WO2022191431A1 - Nanoliposome carrier composition having kras and p53 gene editing function - Google Patents

Nanoliposome carrier composition having kras and p53 gene editing function Download PDF

Info

Publication number
WO2022191431A1
WO2022191431A1 PCT/KR2022/001418 KR2022001418W WO2022191431A1 WO 2022191431 A1 WO2022191431 A1 WO 2022191431A1 KR 2022001418 W KR2022001418 W KR 2022001418W WO 2022191431 A1 WO2022191431 A1 WO 2022191431A1
Authority
WO
WIPO (PCT)
Prior art keywords
abe
nano
cas9
gene
kras
Prior art date
Application number
PCT/KR2022/001418
Other languages
French (fr)
Korean (ko)
Inventor
유경남
원은정
심희진
Original Assignee
주식회사 무진메디
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 무진메디 filed Critical 주식회사 무진메디
Publication of WO2022191431A1 publication Critical patent/WO2022191431A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats associated protein 9) system has been extensively developed in gene editing therapeutics. Recent research trends include protein-based Cas9 nucleases and delivery by single guide RNA (sgRNA) complexes (Cas9 ribonucleoprotein, Cas9-RNP) and various carrier systems. Protein-based gene editing tools are less toxic than plasmid-based gene editing methods and have excellent gene editing efficiency such as minimizing off-target effects. Recently, studies on more sophisticated gene editing tools such as base editing have been reported, whose basic editing systems are a cytosine base editor (CBE) that converts C:G to T:A base pairs and A:T to G:C base pairs. It consists of an adenine base editor (ABE) that changes to This basic gene editing is also a gene editing technology that has recently been used as a tool for the treatment of human genetic diseases.
  • CBE cytosine base editor
  • ABE adenine base editor
  • the present invention is a hybrid of Cas9 protein and guide RNA targeting the KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; relates to a nano-liposome delivery composition that is enclosed.
  • SEQ ID NO: 1 CUGAAUUAGCUGUAUCGUCA
  • the nano liposome may include lecithin, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine and metal chelating lipids.
  • one or more proteins selected from the group consisting of EGFR (Epidermal growth factor receptor), EpCAM (Epithelial cell adhesion molecule), CEA (Carcinoembryonic antigen) and annexins expressed in pancreatic cancer cells can be recognized.
  • EGFR Epidermal growth factor receptor
  • EpCAM EpCAM
  • CEA Carcinoembryonic antigen
  • annexins expressed in pancreatic cancer cells can be recognized.
  • monoclonal or polyclonal antibodies may be bound.
  • SEQ ID NO: 5 GACTTAATCGACATAGCAGT
  • SEQ ID NO: 2 GUGCAUGUUUGUGCCUGUCC
  • SEQ ID NO: 3 is derived from a partial DNA sequence of human ( Homo sapiens ) KRAS .
  • SEQ ID NO: 6 is derived from a partial DNA sequence of human ( Homo sapiens ) P53 .
  • the guide RNA for KRAS applied to the nanoliposome of the present invention is
  • the guide RNA for P53 applied to the nanoliposome of the present invention is as follows
  • 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine serves as a stabilizer to increase the stability of the aqueous solution phase of the nano-liposomes.
  • the material is not limited to the molecular weight of polyethylglycol (2000), and anything including a polyethylglycol molecule can be used.
  • the 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine is the first of the guide RNA targeting the anionic Cas9 and KRAS genes in a cationic state.
  • the hybrid and the second hybrid of guide RNA targeting the ABE and P53 genes serve to stably encapsulate inside the liposome.
  • 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt).
  • the nanoliposome of the present invention can be stably dispersed for several hours or more in neutral water, cell culture medium, blood, and the like.
  • the Cas9 protein and guide RNA targeting the KRAS gene may be mixed in a molar ratio of 1:1 to 1:3. If it is out of the mixing ratio at this time, the preparation of the hybrid may be difficult.
  • the ABE protein and the guide RNA targeting the P53 gene are preferably mixed in a molar ratio of 1:1 to 1:3.
  • Lecithin, metal chelating lipid, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000) amine and cholesterol of the first step are 1:0.005:0.1:0.1 to 1:0.02:0.3:0.2 in a molar ratio. Likewise, if the mixing ratio is exceeded at this time, the preparation of lipids constituting the nano-liposome may not be performed well.
  • the process of freezing and thawing in the third step may be repeated 1 to 12 times.
  • a nano-liposome dispersion having a more uniform size can be formed, and the drug encapsulation efficiency of the nano-liposome can be increased.
  • the encapsulation efficiency of the nano-liposome may be rather reduced, so less than 12 times is preferable.
  • the present invention may also provide a pharmaceutical composition containing the nano-liposome delivery system composition, wherein the pharmaceutical composition is a powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. orally according to a conventional method, respectively. It can be used by formulating in the form of form formulations, external preparations, suppositories, and sterile injection solutions.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the composition of the present invention, for example, starch, calcium carbonate, sucrose or lactose; It is prepared by mixing gelatin, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, etc.
  • the dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, weight, specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. Dosage determination based on these factors is within the level of one of ordinary skill in the art, and dosages generally range from 0.01 mg/kg/day to approximately 2,000 mg/kg/day. A more preferred dosage is 1 mg/kg/day to 500 mg/kg/day. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • Figure 2a shows the gene mutation type of pancreatic cancer cells
  • Figure 2b shows the results of confirming the expression level of the EGFR membrane protein in each pancreatic cancer cell and normal pancreatic cells.
  • Figure 3a is a result of confirming the expression level of KRAS mRNA for single guide RNA sequence selection
  • Figure 3b is a mammalian cell expression plasmid (pCMV-ABE7.10-P53) of the sequence encoding the P53 sgRNA target sequence candidate and ABE7.10-nCas9. It is a schematic showing the result of cloning in
  • Figure 3c is the result of confirming the expression level of the P53 mutant protein for single guide RNA sequence selection.
  • Figure 4a shows the result of confirming that Cas9 has the function of cutting the target KRAS gene
  • Figure 4b shows the result of confirming that the ABE protein corrected the mutant gene of P53 .
  • Figure 5a shows the structural schematic diagram and cryo-transmission electron microscopy (cryo-EM) analysis results of the nano-liposome of the present invention
  • Figure 5b is the result of confirming the binding properties of the nano-liposome of the present invention to pancreatic cancer cells, PANC1 cells, by FACS.
  • 5c shows the results of immunofluorescence (IF) analysis
  • FIG. 5d shows the results of confirming whether Cas9 and ABE were injected into the nucleus by immunostaining (Cas9 protein-green, ABE protein-red).
  • FIG. 8a and 8b are CLSM (Confocal Laser Scanning Microscopy) analysis and qRT-PCR results confirming the expression of protein and mRNA in PANC1 cells after P53 and KRAS gene editing
  • FIG. 8c is KRAS downstream and P53 restoration pathway.
  • PANC1 cells were treated with bare NL-Ab, NL(Cas9)-Ab, NL(ABE)-Ab, and NL(Cas9/ABE)-Ab to confirm the expression level of various signaling proteins.
  • PANC1 cell line is a gemcitabine (GEM) drug-resistant PDAC cell line through WST-8 analysis.
  • GEM gemcitabine
  • Figure 10a shows the results of confirming the cell viability upon treatment with gemcitabine after two kinds of gene editing using NL(Cas9/ABE)-Ab
  • Figure 10b shows the results of co-treatment with NL(Cas9/ABE)-Ab and gemcitabine. shows the cell cycle distribution results
  • FIG. 10c shows the results of various protein expression patterns of cell cycle-related genes through western blotting.
  • Figure 10d is the result of confirming cell cycle checkpoints such as Cyclin A and CDK2 when gemcitabine is treated after NL(Cas9/ABE)-Ab treatment
  • Figure 10e is NL(Cas9/ABE)-Ab and gem
  • 10f and 10g show the results of confirming the effect on various genes involved in the apoptosis pathway
  • FIG. 10h shows the protein expression of various molecular competition-related genes to clarify the role of KRAS and P53 genes in regulating resistance to gemcitabine. show the results.
  • FIG. 13a shows the results of intraperitoneal injection of red fluorescent (RITC)-labeled particles into PANC1 xenograft mice and monitoring the particle distribution in order to confirm the in vivo specific targeting ability of NL particles bound with an antibody
  • FIG. 13b shows This is the result of confirming the tumor tissue by fluorescent immunostaining whether NL(Cas9/ABE)-Ab reached the tumor and the Cas9 and ABE proteins inside the nanoliposome were delivered.
  • Figure 13c is a fluorescence staining photograph confirming the results of inhibition of mutant KRAS and P53 proteins in tumor sections of Group 8 mice treated together with NL(Cas9/ABE)-Ab and gemcitabine
  • Figure 13d is restoration of wild-type P53 in Group 8 mice.
  • FIG. 13e shows various biologics such as GLUT1, TKT, CTPS and ENT1 in KRAS and P53 gene-edited tumor tissues to overcome gemcitabine drug resistance in vivo
  • FIG. 13f is a result of visualizing the tissue using TUNEL analysis and tumor proliferation (Ki67) to evaluate apoptosis of tumors that have overcome gemcitabine drug resistance by gene editing.
  • pCas-Guide-EF1a-GFP (#GE100018) was purchased from Origene.
  • a plasmid encoding the ABE-nCas9 protein (pABE-Guide-EF1a-GFP) was generated by site-directed mutagenesis in the ABE 7.10 sequence provided in a previous study.
  • plasmids (1.0 ⁇ g) were transfected into PANC1 cells (2.5 ⁇ 10 5 cells/12 well plate) using Lipofectamine (Invitrogen).
  • pET28a-Cas9-transformed cells were cultured at 28 °C, and pET42b-ABE-treated cells were cultured at 18 °C for 16 hours.
  • pET28a-Cas9-transformed cells were cultured at 28 °C, and pET42b-ABE-treated cells were cultured at 18 °C for 16 hours.
  • cells were lysed in lysis buffer and then sonicated and centrifuged at 15000 x g, 4 °C for 20 minutes. Thereafter, the supernatant was reacted with Ni-NTA agarose resin (GE Healthcare) and washed in wash buffer before elution.
  • the transfected cells were lysed and the ABE protein was obtained using the same resin as when collecting Cas9.
  • the resin was washed with a buffer before elution, and the sample was eluted using the elution buffer.
  • Lysis buffer 100 mM Tris-HCl, pH 7.5, 0.3 M NaCl, 20 mM imidazole and 0.5 mM PMSF
  • Washing buffer 100 mM Tris-HCl, pH 7.5, 1 M NaCl, 20% glycerol, 5 mM DTT, 20 mM imidazole and 0.5 mM PMSF
  • Elution buffer 100 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 20% glycerol, 5 mM DTT and 20 mM imidazole
  • a DNA template for in vitro sgRNA transcription was prepared using PCR with forward primers containing the T7 promoter sequence.
  • the sgRNA DNA template was reacted with T7 RNA polymerase (Takara) in a reaction buffer (rNTP, RNase inhibitor, DTT) at 37 °C for 16 hours.
  • the mixture was treated with DNase I (Takara) to remove the DNA template at 37 °C for 30 min.
  • the synthesized sgRNA was extracted with phenol : chloroform : isoamyl alcohol and then precipitated using 2-propanol.
  • the primers listed in Table 1 below were used to amplify the DNA sequence containing the KRAS target site.
  • Purified Cas9 protein (1.56 ⁇ M) and KRAS sgRNA (1.47 ⁇ M) in KRAS target PCR product (0.5 ⁇ g) were treated in NEB buffer 3 (10 ⁇ L) at 37° C. for 1 hour. The degraded product was confirmed through a 2% agarose gel.
  • sgRNA single guide RNA
  • Forward primer for KRAS sgRNA construction 5'-GCGGCCTCTAATACGACTCACTATAGGGCTGAATTAGCTGTATCGTCAGTTTTAGAGCTAGAAATAGCA-3' (including SEQ ID NO: 3, forward primer for preparing SEQ ID NO: 7)
  • Forward primer for P53 sgRNA construction 5'-GCGGCCTCTAATACGACTCACTATAGGGGTGCATGTTTGTGCCTGTCCGTTTTAGAGCTAGAAATAGCA-3' (including SEQ ID NO: 4, forward primer for preparing SEQ ID NO: 8)
  • Forward Primer for Scramble sgRNA Construction 5’-GCGGCCTCTAATACGACTCACTATAGGGGCACTACCAGAGCTAACTCAGTTTTAGAGCTAGAAATAGCA-3’
  • Reverse primer for sgRNA construction 5'-AAAAGCACCGACTCGGTG-3' (forward primer to produce SEQ ID NOs: 7 and 8)
  • P53 target PCR product 0.5 ⁇ g was treated with purified ABE protein (1.0 ⁇ M) and P53 sgRNA (1.47 ⁇ M) in NEB buffer 3 (10 ⁇ L) at 37° C. for 3 hours.
  • the reaction mixture was purified using Nucleospin PCR Cleanup (MN) at 37 °C for 1 h before incubation with endonuclease V (endoV, NEB). The degraded product was confirmed through a 2% agarose gel.
  • Genomic DNA (10 ⁇ g) of PANC1 cells was purified using NucleoSpin Tissue (MN) and treated with ABE (1.0 ⁇ M) and sgRNA (1.47 ⁇ M) purified in NEB buffer 3 at 37°C for 16 hours. After treatment with RNase A (50 ⁇ g/mL) and proteinase K (20 mg/mL), inosine-containing genomic DNA was extracted with phenol:chloroform:isoamyl alcohol and precipitated with 2-propanol. Purified DNA (6 ⁇ g) was reacted with endoV (10 units) at 37° C. for 6 hours. After that, the reaction product was again extracted with phenol:chloroform:isoamyl alcohol and precipitated with 2-propanol. The P53 mutation target site (818G>A, R273H) of PANC1 cells was identified by Sanger sequencing analysis.
  • H6c7 human pancreatic duct epithelial cell line
  • PANC1 and MIAPaCa-2 cells were cultured in Dulbecco Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.
  • BxPC-3 and Capan-2 cells were cultured in RPMI medium supplemented with 10% FBS and 1% penicillin/streptomycin.
  • H6c7 cells were cultured in keratinocyte basal medium and supplement (Clonetics KBM, # CC-3111), and all cells were used after confirming that they were mycoplasma-negative.
  • Plasmids pCMV-Cas9-KRAS, pCMV-ABE7.10-P53 and pCMV-ENT1 were transfected into cells using Lipofectamine 3,000 (Invitrogen).
  • PANC1 cells for each experiment were inoculated with 1.5 x 10 6 cells in a 60-mm 2 cell culture plate at 5% CO 2 condition, 37 ° C., and then nanoliposomes were administered, but based on NL(Cas9/ABE)-Ab 68.25 nM of Cas9 and ABE were added and incubated at 37 ° C. If necessary, after 3 hours of nanoliposome treatment, gemcitabine (10 ⁇ M) was administered and the culture was continued for 24 hours.
  • Pancreatic cancer cells have various types of gene mutations as shown in FIG. 2a.
  • PANC1 cells have a KRAS gene point mutation at codon 12 (c.35G>A, p.G12D) and a P53 gene point mutation at codon 273 (c.818G>A, p.R273H).
  • BxPC-3 had a P53 gene mutation and a wild-type KRAS gene, and Capan-2 only had a KRAS gene mutation.
  • PANC1 compared with the expression level of normal pancreatic cells (H6c7) for the expression of EGFR membrane protein for each pancreatic cancer cell (Fig. 2b), PANC1 was determined as the target cell for gene editing, and KRAS and P53 effective for KRAS and P53 gene editing The sgRNA target sequence was selected.
  • the sgRNA sequence for KRAS gene recognition was selected by confirming that the sgKRAS-1 sequence significantly reduced KRAS mRNA expression by qRT-PCR (FIG. 3a).
  • the sgRNA sequence candidates for the P53 target gene selected two different sgP53 sequences, including the P53 point mutation in PANC1 cells (c.818G > A, p.R273H), the P53 sgRNA target sequence candidate and ABE7.10.
  • the sequence encoding -nCas9 was confirmed by cloning into a mammalian cell expression plasmid (pCMV-ABE7.10-P53) (Fig. 3b). After transfecting PANC-1 cells as a vector using lipofectamine, it can be seen that the sgP53-2 sequence significantly reduced the mutant P53 protein level (FIG. 3c).
  • KRAS and P53 mutant genes were edited using sgKRAS-1 (KRAS target sequence: CTGATTAGCTGTATCGTCA) and sgP53-2 (P53 target sequence: GTGCATGTTTGTGCCTGTCC) in PANC-1 cells.
  • the recombinant ABE protein was purified from E. coli after expression of the ABE7.10-nCas9 vector, and the ABE-mediated base conversion ability was detected by in vitro cleavage of the P53 gene PCR product.
  • the target gene is first converted to A-to-I, and the 500bp P53 PCR product is digested with endonuclease V (endoV) to generate a double-stranded break. Aging can be confirmed by Sanger sequencing, and it appears that the ABE-RNP-treated PCR product has a double peak band through the conversion of A to I (Fig. 4b).
  • NL was prepared using the thin film hydration method. Briefly, lecithin:cholesterol:DGS-NTA(Ni):DSPE-PEG(2000)amine (molar ratio 1:0.2:0.0125:0.25) was dissolved in 1 mL of chloroform and the solvent was evaporated. Films were hydrated with purified 383 nM of each of Cas9 and ABE and 625.5 nM sgRNA complexes dispersed in 1 mL phosphate buffered saline (PBS), pH 7.2. After the freeze-thaw procedure, the NL solution was incubated with sulfo-SMCC at 4 °C for 2 h.
  • PBS phosphate buffered saline
  • sulfo-SMCC (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate)
  • the unreacted material was removed by dialysis and thiolated EGFR antibody was bound to NL at 4 °C for 16 hours.
  • the resulting NL-Ab solution was filtered through a 0.2 ⁇ m syringe filter and then dialyzed through a 1,000 kDa membrane at 4 °C for 16 hours.
  • the nano-liposome was prepared similarly to the method disclosed in the existing Korean Patent No. 10-1796036, but the ABE and sgP53 complex were encapsulated in the liposome in addition to the Cas9 and sgKRAS hybrid. The mixing ratio of these two types of composites was added by the same weight.
  • the Cas9 and sgKRAS hybrids were used in which polyethyleneimine was not bound, unlike in Korean Patent Registration No. 10-1796036. Since the Cas9 and ABE proteins to be loaded can sufficiently bind with DGS-NTA-Ni, a compound constituting a nano-liposome, there is no need to use a cationic polymer.
  • DSPE-PEG(2000)-amine was used instead of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE).
  • DSPE-PEG(2000)-PEG(2000) present in amine serves to provide stability of nanoliposomes in an aqueous solution state, increases the encapsulation rate in liposomes without binding polyethyleneimine to Cas9 and sgKRAS hybrids, and liposomes. It serves to introduce the desired antibody through an amine group to the outside.
  • the prepared nano-liposome composition was subjected to 200 nm filtration and 1,000 kDa dialysis, followed by low-temperature conduction electron microscopy (low-temperature conduction electron microscopy), dynamic light scattering (DLS) analysis, zeta potential measurement and Western blot analysis to obtain shape, size, The surface was evaluated.
  • the hydrodynamic size and zeta potential of NL-Ab were measured using a Zetasizer Nano ZS (Malvern Instruments).
  • the morphology of NL-Ab was observed using cryo-transmission electron microscopy (cryo-EM, Tecnai F20 G2, FEI).
  • PANC1 cells were lysed in RIPA buffer with a protease inhibitor and a phosphatase inhibitor (Sigma). Whole cell lysates were normalized using the BCA Protein Assay Kit (Thermo Scientific). Next, the cell lysate (40 ⁇ g) was loaded on a 12% SDS-PAGE gel under denaturing conditions and transferred to a PVDF membrane (iBlot2 Dry Blotting System, Thermo Scientific).
  • Membranes were blocked with 5% skim milk at room temperature for 1 h and reacted with the following primary antibodies at 4 °C for 16 h: anti-RAS, phospho-ERK, phospho-Rb (Cell Signaling), anti-mutant P53, p27KIP , p21CIP (Abcam), anti-wild-type P53 (Sigma), Cyclin D1, CDK4, GLUT1, TKT, actin (Santa Cruz) and HIF-1 ⁇ , CTPS1 and ENT1 (Proteintech).
  • the membrane was treated with Western ECL and the luminescence image was analyzed using LAS500 (GE Healthcare).
  • NL-Ab was added to genistein (10 ⁇ g/mL), chlorpromazine (20 ⁇ g/mL), nocodazole (1.5 ⁇ g/mL) and cytochalasin B (4.8 ⁇ g/mL). incubated for hours. Next, cells were treated with NL(Cas9/ABE)-Ab (Cas9 and ABE at 68.25 nM each in 2.5 mL opti-MEM). All samples were incubated at 37 °C except for samples at 4 °C, and 24 hours later, they were analyzed by flow cytometry (Accuri C6 Plus, BD).
  • PANC1 and H6c7 cells were analyzed by fluorescence immunoassay (IF).
  • IF fluorescence immunoassay
  • PANC1 cells were seeded into 8-well cell culture slides (4 x 10 4 cells/slide) at 37 °C under 5% CO 2 .
  • Cells were incubated with NL(Cas9/ABE)-Ab (22.75 nM of Cas9 and ABE in 0.2 mL opti-MEM, respectively) at 37 °C for 3 h, then the cells were treated with gemcitabine (10 ⁇ M) and 48 h later. analyzed.
  • NL-Ab-treated cells were immunostained with anti-Myc (Cas9 protein, green) and anti-HA (ABE protein, red), and then visualized by IF. Results A fluorescent signal is detected in the nucleus due to the penetrating ability of the nuclear localization sequence from Cas9 and ABE-RNP (Fig. 5d).
  • clathrin-mediated endocytosis inhibitor chlorpromazine
  • clathrin-mediated endocytosis inhibitor chlorpromazine
  • cytochalasin B phagocytosis inhibitor
  • the inhalation route for foreign substances into the cell can be divided into five major categories. Part of the membrane protrudes from the surface of the cell and surrounds and swallows particles, phagocytosis, and membrane ruffling, actin filaments (actin) Filament) actively polymerizes to inhale particles, macropinocytosis, chlatrin-mediated endocytosis using a protein called chlatrin in the cytoplasm, and cholesterol and caveolin.
  • caveolin-dependent endocytosis which uses a place with a high concentration of membrane protein
  • clatrin and caveolin independent endocytosis which does not use proteins such as clathrin and caveolin.
  • drugs that block each of these inhalation pathways are drugs that block each of these inhalation pathways.
  • Genistein inhibits caveolin-dependent endocytosis
  • chloropromazine inhibits clathrin-dependent endocytosis
  • nocodazole inhibits apoptosis
  • cytochalasin B inhibits phagocytosis.
  • the cells cannot use energy, so it is possible to inhibit the endocytosis in an energy-dependent manner (Dos Santos T et al., 2011).
  • NL, NL-Ab and lipofectamine were administered to PANC1 cells with and without antibody binding over time (0, 0.5, 1, 3, 6 h). After treatment, the number of Cas9/ABE proteins was quantitatively confirmed through fluorescence-activated single cell sorting (FACS) analysis by fluorescence staining, which is shown in FIG. 7 .
  • FACS fluorescence-activated single cell sorting
  • the NL-Ab prepared in the present invention has very good permeability to pancreatic cancer cells.
  • PANC1 cells were treated with bare NL-Ab, NL(Cas9)-Ab, and NL(ABE)-Ab to confirm the expression level of various signaling proteins (FIG. 8c) .
  • Bare NL without gene editing function including scrambled sgRNA (sgScramble) showed no change in the expression of RAS, p-ERK and mutant P53 .
  • NL(Cas9)-Ab and NL(Cas9/ABE)-Ab-treated cells suppressed protein expression of KRAS and p-ERK
  • NL(ABE)-Ab and NL(Cas9/ABE)-Ab treatment The aged cells have decreased mutant P53 and increased levels of wild-type P53 expression and vice versa.
  • Cell viability assay was performed using WST-8 assay.
  • PANC1, MIAPaCa-2, BxPC-3 and Capan-2 cells were treated with NL-Ab and then seeded in 96-well plates (1 ⁇ 10 3 cells/well) for 24 hours.
  • Cells were treated with gemcitabine (0 ⁇ 100 ⁇ M), and after 24 hours of incubation, WST-8 reagent (Dojindo) was added to the medium at 37 °C for 1 hour. After that, the absorbance was measured at 450 nm using a microplate reader (BioTek) every 24 hours.
  • the PANC1 cell line is a gemcitabine drug-resistant PDAC cell line ( FIG. 9 ).
  • the cell viability is decreased by ⁇ 90% upon treatment with gemcitabine after two kinds of gene editing using NL(Cas9/ABE)-Ab (Fig. 10a). Therefore, it can be confirmed that the KRAS and P53 genes must be edited simultaneously to overcome gemcitabine drug resistance and increase the therapeutic effect in pancreatic cancer.
  • the effect of co-treatment with NL(Cas9/ABE)-Ab and gemcitabine can be evaluated by examining the cell cycle distribution, which was confirmed using flow cytometry.
  • Gemcitabine-resistant cells increase glucose uptake through overexpression and stabilization of HIF-1 ⁇ through genetic mutations in KRAS and P53 . Enhancement of glucose levels induces glucose metabolism, non-oxidative pentose phosphate pathway (PPP) and de novo pyrimidine synthesis. According to this pathway, dCTP is oversynthesized, eventually causing a molecular competitive reaction with dFdCTP of the gemcitabine metabolite and leading to gemcitabine drug resistance.
  • PPP non-oxidative pentose phosphate pathway
  • dCTP is oversynthesized, eventually causing a molecular competitive reaction with dFdCTP of the gemcitabine metabolite and leading to gemcitabine drug resistance.
  • protein expression of various molecular competition-related genes was analyzed ( FIG. 10h ). The results showed that KRAS and P53 gene editing was associated with degradation of HIF-1 ⁇ , reduction of glucose uptake receptor (GLUT1) and inhibition of dCTP synthesis-associated
  • ENT1 increases after gene editing of KRAS or P53 (FIG. 10h). Overexpressed ENT1 increases gemcitabine uptake and high concentration of gemcitabine into cells.
  • H6c7 the cell line
  • BxPC-3 and Capan-2 cell lines without drug resistance showed a large amount of ENT1 receptor protein expression and did not show resistance to the gemcitabine drug ( FIG. 11 ).

Abstract

The present invention relates to: a nanoliposome carrier composition in which are enclosed a hybrid of a guide RNA targeting a Cas9 protein and a KRAS gene, and a hybrid of a guide RNA targeting an ABE protein and a P53 gene; and an agent for treating anticancer drug-resistant pancreatic cancer, wherein the agent contains the nanoliposome carrier composition. Pancreatic cancer develops one or more genetic mutations and thereby develops resistance to gemcitabine, which is currently used as a therapeutic agent for pancreatic cancer. As a result, pancreatic cancer has a high mortality rate compared to other types of cancer. The nanoliposome of the present invention can fundamentally treat pancreatic cancer cells by removing the KRAS mutation while simultaneously editing the P53 mutation to generate a normal gene, and thus can be used as a highly effective anticancer drug.

Description

KRAS 및 P53 유전자의 편집 기능이 있는 나노 리포좀 전달체 조성물Nanoliposome delivery system composition with editing function of KRAS and P53 genes
본 발명은 KRAS 및 P53 유전자의 편집 기능이 있는 나노 리포좀 전달체 조성물에 관한 것이다. The present invention relates to a composition for a nano-liposome delivery system having an editing function of KRAS and P53 genes.
보다 자세하게는 본 발명은 Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 혼성체; 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 혼성체;가 동봉된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 및 P53 유전자의 편집기능을 이용한 항암제 저항성 췌장암의 개선 또는 치료용 조성물에 관한 것이다. In more detail, the present invention provides a hybrid of a Cas9 protein and a guide RNA targeting the KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; a nanoliposome delivery composition containing the enclosed composition or a composition for improving or treating anticancer drug-resistant pancreatic cancer using the editing function of the KRAS gene and the P53 gene containing the same .
췌장암(Pancreatic ductal adenocarcinoma, PDAC)은 2020년에 보고된 바로 5년 내 생존율이 9 % 미만이었고, 국소적 종양 절제 수술을 받은 환자라 하더라도 5년 내 생존율은 15 % 미만이다. 젬시타빈(Gemcitabine, GEM)은 DNA 합성을 방해하고 암세포의 아폽토시스를 유도하는 치료제로서, 현재 임상에서 PDAC의 1차 치료는 젬시타빈이라는 약물로서 수행한다. 그러나 췌장암은 유전적 돌연변이로 인해 다른 고형암에 비해 젬시타빈에 대한 내성이 심해, PDAC로 인한 사망률이 높은 주된 이유가 된다. 유전자 중 KRAS 돌연변이는 PDAC 환자의 약 90 %에서 보고되어 있고, 종양억제인자 P53 유전자 돌연변이는 환자의 50 ~ 80 %에서 관찰된다. 또한 PDAC 환자의 55 %는 KRAS 및 P53 유전자 돌연변이를 모두 가지고 있으며 이들에 대한 임상 치료는 상대적으로 나쁜 예후를 나타낸다. Pancreatic ductal adenocarcinoma (PDAC) has a 5-year survival rate of less than 9%, reported in 2020, and the 5-year survival rate is less than 15% even for patients who underwent local tumor resection. Gemcitabine (GEM) is a therapeutic agent that interferes with DNA synthesis and induces apoptosis in cancer cells. Currently, the primary treatment for PDAC in clinical practice is a drug called gemcitabine. However, pancreatic cancer is more resistant to gemcitabine than other solid cancers due to genetic mutations, which is the main reason for the high mortality rate from PDAC. Among the genes, KRAS mutations have been reported in about 90% of PDAC patients, and tumor suppressor P53 gene mutations are observed in 50 to 80% of patients. In addition, 55% of PDAC patients have both KRAS and P53 gene mutations, and clinical treatment for them has a relatively poor prognosis.
KRAS 또는 P53 유전자 돌연변이는 HIF-1α(hypoxia-causing factor-1α), 해당 과정 및 피리미딘 de novo 생합성의 순차적 안정화로 이어진다. 그 결과, 복제를 위해 핵의 DNA 가닥에 삽입된 deoxycytidine triphosphate (dCTP)의 고유수준이 증가하게 되고, 유전자 돌연변이 매개 dCTP의 과발현이 젬시타빈 대사산물의 젬시타빈 트리포스페이트(dFdCTP)와의 분자경쟁 반응을 통해 젬시타빈 내성을 유발 한다 (도 1). 따라서 효과적인 PDAC 치료는 종양 증식 및 억제와 관련된 KRAS 및 P53 유전자의 동시 유전자 편집을 통해 약물 내성을 극복해야 치료가 가능한 것이다. KRAS or P53 gene mutations lead to sequential stabilization of hypoxia-causing factor-1α (HIF-1α), glycolysis and pyrimidine de novo biosynthesis. As a result, the intrinsic level of deoxycytidine triphosphate (dCTP) inserted into the nuclear DNA strand for replication increases, and gene mutation-mediated overexpression of dCTP inhibits the molecular competition reaction of gemcitabine metabolites with gemcitabine triphosphate (dFdCTP). It induces gemcitabine resistance through (FIG. 1). Therefore, effective PDAC treatment requires overcoming drug resistance through simultaneous gene editing of KRAS and P53 genes involved in tumor proliferation and suppression.
CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats associated protein 9) 시스템은 유전자 편집 치료제에서 광범위하게 개발되었다. 최근 연구 동향에는 단백질 기반 Cas9 뉴클레아제 및 단일 가이드 RNA (sgRNA) 복합체 (Cas9 ribonucleoprotein, Cas9-RNP) 및 다양한 운반체 시스템에 의한 전달이 포함된다. 단백질 기반 유전자 편집 도구는 플라스미드 기반 유전자 편집 방법보다 독성이 낮고 표적을 벗어난 효과(off-target effect)를 최소화 하는 등의 유전자 편집 효율성이 뛰어나다. 최근 염기 편집 같은 보다 정교한 유전자 편집 도구에 대한 연구가 보고되었는데, 이의 기본 편집 시스템은 C : G를 T : A 기본 쌍으로 변환하는 사이토신 염기 편집기(CBE)와 A : T를 G : C 기본 쌍으로 변경하는 아데닌 염기 편집기(ABE)로 구성된다. 이 기본 유전자 편집 또한 인간 유전 질환 치료를 위한 도구로서 최근부터 사용되기 시작한 유전자 편집 기술이다. The CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats associated protein 9) system has been extensively developed in gene editing therapeutics. Recent research trends include protein-based Cas9 nucleases and delivery by single guide RNA (sgRNA) complexes (Cas9 ribonucleoprotein, Cas9-RNP) and various carrier systems. Protein-based gene editing tools are less toxic than plasmid-based gene editing methods and have excellent gene editing efficiency such as minimizing off-target effects. Recently, studies on more sophisticated gene editing tools such as base editing have been reported, whose basic editing systems are a cytosine base editor (CBE) that converts C:G to T:A base pairs and A:T to G:C base pairs. It consists of an adenine base editor (ABE) that changes to This basic gene editing is also a gene editing technology that has recently been used as a tool for the treatment of human genetic diseases.
이에 본 발명에서는 한 개 이상의 유전자 변이에 의한 약물 내성 PDAC의 KRAS 및 P53 유전자 편집을 동시에 수행하기 위해 특정 전달 담체 시스템으로 생체 적용 가능한 나노 리포좀을 개발하고 두가지 서로 다른 유전자 편집 기능을 가지는 Cas9 및 ABE 기반 RNP를 캡슐화하여 동일 세포에 동시에 전달함으로써, 기존 약물에 대한 저항성을 극복하기 위해 본 발명을 완성하게 되었다. Therefore, in the present invention, in order to simultaneously perform KRAS and P53 gene editing of drug-resistant PDAC by one or more gene mutations, a bio-applicable nanoliposome was developed as a specific delivery carrier system, and Cas9 and ABE-based with two different gene editing functions. By encapsulating RNP and delivering it to the same cell at the same time, the present invention was completed to overcome resistance to existing drugs.
[선행기술문헌][Prior art literature]
[특허문헌][Patent Literature]
대한민국 등록특허 제10-1796036호Republic of Korea Patent No. 10-1796036
본 발명의 목적은 KRAS 및 P53 유전자의 편집 기능이 있는 나노 리포좀 전달체 조성물을 제공하는 데에 있다. It is an object of the present invention to provide a nano-liposome delivery system composition having an editing function of KRAS and P53 genes.
본 발명의 목적은 Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 혼성체; 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 혼성체;가 동봉된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 억제 및 P53 유전자의 변이 정상화 편집기능을 이용한 항암제 저항성 췌장암의 개선 또는 치료용 조성물을 제공하는 데에 있다. An object of the present invention is a hybrid of Cas9 protein and guide RNA targeting the KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; a nanoliposome delivery composition containing the enclosed KRAS gene suppression and P53 gene mutation normalization editing function for improving or treating anticancer drug-resistant pancreatic cancer composition is to provide
본 발명은 Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 혼성체; 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 혼성체;가 동봉된 나노 리포좀 전달체 조성물에 관한 것이다. The present invention is a hybrid of Cas9 protein and guide RNA targeting the KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; relates to a nano-liposome delivery composition that is enclosed.
상기 KRAS 유전자를 타겟으로 하는 가이드 RNA는 서열번호 1의 염기서열을 포함할 수 있다. The guide RNA targeting the KRAS gene may include the nucleotide sequence of SEQ ID NO: 1.
서열번호 1 : CUGAAUUAGCUGUAUCGUCA SEQ ID NO: 1: CUGAAUUAGCUGUAUCGUCA
상기 P53 유전자를 타겟으로 하는 가이드 RNA는 서열번호 2의 염기서열을 포함할 수 있다. The guide RNA targeting the P53 gene may include the nucleotide sequence of SEQ ID NO: 2.
서열번호 2 : GUGCAUGUUUGUGCCUGUCC SEQ ID NO: 2: GUGCAUGUUUGUGCCUGUCC
상기 나노 리포좀은 레시틴, 콜레스테롤, 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민 및 메탈 킬레이팅 지질을 포함할 수 있다. The nano liposome may include lecithin, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine and metal chelating lipids.
상기 나노 리포좀에는 췌장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합될 수 있다.In the nanoliposome, one or more proteins selected from the group consisting of EGFR (Epidermal growth factor receptor), EpCAM (Epithelial cell adhesion molecule), CEA (Carcinoembryonic antigen) and annexins expressed in pancreatic cancer cells can be recognized. monoclonal or polyclonal antibodies may be bound.
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. The nano-liposome may have a particle size of 10 to 2,000 nm.
또한 본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 KRAS 유전자 및 P53 유전자의 편집기능을 이용한 항암제 저항성 췌장암의 개선 또는 치료용 약학 조성물에 관한 것이다. 상기 조성물은 젬시타빈에 대한 저항이 있는 췌장암에 대한 약학 조성물일 수 있다. 이에 상기 조성물은 젬시타빈을 추가로 함유하는 것일 수 있다. The present invention also relates to a pharmaceutical composition for improving or treating anticancer drug-resistant pancreatic cancer using the editing function of the KRAS gene and the P53 gene containing the nano-liposome delivery composition. The composition may be a pharmaceutical composition for pancreatic cancer resistant to gemcitabine. Accordingly, the composition may further contain gemcitabine.
또한 본 발명은 KRAS 유전자 및 P53 유전자의 편집기능을 이용하여 치료할 수 있는 모든 암을 대상으로 하는 약학 조성물일 수 있다. In addition, the present invention may be a pharmaceutical composition for all cancers that can be treated using the editing function of the KRAS gene and the P53 gene.
본 발명은 또한 하기와 같은 췌장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법을 제공한다. The present invention also provides a method for preparing a nano-liposome carrier composition capable of selectively recognizing pancreatic cancer cells as follows.
바람직하게는, Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 제1혼성체, 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 제2혼성체를 각각 제조하고, Preferably, a first hybrid of the guide RNA targeting the Cas9 protein and the KRAS gene, and a second hybrid of the guide RNA targeting the ABE protein and the P53 gene are respectively prepared,
레시틴, 메탈 킬레이팅 지질, 콜레스테롤, 및 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; An agent for preparing a lipid film composition by mixing lecithin, metal chelating lipid, cholesterol, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine in chloroform in chloroform Stage 1;
상기 지질 필름 조성물에, 제1혼성체와 제2혼성체를 혼합하고 넣어 초음파 처리하는 제2단계; A second step of sonicating into the lipid film composition, mixing and putting a first hybrid and a second hybrid;
상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계;After freezing and thawing the sonicated lipid film composition, a third step of sonicating again;
상기 제3단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제4단계; 및,a fourth step of binding the antibody to the nano-liposome in the precipitated state obtained in the third step through a crosslinking agent; and,
상기 제4단계에서 얻은 반응물을 투석하여 과량의 항체를 제거하고 항체가 결합된 나노 리포좀을 제5단계; A fifth step of dialysis of the reaction product obtained in the fourth step to remove the excess antibody, and the nano-liposome to which the antibody is bound;
를 포함할 수 있다. may include.
이하 본 발명을 보다 자세하게 설명한다. Hereinafter, the present invention will be described in more detail.
본 발명은 Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 혼성체; 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 혼성체;가 동봉된 나노 리포좀 전달체 조성물에 관한 것이다. The present invention is a hybrid of Cas9 protein and guide RNA targeting the KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; relates to a nano-liposome delivery composition that is enclosed.
상기 Cas9 단백질은 pET28a/Cas9 플라스미드가 형질전환된 세포 또는 균주에서 획득할 수 있다. 바람직하게는 pET28a/Cas9 플라스미드를 대장균에 형질전환하여 Cas9 단백질을 과발현하여 얻을 수 있다. The Cas9 protein can be obtained from a cell or strain transformed with the pET28a/Cas9 plasmid. Preferably, it can be obtained by transforming the pET28a/Cas9 plasmid into E. coli to overexpress the Cas9 protein.
pET28a/Cas9 플라스미드 : pET28a(+) 벡터에 Cas9 nuclease-Myc와 His가 삽입된 것.pET28a/Cas9 plasmid: Cas9 nuclease-Myc and His inserted into the pET28a(+) vector.
상기 ABE 단백질 또한 pET42b/ABE 플라스미드가 형질전환된 세포 또는 균주에서 획득할 수 있다. 바람직하게는 pET42b/ABE 플라스미드를 대장균에 형질전환하여 ABE 단백질을 과발현하여 얻을 수 있다. The ABE protein can also be obtained from cells or strains transformed with the pET42b/ABE plasmid. Preferably, it can be obtained by transforming the pET42b/ABE plasmid into E. coli to overexpress the ABE protein.
pET42b/ABE 플라스미드 :pET42b(+) 벡터에 ABE7.10-Cas9 nickase-HA와 His가 삽입된 것.pET42b/ABE plasmid: ABE7.10-Cas9 nickase-HA and His inserted into the pET42b(+) vector.
본 발명에서 적용할 수 있는 KRAS 타켓용 가이드 RNA는 하기의 서열번호 1의 염기서열을 포함하는 가이드 RNA이고, 서열번호 3의 염기서열으로 부터 유래된 것이며, 서열번호 5를 타겟으로 한다. The guide RNA for a KRAS target applicable in the present invention is a guide RNA comprising the nucleotide sequence of SEQ ID NO: 1, is derived from the nucleotide sequence of SEQ ID NO: 3, and targets SEQ ID NO: 5.
서열번호 1 : CUGAAUUAGCUGUAUCGUCASEQ ID NO: 1: CUGAAUUAGCUGUAUCGUCA
서열번호 3 : CTGAATTAGCTGTATCGTCASEQ ID NO: 3: CTGAATTAGCTGTATCGTCA
서열번호 5 : GACTTAATCGACATAGCAGT SEQ ID NO: 5: GACTTAATCGACATAGCAGT
본 발명에서 적용할 수 있는 P53 타켓용 가이드 RNA는 하기의 서열번호 2의 염기서열을 포함하는 가이드 RNA이고, 서열번호 4의 염기 서열으로 부터 유래된 것이며, 서열번호 6을 타겟으로 한다. The guide RNA for the P53 target applicable in the present invention is a guide RNA including the nucleotide sequence of SEQ ID NO: 2, is derived from the nucleotide sequence of SEQ ID NO: 4, and targets SEQ ID NO: 6.
서열번호 2 : GUGCAUGUUUGUGCCUGUCCSEQ ID NO: 2: GUGCAUGUUUGUGCCUGUCC
서열번호 4 : GTGCATGTTTGTGCCTGTCCSEQ ID NO: 4: GTGCATGTTTGTGCCTGTCC
서열번호 6 : CACGTACAAACACGGACAGGSEQ ID NO: 6: CACGTACAAACACGGACAGG
상기 서열번호 1과 서열번호 2가 각각 Cas9 와 ABE 단백질이 혼성화되어 포함된 나노 리포좀 전달체 조성물은 KRAS 돌연변이를 억제하고 P53 유전자 돌연변이를 정상화하여 췌장암을 개선 또는 치료할 수 있는 기능을 한다. SEQ ID NO: 1 and SEQ ID NO: 2 function to improve or treat pancreatic cancer by inhibiting the KRAS mutation and normalizing the P53 gene mutation in the nano-liposome delivery system composition comprising the hybridized Cas9 and ABE proteins, respectively.
서열번호 3은 사람(Homo sapiens) KRAS의 일부 DNA 염기서열로부터 유래된 것이다. 서열번호 6은 사람(Homo sapiens) P53의 일부 DNA 염기서열로부터 유래된 것이다. SEQ ID NO: 3 is derived from a partial DNA sequence of human ( Homo sapiens ) KRAS . SEQ ID NO: 6 is derived from a partial DNA sequence of human ( Homo sapiens ) P53 .
상기 서열번호 1의 가이드 RNA 염기서열 이후에는 Cas9 단백질과 혼성체를 형성하기 위해 스캐폴드 염기서열(scaffold sequence)이 포함될 수 있다. 이 때 스캐폴드 염기서열의 종류는 크게 제한되지 않으며, 가이드 RNA의 제조에 이용되는 통상적인 염기서열이라면 어떤 것이든지 사용될 수 있다. After the guide RNA sequence of SEQ ID NO: 1, a scaffold sequence may be included to form a hybrid with the Cas9 protein. At this time, the type of the scaffold nucleotide sequence is not particularly limited, and any general nucleotide sequence used for the preparation of guide RNA may be used.
따라서, 본 발명의 나노 리포좀에 적용되는 KRAS를 위한 가이드 RNA는 하기의 Therefore, the guide RNA for KRAS applied to the nanoliposome of the present invention is
서열번호 7 :SEQ ID NO: 7:
CTGAATTAGCTGTATCGTCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU 이 적용된 나노 리포좀을 제공할 수 있다. Nanoliposomes to which CTGAATTAGCTGTATCGTCA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUUU is applied may be provided.
또한, 본 발명의 나노 리포좀에 적용되는 P53을 위한 가이드 RNA는 하기의 In addition, the guide RNA for P53 applied to the nanoliposome of the present invention is as follows
서열번호 8 : SEQ ID NO: 8:
GUGCAUGUUUGUGCCUGUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU 이 적용된 나노 리포좀을 제공할 수 있다. GUGCAUGUUUGUGCCUGUCC GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUUU applied nanoliposomes can be provided.
상기 서열번호 1의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 5의 DNA 염기서열은, 사람의 상기 서열번호 1의 가이드 RNA의 염기서열이 타겟으로 하는 KRAS (Homo sapiens Chromosome 12, NCBI Reference Sequence: NG_007524)의 Exon2에 존재하는 염기서열이다. 즉, 상기 서열번호 1의 가이드 RNA를 통해 상기 Exon2의 DNA가 편집된다. 상기 KRAS 유전자의 돌연변이는 인간 게놈 DNA의 KRAS exon 2의 codon 12번 서열에서 일어난다. The DNA nucleotide sequence of SEQ ID NO: 5 targeted by the nucleotide sequence of the guide RNA of SEQ ID NO: 1 is KRAS ( Homo sapiens Chromosome 12, NCBI Reference Sequence: NG_007524) is a nucleotide sequence present in Exon2. That is, the DNA of Exon2 is edited through the guide RNA of SEQ ID NO: 1. The mutation of the KRAS gene occurs in the sequence of codon 12 of KRAS exon 2 of human genomic DNA.
상기 서열번호 1의 가이드 RNA는 T7 RNA 폴리머라아제(polymerase)를 사용한 시험관 내 전사 반응 과정(in vitro transcription)을 통하여 합성할 수 있다.The guide RNA of SEQ ID NO: 1 may be synthesized through in vitro transcription using T7 RNA polymerase.
상기 서열번호 2의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 6의 DNA 염기서열은, 사람의 상기 서열번호 2의 가이드 RNA의 염기서열이 타겟으로 하는 P53 (Homo sapiens Chromosome 17, NCBI Reference Sequence: NG_017013.2)의 Exon 8에 존재하는 염기서열이다. 즉, 상기 서열번호 2의 가이드 RNA를 통해 상기 Exon 8의 DNA가 편집된다. 상기 P53 유전자의 돌연변이는 인간 게놈 DNA의 P53 exon 8의 codon 273번 서열에서 일어난다. The DNA nucleotide sequence of SEQ ID NO: 6 targeted by the nucleotide sequence of the guide RNA of SEQ ID NO: 2 is P53 ( Homo sapiens Chromosome 17, NCBI Reference Sequence: It is a nucleotide sequence present in Exon 8 of NG_017013.2). That is, the DNA of Exon 8 is edited through the guide RNA of SEQ ID NO: 2. The mutation of the P53 gene occurs in the sequence of codon 273 of P53 exon 8 of human genomic DNA.
상기 서열번호 2의 가이드 RNA는 T7 RNA 폴리머라아제(polymerase)를 사용한 시험관 내 전사 반응 과정(in vitro transcription)을 통하여 합성할 수 있다.The guide RNA of SEQ ID NO: 2 may be synthesized through in vitro transcription using T7 RNA polymerase.
상기 나노 리포좀은 레시틴(lecithin, α-phosphatidylcholin), 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민, 콜레스테롤 및 메탈 킬레이팅 지질을 포함할 수 있으며, 이를 통해, 상기 레시틴, 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민, 콜레스테롤 및 메탈 킬레이팅 지질이 나노 리포좀을 형성하는 막을 이룰 수 있다. The nano liposome contains lecithin (lecithin, α-phosphatidylcholin), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine, cholesterol and metal chelating lipids Through this, the lecithin, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine, cholesterol and metal chelating lipids form nanoliposomes can be stopped.
레시틴은 동/식물계에 널리 분포되어 있어 생체 적합성이 우수하며 그 안정성에 있어서도 이미 검증되어 식품과 제약의 전달체 기술에 널리 활용되고 있다. 또한 나노 리포좀의 크기 조절과 변형을 용이하게 하는 재료로 사용될 수 있다. Because lecithin is widely distributed in the animal/plant kingdom, it has excellent biocompatibility and its stability has already been verified and is widely used in food and pharmaceutical delivery technology. In addition, it can be used as a material that facilitates the size control and transformation of nano-liposomes.
상기 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민을 사용하는 것은 나노 리포좀의 수용액상의 안정성을 높이는 안정제 역할을 한다. 이 물질의 폴리에틸글리콜(2000)의 분자량에 한정되지 않고, 폴리에틸글리콜 분자를 포함하는 모든 것이 사용 가능하다. 또한 상기 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민은 양이온성 상태로서 음이온성인 Cas9과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 제1혼성체와 ABE와 P53 유전자를 타켓으로 하는 가이드 RNA의 제2혼성체가 안정적으로 리포좀 내부에 포집될 수 있게 하는 역할을 한다. Using the 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine serves as a stabilizer to increase the stability of the aqueous solution phase of the nano-liposomes. The material is not limited to the molecular weight of polyethylglycol (2000), and anything including a polyethylglycol molecule can be used. In addition, the 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000)amine is the first of the guide RNA targeting the anionic Cas9 and KRAS genes in a cationic state. The hybrid and the second hybrid of guide RNA targeting the ABE and P53 genes serve to stably encapsulate inside the liposome.
메탈 킬레이팅 지질로는 바람직하게는 DGS-NTA-Ni 지질, DMPE-DTPA-Gd 지질, DMPE-DTPA-Cu 지질로 이루어진 군 중에서 선택되는 1종 이상을 사용할 수 있다. 상기 DGS-NTA-Ni 지질은 하기의 화학식 1의 화학구조를 갖는 지질로서,As the metal chelating lipid, one or more selected from the group consisting of DGS-NTA-Ni lipid, DMPE-DTPA-Gd lipid, and DMPE-DTPA-Cu lipid may be used. The DGS-NTA-Ni lipid is a lipid having the chemical structure of Formula 1 below,
[화학식 1] [Formula 1]
Figure PCTKR2022001418-appb-I000001
Figure PCTKR2022001418-appb-I000001
1,2-디올레오일-sn-글리세로-3-[(N-(5-아미노-1-카르복시펜틸)이미노디아세트산)숙시닐](니켈염)이라 한다. It is called 1,2-dioleoyl- sn -glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl](nickel salt).
1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl](nikel salt) 1,2-dioleoyl- sn -glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl](nikel salt)
DMPE-DTPA-Gd 지질은 하기의 화학식 2의 화학구조를 갖는 지질로서,DMPE-DTPA-Gd lipid is a lipid having the chemical structure of Formula 2 below,
[화학식 2][Formula 2]
Figure PCTKR2022001418-appb-I000002
Figure PCTKR2022001418-appb-I000002
1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(가돌리늄염)이라 한다. It is called 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt).
1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(gadolinium salt)1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt)
DMPE-DTPA-Cu 지질은 하기의 화학식 3의 화학구조를 갖는 지질로서,DMPE-DTPA-Cu lipid is a lipid having the chemical structure of Formula 3 below,
[화학식 3][Formula 3]
Figure PCTKR2022001418-appb-I000003
Figure PCTKR2022001418-appb-I000003
1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(구리염)이라 한다. It is called 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (copper salt).
1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(copper salt)1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (copper salt)
상기 DGS-NTA-Ni 지질은 단백질 정제 방법에서 사용되는 His-Tag(6X histidin)과 Ni2+ 친연성(affinity)을 활용하여 Cas9 단백질 또는 ABE 단백질(His-Tag 포함된 것)이 효과적으로 나노 리포좀 내부로 봉입(encapsulation)되게 하는 역할을 할 수 있다. 더 자세하게는 상기 DGS-NTA-Ni은 18개의 탄소에 이중결합이 1개 있는 구조로 레시틴과 함께 지질(lipid)를 형성할 수 있고, 끝에 Ni2+가 결합되어 있어, Cas9 단백질과 ABE 단백질에 붙어있는 His-tag 2개와 Ni2+ 1개가 결합하여 Cas9 단백질 또는 ABE 단백질이 좀 더 효율적으로 나노 리포좀 안으로 봉입되게 한다. DMPE-DTPA-Gd 지질과 DMPE-DTPA-Cu 지질 또한 이와 동일한 역할을 하며 Cas9 단백질 또는 ABE 단백질이 포함된 각 혼성체들의 나노 리포좀 내 봉입을 효과적으로 유도한다. The DGS-NTA-Ni lipid utilizes His-Tag (6X histidin) and Ni 2+ affinity, which are used in the protein purification method, so that Cas9 protein or ABE protein (His-Tag included) can be effectively integrated into the nano liposome. It can play a role in encapsulation. In more detail, the DGS-NTA-Ni has a structure having one double bond on 18 carbons, and can form a lipid with lecithin, and Ni 2+ is bonded at the end, so that it is a Cas9 protein and ABE protein. Two attached His-tags and one Ni 2+ combine to allow Cas9 protein or ABE protein to be more efficiently encapsulated into nanoliposomes. DMPE-DTPA-Gd lipid and DMPE-DTPA-Cu lipid also play the same role and effectively induce encapsulation of each hybrid containing Cas9 protein or ABE protein in nanoliposomes.
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. 나노 리포좀의 크기가 10 nm 미만일 경우, 제1혼성체와 제2혼성체가 상기 나노 리포좀에 봉입되기 어려울 수 있으며, 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. 또한 2,000 nm를 초과할 경우에도 상기 나노 리포좀이 포함된 조성물이 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. The nano-liposome may have a particle size of 10 to 2,000 nm. When the size of the nano-liposome is less than 10 nm, it may be difficult to encapsulate the first hybrid and the second hybrid in the nano-liposome, and when injected into the body, stability may be lowered, which is not preferable. In addition, even when it exceeds 2,000 nm, stability may be lowered when the composition containing the nano-liposome is injected into the body, which is not preferable.
상기 나노 리포좀에는 췌장암세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군 중에서 1종 이상 선택되는 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합될 수 있다. The nano liposome can recognize one or more proteins selected from the group consisting of EGFR (Epidermal growth factor receptor), EpCAM (Epithelial cell adhesion molecule), CEA (Carcinoembryonic antigen) and annexins expressed in pancreatic cancer cells. monoclonal or polyclonal antibodies may be bound.
상기 항체를 생성하는 것은 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다. 상기 다클론성 항체는 EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질을 동물에 주사한 뒤 채혈한 혈청에서 얻을 수 있다. 상기 동물로는 염소, 토끼, 돼지 등 임의의 동물 숙주를 이용할 수 있다. 상기 단클론성 항체는, 본 발명이 속하는 기술분야에 널리 알려진 대로, 하이브리도마 방법(Kohler G. and Milstein C.), 또는, 파지 항체 라이브러리(Clackson et al.; Marks et al.) 기술을 이용하여 제조할 수 있다. 상기 하이브리도마 방법을 수행하기 위해서는 마우스와 같은 면역학적으로 적합한 숙주동물의 세포와, 암 또는 골수종 세포주를 이용할 수 있다. 이 후, 폴리에틸렌글리콜 등을 이용하는 방법, 즉, 본 발명이 속하는 기술분야에 널리 공지된 방법으로, 이러한 두 종류의 세포들을 융합시킨 후, 항체 생산 세포를 표준적인 조직 배양방법으로 증식시킬 수 있다. 이 후, 한계 희석법(limited dilution technique)에 의한 서브클로닝에 의해 균일한 세포 집단을 얻은 후, EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질에 대해 특이적인 항체를 생산할 수 있는 하이브리도마를 표준 기술에 따라 시험관 내 또는 생체 내에서 대량 배양할 수 있다. 상기 파지 항체 라이브러리 방법은, EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질에 대한 항체 유전자를 획득하여, 이를 파지(phage)의 표면에 융합 단백질 형태로 발현하여 항체 라이브러리를 시험관 내에서 제작하고, 상기 라이브러리로부터 EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질과 결합하는 단클론성 항체를 분리 및 제작하여 수행할 수 있다. 상기 방법들에 의하여 제조된 항체는 전기영동, 투석, 이온교환 크로마토그래피, 친화 크로마토그래피 등의 방법으로 분리할 수 있다.Such antibodies can be readily prepared using techniques well known in the art. The polyclonal antibody can be obtained from serum collected after injection of one type of protein such as EGFR, EpCAM, CEA, and annexin into an animal. As the animal, any animal host such as goat, rabbit, or pig may be used. The monoclonal antibody is prepared using a hybridoma method (Kohler G. and Milstein C.), or a phage antibody library (Clackson et al.; Marks et al.) technology, as is well known in the art. can be manufactured. In order to perform the hybridoma method, cells from an immunologically suitable host animal such as a mouse and cancer or myeloma cell lines may be used. Thereafter, the method using polyethylene glycol, etc., that is, by a method well known in the art to which the present invention pertains, after fusion of these two types of cells, the antibody-producing cells can be proliferated by a standard tissue culture method. Thereafter, a homogeneous cell population is obtained by subcloning by the limited dilution technique, and then a hybridoma capable of producing an antibody specific for one protein such as EGFR, EpCAM, CEA, and annexin. It can be cultured in large quantities in vitro or in vivo according to standard techniques. In the phage antibody library method, antibody genes for one protein such as EGFR, EpCAM, CEA, and annexin are obtained and expressed in the form of a fusion protein on the surface of a phage to produce an antibody library in vitro, and , can be performed by isolating and producing a monoclonal antibody that binds to one type of protein such as EGFR, EpCAM, CEA, and annexin from the library. Antibodies prepared by the above methods may be separated by methods such as electrophoresis, dialysis, ion exchange chromatography, and affinity chromatography.
상기 항체는 2개의 전체 길이 경쇄(light chain) 및 2개의 전체 길이 중쇄(heavy chain)를 가지는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함할 수 있다. 항체 분자의 기능적 단편이란 적어도 항원 결합기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2, F(ab)2, Fv 등이 있다.The antibody may include a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and includes Fab, F(ab'), F(ab')2, F(ab)2, Fv, and the like.
본 발명에서 상기 항체는 1,4-비스-말레이미도부탄, 1,11-비스-말레이미도테트라에틸렌글리콜, 1-에틸-3-[3-디메틸 아미노프로필] 카보디이미드 하이드로클로라이드, 숙시니미딜-4-[N-말레이미도메틸시클로헥산-1-카복시-[6-아미도카프로에이트]] 및 그의 설폰화염(sulfo-SMCC), 숙시미딜 6-[3-(2-피리딜디티오)-로피오나미도] 헥사노에이트] 및 그의 설폰화염(sulfo-SPDP), m-말레이미도벤조일-N-하이드로시숙시니미드 에스터 및 그의 설폰화염(sulfo-MBS), 및 숙시미딜[4-(p-말레이미도페닐) 부틸레이트] 및 그의 설폰화염(sulfo-SMPB)으로 구성된 군에서 선택된 1종 이상의 가교제가 링커로 이용되어 결합될 수 있다. In the present invention, the antibody is 1,4-bis-maleimidobutane, 1,11-bis-maleimidotetraethylene glycol, 1-ethyl-3-[3-dimethyl aminopropyl] carbodiimide hydrochloride, succinimidyl -4-[N-maleimidomethylcyclohexane-1-carboxy-[6-amidocaproate]] and its sulfonate salt (sulfo-SMCC), succimidyl 6-[3-(2-pyridyldithio) )-Ropionamido] hexanoate] and its sulfonate salt (sulfo-SPDP), m-maleimidobenzoyl-N-hydrosisuccinimide ester and its sulfonate salt (sulfo-MBS), and succimidyl [4- (p-maleimidophenyl) butyrate] and at least one cross-linking agent selected from the group consisting of sulfo-SMPB) may be used as a linker for bonding.
상기 링커는 나노 리포좀의 아민기가 포함된 인지질과 항체를 연결하는 것을 특징으로 한다. The linker is characterized in that it connects the phospholipid containing the amine group of the nano-liposome to the antibody.
본 발명의 나노 리포좀은 중성의 물, 세포 배양액, 혈액 등에서 수 시간 이상 안정하게 분산될 수 있다. The nanoliposome of the present invention can be stably dispersed for several hours or more in neutral water, cell culture medium, blood, and the like.
본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 췌장암의 개선 또는 치료용 조성물을 제공할 수 있다. 상기 조성물은 젬시타빈을 더 포함할 수 있다. 상기 췌장암은 KRAS 돌연변이와 P53 돌연변이 유전자형을 갖는 세포로부터 발현된 것일 수 있다. 즉, 상기 나노 리포좀 전달체 조성물은 KRAS 돌연변이와 P53 돌연변이 유전자형을 가져 젬시타빈에 약물 저항성을 갖는 췌장암의 치료에 효과적이다. The present invention may provide a composition for improving or treating pancreatic cancer containing the nano-liposome carrier composition. The composition may further include gemcitabine. The pancreatic cancer may be expressed from cells having a KRAS mutation and a P53 mutation genotype. That is, the nano-liposome delivery system composition has a KRAS mutation and a P53 mutation genotype and is effective in the treatment of pancreatic cancer having drug resistance to gemcitabine.
본 발명은 또한 하기와 같은 췌장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법을 제공한다. 바람직하게는, Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 제1혼성체, 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 제2혼성체를 제조하고, 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; 상기 지질 필름 조성물에, Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA와 ABE 단백질과 P53 유전자를 타켓으로 하는 가이드 RNA 복합체를 넣어 초음파 처리하는 제2단계; 상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계; 상기 제3단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제4단계; 및, 상기 제4단계에서 얻은 반응물을 투석하여 과량의 항체를 제거하고 항체가 결합된 나노 리포좀을 제5단계;를 포함할 수 있다. The present invention also provides a method for preparing a nano-liposome carrier composition capable of selectively recognizing pancreatic cancer cells as follows. Preferably, a first hybrid of the guide RNA targeting the Cas9 protein and the KRAS gene, and a second hybrid of the guide RNA targeting the ABE protein and the P53 gene are prepared, and lecithin, a metal chelating lipid, A first step of preparing a lipid film composition by mixing cholesterol and cationic phospholipids in chloroform; a second step of ultrasonicating the lipid film composition by adding a guide RNA that targets the Cas9 protein and the KRAS gene, and a guide RNA complex that targets the ABE protein and the P53 gene; After freezing and thawing the sonicated lipid film composition, a third step of sonicating again; a fourth step of binding the antibody to the nano-liposome in the precipitated state obtained in the third step through a crosslinking agent; And, the reaction product obtained in the fourth step is dialyzed to remove the excess antibody, and the nano-liposome to which the antibody is bound is subjected to a fifth step; it may include.
상기 제1단계의 제1혼성체 제조시, Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA는 1:1 내지 1:3의 몰 비로 혼합될 수 있다. 이 때의 혼합비를 벗어나게 되면 혼성체의 제조가 잘 되지 않을 수 있다. 제2혼성체도 역시 ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA가 1:1 내지 1:3의 몰 비로 혼합되는 것이 좋다. In preparing the first hybrid in the first step, the Cas9 protein and guide RNA targeting the KRAS gene may be mixed in a molar ratio of 1:1 to 1:3. If it is out of the mixing ratio at this time, the preparation of the hybrid may be difficult. In the second hybrid, the ABE protein and the guide RNA targeting the P53 gene are preferably mixed in a molar ratio of 1:1 to 1:3.
상기 제1단계의 레시틴, 메탈 킬레이팅 지질, 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민 및 콜레스테롤은 1:0.005:0.1:0.1 내지 1:0.02:0.3:0.2의 몰 비로 혼합되는 것이 좋다. 마찬가지로 이 때의 혼합비를 벗어나게 되면 나노 리포좀을 구성하는 지질의 제조가 잘 되지 않을 수 있다. Lecithin, metal chelating lipid, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000) amine and cholesterol of the first step are 1:0.005:0.1:0.1 to 1:0.02:0.3:0.2 in a molar ratio. Likewise, if the mixing ratio is exceeded at this time, the preparation of lipids constituting the nano-liposome may not be performed well.
이 때, 상기 제3단계에서 동결하고 융해하는 과정은 1 ~ 12회 반복할 수 있다. 지질 필름 조성물을 동결하고 융해하는 단계를 반복함으로써 보다 균일한 크기의 나노 리포좀 분산액이 형성될 수 있고, 나노 리포좀의 약물 봉입 효율을 높일 수 있다. 단, 12회를 초과할 경우에는 나노 리포좀의 봉입 효율이 오히려 줄어들 수 있기 때문에 12회 이내가 바람직하다. At this time, the process of freezing and thawing in the third step may be repeated 1 to 12 times. By repeating the steps of freezing and thawing the lipid film composition, a nano-liposome dispersion having a more uniform size can be formed, and the drug encapsulation efficiency of the nano-liposome can be increased. However, if it exceeds 12 times, the encapsulation efficiency of the nano-liposome may be rather reduced, so less than 12 times is preferable.
상기 제4단계에서 나노 리포좀에 가교제를 1 ~ 5시간 동안 혼합한 다음 항체를 첨가하여 1 ~ 5시간 동안 혼합하는 것을 특징으로 한다. In the fourth step, the crosslinking agent is mixed with the nanoliposome for 1 to 5 hours, and then the antibody is added and mixed for 1 to 5 hours.
상기 제4단계에서 나노 리포좀, 가교제 및 항체는 10:1:1 내지 30:5:1의 중량비로 결합될 수 있다. In the fourth step, the nanoliposome, the crosslinking agent and the antibody may be bound in a weight ratio of 10:1:1 to 30:5:1.
본 발명은 또한 상기 나노 리포좀 전달체 조성물을 함유하는 약학 조성물을 제공할 수 있는데, 상기 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. The present invention may also provide a pharmaceutical composition containing the nano-liposome delivery system composition, wherein the pharmaceutical composition is a powder, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. orally according to a conventional method, respectively. It can be used by formulating in the form of form formulations, external preparations, suppositories, and sterile injection solutions. Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the composition of the present invention, for example, starch, calcium carbonate, sucrose or lactose; It is prepared by mixing gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01 ㎎/㎏/일 내지 대략 2,000 ㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1 ㎎/㎏/일 내지 500 ㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, weight, specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. Dosage determination based on these factors is within the level of one of ordinary skill in the art, and dosages generally range from 0.01 mg/kg/day to approximately 2,000 mg/kg/day. A more preferred dosage is 1 mg/kg/day to 500 mg/kg/day. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. The pharmaceutical composition of the present invention may be administered to mammals such as mice, livestock, and humans by various routes. All modes of administration can be envisaged, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebrovascular injection.
본 발명은 Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 혼성체; 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 혼성체;가 동봉된 나노 리포좀 전달체 조성물 또는 이를 함유하는 항암제 저항성 췌장암 치료제에 관한 것이다. 현재 췌장암 치료제로 사용되고 있는 젬시타빈은 다른 항암용 약물치료제와 비교하여 내성이 심해 다른 암에 비해 췌장암이 사망률이 높은 주된 원인이 되어 왔다. 이에 본 발명의 나노 리포좀은 KRAS 돌연변이를 제거하고 P53 돌연변이를 정상 유전자로 편집함으로써 췌장암 세포를 근본적으로 치료할 수 있어 매우 효과적인 항암제로 이용가능하다. The present invention is a hybrid of Cas9 protein and guide RNA targeting the KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; to a nano-liposome carrier composition or an anticancer drug-resistant pancreatic cancer treatment containing the enclosed composition. Gemcitabine, which is currently used as a treatment for pancreatic cancer, is more resistant than other anticancer drugs, and has been the main cause of higher mortality in pancreatic cancer compared to other cancers. Accordingly, the nanoliposome of the present invention can be used as a very effective anticancer agent because it can fundamentally treat pancreatic cancer cells by removing the KRAS mutation and editing the P53 mutation into a normal gene.
도 1은 췌장암 세포 내에서 일어나는 젬시타빈 내성 과정을 나타낸다. 1 shows the gemcitabine resistance process occurring in pancreatic cancer cells.
도 2a는 췌장암 세포의 유전자 돌연변이 타입을 나타내며, 도 2b는 각 췌장암 세포와 일반 췌장세포에서의 EGFR 막 단백질의 발현량을 확인한 결과를 나타낸다. Figure 2a shows the gene mutation type of pancreatic cancer cells, Figure 2b shows the results of confirming the expression level of the EGFR membrane protein in each pancreatic cancer cell and normal pancreatic cells.
도 3a는 단일 가이드 RNA 서열 선택을 위한 KRAS mRNA 발현량 확인 결과이며, 도 3b는 P53 sgRNA 표적 서열 후보 및 ABE7.10-nCas9를 코딩하는 서열을 포유류 세포 발현 플라스미드 (pCMV-ABE7.10-P53)에 클로닝한 결과를 나타내는 도식이며, 도 3c는 단일 가이드 RNA 서열 선택을 위한 P53 돌연변이 단백질 발현량 확인 결과이다.Figure 3a is a result of confirming the expression level of KRAS mRNA for single guide RNA sequence selection, Figure 3b is a mammalian cell expression plasmid (pCMV-ABE7.10-P53) of the sequence encoding the P53 sgRNA target sequence candidate and ABE7.10-nCas9. It is a schematic showing the result of cloning in, Figure 3c is the result of confirming the expression level of the P53 mutant protein for single guide RNA sequence selection.
도 4a는 Cas9이 표적 KRAS 유전자를 절단하는 기능이 있음을 확인한 결과이며, 도 4b는 ABE 단백질이 P53의 돌연변이 유전자를 교정했음을 나타내는 것을 확인한 결과를 나타낸다. Figure 4a shows the result of confirming that Cas9 has the function of cutting the target KRAS gene, and Figure 4b shows the result of confirming that the ABE protein corrected the mutant gene of P53 .
도 5a는 본 발명의 나노 리포좀의 구조 모식도 및 cryo-transmission electron microscopy (cryo-EM) 분석 결과를 나타내며, 도 5b는 본 발명 나노 리포좀의 췌장암 세포인 PANC1 세포에 대한 결합성을 FACS로 확인한 결과를 나타내고, 도 5c는 이를 면역형광(IF)으로 분석한 결과, 도 5d는 Cas9 및 ABE의 핵 내 투입 여부를 면역 염색법으로 확인한 결과이다 (Cas9 단백질-녹색, ABE 단백질-빨간색). Figure 5a shows the structural schematic diagram and cryo-transmission electron microscopy (cryo-EM) analysis results of the nano-liposome of the present invention, Figure 5b is the result of confirming the binding properties of the nano-liposome of the present invention to pancreatic cancer cells, PANC1 cells, by FACS. 5c shows the results of immunofluorescence (IF) analysis, and FIG. 5d shows the results of confirming whether Cas9 and ABE were injected into the nucleus by immunostaining (Cas9 protein-green, ABE protein-red).
도 6a는 항체 결합으로 NL (6.1 ± 1.17 mV)과 비교하여 NL-Ab (-6.58 ± 0.10 mV)의 제타 전위가 음전하를 나타냄을 확인한 결과이며, 도 6b는 NL-Ab의 EGFR 항체를 대상으로 웨스턴 블롯팅을 통해 나노 리포좀과 항체가 결합되었음을 확인한 결과, 도 6c는 세포 내 이입 억제제의 존재 하에서 세포 흡수 실험을 수행한 결과, 도 6d는 NL-Ab에 봉입된 Cas9 및 ABE 단백질 양의 정량 결과를 나타낸다. Figure 6a is the result of confirming that the zeta potential of NL-Ab (-6.58 ± 0.10 mV) shows a negative charge compared to NL (6.1 ± 1.17 mV) by antibody binding, and Figure 6b is the result of confirming that the EGFR antibody of NL-Ab As a result of confirming that the nanoliposome and the antibody were bound through western blotting, FIG. 6c is a result of a cell uptake experiment in the presence of an endocytosis inhibitor, FIG. 6d is a quantitative result of the amount of Cas9 and ABE proteins encapsulated in NL-Ab indicates
도 7은 리포펙타민이 처리된 세포, NL만 처리된 세포, NL-Ab가 처리된 세포에서의 Cas9 및 ABE의 세포 내 수송율을 확인한 결과를 나타낸다. 7 shows the results of confirming the intracellular transport rates of Cas9 and ABE in lipofectamine-treated cells, NL-only-treated cells, and NL-Ab-treated cells.
도 8a와 도 8b는 P53 및 KRAS 유전자 편집 후 PANC1 세포에서 단백질 및 mRNA의 발현을 확인한 CLSM(Confocal Laser Scanning Microscopy) 분석 및 qRT-PCR 결과이고, 도 8c는 KRAS 다운 스트림 및 P53 복원 경로를 확인하기 위해, PANC1 세포에 bare NL-Ab, NL(Cas9)-Ab, NL(ABE)-Ab 및 NL(Cas9/ABE)-Ab를 처리하여 다양한 신호전달 단백질의 발현 정도를 확인한 결과이다. 8a and 8b are CLSM (Confocal Laser Scanning Microscopy) analysis and qRT-PCR results confirming the expression of protein and mRNA in PANC1 cells after P53 and KRAS gene editing, and FIG. 8c is KRAS downstream and P53 restoration pathway. For this purpose, PANC1 cells were treated with bare NL-Ab, NL(Cas9)-Ab, NL(ABE)-Ab, and NL(Cas9/ABE)-Ab to confirm the expression level of various signaling proteins.
도 9는 WST-8 분석을 통해 PANC1 세포주가 젬시타빈(GEM) 약물 내성 PDAC 세포주임을 확인한 결과이다. 9 is a result of confirming that the PANC1 cell line is a gemcitabine (GEM) drug-resistant PDAC cell line through WST-8 analysis.
도 10a는 NL(Cas9/ABE)-Ab를 이용하여 2종의 유전자 편집 후 젬시타빈 처리시 세포 생존율을 확인한 결과를 나타내며, 도 10b는 NL(Cas9/ABE)-Ab 및 젬시타빈 공동 처리 결과에 대한 세포주기 분포 결과를 나타내며, 도 10c는 웨스턴 블롯팅을 통한 세포주기 관련 유전자의 다양한 단백질 발현 패턴 결과를 나타낸다. 또한 도 10d는 NL(Cas9/ABE)-Ab 처리 이후에 젬시타빈을 처리하였을 때, Cyclin A 및 CDK2와 같은 세포주기 체크 포인트를 확인한 결과이며, 도 10e는 NL(Cas9/ABE)-Ab와 젬시타빈이 공동 처리된 세포에서의 세포 아폽토시스 상태를 확인한 결과이다. 도 10f와 도 10g는 세포 사멸 경로에 관련된 다양한 유전자에 대한 영향을 확인한 결과, 도 10h는 젬시타빈에 대한 내성 조절에서 KRAS 및 P53 유전자의 역할을 명확히 하기 위해 다양한 분자 경쟁 관련 유전자의 단백질 발현을 분석 결과를 나타낸다. Figure 10a shows the results of confirming the cell viability upon treatment with gemcitabine after two kinds of gene editing using NL(Cas9/ABE)-Ab, and Figure 10b shows the results of co-treatment with NL(Cas9/ABE)-Ab and gemcitabine. shows the cell cycle distribution results, and FIG. 10c shows the results of various protein expression patterns of cell cycle-related genes through western blotting. In addition, Figure 10d is the result of confirming cell cycle checkpoints such as Cyclin A and CDK2 when gemcitabine is treated after NL(Cas9/ABE)-Ab treatment, and Figure 10e is NL(Cas9/ABE)-Ab and gem This is the result of confirming the cell apoptosis state in the cells co-treated with cytabine. 10f and 10g show the results of confirming the effect on various genes involved in the apoptosis pathway, and FIG. 10h shows the protein expression of various molecular competition-related genes to clarify the role of KRAS and P53 genes in regulating resistance to gemcitabine. show the results.
도 11은 각 췌장암 세포와 일반 췌장암 세포에서의 젬시타빈 결합 수용체 단백질(ENT1) 발현정도를 학인한 결과이다. 11 is a result of examining the expression level of gemcitabine-coupled receptor protein (ENT1) in each pancreatic cancer cell and general pancreatic cancer cell.
도 12a는 젬시타빈 내성 PANC1 세포 이식 이종 이식 마우스 모델을 제조하는 과정을 나타내는 도식이고, 도 12b는 실험 처치 후의 마우스의 사진 및 종양 부피를 나타내는 결과를 나타낸다. 12A is a schematic diagram showing the process of preparing a gemcitabine-resistant PANC1 cell transplantation xenograft mouse model, and FIG. 12B shows the results showing the photos and tumor volume of mice after experimental treatment.
도 13a은 항체가 결합된 NL 입자의 생체 내 특이적 표적화 능력을 확인하기 위해 적색 형광 (RITC) 표지된 입자를 PANC1 이종 이식 마우스의 복강 내 주입하고 입자 분포를 모니터링한 결과를 나타내며, 도 13b는 NL(Cas9/ABE)-Ab가 종양에 도달하여 나노리포좀 내부의 Cas9, ABE 단백질이 전달되었는지 종양 조직을 형광 면역 염색으로 확인한 결과이다. 도 13c는 NL(Cas9/ABE)-Ab 및 젬시타빈이 함께 처리된 Group 8 마우스의 종양 섹션에서 돌연변이 KRAS 및 P53 단백질의 억제 결과를 확인한 형광염색 사진, 도 13d는 Group 8 마우스에서 야생형 P53의 복원, P21 단백질의 과발현 및 phospho-ERK의 발현 억제가 확인된 사진, 도 13e는 생체 내에서 젬시타빈 약물 내성을 극복하기 위한 KRAS 및 P53 유전자 편집 종양 조직에서 GLUT1, TKT, CTPS 및 ENT1과 같은 다양한 바이오 마커의 생체 내 발현을 측정한 결과, 도 13f는 유전자 편집에 의해 젬시타빈 약물 내성을 극복한 종양의 세포 사멸을 평가하기 위해 조직을 TUNEL 분석 및 종양 증식 (Ki67)을 사용하여 시각화한 결과이다. 13a shows the results of intraperitoneal injection of red fluorescent (RITC)-labeled particles into PANC1 xenograft mice and monitoring the particle distribution in order to confirm the in vivo specific targeting ability of NL particles bound with an antibody, FIG. 13b shows This is the result of confirming the tumor tissue by fluorescent immunostaining whether NL(Cas9/ABE)-Ab reached the tumor and the Cas9 and ABE proteins inside the nanoliposome were delivered. Figure 13c is a fluorescence staining photograph confirming the results of inhibition of mutant KRAS and P53 proteins in tumor sections of Group 8 mice treated together with NL(Cas9/ABE)-Ab and gemcitabine, Figure 13d is restoration of wild-type P53 in Group 8 mice. , a photograph confirming the overexpression of P21 protein and suppression of the expression of phospho-ERK, FIG. 13e shows various biologics such as GLUT1, TKT, CTPS and ENT1 in KRAS and P53 gene-edited tumor tissues to overcome gemcitabine drug resistance in vivo As a result of measuring the expression of the marker in vivo, FIG. 13f is a result of visualizing the tissue using TUNEL analysis and tumor proliferation (Ki67) to evaluate apoptosis of tumors that have overcome gemcitabine drug resistance by gene editing.
도 14는 젬시타빈 내성 PANC1 세포 이식 이종 이식 마우스 모델에서의 장기 또는 체중의 변화를 기재한 결과이다. 14 is a result describing changes in organs or body weight in a gemcitabine-resistant PANC1 cell transplantation xenograft mouse model.
도 15는 본 발명의 나도리포좀 제조시 DSPE-PEG(2000)-아민 대신 DSPE를 사용하였을 때의 나노리포좀의 수용액상 상태를 UV-Vis 스펙트럼으로 확인한 결과를 나타낸다. 15 shows the results of confirming the aqueous phase state of nanoliposomes by UV-Vis spectrum when DSPE was used instead of DSPE-PEG(2000)-amine during the preparation of nadoliposomes of the present invention.
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided so that this disclosure will be thorough and complete, and will fully convey the spirit of the invention to those skilled in the art.
실시예 1. KRAS 및 P53 표적 단일 가이드 RNA 서열의 선택 Example 1. Selection of KRAS and P53 Target Single Guide RNA Sequences
pCas-Guide-EF1a-GFP (# GE100018)는 Origene에서 구입했다. ABE-nCas9 단백질 (pABE-Guide-EF1a-GFP)을 암호화하는 플라스미드는 이전 연구에서 제공된 ABE 7.10 서열에서 부위 지정 돌연변이 유발에 의해 생성되었다. KRAS 및 P53 표적 단일 가이드 RNA 서열의 선택을 수행하기 위해 플라스미드 (1.0 ㎍)를 Lipofectamine (Invitrogen)을 사용하여 PANC1 세포 (2.5 x 105 세포/12 웰 플레이트)로 형질 감염시켰다.pCas-Guide-EF1a-GFP (#GE100018) was purchased from Origene. A plasmid encoding the ABE-nCas9 protein (pABE-Guide-EF1a-GFP) was generated by site-directed mutagenesis in the ABE 7.10 sequence provided in a previous study. To perform selection of KRAS and P53 target single guide RNA sequences, plasmids (1.0 μg) were transfected into PANC1 cells (2.5 × 10 5 cells/12 well plate) using Lipofectamine (Invitrogen).
실시예 2. Cas9 및 ABE 7.10의 발현 및 정제 Example 2. Expression and purification of Cas9 and ABE 7.10
pET28a-Cas9 (# 53261) 및 pET42b-ABE (# 120398)는 Addgene에서 구입했다. Myc- 태그와 HA- 태그를 서브 클로닝하여 각 단백질을 확인하고, Cas9 및 ABE 단백질의 발현을 위해 BL21 StarTM (DE3) (Thermo Fisher)를 플라스미드로 형질 전환하고 600 nm에서 시료의 광학 밀도가 0.5 ~ 0.6이 될 때까지 형질 감염된 세포를 배양했다. 0.5 mM 이소프로필 β-d-1-티오갈락토피라노사이드로 유도한 후, pET28a-Cas9로 형질 전환된 세포를 28 ℃에서 배양하고 pET42b-ABE 처리된 세포를 18 ℃에서 16 시간 동안 배양하였다. Cas9 단백질의 정제를 위해 세포를 용해 완충액에 용해시킨 다음 초음파 처리 및 15000 x g, 4 ℃에서 20분 동안 원심 분리하였다. 이 후 상청액을 Ni-NTA 아가로스수지 (GE Healthcare)와 함께 반응시킨 후 용출 전에 세척 완충액에서 세척했다. pET28a-Cas9 (#53261) and pET42b-ABE (#120398) were purchased from Addgene. Each protein was identified by subcloning the Myc-tag and HA-tag, and BL21 Star TM (DE3) (Thermo Fisher) was transformed into a plasmid for expression of Cas9 and ABE proteins, and the optical density of the sample at 600 nm was 0.5 Transfected cells were incubated until ~0.6. After induction with 0.5 mM isopropyl β-d-1-thiogalactopyranoside, pET28a-Cas9-transformed cells were cultured at 28 °C, and pET42b-ABE-treated cells were cultured at 18 °C for 16 hours. . For purification of Cas9 protein, cells were lysed in lysis buffer and then sonicated and centrifuged at 15000 x g, 4 °C for 20 minutes. Thereafter, the supernatant was reacted with Ni-NTA agarose resin (GE Healthcare) and washed in wash buffer before elution.
ABE 단백질 제조를 위해서도 형질 감염된 세포를 용해시켰고 Cas9 수거시와 같은 레진을 이용해 ABE 단백질을 수득했다. 레진은 용출 전에 완충액으로 세척하고, 용출용 완충액을 이용하여 시료를 용출하였다. For the production of ABE protein, the transfected cells were lysed and the ABE protein was obtained using the same resin as when collecting Cas9. The resin was washed with a buffer before elution, and the sample was eluted using the elution buffer.
정제된 Cas9 및 ABE 단백질은 저장 완충액에 투석한 후 -80 ℃에 보관하였다.Purified Cas9 and ABE proteins were dialyzed against storage buffer and stored at -80°C.
용해 완충액 : 100mM Tris-HCl, pH 7.5, 0.3 M NaCl, 20 mM 이미다졸 및 0.5 mM PMSFLysis buffer: 100 mM Tris-HCl, pH 7.5, 0.3 M NaCl, 20 mM imidazole and 0.5 mM PMSF
세척용 완충액 : 100 mM Tris-HCl, pH 7.5, 1 M NaCl, 20 % 글리세롤, 5 mM DTT, 20 mM 이미다졸 및 0.5 mM PMSFWashing buffer: 100 mM Tris-HCl, pH 7.5, 1 M NaCl, 20% glycerol, 5 mM DTT, 20 mM imidazole and 0.5 mM PMSF
용출용 완충액 : 100 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 20 % 글리세롤, 5 mM DTT 및 20 mM 이미다졸 Elution buffer: 100 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 20% glycerol, 5 mM DTT and 20 mM imidazole
저장 완충액 : 100 mM Tris-HCl, pH 7.5, 0.3 M NaCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF 및 20 % 글리세롤Storage Buffer: 100 mM Tris-HCl, pH 7.5, 0.3 M NaCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF and 20% Glycerol
실시예 3. 단일 가이드 RNA(sgRNA)의 시험관내 T7 전사 Example 3. In vitro T7 transcription of single guide RNA (sgRNA)
시험관 내 sgRNA 전사를 위한 DNA 주형은 T7 프로모터 서열을 포함하는 정방향 프라이머로 PCR을 사용하여 준비하였다. sgRNA DNA 템플릿은 반응 완충액 (rNTP, RNase inhibitor, DTT)에서 T7 RNA 중합 효소 (Takara)와 함께 37 ℃에서 16 시간 동안 반응하였다. 혼합물을 DNase Ⅰ (Takara)로 처리하여 DNA 주형을 37 ℃에서 30 분 동안 제거 하였다. 합성된 sgRNA를 phenol : chloroform : isoamyl alcohol로 추출한 후 2-propanol을 이용하여 침전시켰다.A DNA template for in vitro sgRNA transcription was prepared using PCR with forward primers containing the T7 promoter sequence. The sgRNA DNA template was reacted with T7 RNA polymerase (Takara) in a reaction buffer (rNTP, RNase inhibitor, DTT) at 37 °C for 16 hours. The mixture was treated with DNase I (Takara) to remove the DNA template at 37 °C for 30 min. The synthesized sgRNA was extracted with phenol : chloroform : isoamyl alcohol and then precipitated using 2-propanol.
실시예 4. 정제된 Cas9 및 ABE7.10의 활성Example 4. Activity of purified Cas9 and ABE7.10
Cas9 절단 테스트를 위해 하기 표 1에 나열된 프라이머를 사용하여 KRAS 표적 부위를 포함하는 DNA 서열을 증폭했다. KRAS 표적 PCR 산물 (0.5 ㎍)에 정제된 Cas9 단백질(1.56 μM) 및 KRAS sgRNA (1.47 μM)를 NEB 버퍼 3 (10 μL) 상에서 37 ℃에서 1 시간 동안 처리하였다. 분해된 산물은 2 % 아가로스겔을 통해 확인하였다. For the Cas9 cleavage test, the primers listed in Table 1 below were used to amplify the DNA sequence containing the KRAS target site. Purified Cas9 protein (1.56 μM) and KRAS sgRNA (1.47 μM) in KRAS target PCR product (0.5 μg) were treated in NEB buffer 3 (10 μL) at 37° C. for 1 hour. The degraded product was confirmed through a 2% agarose gel.
단일 가이드 RNA(sgRNA)의 시험관내 T7 전사에 사용된 프라이머Primers used for in vitro T7 transcription of single guide RNA (sgRNA)
KRAS sgRNA 제작을 위한 정방향 프라이머Forward primer for KRAS sgRNA construction 5’-GCGGCCTCTAATACGACTCACTATAGGGCTGAATTAGCTGTATCGTCAGTTTTAGAGCTAGAAATAGCA-3’ (서열번호 3이 포함되며, 서열번호 7을 제작하기 위한 정방향 프라이머)5'-GCGGCCTCTAATACGACTCACTATAGGGCTGAATTAGCTGTATCGTCAGTTTTAGAGCTAGAAATAGCA-3' (including SEQ ID NO: 3, forward primer for preparing SEQ ID NO: 7)
P53 sgRNA 제작을 위한 정방향 프라이머Forward primer for P53 sgRNA construction 5’-GCGGCCTCTAATACGACTCACTATAGGGGTGCATGTTTGTGCCTGTCCGTTTTAGAGCTAGAAATAGCA-3’ (서열번호 4가 포함되며, 서열번호 8을 제작하기 위한 정방향 프라이머)5'-GCGGCCTCTAATACGACTCACTATAGGGGTGCATGTTTGTGCCTGTCCGTTTTAGAGCTAGAAATAGCA-3' (including SEQ ID NO: 4, forward primer for preparing SEQ ID NO: 8)
Scramble sgRNA 제작을 위한 정방향 프라이머Forward Primer for Scramble sgRNA Construction 5’-GCGGCCTCTAATACGACTCACTATAGGGGCACTACCAGAGCTAACTCAGTTTTAGAGCTAGAAATAGCA-3’5’-GCGGCCTCTAATACGACTCACTATAGGGGCACTACCAGAGCTAACTCAGTTTTAGAGCTAGAAATAGCA-3’
sgRNA 제작을 위한 역방향 프라이머Reverse primer for sgRNA construction 5’-AAAAGCACCGACTCGGTG-3’ (서열번호 7, 8을 제작하기 위한 정방향 프라이머)5'-AAAAGCACCGACTCGGTG-3' (forward primer to produce SEQ ID NOs: 7 and 8)
정제된 Cas9 및 ABE7.10의 활성 확인을 위해 사용된 프라이머Primers used to confirm the activity of purified Cas9 and ABE7.10
KRAS 표적 PCR 산물 제작을 위한 프라이머Primer for KRAS target PCR product production (정방향)　5’-CATATAAAGGTGAGTTTGTATTAAAAGG-3’,
(역방향)　5’-CTGAAATACACTTCCAATCAAAATGC-3’(forward) 5'-CATATAAAGGTGAGTTTGTATTAAAAGG-3',
(reverse) 5'-CTGAAATACACTTCCAATCAAAATGC-3'
P53 표적 PCR 산물 제작을 위한 프라이머Primers for the production of P53 target PCR products (정방향) 5’-AATCTCCTTACTGCTCCCACTCAG-3’,
(역방향) 5’-CAAGACTTAGTACCTGAAGGGTG-3’(forward) 5'-AATTCCCTTACTGCTCCCACTCAG-3',
(reverse) 5'-CAAGACTTAGTACCTGAAGGGTG-3'
ABE 활성을 위해서는, P53 표적 PCR 산물 (0.5 ㎍)을 37 ℃에서 3 시간 동안 NEB 완충액 3(10 μL)에서 정제된 ABE 단백질 (1.0 μM) 및 P53 sgRNA (1.47 μM)로 처리했다. 다음으로 엔도뉴클레아제 V (endoV, NEB)와 함께 인큐베이션하기 전에 반응 혼합물을 1 시간 동안 37 ℃에서 Nucleospin PCR Cleanup (MN)을 사용하여 정제했다. 분해된 산물은 2 % 아가로스 겔을 통해 확인하였다. For ABE activity, P53 target PCR product (0.5 μg) was treated with purified ABE protein (1.0 μM) and P53 sgRNA (1.47 μM) in NEB buffer 3 (10 μL) at 37° C. for 3 hours. Next, the reaction mixture was purified using Nucleospin PCR Cleanup (MN) at 37 °C for 1 h before incubation with endonuclease V (endoV, NEB). The degraded product was confirmed through a 2% agarose gel.
PANC1 세포의 게놈 DNA (10 ㎍)를 NucleoSpin Tissue (MN)를 사용하여 정제하고 37 ℃에서 16 시간 동안 NEB 버퍼 3에서 정제된 ABE (1.0 μM), sgRNA (1.47 μM)로 처리했다. RNase A (50 ㎍/mL) 및 proteinase K (20 mg/mL) 처리 후, 이노신 함유 게놈 DNA를 페놀:클로로포름:이소아밀알코올로 추출하고 2-프로판올을 사용하여 침전시켰다. 정제된 DNA (6 ㎍)를 37 ℃에서 6 시간 동안 endoV (10 유닛)와 함께 반응하였다. 이 후 반응 생성물을 다시 페놀:클로로포름:이소아밀알코올로 추출하고 2-프로판올을 사용하여 침전시켰다. PANC1 세포의 P53 돌연변이 표적 부위 (818G> A, R273H)는 Sanger 시퀀싱 분석에 의해 확인하였다.Genomic DNA (10 μg) of PANC1 cells was purified using NucleoSpin Tissue (MN) and treated with ABE (1.0 μM) and sgRNA (1.47 μM) purified in NEB buffer 3 at 37°C for 16 hours. After treatment with RNase A (50 μg/mL) and proteinase K (20 mg/mL), inosine-containing genomic DNA was extracted with phenol:chloroform:isoamyl alcohol and precipitated with 2-propanol. Purified DNA (6 μg) was reacted with endoV (10 units) at 37° C. for 6 hours. After that, the reaction product was again extracted with phenol:chloroform:isoamyl alcohol and precipitated with 2-propanol. The P53 mutation target site (818G>A, R273H) of PANC1 cells was identified by Sanger sequencing analysis.
실시예 5. 세포 배양 및 형질 감염 Example 5. Cell Culture and Transfection
인간 췌관 상피 세포주 (H6c7, Kerafest)를 제외한 모든 세포주는 한국 세포주 은행에서 구매하였다. PANC1 및 MIAPaCa-2 세포는 10 % 소 태아 혈청 (FBS) 및 1 % 페니실린/스트렙토마이신이 보충된 Dulbecco Modified Eagle Medium에서 배양하였다. BxPC-3 및 Capan-2 세포는 10 % FBS 및 1 % 페니실린/스트렙토마이신이 보충된 RPMI 배지에서 배양하였다. H6c7 세포는 keratinocyte basal medium와 보충제 (Clonetics KBM, # CC-3111)에서 배양되었으며 모든 세포는 마이코 플라스마 음성인 것을 확인 후 사용하였다. 플라스미드 (pCMV-Cas9-KRAS, pCMV-ABE7.10-P53 및 pCMV-ENT1)는 Lipofectamine 3,000 (Invitrogen)을 사용하여 세포에 형질 감염시켰다. All cell lines except the human pancreatic duct epithelial cell line (H6c7, Kerafest) were purchased from the Korean Cell Line Bank. PANC1 and MIAPaCa-2 cells were cultured in Dulbecco Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. BxPC-3 and Capan-2 cells were cultured in RPMI medium supplemented with 10% FBS and 1% penicillin/streptomycin. H6c7 cells were cultured in keratinocyte basal medium and supplement (Clonetics KBM, # CC-3111), and all cells were used after confirming that they were mycoplasma-negative. Plasmids (pCMV-Cas9-KRAS, pCMV-ABE7.10-P53 and pCMV-ENT1) were transfected into cells using Lipofectamine 3,000 (Invitrogen).
각 실험을 위한 PANC1 세포는 5 % CO2 조건, 37 ℃에서 60-mm2 세포 배양 플레이트에 1.5 x 106개의 세포를 접종한 다음 나노리포좀을 투여하되, NL(Cas9/ABE)-Ab 기준으로 68.25 nM의 Cas9 및 ABE를 첨가하고 37 ℃에서 배양하였고, 필요에 따라 나노리포좀 처리 3 시간 후에 젬시타빈(10 μM)을 투여하고 24 시간 동안 계속 배양하였다. PANC1 cells for each experiment were inoculated with 1.5 x 10 6 cells in a 60-mm 2 cell culture plate at 5% CO 2 condition, 37 ° C., and then nanoliposomes were administered, but based on NL(Cas9/ABE)-Ab 68.25 nM of Cas9 and ABE were added and incubated at 37 ° C. If necessary, after 3 hours of nanoliposome treatment, gemcitabine (10 μM) was administered and the culture was continued for 24 hours.
실험예 1. 타겟 유전자 대상 단일 가이드 RNA (sgRNA) 선정 및 합성된 Cas9와 ABE의 시험관 내 기능 확인 Experimental Example 1. Selection of target gene target single guide RNA (sgRNA) and confirmation of in vitro functions of the synthesized Cas9 and ABE
췌장암 세포들은 도 2a처럼 다양한 타입의 유전자 돌연변이가 있다. PANC1 세포는 코돈 12에서 KRAS 유전자 점 돌연변이 (c.35G> A, p.G12D) 및 코돈 273에서 P53 유전자 점 돌연변이 (c.818G> A, p.R273H)가 있다. 단일 점 돌연변이 세포주로서 BxPC-3은 P53 유전자 돌연변이와 야생형 KRAS 유전자를 가졌고 Capan-2는 KRAS 유전자 돌연변이만 가지고 있다. Pancreatic cancer cells have various types of gene mutations as shown in FIG. 2a. PANC1 cells have a KRAS gene point mutation at codon 12 (c.35G>A, p.G12D) and a P53 gene point mutation at codon 273 (c.818G>A, p.R273H). As a single point mutant cell line, BxPC-3 had a P53 gene mutation and a wild-type KRAS gene, and Capan-2 only had a KRAS gene mutation.
한편, 각 췌장암 세포별로 EGFR 막 단백질의 발현에 대해 일반 췌장 세포 (H6c7)의 발현 수준과 비교하여(도 2b), PANC1을 유전자 편집 대상 세포로 결정하였고, KRAS 및 P53 유전자 편집에 효과적인 KRAS 및 P53 sgRNA 표적 서열을 선택하였다. On the other hand, compared with the expression level of normal pancreatic cells (H6c7) for the expression of EGFR membrane protein for each pancreatic cancer cell (Fig. 2b), PANC1 was determined as the target cell for gene editing, and KRAS and P53 effective for KRAS and P53 gene editing The sgRNA target sequence was selected.
KRAS 유전자 인식을 위한 sgRNA 서열은 qRT-PCR 법으로 sgKRAS-1 서열이 KRAS mRNA 발현을 현저하게 감소시키는 것을 확인하여 선택하였다(도 3a).The sgRNA sequence for KRAS gene recognition was selected by confirming that the sgKRAS-1 sequence significantly reduced KRAS mRNA expression by qRT-PCR (FIG. 3a).
P53 표적 유전자(sgP53)에 대한 sgRNA 서열 후보는 PANC1 세포의 P53 점돌연변이 (c.818G> A, p.R273H)를 포함하여 두 가지 다른 sgP53 서열을 선택하고, P53 sgRNA 표적 서열 후보 및 ABE7.10-nCas9을 코딩하는 서열을 포유류 세포 발현 플라스미드 (pCMV-ABE7.10-P53)에 클로닝하여 확인하였다(도 3b). 이를 리포펙타민을 사용하여 벡터로서 PANC-1 세포를 형질 감염시킨 후, sgP53-2 서열이 돌연변이 P53 단백질 수준을 현저히 감소시킴을 알 수 있다(도 3c). The sgRNA sequence candidates for the P53 target gene (sgP53) selected two different sgP53 sequences, including the P53 point mutation in PANC1 cells (c.818G > A, p.R273H), the P53 sgRNA target sequence candidate and ABE7.10. The sequence encoding -nCas9 was confirmed by cloning into a mammalian cell expression plasmid (pCMV-ABE7.10-P53) (Fig. 3b). After transfecting PANC-1 cells as a vector using lipofectamine, it can be seen that the sgP53-2 sequence significantly reduced the mutant P53 protein level (FIG. 3c).
이에 본 발명에서는 PANC-1 세포에서 sgKRAS-1 (KRAS 표적 서열 : CTGATTAGCTGTATCGTCA) 및 sgP53-2 (P53 표적 서열 : GTGCATGTTTGTGCCTGTCC)를 사용하여 KRAS 및 P53 돌연변이 유전자를 편집하기로 하였다.Accordingly, in the present invention, KRAS and P53 mutant genes were edited using sgKRAS-1 (KRAS target sequence: CTGATTAGCTGTATCGTCA) and sgP53-2 (P53 target sequence: GTGCATGTTTGTGCCTGTCC) in PANC-1 cells.
다음으로는 대장균(E. coli)에서 재조합 Cas9를 정제하여 얻은 후 KRAS 유전자(PCR 산물)의 500-bp 단편의 시험관 내 절단을 평가하였다. 그 결과, Cas9이 표적 KRAS 유전자를 절단하는 기능이 있음을 아가로스겔 전기영동 분석을 통해 확인할 수 있다(도 4a). Next, the in vitro cleavage of the 500-bp fragment of the KRAS gene (PCR product) after purifying recombinant Cas9 from E. coli was evaluated. As a result, it can be confirmed through agarose gel electrophoresis analysis that Cas9 has a function of cleaving the target KRAS gene (FIG. 4a).
재조합 ABE 단백질은 ABE7.10-nCas9 벡터 발현 후 대장균에서 정제되었으며, ABE 매개 염기 전환 능력은 P53 유전자 PCR 산물의 시험관 내 절단으로 검출된다. 정제된 재조합 ABE 와 P53 PCR 산물을 반응시키면 표적 유전자를 먼저 A-to-I로 전환하고 500bp P53 PCR 산물을 엔도뉴클레아제 V (endoV)로 절단하여 이중 가닥 파손을 생성하는데, P53 염기 탈아미노화를 Sanger 시퀀싱으로 확인할 수 있으며, ABE-RNP 처리된 PCR 산물이 A에서 I로의 전환을 통해 이중 피크 밴드를 갖는 것으로 나타난다(도 4b).The recombinant ABE protein was purified from E. coli after expression of the ABE7.10-nCas9 vector, and the ABE-mediated base conversion ability was detected by in vitro cleavage of the P53 gene PCR product. When the purified recombinant ABE and the P53 PCR product are reacted, the target gene is first converted to A-to-I, and the 500bp P53 PCR product is digested with endonuclease V (endoV) to generate a double-stranded break. Aging can be confirmed by Sanger sequencing, and it appears that the ABE-RNP-treated PCR product has a double peak band through the conversion of A to I (Fig. 4b).
실험예 2. 나노 리포좀(NL-Ab)의 제조 Experimental Example 2. Preparation of nano liposomes (NL-Ab)
NL은 박막 수화 방법을 사용하여 준비하였다. 간단히 말해서, 레시틴 : 콜레스테롤 : DGS-NTA (Ni) : DSPE-PEG(2000) 아민 (몰비 1 : 0.2 : 0.0125 : 0.25)을 클로로포름 1 mL에 용해시키고 용매를 증발시켰다. 필름은 정제된 각각의 383 nM의 Cas9 및 ABE 및 1 mL 포스페이트 완충 식염수 (PBS) (pH 7.2)에 분산된 625.5 nM sgRNA 복합체로 수화되었다. 동결-해동 절차 후, NL 용액을 4 ℃에서 2 시간 동안 sulfo-SMCC와 함께 배양하였다. NL was prepared using the thin film hydration method. Briefly, lecithin:cholesterol:DGS-NTA(Ni):DSPE-PEG(2000)amine (molar ratio 1:0.2:0.0125:0.25) was dissolved in 1 mL of chloroform and the solvent was evaporated. Films were hydrated with purified 383 nM of each of Cas9 and ABE and 625.5 nM sgRNA complexes dispersed in 1 mL phosphate buffered saline (PBS), pH 7.2. After the freeze-thaw procedure, the NL solution was incubated with sulfo-SMCC at 4 °C for 2 h.
sulfo-SMCC : (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) sulfo-SMCC : (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate)
투석을 통해 미반응물을 제거하고 NL에 4 ℃에서 16 시간 동안 thiolated EGFR 항체를 결합하였다. 생성된 NL-Ab 용액을 0.2 μm 주사기 필터를 통해 여과한 다음 1,000 kDa 멤브레인을 통해 4 ℃에서 16 시간 동안 투석하였다. The unreacted material was removed by dialysis and thiolated EGFR antibody was bound to NL at 4 °C for 16 hours. The resulting NL-Ab solution was filtered through a 0.2 μm syringe filter and then dialyzed through a 1,000 kDa membrane at 4 °C for 16 hours.
이 때, 본 발명에서, 나노 리포좀은 기존의 대한민국 등록특허 제10-1796036호에 공시된 방법과 유사하게 제조하되, 리포좀 내부에 Cas9 및 sgKRAS 혼성체 외에 ABE 및 sgP53 복합체가 봉입되도록 하였다. 이 2종의 복합체의 혼합비는 동일 중량으로 추가하였다. At this time, in the present invention, the nano-liposome was prepared similarly to the method disclosed in the existing Korean Patent No. 10-1796036, but the ABE and sgP53 complex were encapsulated in the liposome in addition to the Cas9 and sgKRAS hybrid. The mixing ratio of these two types of composites was added by the same weight.
다만 이 때 Cas9 및 sgKRAS 혼성체에는 대한민국 등록특허 제10-1796036호에서와 달리 폴리에틸렌이민이 결합되지 않은 것을 사용하였다. 탑재되는 Cas9과 ABE 단백질에는 나노 리포좀 구성 화합물인 DGS-NTA-Ni과 결합이 충분히 가능하기 때문에 양이온성 고분자를 사용하지 않아도 된다. 리포좀의 지질층은 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민(DSPE) 대신 DSPE-PEG(2000)-아민을 사용하였다. DSPE-PEG(2000)-아민에 존재하는 PEG(2000)은 수용액 상태에서 나노 리포좀의 안정성을 제공하는 역할을 하고, Cas9 및 sgKRAS 혼성체에 폴리에틸렌이민을 결합하지 않아도 리포좀 내 봉입율을 높이며, 리포좀 외부에 아민기를 통해 원하는 항체를 도입하는 역할을 한다. However, at this time, the Cas9 and sgKRAS hybrids were used in which polyethyleneimine was not bound, unlike in Korean Patent Registration No. 10-1796036. Since the Cas9 and ABE proteins to be loaded can sufficiently bind with DGS-NTA-Ni, a compound constituting a nano-liposome, there is no need to use a cationic polymer. For the lipid layer of the liposome, DSPE-PEG(2000)-amine was used instead of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE). DSPE-PEG(2000)-PEG(2000) present in amine serves to provide stability of nanoliposomes in an aqueous solution state, increases the encapsulation rate in liposomes without binding polyethyleneimine to Cas9 and sgKRAS hybrids, and liposomes. It serves to introduce the desired antibody through an amine group to the outside.
실험예 3. 나노 리포좀(NL-Ab)의 성상 확인 Experimental Example 3. Confirmation of properties of nano liposomes (NL-Ab)
제조된 나노 리포좀 조성물은 200 nm 여과 및 1,000 kDa 투석 후, 저온 전도 전자 현미경 확인(저온 전도 전자 현미경 검사), DLS(dynamic light scattering) 분석, 제타 전위 측정 및 웨스턴 블롯 분석을 수행하여 형태, 크기, 표면을 평가하였다. NL-Ab의 유체 역학적 크기와 제타 전위는 Zetasizer Nano ZS (Malvern Instruments)를 사용하여 측정하였다. NL-Ab의 형태는 cryo-transmission electron microscopy (cryo-EM, Tecnai F20 G2, FEI)를 사용하여 관찰하였다. The prepared nano-liposome composition was subjected to 200 nm filtration and 1,000 kDa dialysis, followed by low-temperature conduction electron microscopy (low-temperature conduction electron microscopy), dynamic light scattering (DLS) analysis, zeta potential measurement and Western blot analysis to obtain shape, size, The surface was evaluated. The hydrodynamic size and zeta potential of NL-Ab were measured using a Zetasizer Nano ZS (Malvern Instruments). The morphology of NL-Ab was observed using cryo-transmission electron microscopy (cryo-EM, Tecnai F20 G2, FEI).
그 결과 141.0 ± 1.28 nm의 나노미터 크기를 갖는 구형 입자가 DLS 측정으로 확인된다(도 5a). As a result, spherical particles having a nanometer size of 141.0 ± 1.28 nm were confirmed by DLS measurement (FIG. 5a).
웨스턴 블롯은 다음의 방법으로 실시하였다. Western blotting was performed in the following manner.
PANC1 세포를 프로테아제 억제제 및 포스파타제 억제제 (Sigma)와 함께 RIPA 버퍼에서 용해하였다. 전체 세포 용해물은 BCA 단백질 분석 키트 (Thermo Scientific)를 사용하여 표준화하였다. 다음으로 세포 용해물 (40 ㎍)을 변성 조건 하에서 12 % SDS-PAGE 겔에 로딩하고 PVDF 막 (iBlot2 Dry Blotting System, Thermo Scientific)으로 이동하였다. 막을 5 % 탈지우유로 실온에서 1 시간 동안 차단하고 다음 1 차 항체와 함께 4 ℃에서 16 시간 동안 반응시켰다 : anti-RAS, phospho-ERK, phospho-Rb (Cell Signaling), anti-mutant P53, p27KIP , p21CIP (Abcam), 안티 야생형 P53 (Sigma), Cyclin D1, CDK4, GLUT1, TKT, 액틴 (Santa Cruz) 및 HIF-1α, CTPS1 및 ENT1 (Proteintech). PANC1 cells were lysed in RIPA buffer with a protease inhibitor and a phosphatase inhibitor (Sigma). Whole cell lysates were normalized using the BCA Protein Assay Kit (Thermo Scientific). Next, the cell lysate (40 μg) was loaded on a 12% SDS-PAGE gel under denaturing conditions and transferred to a PVDF membrane (iBlot2 Dry Blotting System, Thermo Scientific). Membranes were blocked with 5% skim milk at room temperature for 1 h and reacted with the following primary antibodies at 4 °C for 16 h: anti-RAS, phospho-ERK, phospho-Rb (Cell Signaling), anti-mutant P53, p27KIP , p21CIP (Abcam), anti-wild-type P53 (Sigma), Cyclin D1, CDK4, GLUT1, TKT, actin (Santa Cruz) and HIF-1α, CTPS1 and ENT1 (Proteintech).
HRP- 접합된 이차 항체를 실온에서 2 시간 동안 반응시킨 후 멤브레인에 웨스턴 ECL 처리 후 발광 이미지를 LAS500 (GE Healthcare)을 사용하여 분석하였다. After the HRP-conjugated secondary antibody was reacted at room temperature for 2 hours, the membrane was treated with Western ECL and the luminescence image was analyzed using LAS500 (GE Healthcare).
RNA는 제조업체의 지침에 따라 Trizol (Invitrogen)을 사용한 총 RNA 정제 후 SuprimeScript RT 프리믹스 (GeNetBio) 및 올리고 dT 프라이머로 역전사하였다. SYBR Green Premix (Applied Biosystems)를 사용하여 Quantstudio3에서 정량적 PCR (qPCR)을 수행했다. 관심있는 전사체는 액틴 전사체 수준으로 정규화되어 RNA를 정량하였다. 이 때 사용된 프라이머 서열은 표 2에 나열하였다.RNA was reverse transcribed with SuprimeScript RT premix (GeNetBio) and oligo dT primers after total RNA purification using Trizol (Invitrogen) according to the manufacturer's instructions. Quantitative PCR (qPCR) was performed in Quantstudio3 using SYBR Green Premix (Applied Biosystems). Transcripts of interest were normalized to actin transcript levels to quantify RNA. The primer sequences used at this time are listed in Table 2.
정량적 PCR 분석을 위한 프라이머Primers for quantitative PCR analysis
타겟target 정방향 프라이머forward primer 역방향 프라이머reverse primer
KRAS (G12D)KRAS (G12D) 5’-ACTTGTGGTAGTTGGAGCAGA-3’5’-ACTTGTGGTAGTTGGAGCAGA-3’ 5’-TTGGATCATATTCGTCCACAA-3’5’-TTGGATCATATTCGTCCACAA-3’
β-Actinβ-Actin 5’-ACGTGGACATCCGCAAAGA-3’5’-ACGTGGACATCCGCAAAGA-3’ 5’-CTCAGGAGGAGCAATGATC-3’5’-CTCAGGAGGAGCAATGATC-3’
BAX
(origene, #HP207656)BAX
(origene, #HP207656) 		5’-TCAGGATGCGTCCACCAAGAAG-3’5’-TCAGGATGCGTCCACCAAGAAG-3’ 5’-TGTGTCCACGGCGGCAATCATC-3’5’-TGTGTCCACGGCGGCAATCATC-3’
BCL2
(origene, #HP200598)BCL2
(origene, #HP200598) 		5’-ATCGCCCTGTGGATGACTGAGT-3’5’-ATCGCCCTGTGGATGACTGAGT-3’ 5’-GCCAGGAGAAATCAAACAGAGGC-3’5’-GCCAGGAGAAATCAAACAGAGGC-3’
PUMA
(origene, #HP210869)PUMA
(origene, #HP210869) 		5’-ACGACCTCAACGCACAGTACGA-3’5’-ACGACCTCAACGCACAGTACGA-3’ 5’-CCTAATTGGGCTCCATCTCGGG-3’5’-CCTAATTGGGCTCCATCTCGGG-3’
PARP
(origene, #HP205442)PARP
(origene, #HP205442) 		5’-CCAAGCCAGTTCAGGACCTCAT-3’5’-CCAAGCCAGTTCAGGACCTCAT-3’ 5’-GGATCTGCCTTTTGCTCAGCTTC-3’5’-GGATCTGCCTTTTGCTCAGCTTC-3’
Caspase3
(origene, #HP207674)Caspase3
(origene, #HP207674) 		5’-GGAAGCGAATCAATGGACTCTGG-3’5’-GGAAGCGAATCAATGGACTCTGG-3’ 5’-GCATCGACATCTGTACCAGACC-3’5’-GCATCGACATCTGTACCAGACC-3’
NL-Ab의 세포 내 이입 메커니즘을 확인하기 위해서는 PANC1에 genistein (10 ㎍/mL), chlorpromazine (20 ㎍/mL), nocodazole (1.5 ㎍/mL) 및 cytochalasin B (4.8 ㎍/mL)에 첨가해 2 시간 동안 배양하였다. 다음으로, 세포에 NL(Cas9/ABE)-Ab (2.5 mL opti-MEM에서 각각 68.25 nM의 Cas9 및 ABE)를 처리하였다. 모든 샘플은 4 ℃의 샘플을 제외하고 37 ℃에서 배양되었고, 24 시간 후에 flow cytometry (Accuri C6 Plus, BD)로 처리한 후 분석하였다.To confirm the endocytosis mechanism of NL-Ab, PANC1 was added to genistein (10 μg/mL), chlorpromazine (20 μg/mL), nocodazole (1.5 μg/mL) and cytochalasin B (4.8 μg/mL). incubated for hours. Next, cells were treated with NL(Cas9/ABE)-Ab (Cas9 and ABE at 68.25 nM each in 2.5 mL opti-MEM). All samples were incubated at 37 °C except for samples at 4 °C, and 24 hours later, they were analyzed by flow cytometry (Accuri C6 Plus, BD).
또한 이렇게 제조된 NL-Ab가 항체가 결합되어 있기 때문에 PANC1 및 H6c7 세포를 형광면역법(IF)으로 분석하였다. 세포 형광면역법은 다음의 방법으로 실험을 수행하였다. 이를 위해, PANC1 세포를 5 % CO2 하에서 37 ℃ 에서 8-웰 세포 배양 슬라이드 (4 x 104 세포/슬라이드)에 분주했다. 세포를 NL(Cas9/ABE)-Ab (각각 22.75 nM의 Cas9 및 ABE in 0.2 mL opti-MEM)와 함께 37 ℃에서 3 시간 동안 배양 한 다음 세포에 젬시타빈 (10 μM)을 처리하고 48 시간 후에 분석했다. 세포는 파라 포름 알데히드로 세포 고정 후 permeabilization (0.01 % Triton X-100)과 blocking (TBST의 3 % BSA)하였다. 4 ℃에서 16 시간 동안 1 차 항체와 함께 배양한 후, 세포를 형광 결합 2 차 항체와 함께 실온에서 2 시간 동안 배양했다. 세포는 형광 현미경 (LSM800, Carl Zeiss)으로 관찰하였다.In addition, since the thus-prepared NL-Ab is bound to an antibody, PANC1 and H6c7 cells were analyzed by fluorescence immunoassay (IF). Cell fluorescence immunoassay was performed in the following way. For this, PANC1 cells were seeded into 8-well cell culture slides (4 x 10 4 cells/slide) at 37 °C under 5% CO 2 . Cells were incubated with NL(Cas9/ABE)-Ab (22.75 nM of Cas9 and ABE in 0.2 mL opti-MEM, respectively) at 37 °C for 3 h, then the cells were treated with gemcitabine (10 µM) and 48 h later. analyzed. Cells were fixed with paraformaldehyde, followed by permeabilization (0.01% Triton X-100) and blocking (3% BSA in TBST). After incubation with primary antibody at 4 °C for 16 h, cells were incubated with fluorescent-conjugated secondary antibody for 2 h at room temperature. Cells were observed under a fluorescence microscope (LSM800, Carl Zeiss).
실험 결과, 도 5b와 도 5c에서와 같이 NL-Ab의 EGFR 항체가 H6c7 세포에 비해 PANC1 세포와 더 결합을 잘 하는 것을 확인할 수 있다. Cas9 및 ABE-RNP의 핵 내 투입 여부를 확인하기 위해 NL-Ab가 처리된 세포를 anti-Myc (Cas9 단백질, 녹색) 및 anti-HA (ABE 단백질, 빨간색)로 면역 염색한 후 IF로 시각화한 결과 Cas9 및 ABE-RNP로부터 핵 위치 서열의 침투 능력으로 인해 핵에서 형광 신호가 검출된다(도 5d). As a result of the experiment, it can be confirmed that the EGFR antibody of NL-Ab binds better to the PANC1 cells than the H6c7 cells, as shown in FIGS. 5b and 5c. To determine whether Cas9 and ABE-RNP were injected into the nucleus, NL-Ab-treated cells were immunostained with anti-Myc (Cas9 protein, green) and anti-HA (ABE protein, red), and then visualized by IF. Results A fluorescent signal is detected in the nucleus due to the penetrating ability of the nuclear localization sequence from Cas9 and ABE-RNP (Fig. 5d).
또한, 항체 결합으로 인해 NL (6.1 ± 1.17 mV)과 비교하여 NL-Ab (-6.58 ± 0.10 mV)의 제타 전위가 음전하를 나타냄을 파악하였다(도 6a). 이 때 NL-Ab의 EGFR 항체를 대상으로 웨스턴 블롯팅을 통해 측정되어 나노입자 제조가 잘 되었음을 다시 한번 확인할 수 있다(도 6b). In addition, it was found that the zeta potential of NL-Ab (-6.58 ± 0.10 mV) exhibited a negative charge compared to NL (6.1 ± 1.17 mV) due to antibody binding (FIG. 6a). At this time, the EGFR antibody of NL-Ab was measured through western blotting to confirm once again that the nanoparticles were well prepared (FIG. 6b).
세포 내 이입 억제제의 존재 하에서 세포 흡수 실험을 수행한 경우에는(도 6c). 클라트린 매개 세포 내 이입 억제제 (클로르프로마진)에서 NL-Ab의 세포 흡수를 극적으로 감소시키는 것을 확인할 수 있고, 반대로, caveolae-dependent endocytosis inhibitor (genistein), macro-pinocytosis inhibitor (nocodazole) 및 phagocytosis inhibitor (cytochalasin B)는 NL-Ab의 흡수에 영향을 미치지 않는다(4 ℃에서는 세포활성이 억제되기 때문에 NL-Ab의 흡수가 없다). 따라서, NL-Ab의 세포 흡수가 클라트린-매개 세포 내 이입에 의존하는 것을 알 수 있다. 외부 물질이 세포 안으로 들어가는 흡입 경로는 크게 5가지로 나눌 수가 있는데, 세포의 표면에서 막의 일부가 밖으로 돌출되면서 입자를 둘러싸서 삼키는 식세포작용(phagocytosis), 막루플링(membrane ruffling)으로 인해 액틴필라멘트(actin filament)가 활발하게 중합하면서 입자를 흡입하는 대음세포작용(macropinocytosis), 세포질 쪽의 클라스린(chlatrin)이라는 단백질을 이용하는 클라스린 의존성 세포내흡입(chlatrin mediated endocytosis), 콜레스테롤과 카베올린(caveolin)이라는 막단백질의 농도가 높은 곳을 이용하는 카베올린 의존성 세포내흡입(caveolin-dependent endocytosis), 클라스린과 카베올린 등과 같은 단백질을 사용하지 않는 흡입방법 (clatrin and caveolin independent endocytosis)이 있다. 이러한 각각의 흡입 경로를 막는 약물들이 있는데, genistein은 카베올린 의존성 세포내 흡입을 방해하고, chloropromazine은 클라스린 의존성 세포내흡입을 방해, nocodazole은 대음세포작용을 억제, cytochalasin B 는 식세포작용을 억제한다. 한편, 4 ℃ 에서는 세포가 에너지를 사용하지 못하므로 에너지 의존적으로 세포내흡입작용을 억제할 수가 있다(Dos Santos T et al., 2011). When cell uptake experiments were performed in the presence of an endocytic inhibitor (Fig. 6c). It can be seen that clathrin-mediated endocytosis inhibitor (chlorpromazine) dramatically reduces cellular uptake of NL-Ab, and on the contrary, caveolae-dependent endocytosis inhibitor (genistein), macro-pinocytosis inhibitor (nocodazole) and phagocytosis inhibitor (cytochalasin B) does not affect the uptake of NL-Ab (at 4°C, there is no uptake of NL-Ab because cell activity is inhibited). Therefore, it can be seen that the cellular uptake of NL-Ab is dependent on clathrin-mediated endocytosis. The inhalation route for foreign substances into the cell can be divided into five major categories. Part of the membrane protrudes from the surface of the cell and surrounds and swallows particles, phagocytosis, and membrane ruffling, actin filaments (actin) Filament) actively polymerizes to inhale particles, macropinocytosis, chlatrin-mediated endocytosis using a protein called chlatrin in the cytoplasm, and cholesterol and caveolin. There are caveolin-dependent endocytosis, which uses a place with a high concentration of membrane protein, and clatrin and caveolin independent endocytosis, which does not use proteins such as clathrin and caveolin. There are drugs that block each of these inhalation pathways. Genistein inhibits caveolin-dependent endocytosis, chloropromazine inhibits clathrin-dependent endocytosis, nocodazole inhibits apoptosis, and cytochalasin B inhibits phagocytosis. . On the other hand, at 4°C, the cells cannot use energy, so it is possible to inhibit the endocytosis in an energy-dependent manner (Dos Santos T et al., 2011).
다음으로 웨스턴 블로팅을 통해 봉입 전의 Cas9 및 ABE 단백질 시료와 NL-Ab을 동일 중량으로 로딩하여 NL-Ab에 봉입된 Cas9 및 ABE 단백질의 양을 정량화한 바, 약 89.3 %가 봉입된 것을 확인할 수 있다(도 6d). Next, the amount of Cas9 and ABE protein encapsulated in NL-Ab was quantified by loading the Cas9 and ABE protein sample and NL-Ab before encapsulation at the same weight through Western blotting, and it was confirmed that about 89.3% was encapsulated. There is (Fig. 6d).
이 외에도, 세포 흡수 효율(또는 세포내 수송 효율)을 비교하기 위해 항체 결합 유무에 따라 NL, NL-Ab 및 리포펙타민을 PANC1 세포에 시간 별(0, 0.5, 1, 3, 6 시간)로 처리한 후 형광 염색하여 FACS(fluorescence-activated single cell sorting) 분석을 통해 Cas9/ABE 단백질 수를 정량적으로 확인하였고, 이를 도 7에 나타냈다. In addition, to compare cellular uptake efficiency (or intracellular transport efficiency), NL, NL-Ab and lipofectamine were administered to PANC1 cells with and without antibody binding over time (0, 0.5, 1, 3, 6 h). After treatment, the number of Cas9/ABE proteins was quantitatively confirmed through fluorescence-activated single cell sorting (FACS) analysis by fluorescence staining, which is shown in FIG. 7 .
그 결과 리포펙타민 처리를 한 세포는 단백질이 세포투과를 거의 하지 않은 것으로 확인되며, NL만 처리된 세포에 비해 NL-Ab가 처리된 세포가 Cas9/ABE이 세포 내에서 다량 검출되었다. As a result, it was confirmed that the lipofectamine-treated cells hardly permeated the protein, and a large amount of Cas9/ABE was detected in the NL-Ab-treated cells compared to the NL-only treated cells.
따라서 지금까지의 결과를 통해 본 발명에서 제조한 NL-Ab가 췌장암 세포에 대한 투과성이 매우 우수함을 입증할 수 있다. Therefore, through the results so far, it can be demonstrated that the NL-Ab prepared in the present invention has very good permeability to pancreatic cancer cells.
실험예 4. 체외 유전자 편집 능력 확인 iExperimental Example 4. Confirmation of in vitro gene editing ability i
PANC1 세포를 NL-Ab로 처리한 후 NGS(Next Generation Sequencing) 분석으로 유전자 상태를 확인하였다. 이를 위해, PANC1 세포 또는 이종 이식 종양을 NL(Cas9/ABE)-Ab로 처리한 후, 제조업체의 지침에 따라 Nucleospin Tissue(Macherey-Nagel)를 사용하여 게놈 DNA (gDNA)를 분리했다. Covaris 시스템을 사용하여 총 1 ㎍ gDNA를 단편화하였고, 이러한 라이브러리는 Macrogen에서 HiSeq X Ten Sequencer (Illumina)를 사용하여 전체 게놈 시퀀싱을 수행했으며 Cas-OFFinder (www.rgenome.net)를 사용하여 최대 3 bp의 불일치를 가진 잠재적인 오프 타겟 사이트를 식별했다.After the PANC1 cells were treated with NL-Ab, the gene status was confirmed by NGS (Next Generation Sequencing) analysis. To this end, PANC1 cells or xenograft tumors were treated with NL(Cas9/ABE)-Ab, and then genomic DNA (gDNA) was isolated using Nucleospin Tissue (Macherey-Nagel) according to the manufacturer's instructions. A total of 1 μg gDNA was fragmented using the Covaris system, and these libraries were subjected to whole genome sequencing using the HiSeq X Ten Sequencer (Illumina) at Macrogen and up to 3 bp using Cas-OFFinder (www.rgenome.net). Potential off-target sites with mismatches were identified.
이에 대한 분석 결과는 표 3 및 표 4에 나타내었다. The analysis results for this are shown in Tables 3 and 4.
In vitro KRAS target sequence In vitro KRAS target sequence PAMPAM IndelsIndels
ControlControl CTGAATTAGCTGTATCG -TCACTGAATTAGCTGTATCG -TCA AGGAGG WTWT --
NL-Ab treatedNL-Ab treated CTGAATTAGCTGTAT_ _ -TCACTGAATTAGCTGTAT _ _ -TCA AGGAGG -2-2 24.4 %24.4%
CTGAATTAGCTGTATCGA-TCACTGAATTAGCTGTATCG A -TCA AGGAGG +1+1 13.4 %13.4%
CTGAATTAGCTGTATCGT-TCACTGAATTAGCTGTATCG T -TCA AGGAGG +1+1 13.4 %13.4%
Total Indel efficacyTotal Indel efficacy 51.2 %51.2%
In vitro P53 target sequence In vitro P53 target sequence PAMPAM Base edited efficacyBase edited efficacy
ControlControl GTGCATGTTTGTGCCTGTCCGTGC A TGTTTGTGCCTGTCC TGGTGG --
NL-Ab treatedNL-Ab treated GTGCGTGTTTGTGCCTGTCCGTGC G TGTTTGTGCCTGTCC TGGTGG 53.6 %53.6%
분석 결과, NL-Ab 처리 후 48 시간에, KRAS 유전자 편집 효율은 51.2 %로 높게 나타났고, P53 유전자에서도 53.6 %의 A-to-G에 대한 염기 전환이 확인된다.As a result of the analysis, 48 hours after NL-Ab treatment, the KRAS gene editing efficiency was as high as 51.2%, and 53.6% of A-to-G base conversion was confirmed in the P53 gene.
또한, Cas9 및 ABE-RNP 편집의 효과를 확인하기 위해 인간 게놈에서 최대 3bp의 불일치를 포함하는 오프 타겟 효과 분석을 수행한 결과, 전체 게놈 시퀀싱은 KRAS indel(insertion-deletion) editing에서 오프 타겟 효과를 나타내지 않는다 (표 5 및 표 6). 이는 본 발명에서 사용되는 단일 가이드 sgRNA의 염기서열이 매우 효과적으로 KRAS 또는 P53 유전자 부위를 선택적으로 인지하여, 원하는 않는 부위의 유전자는 전혀 편집하지 않았음을 의미한다. In addition, to confirm the effect of Cas9 and ABE-RNP editing, an off-target effect analysis including a mismatch of up to 3 bp in the human genome was performed. not shown (Table 5 and Table 6). This means that the nucleotide sequence of the single guide sgRNA used in the present invention selectively recognizes the KRAS or P53 gene region very effectively, and the gene in the unwanted region is not edited at all.
Off-target sites - KRASOff-target sites - KRAS
In vitro samplein vitro sample ChrChr PositionPosition SequenceSequence StrandStrand Mis-
MatchesMiss-
Matches 		Total CountTotal Count Indel CountIndel Count Indel EfficacyIndel Efficacy
NL-Ab treatedNL-Ab treated 1One Chr1Chr1 74,955,08674,955,086 CaGAATTAGCTGTATCtaCACaGAATTAGCTGTATCtaCA ++ 33 4343 00 00
22 Chr3Chr3 45,705,92745,705,927 CTGAcTTAGCTaTATCtTCACTGAcTTAGCTaTATCtTCA ++ 33 2020 00 00
33 Chr4Chr4 113,644,828113,644,828 tTtAATTAGCTGTcTCGTCAtTtAATTAGCTGTcTCGTCA ++ 33 2121 00 00
44 Chr5Chr5 82,986,24282,986,242 CaGAATTAGCTGTtTgGTCACaGAATTAGCTGTtTgGTCA ++ 33 4040 00 00
55 Chr16Chr16 68,389,10368,389,103 CTGAcTTAGCTcTATcTCACTGAcTTAGCTcTATcTCA ++ 33 2929 00 00
Off-target sites - P53Off-target sites - P53
In vitro samplein vitro sample ChrChr PositionPosition SequenceSequence StrandStrand Mis-
MatchesMiss-
Matches 		Total CountTotal Count Indel CountIndel Count Indel EfficacyIndel Efficacy
NL-Ab treatedNL-Ab treated 1One Chr1Chr1 3,045,6353,045,635 GTGCATGTgTGTGCgTtTCCGTGCATGTgTGTGCgTtTCC ++ 33 6363 00 00
22 Chr6Chr6 44,246,69844,246,698 cTGCATGTgTGTGCCTGTCtcTGCATGTgTGTGCCTGTCt ++ 33 3232 00 00
33 Chr9Chr9 116,287,425116,287,425 GTGCATGTgTcTGCCTGcCCGTGCATGTgTcTGCCTGcCC ++ 33 2929 00 00
44 Chr10Chr10 64,380,31164,380,311 GTGCATGTTTGTGtgTGTCCGTGCATGTTTTGTGtgTGTCC ++ 22 7474 00 00
55 Chr19Chr19 44,273,49744,273,497 GTGCATGTccaTGCCTGTCCGTGCATGTccaTGCCTGTCC ++ 33 2727 00 00
NL 기반 입자에 의한 돌연변이 P53 및 KRAS 유전자 편집 후, 처리된 PANC1 세포에서 단백질 및 mRNA의 발현은 CLSM 분석 및 qRT-PCR에 의해 결정되었다 (도 8a, 8b). 양성 NL(Cas9/ABE)-Ab 처리된 PANC1 세포는 NL(Cas9)-Ab 및 NL(ABE)-Ab 처리된 세포와 비교하여 돌연변이 KRAS 및 돌연변이 P53의 유의미한 하향 조절을 나타냈다. After mutant P53 and KRAS gene editing by NL-based particles, the expression of protein and mRNA in treated PANC1 cells was determined by CLSM analysis and qRT-PCR ( FIGS. 8a , 8b ). Positive NL(Cas9/ABE)-Ab treated PANC1 cells showed significant downregulation of mutant KRAS and mutant P53 compared to NL(Cas9)-Ab and NL(ABE)-Ab treated cells.
KRAS 다운 스트림 및 P53 복원 경로를 확인하기 위해, PANC1 세포에 bare NL-Ab, NL(Cas9)-Ab 및 NL(ABE)-Ab를 처리하여 다양한 신호전달 단백질의 발현 정도를 확인하였다 (도 8c). 스크램블된 sgRNA (sgScramble)를 포함하여 유전자 편집 기능이 없는 bare NL는 RAS, p-ERK 및 돌연변이 P53의 발현에 변화가 없음을 보여주었다. 또한, NL(Cas9)-Ab 및 NL(Cas9/ABE)-Ab가 처리된 세포는 KRAS 및 p-ERK의 단백질 발현이 억제되었고, NL(ABE)-Ab 및 NL(Cas9/ABE)-Ab 처리된 세포는 돌연변이 P53이 감소하고 야생형 P53 발현 수준이 증가하며 그 반대도 마찬가지다. 이러한 결과는 Cas9와 ABE가 동시에 한 입자에 함께 포함되어 있어도 유전자 편집에 대한 활성이 변경되지 않았음을 나타낸다.In order to confirm the KRAS downstream and P53 restoration pathway, PANC1 cells were treated with bare NL-Ab, NL(Cas9)-Ab, and NL(ABE)-Ab to confirm the expression level of various signaling proteins (FIG. 8c) . Bare NL without gene editing function including scrambled sgRNA (sgScramble) showed no change in the expression of RAS, p-ERK and mutant P53 . In addition, NL(Cas9)-Ab and NL(Cas9/ABE)-Ab-treated cells suppressed protein expression of KRAS and p-ERK, and NL(ABE)-Ab and NL(Cas9/ABE)-Ab treatment The aged cells have decreased mutant P53 and increased levels of wild-type P53 expression and vice versa. These results indicate that the activity for gene editing was not altered even when Cas9 and ABE were simultaneously included in one particle.
실험예 5. 체외 유전자 편집 능력 확인 iiExperimental Example 5. Confirmation of in vitro gene editing ability ii
세포 생존력 분석은 WST-8 분석을 이용하였다. 이를 위해, PANC1, MIAPaCa-2, BxPC-3 및 Capan-2 세포를 NL-Ab로 처리한 후 24 시간 동안 96-웰 플레이트 (1 x 103 세포/웰)에 접종했다. 세포에 젬시타빈 (0 ~ 100 μM)에 처리하고 24 시간 배양 후 WST-8 시약 (Dojindo)을 37 ℃에서 1 시간 동안 배지에 첨가하였다. 이 후 24 시간마다 마이크로 플레이트 리더 (BioTek)를 사용하여 450 nm에서 흡광도를 측정하였다. Cell viability assay was performed using WST-8 assay. For this, PANC1, MIAPaCa-2, BxPC-3 and Capan-2 cells were treated with NL-Ab and then seeded in 96-well plates (1×10 3 cells/well) for 24 hours. Cells were treated with gemcitabine (0 ~ 100 μM), and after 24 hours of incubation, WST-8 reagent (Dojindo) was added to the medium at 37 °C for 1 hour. After that, the absorbance was measured at 450 nm using a microplate reader (BioTek) every 24 hours.
그 결과, PANC1 세포주가 젬시타빈 약물 내성 PDAC 세포주임을 확인할 수 있다(도 9). 그러나, NL(Cas9/ABE)-Ab를 이용하여 2종의 유전자 편집 후 젬시타빈 처리시 세포 생존율이 ~ 90 % 감소하는 것이 관찰된다(도 10a). 따라서, 췌장암에서 젬시타빈 약물 내성을 극복하고 치료 효과를 높이려면 KRAS와 P53 유전자를 동시에 편집해야 한다는 것을 확인할 수 있다. As a result, it can be confirmed that the PANC1 cell line is a gemcitabine drug-resistant PDAC cell line ( FIG. 9 ). However, it is observed that the cell viability is decreased by ~90% upon treatment with gemcitabine after two kinds of gene editing using NL(Cas9/ABE)-Ab (Fig. 10a). Therefore, it can be confirmed that the KRAS and P53 genes must be edited simultaneously to overcome gemcitabine drug resistance and increase the therapeutic effect in pancreatic cancer.
NL(Cas9/ABE)-Ab 및 젬시타빈 공동 처리 효과는 세포주기 분포를 조사하여 평가할 수 있는데, 세포주기는 Flow cytometry를 이용하여 확인했다. The effect of co-treatment with NL(Cas9/ABE)-Ab and gemcitabine can be evaluated by examining the cell cycle distribution, which was confirmed using flow cytometry.
측정결과, 세포주기가 NL(Cas9/ABE)-Ab 매개 KRAS 및 P53 편집 과정 동안 G0/G1 단계에서 축적되는 것으로 확인된다(도 10b). 또한, 웨스턴 블롯팅을 통한 세포주기 관련 유전자의 다양한 단백질 발현 패턴도 확인할 수 있다(도 10c). As a result of the measurement, it is confirmed that the cell cycle is accumulated in the G0/G1 phase during NL(Cas9/ABE)-Ab-mediated KRAS and P53 editing ( FIG. 10b ). In addition, various protein expression patterns of cell cycle-related genes can be confirmed through Western blotting (FIG. 10c).
이 외, NL(Cas9/ABE)-Ab에 의한 유전자 편집은 Cyclin D1 및 CDK4와 같은 G0/G1 세포주기 체크 포인트를 담당하는 유전자의 하향 조절을 초래했고, 나노 리포좀 처리된 세포는 P27KIP 및 P21CIP의 단백질 발현 증가를 보였으며, 이는 phospho-Rb 발현 수준과 역상관 관계가 있었다. NL(Cas9/ABE)-Ab 및 젬시타빈이 함께 처리된 세포에서 S 기 체크 포인트 단백질은 Cyclin A 및 CDK2의 발현 수준이 감소한 것으로 나타났다 (도 10d). 이러한 결과는 세포 생존력 결과와 유사하게 NL(Cas9/ABE)-Ab 및 젬시타빈이 공동 처리된 세포는 젬시타빈 또는 NL(Cas9/ABE)-Ab를 사용한 단일 처리보다 더 높은 세포 사멸을 이끌었다(도 10e). In addition, gene editing by NL(Cas9/ABE)-Ab resulted in downregulation of genes responsible for G0/G1 cell cycle checkpoints, such as Cyclin D1 and CDK4, and nanoliposome-treated cells showed that P27KIP and P21CIP Protein expression was increased, which was inversely correlated with the level of phospho-Rb expression. In cells co-treated with NL(Cas9/ABE)-Ab and gemcitabine, the S-phase checkpoint protein showed decreased expression levels of Cyclin A and CDK2 ( FIG. 10d ). Similar to the cell viability results, cells co-treated with NL(Cas9/ABE)-Ab and gemcitabine led to higher apoptosis than single treatment with gemcitabine or NL(Cas9/ABE)-Ab (Fig. 10e).
또한 세포 사멸 경로에 관련된 다양한 유전자에 대한 영향을 확인한 바(도 10f 및 도 10g), BAX, PUMA, PARP, Caspase-3, BAD의 apoptotic marker는 증가하였고, anti-apoptotic marker (BCL2)는 NL(Cas9/ABE)-Ab와 젬시타빈 동시 처리 후 감소하였다. 결과적으로 유전자 편집과 치료 약물의 병용 치료는 약물 내성 암의 시너지적 세포 사멸을 유도할 수 있다.In addition, the effect on various genes related to the apoptosis pathway was confirmed (FIGS. 10f and 10g), the apoptotic markers of BAX, PUMA, PARP, Caspase-3, and BAD were increased, and the anti-apoptotic marker (BCL2) was NL ( It decreased after simultaneous treatment with Cas9/ABE)-Ab and gemcitabine. Consequently, the combination of gene editing and therapeutic drugs can induce synergistic cell death in drug-resistant cancers.
젬시타빈 내성 세포는 KRAS 및 P53의 유전자 변이를 통해 HIF-1α의 과발현 및 안정화를 통해 포도당 흡수를 증가시킨다. 포도당 수준의 향상은 포도당 대사, 비산 화성 오탄당 인산 경로 (PPP) 및 de novo pyrimidine 합성을 유도한다. 이 경로에 따르면 dCTP가 과도 합성되어 결국 젬시타빈 대사 산물의 dFdCTP와 분자 경쟁 반응을 일으키고 젬시타빈 약물 내성을 유발한다. 젬시타빈에 대한 내성 조절에서 KRAS 및 P53 유전자의 역할을 명확히 하기 위해 다양한 분자 경쟁 관련 유전자의 단백질 발현을 분석했다(도 10h). 결과는 KRAS 및 P53 유전자 편집이 HIF-1α의 분해, 포도당 흡수 수용체 (GLUT1)의 감소 및 dCTP 합성 관련 효소 (TKT 및 CTPS)의 억제와 관련이 있음을 보여주었다. Gemcitabine-resistant cells increase glucose uptake through overexpression and stabilization of HIF-1α through genetic mutations in KRAS and P53 . Enhancement of glucose levels induces glucose metabolism, non-oxidative pentose phosphate pathway (PPP) and de novo pyrimidine synthesis. According to this pathway, dCTP is oversynthesized, eventually causing a molecular competitive reaction with dFdCTP of the gemcitabine metabolite and leading to gemcitabine drug resistance. To clarify the role of KRAS and P53 genes in the regulation of resistance to gemcitabine, protein expression of various molecular competition-related genes was analyzed ( FIG. 10h ). The results showed that KRAS and P53 gene editing was associated with degradation of HIF-1α, reduction of glucose uptake receptor (GLUT1) and inhibition of dCTP synthesis-associated enzymes (TKT and CTPS).
한편, KRAS 또는 P53의 유전자 편집 후 젬시타빈 결합 수용체 단백질 수송체 (ENT1) 가 증가하는 것을 알 수 있는데(도 10h), 과다 발현된 ENT1이 젬시타빈 흡수를 증가시키고 세포로의 높은 농도의 젬시타빈 산물 (dFdCTP)을 초래하게 되고, 젬시타빈 민감도와 ENT1 발현 수준의 상관 관계를 이해하기 위해 다양한 췌장암 세포의 생존력을 평가한 결과, KRAS 및 P53 유전자 돌연변이가 있는 PANC1 세포는 일반적인 젬시타빈 약물 내성과 정상 세포주 (H6c7)와 유사한 ENT1의 낮은 발현을 나타냈다. 대조적으로, 약물 내성이 없는 BxPC-3 및 Capan-2 세포주는 다량의 ENT1 수용체 단백질 발현을 보였고 젬시타빈 약물의 저항성을 나타내지 않았다(도 11). On the other hand, it can be seen that the gemcitabine-coupled receptor protein transporter (ENT1) increases after gene editing of KRAS or P53 (FIG. 10h). Overexpressed ENT1 increases gemcitabine uptake and high concentration of gemcitabine into cells. In order to understand the correlation between gemcitabine sensitivity and ENT1 expression level, we evaluated the viability of various pancreatic cancer cells . It showed low expression of ENT1 similar to the cell line (H6c7). In contrast, BxPC-3 and Capan-2 cell lines without drug resistance showed a large amount of ENT1 receptor protein expression and did not show resistance to the gemcitabine drug ( FIG. 11 ).
실험예 6. PDAC에 대한 생체 내 치료 적용 Experimental Example 6. In vivo treatment application for PDAC
젬시타빈 내성 PANC1 세포 이식 이종 이식 마우스 모델은 도 12a의 스케쥴을 따라 제조하였다. 이후 종양이 150 ~ 200 ㎣에 도달하면 NL-Ab 입자 용액을 복강 내로 주사하였고, 4 주 동안 주 2회 젬시타빈 (50 mg/kg)을 투여하였다. A gemcitabine-resistant PANC1 cell transplantation xenograft mouse model was prepared according to the schedule of FIG. 12A. Then, when the tumor reached 150 ~ 200 mm 3 , the NL-Ab particle solution was intraperitoneally injected, and gemcitabine (50 mg/kg) was administered twice a week for 4 weeks.
마우스는 다음과 같은 군으로 구분되었고 도 12b에 나타내었다. Mice were divided into the following groups and shown in FIG. 12B.
실험군experimental group 마우스 처치 상태mouse kill status
Group 1Group 1 non-treatment non-treatment
Group 2Group 2 only GEMonly GEM
Group 3Group 3 Cas9/ABE RNP + GemCas9/ABE RNP + Gem
Group 4Group 4 NL(Cas9/ABE) without Ab + GEMNL(Cas9/ABE) without Ab + GEM
Group 5Group 5 bare NL-Ab + GEMbare NL-Ab + GEM
Group 6Group 6 NL(only Cas9)-Ab + GemNL (only Cas9)-Ab + Gem
Group 7Group 7 NL(only ABE)-Ab + GemNL(only ABE)-Ab + Gem
Group 8Group 8 NL(Cas9/ABE)-Ab + GemNL(Cas9/ABE)-Ab + Gem
Group 9Group 9 only NL(Cas9/ABE)-Abonly NL(Cas9/ABE)-Ab
모든 동물 복지 및 실험 절차는 서울 성모 병원 규정 (IACUC 승인 번호 : 2020-0078-01)에 따라 수행되었다. 이종 이식 마우스 모델의 경우, PANC1 세포 (50 % Matrigel 용액 중 1 x 107 세포)를 5 주령 암컷 BALB/c 누드 마우스의 왼쪽 허벅지에 피하 이식했다. 실험은 종양의 크기가 150 ~ 200 mm3에 도달했을 때 진행되었다. 생체 내 NL-Ab 표적화 효능 평가를 위해 마우스에 RITC가 캡슐화된 NL-Ab (525 mg/kg)를 복강 주사하고 이소플루란으로 마취한 다음 IVIS (Xenogen Spectrum)를 사용하여 이미지를 캡처했다. 또한, 생체 내 치료 효능을 평가하기 위해 마우스에 Cas9/ABE 등이 포함되지 않은 bare NL-Ab, Ab가 없는 NL(Cas9/ABE),NL(Cas9 단독)-Ab, NL(ABE 단독)-Ab, NL(Cas9/ABE)-Ab를 그룹별로 복강 내로 주사했으며(0.25 mL PBS), NL(Cas9/ABE)-Ab 기준 (2.0 μM Cas9, ABE 및 3.75 μM sgRNA 포함), 젬시타빈(GEM)의 치료 효과를 확인하기 위해 젬시타빈 (50 mg/kg)을 4 주 동안 주 2 회 투여했다 (그룹 당 마우스 5 마리). 종양 성장은 2 ~ 3 일마다 캘리퍼스로 확인하였다. 종양 부피는 다음 공식을 사용하여 측정하였다 : 부피 (mm3) = (L × W2)/2. (L : 길이, W : 폭)All animal welfare and experimental procedures were performed in accordance with Seoul St. Mary's Hospital Regulations (IACUC Approval No.: 2020-0078-01). For the xenograft mouse model, PANC1 cells (1 x 10 7 cells in 50% Matrigel solution) were implanted subcutaneously into the left thigh of 5-week-old female BALB/c nude mice. The experiment was carried out when the size of the tumor reached 150 ~ 200 mm 3 . To evaluate the efficacy of NL-Ab targeting in vivo, mice were intraperitoneally injected with RITC-encapsulated NL-Ab (525 mg/kg), anesthetized with isoflurane, and images were captured using Xenogen Spectrum (IVIS). In addition, in order to evaluate the treatment efficacy in vivo, bare NL-Ab without Cas9/ABE, NL without Ab(Cas9/ABE), NL(Cas9 alone)-Ab, NL(ABE alone)-Ab , NL(Cas9/ABE)-Ab was injected intraperitoneally by group (0.25 mL PBS), based on NL(Cas9/ABE)-Ab (containing 2.0 µM Cas9, ABE, and 3.75 µM sgRNA), and gemcitabine (GEM). To confirm the therapeutic effect, gemcitabine (50 mg/kg) was administered twice a week for 4 weeks (5 mice per group). Tumor growth was checked with calipers every 2-3 days. Tumor volume was determined using the following formula: Volume (mm 3 ) = (L × W 2 )/2. (L: Length, W: Width)
그 결과, NL(Cas9/ABE)-Ab 및 젬시타빈이 같이 처리된 마우스에서 종양 성장 억제 효과가 가장 우수하였다(대조군 Group 1 대비 84 % 감소). 젬시타빈 (Group 2) 또는 NL (Group 9) 처리된 마우스는 28 일 치료 후 경미한 억제 현상만 나타났고, NL(Cas9)-Ab 또는 NL(ABE)-Ab와 함께 젬시타빈이 동시 처리된 마우스 (Group 6 및 Group7)는 종양 부피가 상대적으로 감소되었으나 종양 성장을 완전히 억제하지는 못했다. 젬시타빈 단독, RNP 단독, 항체가 결합되지 않은 NL 또는 내용물이 봉입되지 않은 NL-Ab 처리 마우스 (Group 2 ~ Group5)에서는 거의 치료 효과를 나타내지 않았다.As a result, the tumor growth inhibitory effect was the best in mice treated with NL(Cas9/ABE)-Ab and gemcitabine (84% reduction compared to control group 1). Gemcitabine (Group 2) or NL (Group 9) treated mice showed only mild inhibition after 28 days of treatment, and mice co-treated with NL(Cas9)-Ab or NL(ABE)-Ab with gemcitabine ( Group 6 and Group 7) showed a relatively reduced tumor volume, but did not completely inhibit tumor growth. Gemcitabine alone, RNP alone, NL without antibody binding, or NL-Ab treated mice (Group 2 to Group 5) with no encapsulated contents showed almost no therapeutic effect.
다음으로는 이 마우스에서 항체가 결합된 NL 입자의 생체 내 특이적 표적화 능력을 확인하였다. Next, the in vivo specific targeting ability of the NL particles bound to the antibody in this mouse was confirmed.
이를 위해, 조직학적 검사를 위해 기관과 종양을 10 % 포르말린에 고정하고 파라핀에 포매하였다. 조직 절편을 3 μm 두께의 절편으로 자르고 자일렌에서 탈파라핀화 한 후 에탄올을 사용하여 재-수화하였고, 다음으로, 헤마톡실린&에오신(H&E)으로 염색하였다. For this purpose, organs and tumors were fixed in 10% formalin and embedded in paraffin for histological examination. Tissue sections were cut into 3 μm-thick sections, deparaffinized in xylene, rehydrated using ethanol, and then stained with hematoxylin & eosin (H&E).
염색한 섹션은 항원 추척을 위해 unmarking 하고(0.01 M 시트르산 나트륨 완충액, pH 6.0), 3 % 과산화수소에 반응시킨 후, 1 차 항체 반응 전에 Tris 완충 식염수 (TBS)에서 3 % 소 혈청 알부민 (BSA)으로 blocking 하였다. 1 차 항체는 다음의 것을 사용하였다 : anti-RAS, anti-mutant-P53, anti-P21 (Abcam), anti-p-ERK (Cell Signaling), anti-TKT, anti-GLUT1 (Santa Cruz), anti- HIF-1a, anti-ENT1, anti-CTPS (Proteintech) 및 anti-Ki67 (Thermo). 다음으로, 면역 조직 화학적 분석을 위해 조직 절편을 anti-mouse/rabbit horseradish peroxidase (HRP) (Santacruz)와 함께 반응시킨 후 3,3'-diaminobenzidine(DAB)과 반응시키고 hematoxylin으로 대조 염색하고, 슬라이드 스캐너 (3DHISTECH)를 사용하여 슬라이드를 관찰하였다. 또한, 슬라이스 된 종양 조직을 1 차 항체와 함께 4 ℃에서 16 시간 동안 배양 한 다음 면역 형광을 위해 Alexa Fluor 488 또는 Alexa Fluor 594가 접합된 2 차 항체와 함께 반응시켰다. 슬라이드에 4 ', 6-diamidino-2-phenylindole (DAPI, Immunobioscience)을 장착하고 LSM800 공 초점 현미경 (Carl Zeiss)을 사용하여 시료를 확인하였다. Stained sections were unmarked for antigen tracing (0.01 M sodium citrate buffer, pH 6.0), reacted with 3% hydrogen peroxide, and then washed with 3% bovine serum albumin (BSA) in Tris buffered saline (TBS) before primary antibody reaction. blocking was done. The following primary antibodies were used: anti-RAS, anti-mutant-P53, anti-P21 (Abcam), anti-p-ERK (Cell Signaling), anti-TKT, anti-GLUT1 (Santa Cruz), anti -HIF-1a, anti-ENT1, anti-CTPS (Proteintech) and anti-Ki67 (Thermo). Next, for immunohistochemical analysis, the tissue sections were reacted with anti-mouse/rabbit horseradish peroxidase (HRP) (Santacruz), reacted with 3,3'-diaminobenzidine (DAB), counterstained with hematoxylin, and slide scanner. (3DHISTECH) was used to observe the slides. In addition, the sliced tumor tissue was incubated with a primary antibody at 4 °C for 16 h and then reacted with a secondary antibody conjugated with Alexa Fluor 488 or Alexa Fluor 594 for immunofluorescence. 4', 6-diamidino-2-phenylindole (DAPI, Immunobioscience) was mounted on the slide, and the sample was checked using an LSM800 confocal microscope (Carl Zeiss).
이에 도 13a에서와 같이 항체가 결합되지 않은 NL은 2 시간 이내에 종양 근처에서 발견되지만 곧바로 사라지며, NL-Ab가 주입된 마우스의 경우, 입자가 종양 부위에 확연하게 축적되는 것으로 보인다. 이 때, 활성 표적화 효율을 확인하기 위해 도 13b와 같이 NL-Ab가 투입된 마우스 내의 종양 조직을 Cas9 및 ABE 단백질을 면역 염색 후 이를 다시 한번 확인하였다. 한편 NL-Ab가 주입된 마우스에서 종양 조직 내에서 강한 발광 현상이 72 시간 동안 유지되었고 7 일 후에 모두 사라졌다. Accordingly, as shown in FIG. 13a, NL to which the antibody is not bound is found near the tumor within 2 hours, but disappears immediately. At this time, to confirm the activation targeting efficiency, as shown in FIG. 13b , the tumor tissue in the mouse injected with NL-Ab was confirmed once again after immunostaining with Cas9 and ABE proteins. On the other hand, in mice injected with NL-Ab, strong luminescence was maintained in the tumor tissue for 72 hours and disappeared after 7 days.
이러한 현상은 항체 결합 입자에 의한 능동적 표적 전달의 특징으로 전달 및 치료 효과를 극대화할 수 있음을 입증한다. This phenomenon demonstrates that the characteristics of active target delivery by antibody-binding particles can maximize delivery and therapeutic effects.
한편, 7 일째 NL(Cas9/ABE)-Ab 처리된 마우스를 안락사하여 종양의 KRAS 및 P53 유전자의 NGS를 분석하였다. 생체 내 유전자 편집 효율은 KRAS 유전자의 프레임 시프트 인델 (62.5 %)에서 측정되었으며 P53 유전자의 A-to-G에 대해 64.7 % 기본 편집을 보존했다 (표 8 및 표 9). Meanwhile, on day 7, NL(Cas9/ABE)-Ab-treated mice were euthanized and NGS of KRAS and P53 genes in the tumor was analyzed. In vivo gene editing efficiencies were measured in frameshift indels (62.5%) of the KRAS gene and preserved 64.7% basal editing for A-to-G of the P53 gene (Tables 8 and 9).
In vivo KRAS target sequence In vivo KRAS target sequence PAMPAM IndelsIndels
ControlControl CTGAATTAGCTGTATCG -TCACTGAATTAGCTGTATCG -TCA AGGAGG WTWT --
NL-Ab treatedNL-Ab treated CTGAATTAGCTGTATC_ -TCA CTGAATTAGCTGTATC_ -TCA AGGAGG -1-One 25.0 %25.0%
CTGAATTAGCTGTAT__ -TCACTGAATTAGCTGTAT __ -TCA AGGAGG -2-2 12.5 %12.5%
CTGAATTAGCTGTATCGA-TCACTGAATTAGCTGTATCG A -TCA AGGAGG +1+1 12.5 %12.5%
CTGAATTAGCTGTATCGT-TCACTGAATTAGCTGTATCG T -TCA AGGAGG +1+1 12.5 %12.5%
Total Indel efficacyTotal Indel efficacy 62.5 %62.5%
In vivo P53 target sequence In vivo P53 target sequence PAMPAM Base edited efficacyBase edited efficacy
ControlControl GTGCATGTTTGTGCCTGTCCGTGC A TGTTTGTGCCTGTCC TGGTGG --
NL-Ab treatedNL-Ab treated GTGCGTGTTTGTGCCTGTCCGTGC G TGTTTGTGCCTGTCC TGGTGG 64.7 %64.7%
다음으로 원하지 않는 유전자를 편집하는 효율 (off-target) 분석을 수행한 결과, 3bp 불일치를 포함하는 다른 오프 타겟 사이트에서 indel 편집 효과가 나타나지 않은 것을 확인하여 원하는 KRAS 또는 P53 부위 (on-target)에만 편집이 되었음을 의미한다.(표 10 및 표 11). Next, as a result of performing an efficiency (off-target) analysis of undesired gene editing, it was confirmed that the indel editing effect did not appear at other off-target sites containing a 3bp mismatch, so that only the desired KRAS or P53 site (on-target) It means that it has been edited (Table 10 and Table 11).
In vitro samplein vitro sample ChrChr PositionPosition SequenceSequence StrandStrand Mis-MatchesMiss Matches Total CountTotal Count Indel CountIndel Count Indel EfficacyIndel Efficacy
NL-Ab treatedNL-Ab treated 1One Chr1Chr1 74,955,08674,955,086 CaGAATTAGCTGTATCtaCACaGAATTAGCTGTATCtaCA ++ 33 1414 00 00
22 Chr3Chr3 45,705,92745,705,927 CTGAcTTAGCTaTATCtTCACTGAcTTAGCTaTATCtTCA ++ 33 1919 00 00
33 Chr4Chr4 113,644,828113,644,828 tTtAATTAGCTGTcTCGTCAtTtAATTAGCTGTcTCGTCA ++ 33 1111 00 00
44 Chr5Chr5 82,986,24282,986,242 CaGAATTAGCTGTtTgGTCACaGAATTAGCTGTtTgGTCA ++ 33 1313 00 00
55 Chr16Chr16 68,389,10368,389,103 CTGAcTTAGCTcTATcTCACTGAcTTAGCTcTATcTCA ++ 33 1010 00 00
In vitro samplein vitro sample ChrChr PositionPosition SequenceSequence StrandStrand Mis-MatchesMiss Matches Total CountTotal Count Indel CountIndel Count Indel EfficacyIndel Efficacy
NL-Ab treatedNL-Ab treated 1One Chr1Chr1 3,045,6353,045,635 GTGCATGTgTGTGCgTtTCCGTGCATGTgTGTGCgTtTCC ++ 33 1717 00 00
22 Chr6Chr6 44,246,69844,246,698 cTGCATGTgTGTGCCTGTCtcTGCATGTgTGTGCCTGTCt ++ 33 1212 00 00
33 Chr9Chr9 116,287,425116,287,425 GTGCATGTgTcTGCCTGcCCGTGCATGTgTcTGCCTGcCC ++ 33 1919 00 00
44 Chr10Chr10 64,380,31164,380,311 GTGCATGTTTGTGtgTGTCCGTGCATGTTTTGTGtgTGTCC ++ 22 1616 00 00
55 Chr19Chr19 44,273,49744,273,497 GTGCATGTccaTGCCTGTCCGTGCATGTccaTGCCTGTCC ++ 33 1111 00 00
한편, NL(Cas9/ABE)-Ab 및 젬시타빈이 함께 처리된 마우스 (Group 8)는 종양 섹션에서 돌연변이 KRAS 및 P53 단백질의 억제를 나타냈다 (도 13c). 또한, Group 8 마우스에서 야생형 P53의 복원, P21 단백질의 증가 및 phospho-ERK의 감소 과정이 확인되었다 (도 13d). 이는 본 발명의 NL 기반 입자 시스템이 생체 내에서 동시에 이중 유전자 편집을 성공적으로 유도할 수 있음을 입증한다. On the other hand, mice (Group 8) co-treated with NL(Cas9/ABE)-Ab and gemcitabine showed inhibition of mutant KRAS and P53 proteins in tumor sections ( FIG. 13c ). In addition, restoration of wild-type P53, increase in P21 protein, and decrease in phospho-ERK were confirmed in Group 8 mice ( FIG. 13d ). This demonstrates that the NL-based particle system of the present invention can successfully induce double gene editing simultaneously in vivo.
또한 생체 내에서 젬시타빈 약물 내성을 극복하기 위한 KRAS 및 P53 유전자 편집 종양 조직에서 GLUT1, TKT, CTPS 및 ENT1과 같은 다양한 바이오 마커의 생체 내 발현을 측정한 바(도 13e), 시험관 내 결과와 유사하게 G8 마우스에서 HIF-1α, GLUT1, TKT 및 CTPS의 발현이 유의하게 억제되는 것으로 나타났으며, ENT1 발현이 현저하게 증가하였다. 이는 CTPS 발현이 낮아져, dCTP의 생체 내 수준이 감소하고 이후 종양에서 ENT1 수준이 향상되어 젬시타빈 대사 산물 수준 (dFdCTP)이 증가했음을 보여준다. In addition, in vivo expression of various biomarkers such as GLUT1, TKT, CTPS and ENT1 in KRAS and P53 gene-edited tumor tissues to overcome gemcitabine drug resistance in vivo was measured (Fig. 13e), similar to the in vitro results. The expression of HIF-1α, GLUT1, TKT and CTPS was significantly suppressed in G8 mice, and the expression of ENT1 was significantly increased. This shows that CTPS expression was lowered, resulting in decreased in vivo levels of dCTP and subsequently enhanced ENT1 levels in tumors, resulting in increased gemcitabine metabolite levels (dFdCTP).
유전자 편집을 통해 젬시타빈 약물 내성을 극복한 종양 세포 사멸효과를 평가하기 위해, 마우스 조직을 TUNEL 분석 및 종양 증식(Ki67)을 사용하여 시각화하였다. TUNEL 분석을 위해서는 BrdU-Red DNA 단편화 분석 키트를 사용(Abcam)하였다. To evaluate the tumor apoptosis effect of overcoming gemcitabine drug resistance through gene editing, mouse tissues were visualized using TUNEL analysis and tumor proliferation (Ki67). For TUNEL analysis, the BrdU-Red DNA fragmentation analysis kit (Abcam) was used.
그 결과, G8 마우스의 조직은 G1 마우스의 조직에 비해 세포 자멸사 향상과 세포 증식 억제를 나타냈다(도 13f). 이와 대비하여, 다양한 장기의 체중 및 조직 형태 변화는 치료 후 거의 변화가 없다 (도 14).As a result, the tissue of the G8 mouse showed improved apoptosis and inhibition of cell proliferation compared to the tissue of the G1 mouse ( FIG. 13f ). In contrast, changes in body weight and tissue morphology of various organs were almost unchanged after treatment (FIG. 14).
이상과 같은 결과를 통해, Cas9/ABE 단일 가이드 RNA가 포함된 나노 리포좀을 이용한 KRAS 및 P53 유전자의 편집 및 젬시타빈의 동시 처리를 통해, 췌장암 또는 KRAS와 P53 관련 이슈가 있는 다른 고형암에 대해 본 발명의 치료제가 매우 우수한 항암 효능이 있음을 입증할 수 있다. Through the above results, the present invention for pancreatic cancer or other solid cancers having issues related to KRAS and P53 through editing of KRAS and P53 genes using nanoliposomes containing Cas9/ABE single guide RNA and simultaneous treatment with gemcitabine It can be proved that the therapeutic agent has very good anticancer efficacy.
실험예 7. 나노리포좀 조성 성분에 따른 안정도 비교 확인 Experimental Example 7. Comparison of stability according to the composition of the nanoliposome
기존에 나노리포좀 제조시 DSPE(1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민) 또는 DPPE(1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민)를 사용하였다. 그러나 본 발명에서는 Cas9/gRNA와 ABE/gRNA의 동시 내포를 위해 나노리포좀의 안정화에 적절한 소재로서 DSPE-PEG(2000)-아민을 사용하였다. When preparing nanoliposomes in the past, DSPE (1,2-distearoyl-sn-glycero-3-phosphoethanolamine) or DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanol) amine) was used. However, in the present invention, DSPE-PEG(2000)-amine was used as a material suitable for stabilizing nanoliposomes for simultaneous encapsulation of Cas9/gRNA and ABE/gRNA.
이는 도 15에 개시된 바와 같이 나노 리포좀을 수용액상에 분산하고 UV-Vis 스펙트럼 흡광도를 이용하여 분산 상태를 확인하였을 때, DSPE를 나노리포좀 원료로 사용한 것은 시간에 따라 점차 가라앉는 것으로 확인되나 DSPE-PEG(2000)-아민이 원료로 사용된 나노 리포좀은 시간이 지나도 침전되지 않고 수용액 상에서 안정적으로 유지되었기 때문이다. As shown in FIG. 15, when nanoliposomes are dispersed in an aqueous phase and the dispersion state is confirmed using UV-Vis spectrum absorbance, it is confirmed that DSPE as a raw material for nanoliposomes gradually subsides with time, but DSPE-PEG (2000)- This is because the nanoliposomes in which the amine was used as a raw material did not precipitate over time and were stably maintained in an aqueous solution.
이 결과를 통해, 나노리포좀의 형상이 시간이 지나도 온전히 유지되기에 좋은 조건으로 DSPE-PEG(2000)-아민을 사용하는 것이 바람직함을 확인할 수 있다.Through this result, it can be confirmed that it is preferable to use DSPE-PEG(2000)-amine under good conditions for maintaining the shape of the nanoliposome intact even over time.

Claims (7)

  1. Cas9 단백질과 KRAS 유전자를 타겟으로 하는 가이드 RNA의 혼성체; 및, ABE 단백질과 P53 유전자를 타겟으로 하는 가이드 RNA의 혼성체;가 동봉된 나노 리포좀 전달체 조성물. hybrid of Cas9 protein and guide RNA targeting KRAS gene; And, a hybrid of the guide RNA targeting the ABE protein and the P53 gene; nano-liposome delivery system composition enclosed.
  2. 제1항에 있어서,According to claim 1,
    상기 나노 리포좀은 레시틴, 콜레스테롤, 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민 및 메탈 킬레이팅 지질을 포함하는 것을 특징으로 하는 나노 리포좀 전달체 조성물. The nano liposome is lecithin, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000) amine and metal chelating lipid nano-liposome comprising carrier composition.
  3. 제1항에 있어서,According to claim 1,
    상기 나노 리포좀에는 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합된 것을 특징으로 하는 나노 리포좀 전달체 조성물. In the nanoliposome, one or more proteins selected from the group consisting of EGFR (Epidermal growth factor receptor), EpCAM (Epithelial cell adhesion molecule), CEA (Carcinoembryonic antigen) and annexins expressed in colorectal cancer cells can be recognized. Nano-liposome delivery composition, characterized in that the monoclonal or polyclonal antibody that can be bound.
  4. 제1항에 있어서,According to claim 1,
    상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 갖는 것을 특징으로 하는 나노 리포좀 전달체 조성물. The nano-liposome is a nano-liposome delivery system composition, characterized in that it has a particle size of 10 ~ 2,000 nm.
  5. 제1항 내지 제4항 중 어느 한 항의 나노 리포좀 전달체 조성물을 함유하는 것을 특징으로 하는 췌장암의 개선 또는 치료용 조성물. The composition for improving or treating pancreatic cancer, characterized in that it contains the nano-liposome delivery system composition of any one of claims 1 to 4.
  6. 제5항에 있어서, 6. The method of claim 5,
    상기 나노 리포좀 전달체 조성물에 젬시타빈이 첨가된 것을 특징으로 하는 췌장암의 개선 또는 치료용 조성물. A composition for improving or treating pancreatic cancer, characterized in that gemcitabine is added to the nano-liposome delivery composition.
  7. Cas9 단백질과 KRAS 유전자를 타겟으로 하는 단일 가이드 RNA의 제1혼성체, 및, ABE 단백질과 P53 유전자를 타겟으로 하는 단일 가이드 RNA의 제2혼성체를 각각 제조하고, A first hybrid of a single guide RNA targeting the Cas9 protein and the KRAS gene and a second hybrid of a single guide RNA targeting the ABE protein and the P53 gene were prepared, respectively,
    레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민-폴리에틸글리콜(2000)아민을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; Lecithin, metal chelating lipid, cholesterol and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylglycol (2000) amine is mixed in chloroform in chloroform to prepare a lipid film composition step;
    상기 지질 필름 조성물에, 제1혼성체와 제2혼성체를 혼합하고 넣어 초음파 처리하는 제2단계; A second step of sonicating into the lipid film composition, mixing and putting a first hybrid and a second hybrid;
    상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계;After freezing and thawing the sonicated lipid film composition, a third step of sonicating again;
    상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및,A fourth step of centrifuging the lipid film composition sonicated in the third step and recovering the nano-liposomes in the precipitated state; and,
    상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제5단계; a fifth step of binding the antibody to the nanoliposome in the precipitated state obtained in the fourth step through a crosslinking agent;
    를 포함하는 것을 특징으로 하는 췌장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법. A method for producing a nano-liposome delivery composition capable of selectively recognizing pancreatic cancer cells, comprising:
PCT/KR2022/001418 2021-03-09 2022-01-27 Nanoliposome carrier composition having kras and p53 gene editing function WO2022191431A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0030720 2021-03-09
KR1020210030720A KR102328197B1 (en) 2021-03-09 2021-03-09 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function

Publications (1)

Publication Number Publication Date
WO2022191431A1 true WO2022191431A1 (en) 2022-09-15

Family

ID=78703256

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/001418 WO2022191431A1 (en) 2021-03-09 2022-01-27 Nanoliposome carrier composition having kras and p53 gene editing function

Country Status (2)

Country Link
KR (1) KR102328197B1 (en)
WO (1) WO2022191431A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102328197B1 (en) * 2021-03-09 2021-11-17 주식회사 무진메디 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function
WO2023154451A1 (en) * 2022-02-10 2023-08-17 Christiana Care Gene Editing Institute, Inc. Methods for lipid nanoparticle delivery of crispr/cas system
KR102544632B1 (en) 2022-08-05 2023-06-16 주식회사 무진메디 Lipid nanoparticles with long-chain ceramides and composition for cell death comprising the same
KR102569192B1 (en) 2023-02-24 2023-08-22 주식회사 무진메디 Lipid nanoparticles with long-chain ceramides and composition for cell proliferation comprising the same

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101710026B1 (en) * 2016-08-10 2017-02-27 주식회사 무진메디 Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA
KR101796036B1 (en) * 2016-12-29 2017-11-10 주식회사 무진메디 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance
KR102328197B1 (en) * 2021-03-09 2021-11-17 주식회사 무진메디 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101710026B1 (en) * 2016-08-10 2017-02-27 주식회사 무진메디 Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA
KR101796036B1 (en) * 2016-12-29 2017-11-10 주식회사 무진메디 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance
KR102328197B1 (en) * 2021-03-09 2021-11-17 주식회사 무진메디 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DONATO COSCO, FEDERICO, MORITTU, BRITTI, TRAPASSO: "Gemcitabine-loaded liposomes: rationale, potentialities and future perspectives", INTERNATIONAL JOURNAL OF NANOMEDICINE, pages 5423, XP055344141, DOI: 10.2147/IJN.S34025 *
MIRGAYAZOVA REGINA, KHADIULLINA RANIYA, CHASOV VITALY, MINGALEEVA RIMMA, MIFTAKHOVA REGINA, RIZVANOV ALBERT, BULATOV EMIL: "Therapeutic Editing of the TP53 Gene: Is CRISPR/Cas9 an Option?", GENES, vol. 11, no. 6, 1 January 2020 (2020-01-01), pages 704, XP055966562, DOI: 10.3390/genes11060704 *

Also Published As

Publication number Publication date
KR102328197B1 (en) 2021-11-17

Similar Documents

Publication Publication Date Title
WO2022191431A1 (en) Nanoliposome carrier composition having kras and p53 gene editing function
WO2018030608A1 (en) Nanoliposome carrier composition containing hybrid of cas9 protein and guide rna
WO2019212324A1 (en) Targeting m2-like tumor-associated macrophages by using melittin-based pro-apoptotic peptide
WO2010041913A9 (en) Novel uses of grs proteins or fragments thereof
WO2018124538A1 (en) Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation
WO2015076621A1 (en) Peptide having angiogenesis inhibitory activity and composition containing same
WO2017022962A1 (en) Composition for preventing or treating immune disease, comprising ripk inhibitor as active ingredient
WO2019078611A1 (en) Nanoliposome-microbubble conjugate having cas9 protein, guide rna for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same
WO2009134027A2 (en) Anti-nucleic acid antibody inducing cell death of cancer cells and composition for preventing or treating cancers comprising the same
WO2019083172A1 (en) Pharmaceutcal composition for preventing or treating cancer, containing streptonigrin and rapamycin as active ingredients
WO2019194586A1 (en) Novel target for anti-cancer and immune-enhancing
WO2017171373A2 (en) Composition for suppressing resistance to egfr-targeting agent
WO2023033481A1 (en) Adp-ribose binding peptide having anticancer activity and use thereof
WO2021033973A1 (en) Composition for inhibiting myeloid-derived suppressor cell comprising mitf inhibitor as active ingredient
WO2017164486A1 (en) Composition for inhibiting resistance to anticancer agents, containing tesk1 inhibitor, and method for screening for tesk1 inhibitor
WO2022131744A1 (en) Composition for preventing or treating pancreatic cancer comprising peptide nucleic acid complex
WO2021025352A1 (en) Anticancer virus expressing fgf2- or api5-derived peptide, and use thereof
WO2022065726A1 (en) Liposome complex for cancer treatment, comprising novel cd47 binder and polynucleotide
WO2022065724A1 (en) Cd47 binder and liposome complex for treating cancer
WO2023239213A1 (en) Fusion protein operating specifically in inflammatory cells
WO2023163301A1 (en) Peptide that inhibits formation of kitenin dimer, and use for same
WO2023195802A1 (en) Novel-peptide-based anticancer immunotherapeutic agent
WO2024049164A1 (en) Nanovesicles for delivering cell membrane-derived nucleic acids and method for preparing same
WO2020116688A1 (en) Anticancer supplement comprising nc886 and/or pkr inhibitor, and method for providing information of drug for cancer treatment
WO2023132380A1 (en) Polynucleotide for cancer treatment encoding 5'-nucleotidase modified protein

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22767328

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22767328

Country of ref document: EP

Kind code of ref document: A1