions of the disclosure, for example one or more genes to be silenced or have expression reduced).

Diseases and Disorders of the CNS

[00455] The multimeric oligonucleotides of this disclosure may be used in therapy or prophylaxis of diseases and disorders of the CNS.

[00456] Diseases of the CNS include, but are not limited to Huntington’s disease, Alzheimers disease (including, e.g., familial forms of Aizheimers), amyotrophic lateral scherosis (ALS) (also known as motor neuron disease (MND) or Lou Gehrig’s disease), spinal muscular atrophy (SMA), Angelman syndrome,

[00457] Multimeric oligonucleotides used in CNS therapy or prophylaxis may be administered to a subject by intrathecal injection to be taken up by neurons and/or glial cells

[00458] As an alternative means of administration, multimeric oligonucleotides designed and formulated to cross the blood brain barrier (BBB) may be administered to the brain by intravenous or subcutaneous injection. Examples of such oligonucleotides include, but are not limited to conjugates of PMGs with CPPs, tricycle oligonucleotides (6518-6548 NUCLEIC ACIDS RESEARCH, 2016, Vol. 44, No. 14 at 6522),

[00459] General procedures for measurement of gene knockdown and animal experiments are provided in the Examples below, as are working examples of other in vitro and in vivo tests. Other methods are known in the art and can be adapted for use with the present disclosure by those of ordinary skill.

[00460] The following Examples are illustrative and not restrictive. Many variations of the technology will become apparent to those of skill in the art upon review of this disclosure. The scope of the technology should, therefore, be determined not with reference to the Examples, but instead should be detemiined with reference to the appended claims along with their full scope of equivalents.

EXAMPLES

[00461] General procedures for synthesizing and formulating the multimeric oligonucleotides, attaching conjugates to said multimeric oligonucleotides, performing animal experiments, and measuring gene knock down are described in detail in WO20 16/205410 and WO2018/145086, each of which is incorporated herein by reference.

General Procedure 1: Single Chain Oligonucleotide Synthesis

[00462] Oligoribonucleotides were assembled on ABI 394 and 3900 synthesizers (Applied Biosystems) at the 10 mmol scale, or on an Oligopiiot 10 synthesizer at 28 mhioΐ scale, using phosphoramidite chemistry. Solid supports were polystyrene loaded with T - deoxythymidine (Glen Research, Sterling, Virginia, USA), or controlled pore glass (CPG, 520Å, with a loading of 75 mmol /g, obtained from Prime Synthesis, Aston, PA, USA). Ancillary synthesis reagents, DNA-, 2’ -O-Methyl RNA-, and 2^,-deoxy-2^,-fluoro-RNA phosphoramidites were obtained from SAFC Proligo (Hamburg, Germany). Specifically,

5 ’ -O-(4,4’ -dimethoxytrityl)-3 ’ -O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite monomers of 2’ -O-methyl -uridine (2’-OMe-U), 4-N-acetyl-2’-O-methyl-cytidine (2’- OMe-C^Ac), 6-N-benzoyl-2’-O-methyl-adenosine (2’-OMe-A^bz) and 2-N- isobutyrlguanosine (2^,-OMe-G^iBu) were used to build the oligomer sequences. 2^,-Fluoro modifications were introduced employing the corresponding phosphoramidites carrying the same nucleobase protecting groups as the 2’-OMe RNA building blocks. Coupling time for all phosphoramidites (70 mM in Acetonitrile) was 3 min employing 5-Ethy!thio- IH-tetrazole (ETT, 0.5 M in Acetonitrile) as activator. Phosphorothioate linkages were introduced using 50 mM 3-((Dimethyiamino-methylidene)amino)-3H-1 ,2,4-dithi azole-3- thione (DDTT, AM Chemicals, Oceanside, California, USA) in a 1:1 (v/v) mixture of pyridine and Acetonitrile.

[00463] Upon completion of the solid phase synthesis including removal of the DMT group (“DMT off synthesis”) oligonucleotides were cleaved from the solid support and deprotected using a 1:1 mixture consisting of aqueous methyl amine (41 %) and concentrated aqueous ammonia (32 %) for 3 hours at 25°C according to published methods (Wincott, F etal: Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nucleic Acids Res, 23: 2677-2684 (1995).

[00464] Subsequently, crude oligomers were purified by anionic exchange HPLC using a column packed with Source Q15 (GE Healthcare) and an AKTA Explorer system (GE Healthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, J mM EDTA, pH 7.4 (Fluka, Buchs, Switzerland) in 20 % aqueous acetonitrile and buffer B was the same as buffer A with 500 mM sodium perchlorate. A gradient of 22 % B to 42 % B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3M NaOAc, rH=5.2 and 70 % ethanol. Pellets were collected by centrifugation. Alternatively, desalting was carried out using Sephadex HiPrep columns (GE Healthcare) according to the manufacturer’s recom m en dati ons .

[00465] Oligonucleotides were reconstituted in water and identity of the oligonucleotides was confirmed by electrospray ionization mass spectrometry (ESI-MS). Purity was assessed by analytical anion-exchange HPLC.

General Procedure 2: Lipid Nanoparticle Formulation

[00466] 1 ,2-distearoyl-3-phosphatidylcholine (DSPC) was purchased from Avanti Polar Lipids (Alabaster, Alabama, USA). a-[3'-(1 ,2-dimyristoyl-3-propanoxy)- carboxamide-propyi]-03-rnethoxy-polyoxyethylene (PEG-c-DOMG) was obtained from NOF (Bouwefven, Belgium). Cholesterol was purchased from Sigma-Aldrich (Taufkirchen, Germany).

[00467] The proprietary aminolipids KL22 and KL52 are disclosed in the patent literature (< Constien et al. “Novel Lipids and Compositions for Intracellular Deliver}_' of Biologically Active Compounds” US 2012/0295832 Al). Stock solutions of KL52 and KL22 lipids, DSPC, cholesterol, and PEG-c-DOMG were prepared at concentrations of 50 mM in ethanol and stored at -20°C. The lipids were combined to yield various molar ratios (see individual Examples below) and diluted with ethanol to a final lipid concentration of 25 mM. siRNA stock solutions at a concentration of 10 mg/mL in H2O were diluted in 50 mM sodium citrate buffer, pH 3. KL22 and KL52 are sometimes referred to as XL 7 and XL 10, respectively, in the Examples that follow.

[00468] The lipid nanoparticle (LNP) formulations were prepared by combining the lipid solution with the siRNA solution at total lipid to siRNA weight ratio of 7: 1. The lipid ethanolic solution was rapidly injected into the aqueous siRNA solution to afford a suspension containing 33 % ethanol. The solutions were injected by the aid of a syringe pump (Harvard Pump 33 Dual Syringe Pump Harvard Apparatus Holliston, MA).

[00469] Subsequently, the formulations were dialyzed 2 times against phosphate buffered saline (PBS), pH 7.4 at volumes 200-times that of the primary product using a Slide-A-Lyzer cassettes (Thermo Fisher Scientific Inc. Rockford, IL) with a MWCO of 10 kD (RC membrane) to remove ethanol and achieve buffer exchange. The first dialysis was carried out at room temperature for 3 hours and then the formulations were dialyzed overnight at 4°C. The resulting nanoparticle suspension was filtered through 0.2 pm sterile filter (Sarstedt, Numbrecht, Germany) into glass vials and sealed with a crimp closure.

General Procedure 3: LNP Characterization

[00470] Particle size and zeta potential of formulations were determined using a Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) in IX PBS and 15 mM PBS, respectively.

[00471] The siRNA concentration in the liposomal formulation was measured by UV-vis. Briefly, 100 mL of the diluted formulation in IX PBS was added to 900 mL of a 4:1 (v/v) mixture of methanol and chloroform. After mixing, the absorbance spectrum of the solution was recorded between 230 run and 330 ran on a DU 800 spectrophotometer (Beckman Coulter, Beckman Coulter, Inc., Brea, CA). The siRNA concentration in the liposomal formulation was calculated based on the extinction coefficient of the siRNA used in the formulation and on the difference between the absorbance at a wavelength of 260 ran and the baseline value at a wavelength of 330 nm.

[00472] Encapsulation of siRNA by the nanoparticles was evaluated by the Quant- iT™ RiboGreen® RNA assay (Invitrogen Corporation Carlsbad, CA). Briefly, the samples were diluted to a concentration of approximately 5 pg/niL in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5 ). 50 mL of the diluted samples were transferred to a polystyrene 96 well plate, then either 50 mL of TE buffer or 50 mL of a 2 % Triton X-100 solution was added. The plate was incubated at a temperature of 37 °C for 15 minutes. The RiboGreen reagent was diluted 1:100 in TE buffer, 100 mL of this solution was added to each well. The fluorescence intensity was measured using a fluorescence plate reader (Wallac Victor 1420 Multilabel Counter; Perkin Elmer, Waltham, MA) at an excitation wavelength of -480 nm and an emission wavelength of -520 nm. The fluorescence values of the reagent blank were subtracted from that of each of the samples and the percentage of free siRNA was determined by dividing the fluorescence intensity of the intact sample (without addition of Triton X-100) by the fluorescence value of the disrupted sample (caused by the addition of Triton X-100).

General Procedure 4: Animal Experiments [00473] Mouse strain C57BL/6N was used for ail in vivo experiments. Animals were obtained from Charles River (Sulzfeld, Germany) and were between 6 and 8 weeks old at the time of experiments. Intravenously administered formulations were injected by infusion of 200 mL into the tail vein. Subcutaneously administered compounds were injected in a volume of 100-200 mL. Blood was collected by submandibular vein bleed the day before injection (“prebleed”) and during the experiment post injection at times indicated. Serum was isolated with serum separation tubes (Greiner Elio-One, Fiickenhausen, Germany) and kept frozen until analysis. 7 days after compound administration, mice were anaesthetized by CO₂ inhalation and killed by cervical dislocation. Blood was collected by cardiac puncture and serum isolated as described above. Tissue for mRNA quantification was harvested and immediately snap frozen in liquid nitrogen.

Additional General Procedure 1: Single Chain Oligonucleotide Synthesis

[00474] Oligoribonucleotides were assembled on AEI 394 and 3900 synthesizers (Applied Biosystems) at the 10 mmol scale, or on an Oligopiiot 10 synthesizer at 28 mihoΐ scale, using phosphoramidite chemistry. Solid supports were polystyrene loaded with 2’- deoxythymidine (Glen Research, Sterling, Virginia, USA), or controlled pore glass (CPG, 520A, with a loading of 75 mmol /g, obtained from Prime Synthesis, Aston, PA, USA) Ancillary synthesis reagents, DNA-, T -O-Methyl RNA-, and 2’-deoxy-2’-fluoro-RNA phosphoramidites were obtained from SAFC Proligo (Hamburg, Germany). Specifically,

5 ’ -O-(4,4’ -dimethoxytrityl)-3 ’ -O-(2-cyanoethyl-N,N-diisopropyl) phosphoramidite monomers of T -O-methyl -uridine (2’-OMe-U), 4-N-acetyl-2’-O-methyl-cytidine (2’- OMe-CAc), 6-N-benzoyl-2’-O-methyl-adenosine (2’-OMe-Abz) and 2-N- isobutyrlguanosine (2’-OMe-GiBu) were used to build the oligomer sequences. 2’-Fluoro modifications were introduced employing the corresponding phosphoramidites carrying the same nucleobase protecting groups as the 2’-OMe RNA building blocks. Coupling time for all phosphoramidites (70 mM in Acetonitrile) was 3 min employing 5-Ethylthio- lH-tetrazole (ETT, 0.5 M in Acetonitrile) as activator. Phosphorothioate linkages were introduced using 50 mM 3-((Dimethylamino-methylidene)amino)-3H-1 ,2,4-dithiazole-3- thione (DDTT, AM Chemicals, Oceanside, California, USA) in a 1:1 (v/v) mixture of pyridine and Acetonitrile. [00475] Upon completion of the solid phase synthesis including removal of the DMT group (“DMT off synthesis”) oligonucleotides were cleaved from the solid support and deproteeted using a 1:1 mixture consisting of aqueous methyl amine (41 %) and concentrated aqueous ammonia (32 %) for 3 hours at 25°C according to published methods (Wincott, F et al: Synthesis, deprotection, analysis and purification of ENA and ribozymes. Nucleic Acids Res, 23: 2677-2684 (1995).

[00476] Subsequently, crude oligomers were purified by anionic exchange HPLC using a column packed with Source Q15 (GE Healthcare) and an AKTA Explorer system (GE Healthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 (Fluka, Buchs, Switzerland) in 20 % aqueous acetonitrile and buffer B was the same as buffer A with 500 mM sodium perchlorate. A gradient of 22 % B to 42 % B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded. Appropriate fractions were pooled and precipitated with 3M NaOAc, pH=5.2 and 70 % ethanol. Pellets were collected by centrifugation. Alternatively, desalting was carried out using Sephadex HiPrep columns (GE Healthcare) according to the manufacturer’ s recommendati on s .

[00477] Oligonucleotides were reconstituted in water and identity of the oligonucleotides was confirmed by electrospray ionization mass spectrometry (ESI-MS). Purity was assessed by analytical anion-exchange HPLC.

[00478] 5’-aminohexyl linkers were introduced employing the TFA-protected hexylamino-linker phosphoramidite (Sigma-Aldrich, SAFC, Hamburg, Germany). 3’- hexyl amino-linkers were introduced using a phtalimido protected hexylamino-linker immobilized on CPG (Prime Synthesis, Aston, PA, USA). Deprotection and purification was performed as above.

Additional General Procedure 2: Generation of Thiol-terminated siRNA [00479] 3’- or 5’ -terminal thiol groups were introduced via 1-O-Dimethoxytrityl- hexyl-disulfide,l'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite linker (NueleoSyn, Olivet Cedex, France). After deprotection and purification as above each disulfide containing oligomer was reduced using Dithiothreitol (DTT) (0.1 M DTT stock solution (Sigma-Aldrich Chemie GmbH, Munich, Germany, #646563) in Triethylammonium bicarbonate buffer (TEABc, Q.1M, pH 8.5, Sigma, #90360). The oligonucleotide was dissolved in TEABc buffer (lOOmM, pH 8.5) to yield a 1 mM solution. To accomplish the disulfide reduction a 50-100 fold molar DTT excess was added to the oligonucleotide solution. The progress of the reduction was monitored by analytical AEX HPLC on a Dionex DNA Pac 200 column (4x 250 mm) obtained from Thermo Fisher. The reduced material, i.e. the corresponding thiol (C6SH), elutes prior to the starting material. After completion of the reaction, excess reagent is removed by size exclusion chromatography using a HiPrep column from GE Healthcare and water as eluent. Subsequently, the oligonucleotide is precipitated using 3 M NaOAc (pH 5.2) and ethanol and stored at minus 20 °C.

Additional General Procedure 3: General Procedure for Annealing of Single- stranded RNAs (ssRNAs) to Form Double-stranded RNA (dsRNA)

[00480] dsRNAs were generated from RNA single strands by mixing a slight excess of the required complementary antisense strand(s) relative to sense strand and annealing in 20 mM NaCl/4 mM sodium phosphate pH 6.8 buffer. Successful duplex formation was confirmed by native size exclusion HPLC using a Superdex 75 column (10 x 300 mm) from GE Healthcare. Samples were stored frozen until use

[00481] In the sequences described herein upper case letters “A”, “C”, “G” and “U” represent RNA nucleotides. Lower case letters “c”, “g”, “a”, and “u” represent 2’-O- methyl-modiiied nucleotides: “s” represents phosphorothioate; and “dT” represents deoxythymidine residues. Upper case letters A, C, G, U followed by “f ’ indicate T- fluoro nucleotides. “(SHC6)” represents a thiohexyl linker. “(DIME)” represents the cleavable homobifunctional crosslinker dithiobisrna!eirnkloethane, “C6NH2” and “C6NH” are used interchangeably to represent the aminohexyl linker. “C6SSC6” represents the dihexyldisulfide linker. “InvdT” means inverted thymidine.

Additional General Procedure 4: General Procedure to Generate Multimeric siRNAs by Sequential Annealing

[00482] Preparation of multimeric siRNAs via stepwise annealing w¾s performed in water and utilized stepwise addition of complementary strands. No heating/cooling of the solution was required. After each addition, an aliquot of the annealing solution w¾s removed and monitored for duplex formation using analytical RP HPLC under native conditions (20°C). The required amounts to combine equimolar amounts of complementary single strands were calculated based on the extinction coefficients for the individual single strands computed by the nearest neighbor method. If the analytical RP HPLC trace showed excess single strand, additional amounts of the corresponding complementary strand were added to force duplex formation (“duplex titration”).

[00483] Duplex titration was monitored using a Dionex Ultimate 3000 HPLC system equipped with a XBride 08 Ofigo BEH (2.5 pm; 2.1x50 mm, Waters) column equilibrated to 20°C. The diagnostic wavelength was 260 nm. Buffer A was 100 mM hexafluoro-isopropanol (HF!P), 16.3 mM triethylamine (TEA) containing 1 % methanol. Buffer B had the same composition except MeOH was 95 %. A gradient from 5 % to 70 % buffer B in 30 minutes was applied at a flow rate of 250 mL/min. The two complementary strands were run independently to establish retention times. Then the aliquot containing the duplex solution was analyzed and compared to the retention times of the constituent single strands. In case the duplex solution showed a significant amount of singl e strand the corresponding complementary strand was added to the duplex solution.

Example 1: Generation of Thiol-terminated siRNA

[00484] Where necessary 3’- or 5’ -terminal thiol groups were introduced via l-O- Dimethoxytri tyl-hexyl-di sulfide, r-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite linker (NucleoSyn, Olivet Cedex, France). Upon completion of the solid phase synthesis and final removal of the DMT group (“DMT off synthesis”) oligonucleotides were cleaved from the solid support and deprotected using a 1:1 mixture consisting of aqueous methy!amine (41 %) and concentrated aqueous ammonia (32 %) for 6 hours at 10°C. Subsequently, the crude oligonucleotides were purified by anion-exchange high- performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany) Purified (C₆SSCe)-oligonucleotides were precipitated by addition of ethanol and overnight storage in the freezer. Pellets were collected by centrifugation. Oligonucleotides were reconstituted in water and identity of the oligonucleotides was confirmed by electrospray ionization mass spectrometry (ESI-MS). Purity was assessed by analytical anion-exchange and RP HPLC.

[00485] Each disulfide containing oligomer was then reduced using a 100 mM DL- Dithiothreitol (DTT) solution. 1.0 M DTT stock solution (Sigma- Aldrich Chemie GmbH, Munich, Germany, #646563) was diluted with Triethylammonium bicarbonate buffer (TEABc, IM, pH 8.5, Sigma, #90360) and water to give a solution 100 mM each in DTT and TEABc. The oligonucleotide was dissolved in TEABc buffer (lOOmM, pH 8.5) to yield a 1 mM solution. To accomplish the disulfide reduction a 50-100 fold molar DTT excess is added to the oligonucleotide solution. The progress of the reduction rvas monitored by analytical AEX HPLC on a Dionex DNA Pae 200 column (4x 250 mm) obtained from Thermo Fisher. The reduced material, i.e. the corresponding thiol (C6SH), elutes prior to the starting material. After completion of the reaction, excess reagent is removed by size exclusion chromatography using a HiPrep column from GE Healthcare and water as eluent. Subsequently, the oligonucleotide is precipitated using 3 M NaOAc (pH 5.2) and ethanol and stored at minus 20 °C.

Example 2: General Procedure for Preparation of Mono-DTME Oligomer

[00486] Thiol modified oligonucleotide was dissolved in 300 mM NaOAc (pH 5.2) containing 25 % acetonitrile to give a 20 OD/mL solution. 40 equivalents dithiobismaleimidoethane (DTME, Thermo Fisher, # 22335) were dissolved in acetonitrile to furnish a 15.6 mM solution. The DTME solution was added to the oligonucleotide-containing solution and agitated at 25 °C on a Thermomixer (Eppendorf, Hamburg, Germany). Progress of the reaction was monitored by analytical AEX HPLC using a Dionex DNA Pac200 column (4x 250 mm). Depending on the required purity level excess DTME is either removed by size exclusion HPLC using a HiPrep column (GE Healthcare) or the crude reaction mixture is purified by preparative AEX HPLC using a column packed with Source 15 Q resin commercially available from GE Healthcare.

Example 3: General Procedure for Preparation of Dimer via DTME Functionality [00487] The DTME modified oligonucleotide prepared according to the procedure in Example 2 was reacted with another oligonucleotide equipped with a thiol linker. This reaction could either be carried out on the single-stranded sequence or after prior annealing of the complementary oligonucleotide of one of the reaction partners. Consequently, if desired, the DTME modified oligonucleotide w'as reacted with the thiol modified oligonucleotide directly, or was annealed with its complementary strand and the resulting duplex reacted with the thiol modified oligonucleotide. Alternatively, the thiol modified oligonucleotide was annealed with its complementary strand and this duplex reacted with the DIME modified single strand. In all cases the reaction was carried out in aqueous solution in the presence of 300 rnM NaOAc (pH 5.2).

Example 4: General Procedure for Annealing of Single-stranded RNAs (ssRNAs) to Form Double-stranded RNA (dsRNA)

[00488] dsRNAs were generated from RNA single strands by mixing equimolar amounts of complementary sense and antisense strands and annealing in 20 mM NaCl/4 mM sodium phosphate pH 6.8 buffer. Successful duplex formation was confirmed by native size exclusion HPLC using a Superdex 75 column (10 x 300 mm) from GE Healthcare. Samples were stored frozen until use.

Example 5: General Procedure for Preparation of 3’- or 5’- NEh Derivatized Oligonucleotides

[00489] RNA equipped with a C-6-aminolinker at the 5 '-end of the sense strand was produced by standard phosphoramidite chemistry on solid phase at a scale of 140 mmol using an AKTA Oligopilot 100 (GE Healthcare, Freiburg, Germany) and controlled pore glass (CPG) as solid support (Prime Synthesis, Aston, PA, USA). Oligomers containing 2 '-O-methyl and 2’-F nucleotides wore generated employing the corresponding 2’-OMe-phosphoramidites, 2 '-F -methyl phosphoramidites. The 5’- ami nohexyl linker at the 5 ’-end of the sense strand was introduced employing the TFA- protected hexylaminolinker phosphoramidite (Sigma- Aldrich, SAFC, Hamburg, Germany). In case the hexylamino-linker was needed at the 3’ -position, a phtalimido protected hexyl amino-linker immobilized on CPG (Prime Synthesis, Aston, PA, USA) was used. Cleavage and deprotection was accomplished using a mixture of 41 % methyl amine in water and concentrated aqueous ammonia (1:1 v/v). Crude oligonucleotides were purified using anion exchange HPLC and a column (2.5 x 18 cm) packed with Source 15Q resin obtained from GE Healthcare

Example 6: General Method for Ligand Conjugation

[00490] The trivaient GaiNAc ligand was prepared as outlined in Hadwiger et al ., patent application US2012/0157509 Al. The corresponding carboxylic acid derivative was activated using NHS chemistry according to the following procedure: [00491] 3GalNAc-COOH (90 mmol , 206 mg) was dissolved in 2.06 mL DMF. To this solution N-Hydroxysuccinimide (NHS, 14.3 mg (99 mmol , 1.1 eq.) and Diisopropylcarbodiimide (DIC, 18.29 mL, 1.05 eq., 94 mmol ) were added at 0°C. This solution was stirred overnight at ambient temperature. Completion of the reaction was monitored by TLC (DCM:MeOH=9:l).

[00492] The precursor oligonucleotide equipped with an aminohexyl linker was dissolved in sodium carbonate buffer (pH 9.6):DMSO 2:3 v/v to give a 44 mM solution. To this solution an aliquot of the NHS activated GalNAc solution (1.25 eq, 116 mL) was added. After shaking for 1 hour at 25°C, another aliquot (116 mL) of the NHS activated GalNAc was added. Once RP HPLC analysis showed at least more than 85 % conjugated material, the crude conjugate was precipitated by addition of ethanol and storage in the freezer overnight. The pellet was collected by centrifugation. The pellet was dissolved in 1 mL concentrated aqueous ammonia and agitated for 4 hours at room temperature in order to remove the O-acetates from the GalNAc sugar residues. After confirmation of quantitative removal of the O-acetates by RP HPLC ESI MS, the material was diluted with 100 mM Triethyl ammonium acetate (TEAA) and the crude reaction mixture was purified by RP HPLC using an XBridge Prep C18 (5 mm, 10x 50 mm, Waters) column at 60 °C on an AKTA explorer HPLC system. Solvent A was 100 mM aqueous TEAA and solvent B was 100 mM TEAA in 95 % CAN, both heated to 60 °C by means of a buffer pre-heater. A gradient from 5 % to 25 % B in 60 min with a flow rate of 3.5 mL/min was employed. Elution of compounds was observed at 260 and 280 nm. Fractions with a volume of 1.0 ml were collected and analyzed by analytical RP HPLC/ESI-MS. Fractions containing the target conjugate with a purity of more than 85 % were combined. The correct molecular weight was confirmed by ESI/MS.

Example 7: General Procedure to Generate Dimeric, Trimeric and Tetrameric siRNAs by Sequential Annealing

[00493] For the preparation of dimeric, trimeric and tetrameric siRNAs, a stepwise annealing procedure was performed. The annealing was performed in water and utilized stepwise addition of complementary strands. No heating/cooling of the solution was required. After each addition, an aliquot of the annealing solution was removed and monitored for duplex formation using analytical RP HPLC under native conditions (20°C). The required amounts to combine equimolar amounts of complementary single strands were calculated based on the extinction coefficients for the individual single strands computed by the nearest neighbor method. If the analytical RP HPLC trace showed excess single strand, additional amounts of the corresponding complementary strand were added to force duplex formation (“duplex titration”).

[00494] Duplex titration was monitored using a Dionex Ultimate 3000 HPLC system equipped with a XBride Cl 8 Oligo BEH (2.5 pm; 2,1x50 mm, Waters) column equilibrated to 20°C. The diagnostic wavelength was 260 nm. Buffer A was 100 mM hexafluoro-isopropanol (HTTP), 16.3 mM triethylamine (TEA) containing 1 % methanol. Buffer B had the same composition except MeOH was 95 %. A gradient from 5 % to 70 % buffer B in 30 minutes was applied at a flow rate of 250 mL/min The two complementary strands were run independently to establish retention times. Then the aliquot containing the duplex solution was analyzed and compared to the retention times of the constituent single strands. In case the duplex solution showed a significant amount of single strand the corresponding complementary strand was added to the duplex solution.

Example 8: Synthesis of Homo-tetramer

[00495] Multimeric oligonucleotide according to the disclosure can be synthesized by any of the methods disclosed herein. Two example methods are provided below for homo-tetramers. These Examples can be readily adapted to synthesize longer multimers (e.g., pentamers, hexarners, etc.)

[00496] A homo-tetrameric siRNA with linkages on a single strand can be synthesized by preparing a tetramer of the sense strand, each sense strand linked via a cleavab!e linker, on a synthesizer and then subsequently adding a targeting ligand and annealing the anti-sense strands. The cleavable linkers of the sense strand may be disulfides (as shown) or other labile linkages (e.g., chemically unmodified nucleic acid sequences such as UUU/Uridine-Uridine-Uridine).

[00497] Variations on the scheme can include using alternative linkers, linking anti-sense strands and annealing sense strands, synthesizing longer multimers, or where the technical limits of machine-based synthesis are reached, synthesizing one or more multimers and then joining said multimers together using one or more solution phase chemical reactions (e.g., synthesizing two tetramers per scheme 1, one with ligand, the other without, one or both strands modified, as appropriate, with a functional group to facilitate linking, and then linking the two tetramers together via the formation of a covalent bond, with or without the addition of a linking moiety such as, e.g., DIME).

[00498] Alternatively, the homo-tetramer could be assembled with linkages on alternating strands.

Example 9: Synthesis of Ligand Conjugates

[00499] A ligand conjugate can be synthesized as follows:

[00500] 3’-Sulfydryl derivatives of both sense and antisense strands of the monomer are synthesized:

(Structure 61) (Structure 62)

[00501] Portions of each are converted to the corresponding mono-maleimide derivative:

(Structure 63) (Structure 64)

[00502] A portion of the sense-strand maieimide derivative thus obtained is then treated with a sulfhydryl derivative of the targeting ligand of choice:

(Structure 65)

[00503] A slight molar excess of anti-sense-maleimide derivative is then added and the desired ligand-ds-siRNA-maleimide product isolated by preparative chromatography:

(Structure 66)

[00504] A slight molar excess of each of the sense and anti-sense components of the homo-tetramer are then added in the sequence, the products at each step being purified by preparative chromatography when required. Example 10: Synthesis of Multimeric Oligonucleotides

[00505] Multimeric oligonucleotide according to the disclosure can be synthesized by any of the methods disclosed herein or adapted from the art. Example methods are provided below for homo-mu! timers, but the present synthesis can also be readily adapted to synthesize hetero-multimers.

[00506] These Examples can also be adapted to synthesize mu!timers of different lengths. For example, one can use essentially the same synthesis and linking chemistry to combine a tetramer and monomer (or trimer and dimer) to produce a pentamer. Likewise, one can combine a tetramer and a trimer to produce a septamer, etc. Complementary' linking chemistries (e.g., click chemistry) can be used to assemble larger multimers.

Example 11 A: Synthesis of Homo-Tetramer of siRNA Via Pre-Synthesized

Homodimers

[00507] Step 1 : A sense strand homodimer is synthesized wherein the two sense strands are linked by a nuclease cleavable oligonucleotide (NA) and terminated with an amino function and a disulfide moiety.

(Structure 67)

Individual strands (for this and other steps) are synthesized as outlined above in the General Procedure: Single Chain Oligonucleotide Synthesis section. Other methods for oligonucitide strand synthesis, linking, and chemical modification can be adapted from the art.

[00508] Step 2: A tri-antennary GalNAc ligand is then added to the terminal amino function of one part of the sense strand homo-dimer via reaction with an acyl activated triantennary GalNAc ligand.

(Structure 68)

[00509] Step 3: The remainder of the sense strand homodimer is treated with a molar excess of dithiothreitol to cleave the disulfide group to generate a thiol terminated sense strand homodimer.

(Structure 69)

[00510] Step 4: This material is mono-derivatized with dithiobismaleimidoethane (DTME) according to the procedure used to prepare hetero-multimers (see above).

(Structure 70)

[00511] Step 5: The disulfide group of the GalNAc derivitized homodimer is also cleaved by treatment with a molar excess of dithiothreitol.

(Structure 71)

[00512] Step 6: The GalNAc terminated homodimer is then linked to the mono- DTME derivatized homodimer via reaction of the terminal thiol-group to yield single- stranded homo-tetramer. “-S-CL-S-” represents the cleavable disulfide group in DTME, e.g., a Cleavable linker (CL).

(Structure 72)

[00513] Step 7: This material is then annealed with 4 molecular equivalents of antisense monomer to yield the desired double-stranded homo-tetramer (this annealing step is optional and can be omitted, for example to prepare single-stranded multimers such as antisense oligonucleotides).

(Structure 73)

Example 11B: Synthesis of Homo-Hexamer of siRNA Via Presynthesized Homodimer and Homo-tetramer

[00514] Step 1 : A sense strand homo-tetramer is synthesized wherein the four sense strands are linked by a nuclease cleavable oligonucleotide and terminated with an amino function and a disulfide moiety.

(Structure 74)

[00515] Step 2: This material is treated with a molar excess of dithiothreitol to cleave the disulfide group

(Structure 75)

[00516] Step 3: This material is monoderivatized with dithiobismaleimidoethane (DTME) according to the procedure used to prepare hetero-mul timers (see above).

(Structure 76)

[00517] Step 4: This material is reacted with the thiol terminated GalNAc homodimer to yield the single-stranded homo-hexamer.

(Structure 77)

[00518] Note: In Structures 77, 78, 81, 82, 89, and 91, a single contiguous structure is broken into two parts by the symbol

[00519] Step 5: This material is then annealed with 6 molecular equivalents of antisense monomer to yield the desired double-stranded homo-hexamer (this annealing step is optional and can be omitted, for example to prepare single-stranded multimers such as antisense oligonucleotides).

(Structure 78)

Example 11C: Synthesis of Homo-Octamer of siRNA Via Presynthesized Honso- tetramer [00520] Step 1 : One part of the amino-terminal homo-tetramer synthesized above is converted to the corresponding GalNAc derivative by reaction with an acyl activated triantennary GalNAc ligand.

(Structure 79)

[00521] Step 2: This material is treated with a molar excess of dithiothreitol to cleave the disulfide group

(Structure 80)

[00522] Step 3: This material is reacted with the mono-DTME derivatized tetramer to yield the terminal GalNAc derivatized single-stranded octamer.

(Structure 81)

[00523] Step 4: This material is then annealed with 8 molecular equivalents of antisense monomer to yield the desired double-stranded homo-octamer (this annealing step is optional and can be omitted, for example to prepare single-stranded multimers such as antisense oligonucleotides).

(Structure 82) Example 11D: Synthesis of Homo-Dodecamer of Anti-Sense Oligonucleotide via Pre-synthesized Homo-tetramers Using Combination of Thiol/maleimide and Azide/aeetylene (“Click”) Linkers

[00524] Step 1 : A homo-tetramer of anti-sense oligonucleotides is synthesized containing 3 nuclease cleavable oligonucleotide linkers and terminal disulfide and amino groups

(Structure 83)

[00525] Step 2: This material is converted to the corresponding GalNAc derivative by reaction with an acyl activated triantennary GalNAc ligand.

(Structure 84)

[00526] Step 3: This material is treated with a molar excess of dithiothreitof to cleave the disulfide group

(Structure 85)

[00527] Step 4: Separately, a homo-tetramer of anti-sense oligonucleotides is synthesized containing 3 nuclease cleavable oligonucleotide linkers and terminal disulfide and azide groups.

(Structure 86)

[00528] Step 5: This material is treated with a molar excess of dithiothreitol to cleave the disulfide group

(Structure 87)

[00529] Step 6: This material is mono-derivatized with dithiobismaleimidoethane (DIME) according to the procedure used to prepare siRNA hetero-multimers (see above).

(Structure 88)

[00530] Step 7: This material is reacted with the thiol -terminated GalNAc derivatized tetramer to yield the terminal GalNAc derivatized single-stranded anti-sense octamer.

(Structure 89)

[00531] Step 8: Separately, a third honio-tetramer of anti-sense oligonucleotides is synthesized containing 3 nuclease cleavab!e oligonucleotide linkers and a terminal acetylene group. The latter can be underivatized or a sterically strained derivative such as dibenzocyclooctyne (DBCO, Glen Research, VA, USA)

(Ex Synthesiser)

(Structure 90)

[00532] Step 9: This material is then reacted with the azide-terminated octamer prepared in Step 7 to yield the desired Anti-Sense Homo-Dodecamer. If the terminal acetylene on the tetramer is underivatized a metal salt catalyst such as copper 1 chloride will be required to effect the linking. By contrast if the terminal acetylene is DBCO then the coupling reaction will be spontaneous.

(Structure 91)

[00533] This methodology, or methods using alternative linking chemistry, can also be used to make muitirners of other lengths (e.g., 9, 10, 11, 13, 14, 15, ... oligonucleotides). Such multi mers can be made double-stranded by annealing the single- stranded multimer with complementary oligonucleotides.

Example 12: Synthesis of a Panel of siRNA Oligomers from 1- to 8-mer

[00534] An siRNA sequence targeting Hit mRNA is selected from the literature or from discovery. The sequence is designed with chemical modification (including, as appropriate, phosphorothioate content and pattern) according to strategies from the literature or from discover_}'.

[00535] The siRNA sequence is used to manufacture a range of siRNA oligomers from monomer to octamer. 1-6-mers are obtained directly from the synthesizer and 7- and 8-mers via a pentamer and hexamer, respectively, being linked to a dimer via a mono-DTME derivative to give the disulfide linked products, as is depicted in FIG. 1 from an earlier experiment (Example 23 below) involving siRNA targeting FVII. Each of the oligomers is labeled with Cy3.

Example 13: Distribution Study of the 1- to 8-mer Panel of siRNA Oligomers After

Intrastriatal Injection

[00536] The panel of Htt siRNA oligomers (Cy-3 labeled) is administered separately to mice or larger mammal such as nonhuman primate via a single intrastriatal injection of an appropriate dose, e.g., 50 ug. The dose of injected compounds is defined by guide stand concentration (e.g., an injection of the siRNA dimer included half the number of molecules compared to the mono-siRNA injection). siRNA distribution is measured via siRNA guide strand accumulation at 48 hours post-injection and the results analyzed. Distribution is measured in in all CNS regions, including prefrontal, medial and posterior cortices, striatum, hippocampus, thalamus, hypothalamus, cerebellum, brain stem and cervical, thoracic and lumbar sections of the spinal cord.

Example 14: Distribution Study of the 1- to 8-mer Panel of siRNA Oligomers After CSF Injection

[00537 ] The same panel of Htt siRNA oligomers (Cy-3 labeled) is administered separately to mice or larger mammal such as nonhuman primate via intracerebroventricularly (ICV) injection of an appropriate dose, e.g., 475 ug (237 ug/ventiicle). siRNA distribution is measured via siRNA guide strand accumulation at 48 hours post-injection and the results analyzed. siRNA distribution was measured in all brain regions, including prefrontal, medial and posterior cortices, striatum, hippocampus, thalamus, hypothalamus, cerebellum, brain stem and cervical, thoracic and lumbar sections of the spinal cord at 48 hours post-injection and the results analyzed. Distribution was measured in in all CNS regions, including prefrontal, medial and posterior cortices, striatum, hippocampus, thalamus, hypothalamus, cerebellum, brain stem and cervical, thoracic and lumbar sections of the spinal cord

Example 15: Knockdown Study of Selected Oligomers

[00538] Oligomers selected from Example 13 and/or Example 14 for their broad distribution pattern are separately administered to wild type mice or larger mammal such as nonhuman primate at 10 ug and 50 ug doses, respectively. A monomeric siRNA is used as a positive control, and a scrambled siRNA is used as a negative control.

Silencing of Htt mRNA and/or protein is measured at intervals post-injection up to 2 weeks. Data obtained for the multimeric oligonucleotides is analyzed against monomer.

Example 17: Safety and Tolerability Studies

[00539] One or more multimeric oligonucleotides selected from Examples 12-16 are administered to mice or larger mammal such as nonhuman primate at appropriate doses over a 6-month period of time, along with appropriate controls. Neuronal viability is assessed by measuring DARPP32 protein expression. Microglia activation and gliosis is evaluated by measuring IBA-1 and glial fibrillary acidic protein (GFAP), which are markers of immune stimulation. A comprehensive blood chemistry panel is also run at appropriate time points.

Example 18: Multimeric oligonucleotides used in vivo in xenograft mouse model [00540] A homo-trimer, -tetramer and -hexamer of an siRNA complementary to EGFR mRNA is manufactured according to previously described methods and protocols. Each is separately administered to mice xenografted with glioblastoma tumors by i) intraparenchymal and ii) ICV injection. A monomeric control and a scrambled control are likewise administered. The sizes of the tumor grafts are measured over time, for all samples. The sizes of the tumor grafts measured over time from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% smaller when compared to sizes of the tumor grafts measured over time from mice administered the monomeric or scrambled siRNA controls.

Example 19: Synthesis of a homotetramer targeting TTR - Scheme 1

[00541] A homo-tetramer of siRNA targeting TTR is synthesized by linking two double-stranded homodimers ex synthesizer according to Scheme 1 (FIG. 2). The dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkyl amino and disulfide groups at either end. After addition of triantennary GalNAc ligand to the amino termini and cleavage of the disulfide to yield the corresponding thiol, the tetrameric single stranded sense strand is prepared via addition of DIME. Addition of 4 equivalents of TTR antisense strand affords the bis(triantennary GalNAc) homo-tetrarneric siTTR

[00542] The bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined

[00543] As a control, a monomeric siRNA targeting TTR is administered via SC and compared against the results of the homo-tetramer. The level of TTR protein in blood sample from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.

[00544] The method described herein may be used to make the multimeric oligonucleotide represented by Structure B:

wherein (GalNAc^ is tri-antennary GalNAc; NH is a secondary amine; dT is a deoxythymidine residue; and -S-CL-S- is

Example 20: Synthesis of a homotetramer targeting TTR - Scheme 2 [00545] A homo-tetramer of siRNA targeting TTR is synthesized by linking two ds homodimers ex synthesizer according to Scheme 2 (FIG. 3) The dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkyl amino and disulfide groups at either end A triantennary GalNAc ligand is added to the amino terminus of one portion of the strands and after cleavage of the disulfide to yield the corresponding thiol, is converted to corresponding mono-DTME derivative as described previously. Addition of the thiolated dimer derived from the remaining portion of single strand material ex synthesizer and subsequent annealing with 4 equivalents of affords the mono-(triantennary GalN Ac) ) homo-tetrameric si TTR.

[00546] The bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined. As a control, a monomeric siRNA targeting TTR is administered subcutaneously and compared against the results of the homo-tetramer. The level of TTR protein in blood samples from mice admini stered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.

[00547] The method described herein may be used to make the multimeric oligonucleotide represented by Structure C:

wherein (GalNAc)3 is tri-antennary GalNAc; NH₂ is a primary amine; NH is a secondary amine; dT is a deoxythymidine residue; and -S-CL-S- is

Example 21: Synthesis of a homo-tetramer targeting TTR- Scheme 3

[00548] A homo-tetramer of siRNA targeting TTR is synthesized by linking two ds homodimers ex synthesizer according to Scheme 3 (FIG. 4). The dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkyl amino and disulfide groups at either end. After addition of a mono-antennary GalNAc ligand to the amino terminus and cleavage of the disulfide to yield the corresponding thiol, the tetrameric single stranded sense strand is prepared via addition of DIME. Addition of 4 equivalents of TTR antisense strand each conjugated to a monomeric GalNAc ligand affords the homo-tetrameric siTTR ligated to six monomeric GalNAc ligands.

[00549] The bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined. As a control, a monomeric siRNA targeting TTR is administered subcutaneously and compared against the results of the homo-tetramer. The level of TTR protein in blood samples from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.

[00550] The method described herein may be used to make the multimeric oligonucleotide represented by Structure E:

wherein (GalNAc)₃ is mono-antennary GalNAc, NH is a secondary' amine, dT is a deoxythymidine residue; and -S-CL-S- is

Example 22: Synthesis of a homo-tetramer targeting TTR - Scheme 4

[00551] A homo-tetramer of siRNA targeting TTR is synthesized by linking two ds homodimers ex synthesizer according to Scheme 4 (FIG. 5). The dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkyl amino and disulfide groups at either end. A triantennary GalNAc ligand is added to the amino terminus of one portion of the single stranded dimer and after cleavage of the disulfide to yield the corresponding thiol, is converted to the corresponding mono-DTME derivative as described previously. An endosome escape ligand is added to the amino terminus of the remaining portion of the strands and after cleavage of the disulfide to yield the corresponding thiol is reacted with the previously obtained mono-DTME derivative. Subsequent annealing with 4 equivalents of TTR antisense strand affords the mono- (triantennary GalNAc) homo-tetrameric siTTR conjugated with an endosome escape ligand.

[00552] The bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined. As a control, a monomeric siRNA targeting TTR is administered subcutaneously and compared against the results of the homo-tetramer. The level of TTR protein in blood samples from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.

[00553] The method described herein may be used to make the multimeric oligonucleotide represented by Structure D:

wherein (GalNAc)3 is tri-antennary Ga!NAc; NH is a secondary amine; EEM is an endosomal escape moiety; dT is a deoxythyntidine residue; and -S-CL-S- is

Example 23: Determination of the Effect of Size of Multimer on Rate of Release from Subcutaneous Tissue

[00554] A range of FVII siRNA oligomers from monomer to octamer was prepared. 1-6-mers were obtained directly from the synthesizer and 7- and 8-mers via a pentarner and hexamer, respectively, being linked to a dimer via a mono-DTME derivative to give the disulfide linked products as before (FIG. 1).

[00555] Each of the 1- to 8-mers was separately administered to C57BL/6N mice at 20 mg/kg via SC administration and blood samples taken at 5, 30, 60, 240, 600 and 1440 minutes. The samples were digested with proteinase K and a specific complementary Atto425-Peptide Nucleic Acid-fluorescent probe was added and hybridized to the FVII siRNA antisense strand. The concentration of siFVII at the various timepoints was determined by subsequent AEX-HPLC analysis.

Claims

WHAT IS CLAIMED IS:

1. A multimeric oligonucleotide comprising subunits wherein each of the subunits . independently comprises a single- or a double-stranded oligonucleotide; wherein each of the subunits ------- is joined to another subunit by a covalent linker ·; and wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

2. The multimeric oligonucleotide of claim 1, wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor whose concentration or activity is higher or lower compared to a healthy cell.

3. The multimeric oligonucleotide of claim 1 or 2, wherein at least one subunit comprises an oligonucleotide that hinds to or is active against a biomarker or biomarker precursor in a neuron or a glial cell.

4. The multimeric oligonucleotide of claim 3, wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a glial cell

5. The multimeric oligonucleotide of any of claims 1 to 4, wherein at least one subunit comprises an oligonucleotide with complementarity to an mRNA that is over-expressed in a CNS cell.

6. The multimeric oligonucleotide of any of claims 1 to 5, wherein at least one subunit comprises an oligonucleotide that activates expression of an mRNA that is under-expressed in a CNS cell.

7. The multimeric oligonucleotide of any of claims 1 to 6, wherein at least one subunit ...... comprises a single-stranded oligonucleotide that is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

8. The multimeric oligonucleotide of any of claims 1 to 6, wherein all of the subunits - ----- - in the multimeric oligonucleotide comprise a single-stranded oligonucleotide that is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

9. The multimeric oligonucleotide of any of claims 1 to 8, wherein each subunit - ----- - independently contains fewer than 5 phosphorothioate groups.

10. The multimeric oligonucleotide of claim 9, wherein each subunit . independently contains fewer than 4 phosphorothioate groups.

11 The multimeric oligonucleotide of claim 10, wherein each subunit ------- independently contains fewer than 3 phosphorothioate groups

12. The multimeric oligonucleotide of any of claims 1 to 11, wherein each subunit ------- independently comprises less than 75% chemically modified nucleotides

13. The multimeric oligonucleotide of claim 12, wherein each subunit ------- independently comprises less than 80% chemically modified nucleotides.

14. The multimeric oligonucleotide of any of claims 1 to 13, wherein at least one subunit .-.-.-. is different from another subunit · ·_{* * *}·.

15. The multimeric oligonucleotide of any of claims 1 to 13, wherein all of the subunits ------- are different.

16. The multimeric oligonucleotide of any of claims 1 to 15, wherein at least two subunits are joined by a covalent linker ● between the 3’ end of a first subunit and the 5’ end of a second subunit.

17. The multimeric oligonucleotide of any of claims 1 to 15, wherein at least two subunits are joined by a covalent linker ● between the 5’ end of a first subunit and the 3 ’ end of a second subunit.

18. The multimeric oligonucleotide of any of claims 1 to 15, wherein at least two subunits are joined by a covalent linker ● between the 5' end of a first subunit and the 5’ end of a second subunit

19. The multimeric oligonucleotide of any of claims 1 to 18, wherein at least one subunit - ----- - comprises a double-stranded oligonucleotide that comprises an active strand and an inactive passenger strand; or wherein all of the subunits in the multimeric oligonucleotide comprise double-stranded oligonucleotides, each of which comprises an active strand and an inactive passenger strand

20. The multimeric oligonucleotide of any of claims 1 to 19, wherein the multimeric oligonucleotide includes one or more chemically modified nucleotides, but does not contain three identical chemical modifications on three consecutive nucleotides.

21. The multimeric oligonucl eotide of any of claims 1 to 20, wherein the multimeric oligonucleotide does not include a double-stranded subunit - ------ having a sense and an antisense strand, wherein the sense and antisense strands comprise Structure F : sense strand: 5’ n_p - N_{a -} (XXX)i - N_{b -} YYY -N_b - (ZZZ)_{j -} N_a - n_q 3' antisense: 3' np' - Na' - (X’X'X')k - Nb' - YYY^' - Nb' - (Z'Z'Z')i - N_a' - nq' 5' wherein: i, j, k, and 1 are each independently 0 or 1; p, p', q, and q' are each independently 0-6; each N_a and N_a' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N_b and Nf independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n_p', n_p, n_{q ,} and n_q independently represents an overhang nucleotide or may not be present; and

XXX, YYY, ZZZ, X'X'X’, UΎΎ', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

22. The multimeric oligonucleotide of any of claims 1 to 21, wherein the multimeric oligonucleotide comprises Structure B:

wherein: each FM is independently a functional moiety, a targeting ligand, or is absent; and n is greater than or equal to zero.

23. The multimeric oligonucleotide of claim 22, wherein at least one FM that is present in the multimeric oligonucleotide is covalently bound to a terminus of the multimeric oligonucleotide.

24. The multimeric oligonucleotide of claim 22 or 23, wherein at least one FM that is present in the multimeric oligonucleotide is covalently bound to an internal subunit of the multimeric oligonucleotide.

25. The multimeric oligonucleotide of claim 22, wherein each of the termini of the multimeric oligonucleotide is covalently bound, respectively, to a FM and each of the internal subunits of the multimeric oligonucleotide is covalently bound, respectively, to a FM.

26. The multimeric oligonucleotide of any of claims 22 to 25, wherein n is 0, 1, 2, or 3.

27. The multimeric oligonucleotide of claim 26, wherein n is 2 or 3.

28. The multimeric oligonucleotide of claim 27, wherein n is 2.

29. The multimeric oligonucleotide of any of claims 22 to 25, wherein n is 4, 5, 6, 7, 8, 9, or 10.

30. The multimeric oligonucleotide of claim 29, wherein n is 4, 5, or 6.

31. The multimeric oligonucleotide of claim 30, wherein n is 4.

32. The multimeric oligonucleotide of any of claims 22 to 31, wherein all FM that are present in the multimeric oligonucleotide are the same

33. The multimeric oligonucleotide of any of claims 22 to 31, wherein at least one FM that is present in the multimeric oligonucleotide is different from any other FM that is also present in the oligonucleotide.

34. The multimeric oligonucleotide of any of claims 22 to 31, wherein each FM that is present in the multimeric oligonucleotide is different from any other FM that is present in the oligonucleotide.

35. The multimeric oligonucleotide of any of claims 22 to 34, wherein at least one FM that is present in the multimeric oligonucleotide is a fatty acid, steroid, secosteroid, lipid, gang!ioside, nucleoside analog, endocannabinoid, vitamin, cholesterol, Lithocholic acid (LCA), Eicosapentaenoic acid (EPA), Docosahexaenoic acid (DHA), DHA with a phosphocholine head group, Docosanoic acid (DCA), choline, vitamin A, vitamin E, retinoic acid, alpha-tocopheryl succinate, or derivatives or metabolites thereof,

36. The multimeric oligonucleotide of any of claims 22 to 35, wherein at least one FM that is present in the multimeric oligonucleotide is an endosomal escape moiety (EEM), or an immunostimulant.

37. The multimeric oligonucleotide of claim 36, wherein the at least one FM that is present in the multimeric oligonucleotide is an endosomal escape moiety (EEM).

38. The multimeric oligonucl eotide of claim 37, wherein the EEM is chloroquine, a peptide, protein, or influenza virus hemagglutinin (HA2).

39. The multimeric oligonucleotide of any of claims 22 to 38, wherein at least one FM that is present in the multimeric oligonucleotide is a targeting ligand.

40. The multimeric oligonucl eotide of claim 39, wherein the targeting ligand is a phospholipid, aptamer, peptide, antigen-binding protein, folate, other folate receptor- binding ligand, mannose, other mannose receptor-binding ligand, or an immunostimulant.

41. The multimeric oligonucleotide of any of claims 39 to 40, wherein the targeting ligand targets a neuron or a glial cell.

42. The multimeric oligonucleotide of any of claims 39 to 40, wherein the targeting ligand targets a cancer ceil or a cancer-targeting immune cell.

43. The multimeric oligonucleotide of claim 42, wherein the targeting ligand comprises a lipophilic moiety, phospholipid, aptamer, peptide, antigen-binding protein, small molecule, vitamin, cholesterol, tocopherol, folate, folate receptor-binding ligand, mannose, mannose receptor-binding ligand, 2-[3-(1,3-dicarboxypropyl)- ureidojpentanedioic acid (DUPA), anisamide, or immunostimulant.

44. The multimeric oligonucleotide of claim 39, wherein the targeting ligand is a fatty acid, steroids, secosteroid, lipid, ganglioside, nucleoside analog, endocannabinoid, vitamins, cholesterol, Lithocholic acid (LCA), Eicosapentaenoic acid (EPA), Docosahexaenoic acid (DHA), DHA with a phosphocholine head group, Docosanoic acid (DCA), choline, vitamin A, vitamin E, retinoic acid, alpha-tocopheryl succinate, or derivatives of metabolites thereof.

45. The multimeric oligonucleotide of any of claims 1 to 44, wherein at least one of the covalent linkers ● is different from another covalent linker.

46. The multimeric oligonucleotide of any of claims 1 to 44, wherein all of the covalent linkers ● are different.

47. The multimeric oligonucleotide of any of claims 1 to 44, wherein all of the covalent linkers ● are the same.

48. The multimeric oligonucleotide of any of claims 1 to 47, wherein at least one covalent linker ● is a cleavable covalent linker.

49. The multimeric oligonucleotide of claim 48, wherein the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio- cieavable bond, or an enzyme cleavable bond.

50. The multimeric oligonucleotide of claims 48 or 49, wherein the cleavable covalent linker is cleavable under intracellular conditions.

51. The multimeric oligonucleotide of any of claims 1 to 50, wherein at least one covalent linker ● is a disulfide bond or a compound of Formula (I):

wherein:

S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each Ri is independently a C₂-C₁₀ alkyl, alkoxy, or aryl group R_?. is a thiopropionate or disulfide group; and each X is independently selected from:

52 The multimeric oligonucleotide of claim 51 , wherein the compound of Formula (I) comprises

and wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit.

53 The multimeric oligonucleotide of claim 51, wherein the compound of Formula (I) comprises

54 The multimeric oligonucleotide of claim 51 , wherein the compound of Formula (I) comprises

55. The multimeric oligonucleotide of any one of claims 51 to 54, wherein the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (II):

wherein: each R₁ is independently a C₂-C₁₀ alkyl, alkoxy, or aryl group; and R₂ is a thiopropionate or disulfide group.

56. The multimeric oligonucleotide of any of claims 1 -55, wherein at least one of the covalent linkers ● comprises a nucleotide linker.

57. The multimeric oligonucleotide of claim 56, wherein the nucleotide linker comprises 2 to 6 nucleotides.

58. The multimeric oligonucleotide of claim 57, where the nucleotide linker comprises 4 nucleotides.

59. A method for treating a subject comprising administering to the subject an effective amount of a multimeric oligonucleotide according to any of claims 1 to 58.

60. The method of claim 59, wherein the multimeric oligonucleotide comprises siRNA.

61. The method of claim 59, wherein the multimeric oligonucleotide comprises miRNA.

62. The method of any of claims 59 to 61, wherein the multimeric oligonucleotide comprises an oligonucleotide that targets a therapeutically relevant gene or gene product.

63. The method of claim 62, wherein the therapeutically relevant gene product is an mRNA that encodes an oncogene.

64. A method for silencing or reducing gene expression, comprising administering to a subject in need thereof an effective amount of a multimeric oligonucleotide according to any of claims 1 to 58, wherein the multimeric oligonucleotide comprises an oligonucleotide that silences or reduces gene expression

65. The method of claim 64, wherein the oligonucleotide is an siRNA.

66. The method of claim 64, wherein the oligonucleotide is an antisense oligonucleotide.

67. A method for silencing or reducing expression of two or more genes comprising administering to a subject in need thereof an effective amount of a multimeric oligonucleotide according to any of claims 1 to 58, wherein the multimerie oligonucleotide comprises oligonucleotides targeting two or more genes.

68. The method of claim 67, wherein the multimeric oligonucleotide comprises oligonucleotides targeting two, three, or four genes.

69. A method for delivering two or more oligonucleotides to a cell per targeting ligand binding event, comprising administering to a subject in need thereof an effective amount of a multimerie oligonucleotide according to any of claims 1 to 58, wherein the multimerie oligonucleotide comprises a targeting ligand.

70. A method for delivering a predetermined stoichiometric ratio of two or more oligonucleotides to a cell comprising administering to a subject in need thereof an effective amount of a multimerie oligonucleotide according to any of claims 1 to 58, wherein the multimerie oligonucleotide comprises a predetermined stoichiometric ratio of two or more oligonucleotides.

71. The method of any of claims 59 to 70, wherein the multimerie oligonucleotide comprises at least one oligonucleotide that targets and silences a gene transcript that is over-expressed in the subject and at least one oligonucleotide that targets and induces expression of a gene transcript that it is under-expressed in the subject.

72. The method of any of claims 59 to 71, wherein the multimerie oligonucleotide comprises an siRNA, saRNA, miRNA, aptamer, or antisense oligonucleotide.

73. The method of any of claims 59 to 72, wherein the subject is a human.

74. The method of any of claims 59 to 73, wherein the subject is in need of therapy for a disease or disorder of the CNS.

75. The method of any of claims 59 to 73, wherein the subject is in need of prophylaxis for a disease or disorder of the CNS.

76. The method of claim 74 or 75, wherein the disease or di sorder of the CNS is Huntington’s disease, Alzheimers disease, amyotrophic lateral scherosis (ALS), spinal muscular atrophy (SMA), or Angelman syndrome.

77. The method of any of claims 59 to 76, wherein the multimerie oligonucleotide is administered to the subject by intrathecal injection.

78. The method of any of claims 59 to 76, wherein the multimeric oligonucleotide is formulated to cross the blood brain barrier and administered to the subject by intravenous injection.

79. The method of any of claims 59 to 76, wherein the multimeric oligonucleotide is formulated to cross the blood brain barrier and administered to the subject by subcutaneous injection.

80. The method of any of claims 74 to 79, wherein the subject is in need of treatment or prophylaxis for Huntington’s disease.

81. The method of any of claims 74 to 79, wherein the subject is in need of treatment or prophylaxis for glioblastoma.

82. A multimeric oligonucleotide comprising subunits · - - - - - - , wherein: each of the subunits independently comprises a single- or a double-stranded oligonucleotide, and each of the subunits ...... is joined to another subunit by a covalent linker ·; the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or to a target region of the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; and each subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS.

83. The multimeric oligonucleotide of claim 82, wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor whose concentration or activity is higher or lower cell compared to a healthy cell

84. The multimeric oligonucleotide of claim 82 or 83, wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a neuron or a glial cell.

85. The multimeric oligonucleotide as in any one of claims 82-84, wherein at least one subunit comprises an oligonucleotide with complementarity to an mRNA that is overexpressed in a CNS ceil.

86. The multimeric oligonucleotide as in any one of claims 82-85, wherein at least one subunit comprises an oligonucleotide that activates expression of an mRNA that is under expressed in a CNS cell.

87. The multimeric oligonucleotide as in any one of claims 82-86, wherein the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS.

88. The multimeric oligonucleotide as in any one of claims 82-86, wherein the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or throughout a desired region of the CNS.

89. The multimeric oligonucleotide as in any one of claims 82-86, wherein the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form

90. The multimeric oligonucleotide as in any one of claims 82-89, wherein the molecular weight of the multimeric oligonucleotide is at least about 45 kD.

91. The multimeric oligonucleotide as in any one of claims 82-90, wherein the multimeric oligonucleotide comprises 2 or more subunits ......

92. The multimeric oligonucleotide as in any one of claims 82-91, wherein the multimeric oligonucleotide comprises three, four, five, six, seven, eight, nine, or ten subunits ......

93. The multimeric oligonucl eotide as in any one of claim s 82-92, wherein the multimeric oligonucleotide comprises three subunits.

94. The multimeric oligonucleotide as in any one of claims 82-92, wherein the multimeric oligonucleotide comprises four subunits.

95. The multimeric oligonucleotide as in any one of claims 82-92, wherein the multimeric oligonucleotide comprises five subunits.

96. The multimeric oligonucleotide as in any one of claims 82-92, wherein the multimeric oligonucleotide comprises six subunits .......

97. The multimeric oligonucleotide as in any one of claims 82-96, wherein at least two subunits ...... are substantially different.

98. The multimeric oligonucleotide of claim 97, wherein all of the subunits are substantially different.

99. The multimeric oligonucleotide as in any one of claims 82-97, wherein at least two subunits ...... are substantially the same or are identical.

100. The multimeric oligonucleotide as in claim 99, wherein all of the subunits ...... are substantially the same or are identical.

101. The multimeric oligonucleotide as in any one of claims 82-100, wherein the multimeric oligonucleotide comprises a hetero-multimer of six or more subunits

_{^ y/}herein at least two subunits ...... are substantially different

102. The multimeric oligonucleotide as in any one of claims 82-101, wherein each subunit . independently comprises 10-30, 17-27, 19-26, or 20-25 nucleotides in length.

103. The multimeric oligonucleotide as in any one of claims 82-102, wherein one or more subunits are double-stranded.

104. The multimeric oligonucleotide as in any one of claims 82-103, wherein one or more subunits are single-stranded.

105. The multimeric oligonucleotide as in any one of claims 82-104, wherein the subunits comprise a combination of single-stranded and double- stranded oligonucleotides.

106. The multimeric oligonucleotide as in any one of claims 82-105, wherein one or more nucleotides within an oligonucleotide comprises an RNA, a DNA, or an artificial or non-natural nucleic acid analog.

107. The multimeric oligonucleotide as in any one of claims 82-106, wherein at least one of the subunits comprise RNA.

108. The multimeric oligonucleotide as in any one of claims 82-107, wherein at least one of the subunits comprises a siRNA, a saRNA, or a miRNA.

109. The multimeric oligonucleotide as in any one of claims 82-108, wherein at least one of the subunits comprises an antisense oligonucleotide.

110. The multimeric oligonucleotide as in any one of claims 82-109, wherein at least one of the subunits comprises a double-stranded siRNA.

111. The multimeric oligonucleotide of claim 110, wherein two or more siRNA subunits are joined by covalent linkers attached to the sense strands of the siRNA.

112. The multimeric oligonucl eotide of claim 110, wherein two or more siRNA subunits are joined by covalent linkers attached to the antisense strands of the siRNA.

113. The multimeric oligonucleotide of claim 110, wherein two or more siRNA subunits are joined by covalent linkers attached to the sense strand of a first siRNA and the antisense strand of a second siRNA.

114. The multimeric oligonucleotide as in any one of claims 82-113, wherein one or more of the covalent linkers ● comprise a cleavable covalent linker.

115. The multimeric oligonucleotide of claim 114, wherein the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio- cleavable bond, or an enzyme cleavable bond

116. The multimeric oligonucleotide as in any one of claims 114 and 115, in which the cleavable covalent linker ●is cleavable under intracellular conditions.

117. The multimeric oligonucleotide as in any one of claims 82-113, wherein one or more of the covalent linkers comprise a noncleavable linker.

118. The multimeric oligonucleotide as in any one of claims 82-116, wherein at least one covalent linker comprises a disulfide bond or a compound of Formula (I):

wherein:

S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each Ri is independently a C2-C10 alkyl, alkoxy, or aryl group; R2 is a thiopropionate or disulfide group; and each X independently comprises :

119. The multimeric oligonucleotide of claim J 18, wherein the compound of Formula (I) comprises

and wherein S is atached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit.

120. The multimeric oligonucleotide of claim 118, wherein the compound of Formula (I) comprises

121. The multimeric oligonucleotide of claim 118, wherein the compound of Formula (I) comprises

122. The multimeric oligonucleotide of any one of claims 118-121, wherein the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (II):

wherein: each Ri comprises a C₂-C₁₀ alkyl, an alkoxy, or an aryl group; and R₂ comprises a thiopropionate or disulfide group.

123. The multimeric oligonucleotide as in any one of claims 82-122, wherein one or more of the covalent linkers · comprise a nucleotide linker.

124. The multimeric oligonucleotide of claim 123, wherein the nucleotide linker comprises 2-6 nucleotides.

125. The multimeric oligonucleotide of claim 124, wherein the nucleotide linker comprises a dinucleotide linker.

126. The multimeric oligonucleotide as in any one of claims 82-125, wherein each covalent linker ● is the same.

127. The multimeric oligonucleotide as in any one of claims 82-125, wherein the covalent linkers ● comprise two or more different covalent linkers.

128. The multimeric oligonucleotide as in any one of claims 82-127, wherein at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 3’ end of a second subunit.

129. The multimeric oligonucleotide as in any one of claims 82-127, wherein at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 5’ end of a second subunit.

130. The multimeric oligonucleotide as in any one of claims 82-127, wherein at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the 3’ end of a second subunit.

131. The multimeric oligonucleotide as in any one of claims 82-127, wherein at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the 5’ end of a second subunit.

132. The multimeric oligonucleotide as in any one of claims 82-131, wherein the multimeric oligonucleotide further comprises one or more targeting ligands

133. The multimeric oligonucleotide as in any one of claims 82-131, wherein at least one of the subunits is a targeting ligand.

134. The multimeric oligonucleotide of claim 132 or 133, wherein the targeting ligand targets a cell or tissue of the CNS.

135. The multimeric oligonucleotide of claim 134, wherein the targeting ligand is selected from the group consisting of a phospholipid, an aptamer, a peptide, an antigen- binding protein, folate and other folate receptor-binding ligands, mannose and other mannose receptor-binding ligands, and an immunostimulant.

136. The multimeric oligonucleotide of claim 135, wherein the peptide is selected from the group consisting of, APRPG, cNGR (CNGRCVSGCAGRC), F3 (KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and iRGD (CRGDKGPDC).

137. The multimeric oligonucleotide of claim 135, wherein the antigen-binding protein is an ScFv or a VHH.

138. The multimeric oligonucleotide of claim 135, wherein the immunostimulant comprises a CpG oligonucleotide.

139. The multimeric oligonucleotide of claim 134, wherein the targeting ligand targets a neuron or a glial cell.

140. The multimeric oligonucleotide of claim 134, wherein the targeting ligand is an aptamer.

141. The multimeric oligonucleotide as in any one of claims 82-140, wherein the multimeric oligonucleotide is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure.

142. The multimeric oligonucleotide as in any one of claims 82-141, wherein the multimeric oligonucleotide is formulated for in vivo CNS administration.

143. The multimeric oligonucleotide as in any one of claims 82-136, wherein the multimeric oligonucleotide is formulated for in vivo intrathecal injection.

144. The multimeric oligonucleotide of any one of claims 82-143, wherein the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

145. The multimeric oligonucleotide of claim 144, wherein the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 5-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

146. The multimeric oligonucleotide of claim 145, wherein the increase in in vivo activity of one or more subunits within the multimeric oligonucleoti de is an at least 10-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

147. The multimeric oligonucleotide as in any one of claims 85-146, wherein the mRNA overexpressed in a CNS cell comprises mRNA encoding an oncogene.

148. The multimeric oligonucleotide as in any one of claims 85-146, wherein the mRNA overexpressed in a cancer cell comprises mRNA encoded by an immune checkpoint gene.

149. The multimeric oligonucleotide as in any one of claims 82-148, wherein at least one subunit within the multimeric oligonucleotide is an SSO for the treatment of a neurodegenerative disease.

150. The multimeric oligonucl eotide as in any one of claim s 82-149, wherein at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to huntingtin mRNA.

151. The multimeric oligonucleotide as in any one of claims 82-150, wherein each of the subunits within the multimeric oligonucleotide, independently, are an si RN A with complementarity to huntingtin mRNA.

152. The multimeric oligonucleotide as in claim 151, wherein each of the subunits is complementary to the same region of the huntingtin mRNA.

153. The multimeric oligonucleotide as in claim 151, wherein one or more subunits are complementary to different regions of the huntingtin mRNA.

154. The multimeric oligonucleotide as in any one of claims 82-146, wherein at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to a cyciophilin B (Ppib) mRNA or to an apolipoprotein E (ApoE) mRNA.

155. The multimeric oligonucleotide as in any one of claims 82-146, wherein at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to an EGFR mRNA.

156. The multimeric oligonucleotide as in any one of claims 82-155, wherein the multimeric oligonucleotide comprises 3 or more subunits.

157. The multimeric oligonucleotide as in any one of claims 82-156, wherein the multimeric oligonucleotide does not comprise a branched structure wherein at least one of the covalent linkers joins three or more monomeric subunits.

158. The multimeric oligonucleotide as in any one of claim 82-157, wherein: i) the decreased clearance from the CNS; ii) the enhanced distribution throughout the CNS or throughout a desired region of the CNS, and/or iii) the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the multimeric oligonucleotide.

159. A method of delivering a multimeric oligonucleotide to a subject in need thereof the method comprising administration of an effective amount of the multimeric oligonucleotide to the subject, the multimeric oligonucleotide comprising subunits wherein: each of the subunits ------- comprises a single- or a double-stranded oligonucleotide, and each of the subunits - ------ is joined to another subunit by a covalent linker ·; and the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or to a target region of the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance from the CNS relative to an oligonucleotide administered in monomeric form; and/or the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; and each subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a cell or tissue of the CNS|

160. The method of claim 159, wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor whose concentration or activity is higher or lower compared to a healthy cell.

161. The method of claim 159 or 160, wherein at least one subunit comprises an oligonucleotide that binds to or is active against a biomarker or biomarker precursor in a neuron or a glial cell.

162 The method of any one of claims 159-161, wherein at least one subunit comprises an oligonucleotide with complementarity to an mRNA that is overexpressed in a CNS cell

163. The method of any one of claims 159-161, wherein at least one subunit comprises an oligonucleotide that activates expression of an mRNA that is underexpressed in a CNS cell .

164. The method of any one of claims 159-163, wherein the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its ciearancefrom the CNS.

165 The method of any one of claims 159-163, wherein the multimeric oligonucleotide has a molecular weight and/or size configured to enhance distribution throughout the CNS or throughout a desired region of the CNS.

166. The method of any one of claims 159-163, wherein the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form.

167. The method of any of claims 159-166, wherein the molecular weight of the multimeric oligonucleotide is at least about 45 kD.

168. The method as in any one of claims 159-167, wherein the multi meric oligonucleotide comprises 2 or more subunits.

169. The method as in any one of claims 159-168, wherein the multimeric oligonucleotide comprises two, three, four, five, six, seven, eight, nine, or ten subunits

170. The method as in any one of claims 159-169, wherein the multimeric oligonucleotide comprises three subunits.

171. The method as in any one of claims 159-169, wherein the multimeric oligonucleotide comprises four subunits.

172. The method as in any one of claims 159-169, wherein the multi meric oligonucleotide comprises five subunits.

173. The method as in any one of claims 159-169, wherein the multimeric oligonucleotide comprises six subunits .......

174. The method as in any one of claims 159-173, wherein at least two subunits _° are substantially different.

175. The method of claim 174, wherein all of the subunits are substantially different.

176. The method as in any one of claims 159-173, wherein at least two subunits ....... are substantially the same or are identical.

177. The method of claim 176, wherein all of the subunits ...... are substantially the same or are identical.

178. The method as in any one of claims 159-177, wherein the multimeric oligonucleotide comprises a hetero-mul timer of six or more subunits ......, wherein at least two subunits ...... are substantially different

179. The method as in any one of claims 159-178, wherein each subunit ....... independently comprises 10-30, 17-27, 19-26, or 20-25 nucleotides in length.

180. The method as in any one of claims 159-179, wherein one or more subunits are double-stranded.

181. The method as in any one of claims 159-180, wherein one or more subunits are single-stranded.

182. The method as in any one of claims 159-181, wherein the subunits comprise a combination of single-stranded and double-stranded oligonucleotides.

183. The method as in any one of claims 159-182, wherein one or more nucleotides within an oligonucleotide comprises an RNA, a DNA, or an artificial or non natural nucleic acid analog.

184. The method as in any one of claims 159-183, wherein at least one of the subunits comprises RNA.

185. The method as in any one of claims 159-183, wherein at least one of the subunits comprises a siRNA, a saRNA, or a miRNA.

186. The method as in any one of claims 159-186, wherein at least one of the subunits comprises an antisense oligonucleotide.

187. 1 The method as in any one of claims 159-186, wherein at least one of the subunits comprises a double-stranded siRNA.

188. The method of claim 187, wherein two or more siRNA subunits are joined by covalent linkers attached to the sense strands of the siRNA.

189. The method of claim 187, wherein two or more siRNA subunits are joined by covalent linkers attached to the antisense strands of the siRNA

190. The method of claim 187, wherein two or more siRNA subunits are joined by covalent linkers attached to the sense strand of a first siRN A and the antisense strand of a second siRNA.

191. The method as in any one of claims 159-190, wherein one or more of the covalent linkers · comprise a cleavable covalent linker

192. The method of claim 191, wberein the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.

193. The method as in any one of claims 191 and 192, in which the cleavable covalent linker is cleavable under intracellular conditions.

194. The method as in any one of claims 159-193, wherein at least one covalent linker comprises a disulfide bond or a compound of Formula (I):

wherein:

S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each R₁ compri ses a C₂-C₁₀ alkyl, alkoxy, or aryl group, R₂ comprises a thiopropionate or disulfide group; and each X independently comprises:

195. The method of claim 194, wherein the compound of Formula (I) comprises

196. The method of claim 194, wherein the compound of Formula (I) comprises

197. The method of claim 194, wherein the compound of Formula (I) comprises

198. The method of any one of claims 194-197, wherein the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (II):

wherein: each R₁ comprisesa C₂-C₁₀ alkyl, an alkoxy, or an aryl group; and R₂ comprises a thiopropionate or disulfide group.

199. The method of any one of claims 159-198, wherein one or more of the covalent linkers · comprise a nucleotide linker.

200. The method of claim 199, wherein the nucleotide linker comprises 2-6 nucleotides.

201. The method of claim 200, wherein the nucleotide linker comprises a dinucieotide linker.

202. The method of any one of claims 159-201, wherein each covalent linker · is the same.

203. The method of any one of claims 159-202, wherein the covalent linkers · comprise two or more different covalent linkers.

204. The method of any one of claims 159-203, wherein at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 3’ end of a second subunit.

205. The method of any one of claims 159-203, wherein at least two subunits are joined by covalent linkers ● between the 3’ end of a first subunit and the 5’ end of a second subunit.

206. The method of any one of claims 159-203, wherein at least two subunits are joined by covalent linkers · between the 5’ end of a first subunit and the 3’ end of a second subunit.

207. The method of any one of claims 159-203, wherein at least two subunits are joined by covalent linkers ● between the 5’ end of a first subunit and the 5’ end of a second subunit.

208. The method of any one of claims 159-206, wherein the multi meric oligonucleotide further comprises one or more targeting ligands.

209. The method of any one of claims 159-206, wherein at least one of the subunits is a targeting ligand.

210. The method of claim 208 or 209, wherein the targeting ligand targets a cell or tissue of the CNS.

211. The method of claim 210, wherein the targeting ligand is selected from the group consisting of a phospholipid, an aptamer, a peptide, anantigen-binding protein, folate and other folate receptor-binding ligands, mannose and other mannose receptor binding ligands, and an immunostimulant.

212. The method of claim 210, wherein the peptide is selected from the group consisting of cRGD, APRPG, cNGR (CNGRCVSGCAGRC), F3 (KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and iRGD (CRGDKGPDC).

213. The method of claim 210, wherein the antigen-binding protein is an ScFv or a VHH.

214. The method of claim 210, wherein the immunostimulant comprises a CpG oligonucleotide.

215. The method of claim 210, wherein the targeting ligand targets a neuron or a glial cell.

216. The method of claim 210, wherein the targeting ligand is an aptamer.

217. The method of any one of claims 159-216, wherein the multimeric oligonucleotide is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure.

218. The method of any one of claims 159-217, wherein the multimeric oligonucleotide is formulated for in vivo CNS administration.

219. The method as in any one of claims 159-218, wherein the multi meric oligonucleotide is formulated for in vivo intrathecal injection.

220. The method of any one of claims 159-219, wherein the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2- fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

221. The method of claim 220, wherein the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 5-fold increase relative to in vivo activity of the same subunit when administered in monomeri c form.

222. The method of claim 221, wherein the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 10-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.

223. The method as in any one of claims 162-222, wherein the mRNA overexpressed in a CNS cell comprises mRNA encoding an oncogene.

224. The method as in any one of claims 163-222, wherein the mRNA overexpressed in a cancer cell comprises mRNA encoded by an immune checkpoint gene.

225. The method as in any one of claims 223-224, wherein the mRNA expressed in a cancer-targeting immune cell comprises mRNA encoded an immune checkpoint gene.

226. The method as in any one of claims 159-222, wherein at least one subunit within the multimeric oligonucleotide is an SSO for the treatment of a neurodegenera tive disease.

227. The multimeric oligonucleotide as in any one of claims 159-222, wherein at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to huntingtin mRNA.

228. The multimeric oligonucleotide as in claim 227, wherein each of the subunits within the multimeric oligonucleotide, independently, are an siRNA with complementarity to huntingtin mRNA.

229. The multimeric oligonucleotide as in claim 227, wherein each of the subunits is complementary to the same region of the huntingtin mRNA.

230. The multimeric oligonucleotide as in claim 227, wherein one or more subunits are complementary to different regions of the huntingtin mRNA.

231. The multimeric oligonucleotide as in any one of claims 159-222, wherein at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to a cyclophilin B (Ppib) mRNA or to an apolipoprotein E (ApoE) mRNA.

232. The multimeric oligonucleotide as in any one of claim s 159-222, wherein at least one subunit within the multimeric oligonucleotide is an siRNA with complementarity to an EGFR mRNA.

233. The multimeric oligonucleotide as in any one of claims 159-232, wherein the multimeric oligonucleotide comprises 3 or more subunits.

234. The multimeric oligonucleotide as in any one of claims 159-233, wherein the multimeric oligonucleotide does not comprise a branched structure wherein at least one of the covalent linkers joins three or more monomeric subunits.

235. The multimeric oligonucleotide as in any one of claim 159-234, wherein: i) the decreased clearance from the CNS; ii) the enhanced distribution throughout the CNS or throughout a desired region of the CNS, and/or iii) the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the multimeric oligonucleotide.