WO2018124538A1 - Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation - Google Patents

Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation Download PDF

Info

Publication number
WO2018124538A1
WO2018124538A1 PCT/KR2017/014453 KR2017014453W WO2018124538A1 WO 2018124538 A1 WO2018124538 A1 WO 2018124538A1 KR 2017014453 W KR2017014453 W KR 2017014453W WO 2018124538 A1 WO2018124538 A1 WO 2018124538A1
Authority
WO
WIPO (PCT)
Prior art keywords
kras
nano
guide rna
colorectal cancer
composition
Prior art date
Application number
PCT/KR2017/014453
Other languages
French (fr)
Korean (ko)
Inventor
류지연
유경남
Original Assignee
주식회사 무진메디
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 무진메디 filed Critical 주식회사 무진메디
Priority to CN201780067497.0A priority Critical patent/CN110325176B/en
Publication of WO2018124538A1 publication Critical patent/WO2018124538A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6863—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from stomach or intestines cancer cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A61K47/6913—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome the liposome being modified on its surface by an antibody
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1277—Processes for preparing; Proliposomes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present invention relates to nanoliposome delivery compositions encapsulated with a complex of Cas9 protein, guide RNA and cationic polymer. More specifically, the present invention provides a nanoliposome delivery composition or KRAS containing a complex containing a complex of Cas9 protein, guide RNA and cationic polymer that inhibit expression of KRAS gene. It relates to a composition for improving or treating anti-cancer drug-resistant colorectal cancer according to genetic variation.
  • Gene editing technology originates from the adaptive immunity of microorganisms.
  • a fragment of bacteriophage is remembered as DNA for bacteriophage infection and then cut and removed by Cas9 ( C- RISPR as sociated protein 9 : RNA-guided DNA endonuclease enzyme), a nuclease that acts as a genetic scissors when reinfected. Started.
  • Cas9 C- RISPR as sociated protein 9 : RNA-guided DNA endonuclease enzyme
  • gRNA guide RNA
  • Colon cancer is a malignant tumor consisting of cancerous cells of the large intestine.
  • the large intestine absorbs all the water from food from the small intestine, collects it in the rectum, and then excretes it in the form of feces. Cancer cells are easier to grow than organs.
  • 'Cetuximab Erbitux
  • Cetuximab is a monoclonal antibody targeting Epidermal Growth Factor Receptor (EGFR) that specifically binds to EGFR on the surface of colorectal cancer cells, inhibiting certain parts of the signal transduction process that causes cancer cell proliferation. Suppress overall proliferation.
  • EGFR Epidermal Growth Factor Receptor
  • patients who have mutations in the KRAS gene a gene that causes colorectal cancer (40-50% of all colorectal cancer patients), cannot be treated with this injection.
  • Cetuximab treatment is continued, 60-80% of the KRAS genes will be mutated.
  • the KRAS gene is one of several genes involved in the development of colorectal cancer, and the mutation of this gene is known to significantly improve the response and survival of drugs in colorectal cancer patients to determine the effectiveness of custom treatments such as Cetuximab. It is considered very important.
  • the present inventors prepared a cell delivery agent having high drug delivery efficiency by encapsulating a complex of Cas9 protein, guide RNA and cationic polymer that inhibit expression of KRAS gene in nano liposomes for treatment of colorectal cancer through gene editing.
  • the present invention was completed by using it as a cancer medicament.
  • Patent Document 1 Korean Unexamined Patent Publication No. 10-2015-0101476 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
  • Patent Document 2 Korean Unexamined Patent Publication No. 10-2015-0101477 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
  • Patent Document 3 Korean Patent Publication No. 10-2015-0101478 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
  • Non-Patent Document 1 Belov L et al., Cell surface markers in colorectal cancer prognosis, Int J Mol Sci, 2010, 12 (1), 78-113.
  • Non-Patent Document 2 Dos Santos T et al., Effects of transport inhibitors on the cellular uptake of carboxylated polystyrene nanoparticles in different cell lines, PLoS One, 2011, 6 (9): e24438.
  • Non-Patent Document 3 Dow LE et al., Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer, Cell, 2015, 161 (7), 1539-1552.
  • Non-Patent Document 4 Lee J et al., Effect of simvastatin on Cetuximab resistance in human colorectal cancer with KRAS mutations, J Natl Cancer Inst, 2011, 103 (8), 674-688.
  • Non-Patent Document 5 Lievre et al., KRAS mutation status is predictive of response to Cetuximab therapy in colorectal cancer, Cancer Res, 2006, 66 (8), 3992-3995.
  • Non-Patent Document 6 Matano M et al., Modeling colorectal cancer using CRISPR-Cas9-mediated engineering of human intestinal organoids, Nat Med, 2015, 21 (3), 256-262.
  • Non-Patent Document 7 Montagut C et al., Identification of a mutation in the extracellular domain of the Epidermal Growth Factor Receptor conferring Cetuximab resistance in colorectal cancer, Nat Med, 2012, 18 (2), 221-223.
  • Non-Patent Document 8 Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24 (6), 1020-1027.
  • Non-Patent Document 9 Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33 (11), 1162-1164.
  • Non-Patent Document 10 Zuris JA et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33 (1), 73-80.
  • An object of the present invention is to provide a nano liposome delivery composition containing a complex of Cas9 protein, guide RNA and cationic polymer. More specifically, an object of the present invention is to improve or treat the anti-cancer drug-resistant colorectal cancer according to the KRAS gene mutations containing the nano-liposomal delivery composition containing the complex of the Cas9 protein, guide RNA that inhibits the expression of the KRAS gene and cationic polymer It is to provide a composition for.
  • the present invention relates to a nanoliposome delivery composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer.
  • Guide RNA for inhibiting the expression of the KRAS gene may comprise a nucleotide sequence of SEQ ID NO: 1 or 2.
  • the nano liposomes may comprise lecithin, cholesterol, cationic phospholipids and metal chelating lipids.
  • the nano liposomes may recognize one or more proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epithelial cell adhesion molecule (EpCAM), carcinoembryonic antigen (CEA), and annexin (Annexins) expressed in colorectal cancer cells.
  • EGFR epidermal growth factor receptor
  • EpCAM epithelial cell adhesion molecule
  • CEA carcinoembryonic antigen
  • annexins annexin expressed in colorectal cancer cells.
  • Monoclonal or polyclonal antibodies can be combined.
  • the nano liposomes may have a particle size of 10 ⁇ 2,000 nm.
  • the present invention can provide a composition for improving or treating colorectal cancer containing the nano-liposomal delivery composition.
  • Cetuximab may be added to the composition for improving or treating colorectal cancer.
  • the present invention also provides a method for preparing a nanoliposome transporter composition capable of selectively recognizing colon cancer cells as follows.
  • a preparation for preparing a lipid film composition by preparing a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipid on chloroform Stage 1;
  • a second step of sonicating the lipid film composition by inserting a complex of a Cas9 protein, a guide RNA that inhibits the expression of the KRAS gene, and a cationic polymer;
  • the present invention relates to a nanoliposome delivery composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer.
  • the Cas9 protein may be obtained from a cell or strain transformed with a pET28a / Cas9-Cys plasmid (in which Cas9-Cys is inserted into a pET28a (+) vector).
  • pET28a / Cas9-Cys plasmid can be obtained by transforming Escherichia coli overexpressing Cas9 protein.
  • Guide RNA that can be applied in the present invention is a guide RNA comprising a nucleotide sequence of the following SEQ ID NO: 1 or 2, the nano liposome carrier composition comprising such a guide RNA inhibits the expression of KRAS normal gene or mutant gene colon Function to improve or treat cancer
  • the guide RNA of SEQ ID NO: 1 is derived from a partial DNA nucleotide sequence of human ( Homo sapiens ) KRAS of SEQ ID NO: 3 below, and targets a partial DNA nucleotide sequence of KRAS of SEQ ID NO: 5 (SEQ ID NO: 3 And SEQ ID NO: 5 have complementary nucleotide sequences).
  • Will of the SEQ ID NO: 2 of the guide RNA is derived from a part of the DNA sequence of the KRAS of SEQ ID NO: 4, and some DNA sequence of the KRAS of SEQ ID NO: 6 to a target (SEQ ID NO: 4 and SEQ ID NO: 6 Having complementary sequences).
  • a scaffold sequence may be included to form a complex with the Cas9 protein.
  • the type of scaffold base sequence is not particularly limited, and any base sequence can be used as long as it is a conventional base sequence used for the production of guide RNA.
  • the guide RNA applied to the nano liposome of the present invention is
  • Nano liposomes can be applied.
  • the DNA base sequence of SEQ ID NO: 5 or 6 targeted by the base sequence of the guide RNA of SEQ ID NO: 1 or 2 is the sequence of SEQ ID NO: 5 or 6 targeted by the base sequence of the guide RNA of SEQ ID NO: 1 or 2 of human
  • the DNA sequence is a nucleotide sequence present in Exon2 of KRAS ( Homo sapiens Chromosome 12, Genbank No. NC_000012.12), and the DNA of Exon2 is cut through the guide RNA of SEQ ID NO: 1 or 2.
  • Mutation of the KRAS gene occurs in the codon 12 sequence of KRAS exon 2 of human genomic DNA, which was identified in the SW480 and SNU407 cell lines, which are colon cancer cells, and is schematically shown in FIGS. 1A and 1B.
  • the guide RNAs of SEQ ID NO: 1, 2, 7, 8 can be synthesized through in vitro transcription using a T7 RNA polymerase.
  • the cationic polymer is preferably poly-L-lysine, polyamidoamine, poly [2- (N, N-dimethylamino) ethyl methacrylate], chitosan, poly-L-ornithine, cyclodextrin, histone,
  • One or more selected from collagen, dextran and polyethyleneimine may be used, most preferably polyethyleneimine.
  • the nano liposomes may include lecithin ( ⁇ -phosphatidylcholin), cationic phospholipids, cholesterol and metal chelating lipids, whereby the lecithin, cationic phospholipids, cholesterol and metal chelating lipids form nano liposomes. This can be done.
  • lecithin ⁇ -phosphatidylcholin
  • cationic phospholipids cholesterol and metal chelating lipids
  • Lecithin is widely distributed in animal and plant systems, so it has excellent biocompatibility and has already been proven in its stability, and has been widely used in food and pharmaceutical delivery technologies. It can also be used as a material to facilitate the size control and modification of nano liposomes.
  • the cationic phospholipids are dioleoyl phosphatidylethanolamine (DOPE), 1,2-dipitanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,2-distearoyl-sn-glycer Rho-3-phosphoethanolamine (DSPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) and 1,2-dioleoyl-sn-glycero-3- It may be selected from the group consisting of phosphocholine (DOPC).
  • DOPC phosphocholine
  • 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) is used.
  • DOGS-NTA-Ni lipid is a lipid having the chemical structure of Formula 1,
  • DMPE-DTPA-Gd lipid is a lipid having the chemical structure of Formula 2,
  • 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt).
  • DMPE-DTPA-Cu lipid is a lipid having the chemical structure of Formula 3
  • the DOGS-NTA-Ni lipids are encapsulated into the nano-liposomes (that contained His-Tag) to take advantage of the His-Tag (6X histidin) and Ni 2 + chinyeonseong (affinity) that is used in the protein purification methods Cas9 protein is efficiently ( encapsulation). More specifically His in the DOGS-NTA-Ni may form a lipid (lipid) along with the lecithin with one double bond structures in the 18 carbon, at the end there is Ni 2 + is coupled, attached to Cas9 protein dog 2 dog coupled -tag Ni 2 + 1 to Cas9 causes the protein encapsulated in nanoliposomes more effectively.
  • DMPE-DTPA-Gd lipids and DMPE-DTPA-Cu lipids also play the same role, effectively inducing the encapsulation of nanoliposomes in complexes containing Cas9 proteins.
  • a Cas9 protein coupled with a guide RNA comprising a nucleotide sequence of SEQ ID NO: 1 and a Cas9 protein coupled with a guide RNA comprising a nucleotide sequence of SEQ ID NO: 2 may be present.
  • the nano liposomes may have a particle size of 10 ⁇ 2,000 nm.
  • size of the nano liposomes is less than 10 nm, it may be difficult to encapsulate the complexes of the Cas9 protein, the guide RNA and the cationic polymer that inhibit the expression of the KRAS gene, and the stability may be lowered when injected into the body. Not desirable In addition, even if it exceeds 2,000 nm when the composition containing the nano liposomes are injected into the body it is not preferable because the stability can be lowered.
  • the nano liposomes may recognize proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epitope cell adhesion molecule (EpCAM), carcinoembryonic antigen (CEA), and annexin (Annexins) expressed in colorectal cancer cells.
  • EGFR epidermal growth factor receptor
  • EpCAM epitope cell adhesion molecule
  • CEA carcinoembryonic antigen
  • Annexins annexin expressed in colorectal cancer cells.
  • Monoclonal or polyclonal antibodies can be combined.
  • the polyclonal antibody may be obtained from a blood sample obtained by injecting one kind of protein such as EGFR, EpCAM, CEA, annexin, or the like into an animal.
  • the animal may be any animal host such as goat, rabbit, or pig.
  • the monoclonal antibodies as is well known in the art, use hybridoma methods (Kohler G. and Milstein C.) or phage antibody library (Clackson et al .; Marks et al.) Technology. Can be prepared.
  • cells of an immunologically suitable host animal such as a mouse and cancer or myeloma cell line may be used.
  • the antibody-producing cells can be propagated by a standard tissue culture method. have.
  • hybridomas capable of producing antibodies specific for one protein such as EGFR, EpCAM, CEA, Annexin, etc.
  • Mass culture can be performed in vitro or in vivo according to standard techniques.
  • the phage antibody library method by obtaining an antibody gene for one protein, such as EGFR, EpCAM, CEA, Annexin, and expressing it in the form of a fusion protein on the surface of the phage (phage) to produce an antibody library in vitro From the library, monoclonal antibodies that bind to one protein such as EGFR, EpCAM, CEA, Annex, and the like can be isolated and produced. Antibodies prepared by the above methods can be separated by electrophoresis, dialysis, ion exchange chromatography, affinity chromatography and the like.
  • the antibody may include functional fragments of antibody molecules, as well as complete forms having two full length light chains and two full length heavy chains.
  • the functional fragment of an antibody molecule means the fragment which has at least antigen binding function, and includes Fab, F (ab '), F (ab') 2, F (ab) 2, Fv.
  • the antibody is 1,4-bis-maleimidobutane, 1,11-bis-maleimidotetraethylene glycol, 1-ethyl-3- [3-dimethyl aminopropyl] carbodiimide hydrochloride, succinimidyl -4- [N-maleimidomethylcyclohexane-1-carboxy- [6-amidocaproate]] and its sulfonates (sulfo-SMCC), succimidyl 6- [3- (2-pyridyldithio ) -Lopionamido] hexanoate] and its sulfonate (sulfo-SPDP), m-maleimidobenzoyl-N-hydrosuccisinimide ester and its sulfonate (sulfo-MBS), and succimidyl [4- (p-maleimidophenyl) butyrate] and one or more crosslinking agents selected from the group consisting of
  • the linker is characterized in that connecting the cationic phospholipid of the nano liposomes and the antibody.
  • Nano liposomes of the present invention can be stably dispersed in neutral water, cell culture, blood and the like for several hours or more.
  • the present invention can provide a composition for improving or treating colorectal cancer containing the nano-liposomal delivery composition.
  • the composition may further comprise Cetuximab.
  • the colorectal cancer may be colorectal cancer having a KRAS normal gene or a mutant genotype.
  • the nano liposome carrier composition has a KRAS mutant genotype and is effective in treating colorectal cancer having drug resistance to Cetuximab.
  • the present invention also provides a method for preparing a nanoliposome transporter composition capable of selectively recognizing colon cancer cells as follows.
  • a preparation for preparing a lipid film composition by preparing a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipid on chloroform Stage 1;
  • a second step of sonicating the lipid film composition by inserting a complex of a Cas9 protein, a guide RNA that inhibits the expression of the KRAS gene, and a cationic polymer;
  • the guide RNA and the cationic polymer that inhibits the expression of the Cas9 protein, KRAS gene may be mixed in a molar ratio of 1: 1 to 3:30 to 70. If the mixing ratio at this time is out of production of the composite may not be good.
  • Lecithin, metal chelating lipids, cholesterol and cationic phospholipids of the first step may be mixed in a ratio of 2: 0.1 to 5: 0.01 to 0.5: 0.01 to 0.5 mole. Likewise, if the mixing ratio is out of this time, the preparation of lipids constituting the nano liposomes may not be performed well.
  • the process of freezing and thawing in the third step may be repeated 1 to 12 times.
  • the process of freezing and thawing in the third step may be repeated 1 to 12 times.
  • nano liposome dispersions of more uniform size can be formed, and the drug encapsulation efficiency of the nano liposomes can be improved.
  • it exceeds 12 times since the encapsulation efficiency of the nano liposomes may be rather reduced, less than 12 times is preferable.
  • the cross-linking agent is mixed in the nanoliposome for 1 to 5 hours, and then, the antibody is added and mixed for 1 to 5 hours.
  • the nano liposomes, the crosslinking agent and the antibody may be combined in a weight ratio of 10 to 30: 1 to 5: 1.
  • the metal chelating lipids have a negative charge ( ⁇ )
  • the encapsulation of the liposomes may not be well performed in response to the negative charge ( ⁇ ) of the hybrid of the guide RNA that suppresses the expression of the Cas9 and KRAS genes. Can be. Therefore, in order to overcome this, it is possible to enhance the encapsulation of the nano liposomes by preparing a complex in which a cationic polymer having a positive charge (+) is bound.
  • the present invention can also provide a pharmaceutical composition containing the nano-liposomal delivery composition, wherein the pharmaceutical composition is oral, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. according to conventional methods, respectively. It may be used in the form of a dosage form, an external preparation, a suppository, and a sterile injectable solution.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid form preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin.
  • excipients such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin.
  • lubricants such as magnesium stearate and talc are also used.
  • Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • the non-aqueous solvent and suspending agent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determination based on these factors is within the level of skill in the art and generally dosages range from 0.01 mg / kg / day to approximately 2000 mg / kg / day. More preferred dosage is 1 mg / kg / day to 500 mg / kg / day. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.
  • the pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, humans, etc. by various routes. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.
  • the present invention relates to a nanoliposome carrier composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits KRAS gene expression, and a cationic polymer, or an anticancer drug-resistant colorectal cancer therapeutic agent according to KRAS mutations.
  • Cetuximab currently used as a treatment for metastatic colorectal cancer, is effective only for patients with normal KRAS colon cancer, and even if KRAS patients with normal colorectal cancer continue to receive Cetuximab treatment, 60% to 80% of patients can develop a KRAS mutation. It has a disadvantage.
  • it is possible not only to fundamentally suppress the mutation of KRAS , which is a colon cancer-causing gene, but also to effectively treat the KRAS mutant metastatic colorectal cancer.
  • Figures 1a and 1b shows the genomic DNA of each cell in order to determine whether KRAS is a normal sequence (GGT) or mutation (GTT or GAT) at Exon2, codon 12 in colon cancer cells HT29, SW480, SNU407 cell line This is the result of confirming codon sequence of KRAS exon 2.
  • Figure 2 shows the results confirmed the mRNA expression of the plasmid system and KRAS sequence efficiency of the guide RNA (sgRNAs) 1 and 2 of the single strand state of the present invention.
  • sgRNAs guide RNA
  • Figure 3a is a schematic diagram of the nucleotide sequence structure of the guide RNA (sgRNAs, SEQ ID NO: 1) of the single-stranded state of the present invention.
  • Figure 3b shows a result of confirming the presence of the protein purified by Cas9 protein used in the present invention and subjected to SDS-PAGE (Sodium dodecyl sulphate polyacrylamide gel electrophoresis) and stained with Coomassie blue solution.
  • SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis
  • Figure 4 shows the results of in vitro transcriptied sgRNAs and purified Cas9 protein to be hybridized in the laboratory to prepare a hybrid (Cas9 / sgRNA hybrid), the actual truncation of the KRAS gene using this hybrid.
  • FIG. 5 is a schematic of the nano liposome structure of Example 2 of the present invention, the nano liposome is a complex containing a combination of Cas9 protein, guide RNA (sgRNA) and polyethyleneimine (PEI, Polyethylenimine), constituting the liposome
  • the membrane consists of lecithin, cholesterol (Cholestrol), DPPE (1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine) and DOGS-NTA-Ni lipids.
  • the amine group of DPPE exposed on the surface of the liposome is EGFR antibody which targets colon cancer cells by using Sulfo-SMCC (Sulfosuccinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate) as a linker. (anti-EGFR) is bound.
  • Sulfo-SMCC Sulfosuccinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate
  • FIG. 6 is an immunostained with an antibody against Cas9 and treated with confocal fluorescence microscopy after treating the inhibitors for inhibiting the influx into cells to confirm the inflow process of the nanoliposome of the present invention Example 2 into colorectal cancer cells. Photo taken with Scanning Microscopy.
  • Figure 7a is a diagram showing the location in the KRAS gene of the human genome targeted by sgRNA 1 and sgRNA 2 of the present invention.
  • Figure 7b is a diagram showing the 20 nucleotide sequence of the KRAS gene is cut by processing the nano liposome of Example 2 of the present invention.
  • Figure 7c shows the effect of inhibiting the mRNA expression of KRAS in each colorectal cancer cells (HT29 cells with KRAS normal gene, SW480 and SNU407 cells with KRAS mutant gene) treated with nano liposomes of Example 2 of the present invention.
  • Figure 7d shows the results of confirming the protein expression level and Erk 1/2 signaling of Ras in SW480 cells treated with the nanoliposome of Example 2 of the present invention.
  • 7E and 7F illustrate cell signaling processes associated with K-ras, Cetuximab, and Cas9 / sgRNA.
  • Figure 8a is a result of the cell group treated only with Cetuximab, cell survival and proliferation in HT29 cells with KRAS normal gene, SW480 with KRAS mutant gene, SNU407 cells is shown by the WST-1 assay method.
  • Figure 8b is a result of the experimental group treated with Cetuximab to the KRAS gene-edited cells treated with the nano liposome of Example 2 of the present invention, HT29 cells with KRAS normal gene, SW480, SNU407 cells with KRAS mutant gene Cell survival and proliferation of the cells were shown by the WST-1 assay method.
  • Figure 9 shows cell apoptosis in the treatment of the nano liposomes of Comparative Example 1 in which Cas9, sgRNAs and polyethyleneimine complexes were not encapsulated and the nano liposomes of Example 2 in which Cas9, sgRNAs and polyethyleneimine complexes were encapsulated. Check the process to show the difference in protein expression results.
  • Example 10 shows the results of measuring caspase-3 activity to confirm apoptosis due to Cetuximab in the colorectal cancer cells treated with the nanoliposome of Example 2 of the present invention.
  • FIG. 12 shows the structure of a plasmid Cas guide vector.
  • Fig. 13 shows the structure of pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261).
  • FIG. 14 is a schematic diagram showing a process of preparing a half-antibody extracted from [Wu S et al].
  • Example 1-1 KRAS Guide RNA production with target genes
  • a guide RNA was prepared using KRAS as a target gene by in vitro transcription using T7 RNA polymerase (NEB).
  • T7 RNA polymerase NEB
  • the T7 promoter sequence of Table 1 and the 20 bp sequence of the KRAS gene SEQ ID NO: 3: CTGAATTAGCTGTATCGTCA
  • SEQ ID NO: 4 '69 mer forward primer 'including GAATATAAACTTGTGGTAGT
  • One 140 bp DNA template was prepared by PCR using a plasmid Cas guide vector (origene). Including this DNA template, rNTP mixture, T7 RNA polymerase and RNAase inhibitor, guide RNA was prepared by transcriptional reaction at 37 ° C for 2 hours, and RNA purity was increased through RNA purification.
  • T7 promoter sequence corresponds to the underlined portion of Table 1 below.
  • the bold nucleotide sequence of Table 1 is a region for recognizing the KRAS gene, and guide RNA is synthesized by recognizing a template of the scaffold nucleotide (plasmid Cas guide vector), and the sequence of the finally prepared guide RNA and this nucleotide sequence It has this same (substituted by U instead of T) nucleotide sequence.
  • the plasmid Cas guide vector contains the template of the scaffold sequence.
  • KRAS sgRNA 1_F GCGGCCTCTAATACGACTCACTATAGGG CTGAATTAGCTGTATCGTCA GTTTTAGAGCTAGAAATAGCA
  • KRAS sgRNA 2_F GCGGCCTCTAATACGACTCACTATAGGG GAATATAAACTTGTGGTAGT GTTTTAGAGCTAGAAATAGCA reverse primer (sg RNA_R) AAAAGCACCGACTCGGTGCCA
  • sgRNA single stranded guide RNA
  • the guide RNA is the final manufacturing of the KRAS gene From SEQ ID NO: 5: TGACGATACAGCTAATTCAG or SEQ ID NO: 6: recognizing the target base sequence of CTTATATTTGAACACCATCA serves to inhibit the expression of each of KRAS gene.
  • pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261) was transformed into Escherichia coli (DH5 ⁇ ) to overexpress Cas9 protein under 0.5 mM IPTG (isopropyl ⁇ -D-1-thiogalactopyranoside) and 28 ° C, and overexpress Cas9 protein.
  • E. coli was sonicated with lysis buffer (20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1x protease inhibitor cocktail, 1 mg / mL lysozyme). The pulverized product obtained by sonication was centrifuged to obtain a liquid phase containing protein.
  • Cas9 protein in the liquid phase was isolated by Ni-NTA agarose bead extraction (elution buffer: 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1x protease inhibitor cocktail). The isolate was then dialyzed (cut off 10K) in a mixed buffer in a storage buffer (50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol). After removing the protein concentration was quantified (using BCA method). At this time, the Cas9 protein obtained by dialysis was confirmed by SDS-PAGE to confirm that the Cas9 protein was well generated (FIG. 3B).
  • the complex was prepared by mixing the Cas9 protein, guide RNA and polyethyleneimine prepared in Example 1 in a mole ratio of 1: 2: 50. At this time, as the guide RNA, SEQ ID NO: 7 or 8 including the scaffold base sequence was used (SEQ ID NO: 1 or 2 nested).
  • lecithin Sigma Aldrich
  • DOGS-NTA-Ni lipids Avanti polar lipids
  • cholesterol Cholesterol, Sigma Aldrich
  • DPPE DPPE
  • the complex of Cas9 protein / guide RNA / polyethyleneimine was added and mixed with ultrasonic waves.
  • the freeze thaw cycle was repeated 10 times using liquid nitrogen and then ultrasonicated (probe method) to produce nanoliposome compositions with a smaller size and a uniform state.
  • the nano liposome composition precipitated by centrifugation (19.82 mg total amount of lipid, 0.034 mg total amount of Cas9 and gRNA) was recovered, and 2.5 mg of Sulfo-SMCC (ProteoChem) to be used as a linker for antibody binding was used for 25 hours in PBS. Mix at room temperature.
  • EGFR epidermal growth factor receptor
  • EpCAM epipithelial cell adhesion molecule
  • CEA carcinoembryonic
  • EGFR antibody Anti-EGFR
  • abcam ab2430
  • 2-Mercaptoethylamine Thermo
  • PD-10 desalting column GE Healthcare
  • Thermo antibody and 2-Mercaptoethylamine are mixed at 1mg: 0.6mg.
  • the purification process of the antibody can be described by the following figure (The antibody is composed of the same two chains having a Y shape, 2-Mercaptoethylamine is added to make a half-antibody and purified again, and then bound to the nano liposomes. Sikkim-Wu S et al., Highly sensitive nanomechanical immunosensor using half antibody fragment, Anal Chem, 2014, 86 (9), 4271-4277). See FIG. 14.
  • -SH is produced. Because of the presence of -NH2 in the DPPE lipids that make up the nano liposomes, sulfo-SMCC (linker) reacts with it, and the sulfo-SMCC and half -antibody's -SH portion of the nano liposomes are combined. Thus, half-antibody production can double the recognition capacity of nanoliposomes for colon cancer cells.
  • Nano liposomes of the present invention to which the antibody is bound were obtained and mixed in a progress buffer (cell culture medium or PBS [Phosphate Buffered Saline]) and used in the following experiment.
  • Nano liposomes were prepared by the method described in Example 2, but the process of adding a complex of Cas9 protein / guide RNA / polyethylenimine was excluded.
  • Nano liposomes were prepared except for DOGS-NTA-Ni lipids in preparation of nano liposomes, and then the procedure of Example 2 was performed, but the hybrid of Cas9 protein / guide RNA was replaced with the complex of Cas9 protein / guide RNA / polyethylenimine. Encapsulated in liposomes.
  • Nano liposomes were prepared as in Example 2, but a hybrid of Cas9 protein / guide RNA was encapsulated in nano liposomes instead of the complex of Cas9 protein / guide RNA / polyethylenimine.
  • Nano liposomes were prepared as in Example 2 but did not bind antibodies and linkers.
  • the Cas9 protein could not cut the fragment because no guide RNA was present, and in the experimental group in which the purified Cas9 protein was mixed with sgRNA 1 (SEQ ID NO: 1), sgRNA 1 Recognizing the sequence of SEQ ID NO: 5 in this fragment, the result showing that the Cas9 protein cut the fragment was confirmed.
  • DNA was extracted from colon cancer cells (HT29, SW480, SNU407) cells, and template fragments were prepared by PCR using Foward primer: TGAAGTACAGTTCATTACGATACACG and Reverse primer: GGAAAGTAAAGTTCCCATATTAATGGT.
  • Foward primer TGAAGTACAGTTCATTACGATACACG
  • Reverse primer GGAAAGTAAAGTTCCCATATTAATGGT.
  • the sequence of the template fragment was analyzed by requesting a sequencing service from Bioneer. Analysis results are shown in Figure 1, the gene Exon 2 times of KRAS, codon No. 12 in the top spot HT29 cells, SW480 cells and cells SNU407 has taken place to determine the KRAS mutation has occurred.
  • sgRNA 1 SEQ ID NO: 1
  • sgRNA 2 SEQ ID NO: 2
  • pCas plasmid SEQ ID NO: 3 and SEQ ID NO: 4 were put into the pCas-Guide plasmid and treated in the cells.
  • Treated cells were collected and total RNA was extracted using Trizol (invitrogen), and cDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).
  • KRAS sense GACTGAATATAAACTTGTGGTAGTTGGA
  • KRAS antisense TCCTCTTGACCTGCTGTGTCG
  • GAPDH sense GCACCGTCAAGGCTGAGAA
  • GAPDH antisense AGGGATCTCGCTCCTGGAA
  • sgRNA 1 SEQ ID NO: 1
  • the guide RNA of SEQ ID NO: 1 was used.
  • the position of the human genomic DNA recognized by the guide RNA of SEQ ID NO: 1 or 2 is shown in Figure 7a
  • a schematic diagram is shown in Figure 7b representing a nano liposome comprising SEQ ID NO: 1, referring to this .
  • the guide RNA recognizes 20 nucleotide sequences, and the Cas9 protein cuts the PAM (protospacer adjacent motif) (TGG sequence, etc.) site, thereby repairing the cut DNA by itself. It was confirmed that 20 DNA sequences were cut out (the genomic DNA of the cells treated with the nano liposomes was directly extracted by the method of Example 1-2, and the sequencing service was requested to Bioneer Co., Ltd. as shown in FIG. 7B. Location of the truncated sequence was identified).
  • PAM protospacer adjacent motif
  • the nano liposomes of Example 2 were transferred to colon cancer cells (SW480 cells) for 24 hours in Cas9: gRNA (24.7 ⁇ g: 9.3 ⁇ g ⁇ Cas9 in total culture). Confocal fluorescence micrographs are shown in FIG. 6 by immunostaining with an antibody against Cas9 after treatment at concentrations of 24.7 ⁇ g and 9.3 ⁇ g gRNA). At this time, the drugs that can block the influx process were treated in colon cancer cells, respectively, and identified as a comparison group.
  • Cas9 protein of CFL-488 was used to label intracellular Cas9 protein and image it with confocal fluorescence microscopy.
  • the results are shown in Figure 6 representatively containing the guide RNA of SEQ ID NO: 1.
  • DIC is an electron image photograph of a cell
  • DAPI is a DNA staining photograph
  • Cas9 is a CFL-488 staining photograph of the Cas9 protein
  • Merge is an image photograph combining all of them.
  • the cells were treated with genistein (400 ⁇ M), chlorpromazine (20 ⁇ g / ml), nocodazole (100 ⁇ M), cytochalasin B (10 ⁇ M), and then incubated at 37 ° C. for 30 minutes.
  • the nano liposomes of Example 2 were treated to see intracellular inhalation.
  • the control shows that RITC and Cas9 proteins are well injected into the nucleus of colorectal cancer cells due to the nanoliposome treatment of Example 2, and drug treatment groups such as genistein, chloropromazine, nocodazole, and cells Intracellular inhalation of the drug is inhibited at 4 ° C. in which no energy is used.
  • drug treatment groups such as genistein, chloropromazine, nocodazole, and cells
  • Intracellular inhalation of the drug is inhibited at 4 ° C. in which no energy is used.
  • the nanoliposome of the present invention can be confirmed that the intracellular intake of clathrin-dependent intracellular inhalation, macrophage, and energy dependence. have.
  • actin filaments due to phagocytosis and membrane ruffling, which encircle the particles as part of the membrane protrudes out of the cell's surface filament polymerizes the macromolecules (macropinocytosis) that actively inhales the particles, chlartrin-mediated endocytosis using the protein called clastrin on the cytoplasm, cholesterol and caveolin Caveolin-dependent endocytosis using high concentrations of membrane proteins, and clarinet and caveolin independent endocytosis without proteins such as clathrin and caveolin.
  • actin filaments due to phagocytosis and membrane ruffling, which encircle the particles as part of the membrane protrudes out of the cell's surface filament polymerizes the macromolecules (macropinocytosis) that actively inhales the particles, chlartrin-mediated endocytosis using the protein called clastrin on the cytoplasm, cholesterol and caveolin Caveolin-dependent endocytosis using high
  • genistein interferes with caveolin-dependent intracellular inhalation
  • chloropromazine interferes with claslin-dependent intracellular intake
  • nocodazole inhibits phagocytosis
  • cytochalasin B inhibits phagocytosis.
  • cells do not use energy and thus can inhibit energy intake in a cell-dependent manner (Dos Santos T et al., 2011).
  • Each of the liposomes prepared in the present invention was treated with colorectal cancer cells (HT29, SW480, SNU407) at a concentration of Cas9: gRNA (24.7 ⁇ g: 9.3 ⁇ g) for 24 hours, and then total cells were collected using Trizol (invitrogen). RNA was extracted and cDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).
  • KRAS sense GACTGAATATAAACTTGTGGTAGTTGGA
  • KRAS antisense TCCTCTTGACCTGCTGTGTCG
  • GAPDH sense GCACCGTCAAGGCTGAGAA
  • GAPDH antisense AGGGATCTCGCTCCTGGAA
  • the group was further treated for 24 hours with Cetuximab (10 ⁇ g / mL) by replacing the culture solution after 24 hours of nano liposome treatment.
  • Cetuximab (10 ⁇ g / mL) for 24 hours, cells were collected, the cells were treated with RIPA Buffer (Sigma), and the protein was extracted and the expression of the protein was confirmed.
  • Each protein is responsible for the anti-Ras (rabbit), anti-p- signal transduction relationships between Ras, phosphorylated Erk1 / 2, and phosphorylated Akt, according to Cetuximab-related cell signaling ( Figure 7e and 7f) in colorectal cancer cells.
  • Akt rabbit
  • anti-p-Erk1 / 2 rabbit
  • anti-GAPDH mouse
  • KRAS Ras instead of only recognizing antibodies Antibodies that recognize the total protein of the family (KRAS, NRAS, HRAS) was used, the nano liposome of the present invention is KRAS Because it only affects protein expression, the amount of protein reduced after nanoliposomal treatment in the entire Ras protein is consistent with the amount of KRAS reduction.
  • the degree of phosphorylation of Erk 1/2 and Akt protein was significantly reduced in colorectal cancer cells treated with only the nanoliposomes of Cetuximab Example 2, and thus, the nanoliposomes of the present invention were KRAS in colorectal cancers resistant to Cetuximab. It is found to control the expression process.
  • EGFR a receptor called EGFR is present in the cell membrane, which forms a dimer by the EGFR ligand, thereby signaling lower proteins (PI3K, KRAS) by auto-phosphorylation.
  • PI3K protein phosphorylates Akt protein, which affects the survival of cells
  • KRAS protein phosphorylates Erk protein, indicating that it affects the proliferation of cancer cells.
  • FIG. 7E b is Cetuximab, an antibody therapeutic drug developed to inhibit the proliferation of colorectal cancer cells as in a of FIG. 7E, which binds to EGFR and blocks EGFR from forming dimers.
  • PI3K or KRAS which is a sub-protein that receives the signal of, does not work.
  • FIG. 7F illustrates a process of inhibiting KRAS protein in colorectal cancer cells by delivering a nanoliposome containing the RNA of the Cas9 protein and the KRAS gene of Example 2 to the cell.
  • FIG. 7F the treatment of Cetuximab in colorectal cancer cells genetically edited by nanoliposomes blocks two cellular signaling processes as shown in b of FIG. 7E, and thus the effect of Cetuximab can be seen in colorectal cancer patients with KRAS mutations.
  • FIG. 7F the treatment of Cetuximab in colorectal cancer cells genetically edited by nanoliposomes blocks two cellular signaling processes as shown in b of FIG. 7E, and thus the effect of Cetuximab can be seen in colorectal cancer patients with KRAS mutations.
  • Figure 8a is a result for the cell experimental group treated with only Cetuximab
  • Figure 8b is a result for the cell experimental group treated with Cetuximab after the nano liposome of Example 2 of the present invention
  • the nano liposome of Example 2 Survival and proliferation of SW480 and SNU407 cells with the treated KRAS mutant gene were significantly reduced.
  • each concentration display in the graphs of FIGS. 8A and 8B means a treatment concentration of Cetuximab.
  • the nano liposomes of Comparative Example 1 and the nano liposomes of Example 2 were treated with SW9 cells at a concentration of Cas9: gRNA (24.7 ⁇ g: 9.3 ⁇ g) and replaced with medium treated with 10 ⁇ g / mL of Cetuximab after 24 hours.
  • An array kit (R & D Systems Inc, ARY009) was used to confirm the expression of apoptosis-related proteins.
  • the control of the nano liposomes of Comparative Example 1 is to compare the apoptosis does not occur by the nano liposomes themselves.
  • Cleaved caspase-3 protein is a truncated form of pro-caspase-3 and is the final protein produced during apoptosis. This is a protein that plays an important role in the apoptosis process.
  • the increase of cleaved caspase-3 protein indicates that apoptosis progresses.
  • the Fas / TNFRSF6 / CD95 protein indicates that apoptosis has progressed due to an external signal
  • the SMAC / Diablo and HTRA2 / Omi proteins also play a role in inhibiting anti-apoptosis proteins. You can see that this is done. Therefore, it can be seen that when Cetuximab is treated with the nanoliposomes of the present invention, the death of colorectal cancer cells having drug resistance to Cetuximab is effectively performed.
  • Caspase-3 activity Caspase-3 assay kit (Cell Signaling) was confirmed using.
  • the nano liposomes of Example 2 were treated with colorectal cancer cells (HT29, SW480, SNU407) at a concentration of Cas9: gRNA (24.7 ⁇ g: 9.3 ⁇ g) for 24 hours, and then replaced with medium containing Cetuximab (10 ⁇ g). Treated for hours. Thereafter, the protein was extracted from each cell, 200 ⁇ l of 1x assay buffer A and substrate solution B were added to the extracted protein, mixed, and reacted at 37 ° C. for 30 minutes. After the reaction, the activity was measured by measuring the fluorescence value at excitation 380 nm and emission 440 nm.
  • the total amount of Cas9 protein added at the start of the synthesis of the nano liposomes and the amount of Cas9 protein remaining in the filtrate after the synthesis of the nano liposomes were measured by Western blot experiment to confirm the encapsulation efficiency of the nano liposomes.
  • Western blot experiments were conducted with only Cas9 protein. Encapsulation efficiency of the nano liposomes is easily confirmed by comparing the content of the Cas9 protein remaining in the filtrate remaining after the preparation of the nano liposomes.
  • Table 4 shows the numerical results of Figure 11, the encapsulation efficiency of the hybrids or complexes containing the guide RNA was the best in the nano liposomes of Example 2 and Comparative Example 4 (without binding to the antibody / linker only) (Cas9 protein was not added in the preparation of nano liposomes of Comparative Example 1, so no Cas9 protein was also identified in the filtrate.)
  • Example 2 -2.09 90-1100 330 Comparative Example 2 -4.08 50 ⁇ 150, 800 ⁇ 4300 981 Comparative Example 3 -7.89 60 ⁇ 140, 1100 ⁇ 5200, 7800 ⁇ 8200 420 Comparative Example 4 -2.25 90-1100 411
  • the nano liposomes of Example 2 belong to the lower surface charge value.
  • the nano liposome condition of Comparative Example 2 also has a low surface charge, but it is confirmed that the dispersion degree is lowered with time, so that the stability of the nano liposome is not good (dispersion degree is not shown in the table).
  • the particle size of the nano liposomes also compared to the nano liposomes of Example 2 and Comparative Example 4 it can be seen that the nano liposomes of Comparative Example 2 and Comparative Example 3 is not uniform in size distribution.

Abstract

The present invention relates to a nano-liposomal carrier composition in which a complex including a Cas9 protein, a guide RNA inhibitory of KRAS gene expression, and a cationic polymer is loaded, or a therapeutic agent comprising the same for colorectal cancer resistant to anticancer agents due to KRAS gene mutation therein. Cetuximab, which is used as a therapeutic agent for metastatic colorectal cancer at present, is effective only for patients with KRAS wild-type colorectal cancer. Cetuximab has the fatal drawback in that given a continual treatment with cetuximab, even patients with KRAS wild-type colorectal cancer may develop KRAS mutant colorectal cancer in 60-80% cases. However, the use of the nano-liposomal composition of the present invention can not only fundamentally suppress the mutation of KRAS, which is an oncogene in colorectal cancer, but also very effectively treat KRAS mutant metastatic colorectal cancer.

Description

Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암 치료제Nanoliposomal carrier composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer or anticancer agent resistant colorectal cancer therapeutic agent according to KRAS gene mutation containing same
본 발명은 Cas9 단백질, 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. 보다 자세하게는 본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암의 개선 또는 치료용 조성물에 관한 것이다. The present invention relates to nanoliposome delivery compositions encapsulated with a complex of Cas9 protein, guide RNA and cationic polymer. More specifically, the present invention provides a nanoliposome delivery composition or KRAS containing a complex containing a complex of Cas9 protein, guide RNA and cationic polymer that inhibit expression of KRAS gene. It relates to a composition for improving or treating anti-cancer drug-resistant colorectal cancer according to genetic variation.
유전자 편집 기술은 미생물의 적응면역에서 비롯된 기술이다. 박테리오파지 감염에 박테리오파지의 단편을 DNA로 기억하고 있다가 재감염 되었을 때 유전자 가위 역할을 하는 누클레아제(nuclease)인 Cas9(CRISPR associated protein 9 : RNA-guided DNA endonuclease enzyme)으로 잘라 없애는 면역 시스템에서 시작되었다. 이는 유전체에서도 특정 염기 서열을 가이드 RNA(guide RNA, gRNA)에 의해서 인식 가능하면 원하는 부위를 잘라 고칠 수 있는 유전자 교정 기술로 발전하였다(Woo JW et al., 2015).Gene editing technology originates from the adaptive immunity of microorganisms. In the immune system, a fragment of bacteriophage is remembered as DNA for bacteriophage infection and then cut and removed by Cas9 ( C- RISPR as sociated protein 9 : RNA-guided DNA endonuclease enzyme), a nuclease that acts as a genetic scissors when reinfected. Started. This has evolved into a genetic correction technique that can cut and fix a desired site if a specific base sequence can be recognized by a guide RNA (gRNA) in the genome (Woo JW et al., 2015).
이는 불치병으로 분리되었던 유전자 이상으로 유도된 질환에서 질병의 근본원인을 치료할 수 있는 방법으로 각광받고 있다. 하지만 유전자 편집 시스템의 효율적인 체내 전달과 목표 유전자가 아닌 다른 유전자를 자르는 off targeting 등의 해결해야 하는 문제점들을 가지고 있다. 특히 초기 방식인 Cas9 플라스미드를 사용한 유전자 편집 시스템은 체내 전달시의 항생제 저항성, 여러 면역 반응 등의 안전성에 대한 검증이 필요하였다. 최근에는 단백질로 이뤄진 유전자 가위(Cas9)와 가이드 RNA를 실험관내에서 만들어 전달하는 시스템이 그 대안으로 적용되고 있으나 이 또한 세포내 효율적인 전달과 단백질과 RNA의 안정성에 대한 문제가 제기되고 있다(Ramakrishna S et al., 2014). This is in the spotlight as a way to treat the root cause of the disease in diseases induced by gene abnormalities that were separated into incurable diseases. However, there are problems to be solved, such as efficient intracellular delivery of gene editing systems and off targeting to cut genes other than target genes. In particular, the gene editing system using the Cas9 plasmid, which is an early method, required verification of safety of antibiotic resistance and various immune responses in the body delivery. Recently, a system for making and delivering protein scissors (Cas9) and guide RNA made in vitro has been applied as an alternative, but this also raises the issue of efficient intracellular delivery and stability of proteins and RNA (Ramakrishna S). et al., 2014).
대장암은 대장에 생긴 암세포로 이루어진 악성 종양을 말한다. 대장은 소장에서 넘어온 음식물로부터 수분을 모두 흡수 한 뒤 직장에 모아 두었다가 대변의 형태로 배설시키는 역할을 하고 있기 때문에 영양 성분 보다는 발암 물질을 포함하는 노폐물이나 우리 몸에서 불필요한 물질들이 대장에 모여 상대적으로 다른 기관에 비해 암세포가 자라기 쉽다. Colon cancer is a malignant tumor consisting of cancerous cells of the large intestine. The large intestine absorbs all the water from food from the small intestine, collects it in the rectum, and then excretes it in the form of feces. Cancer cells are easier to grow than organs.
기존 대장암 치료는 외과적인 수술과 항암화학요법이 이루어지는데, 대표적 표적 치료 요법으로 'Cetuximab(Erbitux) 주사제'가 쓰이고 있다. Cetuximab은 표피성장인자수용체(Epidermal growth factor receptor, EGFR)를 표적으로 하는 단일클론항체로 대장암 세포 표면의 EGFR에 특이적으로 결합하여, 암세포 증식을 일으키는 신호 전달 과정 중 특정 부분을 억제하여 암세포의 전반적인 증식을 억제한다. 하지만 대장암 유발 유전자인 KRAS에 돌연변이를 가지고 있는 환자(전체 대장암 환자의 40~50%)들은 이 주사제로 치료가 어렵다. 또한, KRAS 유전자가 정상적인 대장암 환자이더라도 지속적으로 Cetuximab 치료를 받게 되면, 60~80%가 KRAS 유전자에 돌연변이가 생긴다. Conventional colorectal cancer treatment includes surgical surgery and chemotherapy, and 'Cetuximab (Erbitux) injection' is used as a representative target therapy. Cetuximab is a monoclonal antibody targeting Epidermal Growth Factor Receptor (EGFR) that specifically binds to EGFR on the surface of colorectal cancer cells, inhibiting certain parts of the signal transduction process that causes cancer cell proliferation. Suppress overall proliferation. However, patients who have mutations in the KRAS gene, a gene that causes colorectal cancer (40-50% of all colorectal cancer patients), cannot be treated with this injection. In addition, even if the KRAS gene is a normal colorectal cancer patient, if Cetuximab treatment is continued, 60-80% of the KRAS genes will be mutated.
KRAS 유전자는 대장암의 발생에 연관된 여러 유전자 중 하나이며, Cetuximab과 같은 맞춤치료의 효과 여부를 판단하기 위해 본 유전자의 돌연변이 여부로 대장암 환자의 약물의 반응 및 생존 기간을 의미 있게 개선시키는 것으로 알려져 있어 매우 중요하게 여겨지고 있다. The KRAS gene is one of several genes involved in the development of colorectal cancer, and the mutation of this gene is known to significantly improve the response and survival of drugs in colorectal cancer patients to determine the effectiveness of custom treatments such as Cetuximab. It is considered very important.
한편 세포 내 약물 전달 시스템에서 요구되는 중요 두가지 성질은 효율성과 세포 독성(안전성)으로서, 콜레스테롤이나 지질 등으로 구성된 나노 리포좀 전달체 기술이 폭넓게 사용되고 있다(Zuris JA et al., 2015). Two important properties required for intracellular drug delivery systems are efficiency and cytotoxicity (safety), and nanoliposome carrier technology consisting of cholesterol and lipids is widely used (Zuris JA et al., 2015).
이에 본 발명자들은 유전자 편집을 통한 대장암 치료를 위해 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 나노 리포좀에 봉입함으로써 약물전달 효율이 좋은 세포 전달체를 제조하고, 이를 대장암 체료제로서 이용함으로써 본 발명을 완성할 수 있었다. Accordingly, the present inventors prepared a cell delivery agent having high drug delivery efficiency by encapsulating a complex of Cas9 protein, guide RNA and cationic polymer that inhibit expression of KRAS gene in nano liposomes for treatment of colorectal cancer through gene editing. The present invention was completed by using it as a cancer medicament.
[선행기술문헌[Preceding technical literature
(특허문헌 1) 대한민국 공개특허 제10-2015-0101476호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)(Patent Document 1) Korean Unexamined Patent Publication No. 10-2015-0101476 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
(특허문헌 2) 대한민국 공개특허 제10-2015-0101477호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)(Patent Document 2) Korean Unexamined Patent Publication No. 10-2015-0101477 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
(특허문헌 3) 대한민국 공개특허 제10-2015-0101478호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일) (Patent Document 3) Korean Patent Publication No. 10-2015-0101478 (Invention name: Composition for cutting target DNA, including nucleic acid or Cas protein encoding guide RNA and Cas protein specific for target DNA and its Use, Applicant: Toulzen Co., Ltd., Publication Date: September 03, 2015)
(비특허문헌 1) Belov L et al., Cell surface markers in colorectal cancer prognosis, Int J Mol Sci, 2010, 12(1), 78-113.(Non-Patent Document 1) Belov L et al., Cell surface markers in colorectal cancer prognosis, Int J Mol Sci, 2010, 12 (1), 78-113.
(비특허문헌 2) Dos Santos T et al., Effects of transport inhibitors on the cellular uptake of carboxylated polystyrene nanoparticles in different cell lines, PLoS One, 2011, 6(9):e24438.(Non-Patent Document 2) Dos Santos T et al., Effects of transport inhibitors on the cellular uptake of carboxylated polystyrene nanoparticles in different cell lines, PLoS One, 2011, 6 (9): e24438.
(비특허문헌 3) Dow LE et al., Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer, Cell, 2015, 161(7), 1539-1552.(Non-Patent Document 3) Dow LE et al., Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer, Cell, 2015, 161 (7), 1539-1552.
(비특허문헌 4) Lee J et al., Effect of simvastatin on Cetuximab resistance in human colorectal cancer with KRAS mutations, J Natl Cancer Inst, 2011, 103(8), 674-688.(Non-Patent Document 4) Lee J et al., Effect of simvastatin on Cetuximab resistance in human colorectal cancer with KRAS mutations, J Natl Cancer Inst, 2011, 103 (8), 674-688.
(비특허문헌 5) Lievre et al., KRAS mutation status is predictive of response to Cetuximab therapy in colorectal cancer, Cancer Res, 2006, 66(8), 3992-3995.(Non-Patent Document 5) Lievre et al., KRAS mutation status is predictive of response to Cetuximab therapy in colorectal cancer, Cancer Res, 2006, 66 (8), 3992-3995.
(비특허문헌 6) Matano M et al., Modeling colorectal cancer using CRISPR-Cas9-mediated engineering of human intestinal organoids, Nat Med, 2015, 21(3), 256-262.(Non-Patent Document 6) Matano M et al., Modeling colorectal cancer using CRISPR-Cas9-mediated engineering of human intestinal organoids, Nat Med, 2015, 21 (3), 256-262.
(비특허문헌 7) Montagut C et al., Identification of a mutation in the extracellular domain of the Epidermal Growth Factor Receptor conferring Cetuximab resistance in colorectal cancer, Nat Med, 2012, 18(2), 221-223.(Non-Patent Document 7) Montagut C et al., Identification of a mutation in the extracellular domain of the Epidermal Growth Factor Receptor conferring Cetuximab resistance in colorectal cancer, Nat Med, 2012, 18 (2), 221-223.
(비특허문헌 8) Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24(6), 1020-1027.(Non-Patent Document 8) Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24 (6), 1020-1027.
(비특허문헌 9) Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33(11), 1162-1164.(Non-Patent Document 9) Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33 (11), 1162-1164.
(비특허문헌 10) Zuris JA et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33(1), 73-80.(Non-Patent Document 10) Zuris JA et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33 (1), 73-80.
본 발명의 목적은 Cas9 단백질, 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물을 제공하는 데에 있다. 보다 자세하게는 본 발명의 목적은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암의 개선 또는 치료용 조성물을 제공하는 데에 있다. An object of the present invention is to provide a nano liposome delivery composition containing a complex of Cas9 protein, guide RNA and cationic polymer. More specifically, an object of the present invention is to improve or treat the anti-cancer drug-resistant colorectal cancer according to the KRAS gene mutations containing the nano-liposomal delivery composition containing the complex of the Cas9 protein, guide RNA that inhibits the expression of the KRAS gene and cationic polymer It is to provide a composition for.
본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. The present invention relates to a nanoliposome delivery composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer.
상기 KRAS 유전자의 발현을 억제하는 가이드 RNA는 서열번호 1 또는 2의 염기서열을 포함할 수 있다. Guide RNA for inhibiting the expression of the KRAS gene may comprise a nucleotide sequence of SEQ ID NO: 1 or 2.
상기 나노 리포좀은 레시틴, 콜레스테롤, 양이온성 인지질 및 메탈 킬레이팅 지질을 포함할 수 있다. The nano liposomes may comprise lecithin, cholesterol, cationic phospholipids and metal chelating lipids.
상기 나노 리포좀에는 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합될 수 있다. The nano liposomes may recognize one or more proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epithelial cell adhesion molecule (EpCAM), carcinoembryonic antigen (CEA), and annexin (Annexins) expressed in colorectal cancer cells. Monoclonal or polyclonal antibodies can be combined.
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. The nano liposomes may have a particle size of 10 ~ 2,000 nm.
본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 대장암의 개선 또는 치료용 조성물을 제공할 수 있다. The present invention can provide a composition for improving or treating colorectal cancer containing the nano-liposomal delivery composition.
상기 대장암의 개선 또는 치료용 조성물에는 세툭시맵(Cetuximab)이 첨가될 수 있다. Cetuximab may be added to the composition for improving or treating colorectal cancer.
본 발명은 또한 하기와 같은 대장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법을 제공한다. The present invention also provides a method for preparing a nanoliposome transporter composition capable of selectively recognizing colon cancer cells as follows.
바람직하게는, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 제조하고, 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; Preferably, a preparation for preparing a lipid film composition by preparing a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipid on chloroform Stage 1;
상기 지질 필름 조성물에, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 넣어 초음파 처리하는 제2단계; A second step of sonicating the lipid film composition by inserting a complex of a Cas9 protein, a guide RNA that inhibits the expression of the KRAS gene, and a cationic polymer;
상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계;A third step of freezing and melting the sonicated lipid film composition and then again ultrasonicating;
상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및,A fourth step of centrifuging the lipid film composition sonicated in the third step and recovering the nano liposomes in the precipitate; And,
상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제5단계; A fifth step of binding the antibody to the nano liposome in the precipitate obtained in the fourth step through a crosslinking agent;
를 포함할 수 있다. It may include.
이하 본 발명을 보다 자세하게 설명한다. Hereinafter, the present invention will be described in more detail.
본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. The present invention relates to a nanoliposome delivery composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer.
상기 Cas9 단백질은 pET28a/Cas9-Cys 플라스미드(pET28a(+) 벡터에 Cas9-Cys가 삽입된 것)가 형질전환된 세포 또는 균주에서 획득할 수 있다. 바람직하게는 pET28a/Cas9-Cys 플라스미드를 대장균에 형질전환하여 Cas9 단백질을 과발현하여 얻을 수 있다. The Cas9 protein may be obtained from a cell or strain transformed with a pET28a / Cas9-Cys plasmid (in which Cas9-Cys is inserted into a pET28a (+) vector). Preferably, pET28a / Cas9-Cys plasmid can be obtained by transforming Escherichia coli overexpressing Cas9 protein.
본 발명에서 적용할 수 있는 가이드 RNA는 하기의 서열번호 1 또는 2의 염기서열을 포함하는 가이드 RNA이며, 이러한 가이드 RNA가 포함된 나노 리포좀 전달체 조성물은 KRAS 정상 유전자 또는 돌연변이 유전자의 발현을 억제하여 대장암을 개선 또는 치료할 수 있는 기능을 한다. Guide RNA that can be applied in the present invention is a guide RNA comprising a nucleotide sequence of the following SEQ ID NO: 1 or 2, the nano liposome carrier composition comprising such a guide RNA inhibits the expression of KRAS normal gene or mutant gene colon Function to improve or treat cancer
서열번호 1 : CUGAAUUAGCUGUAUCGUCA SEQ ID NO: 1 CUGAAUUAGCUGUAUCGUCA
서열번호 2 : GAAUAUAAACUUGUGGUAGU SEQ ID NO: 2 GAAUAUAAACUUGUGGUAGU
상기 서열번호 1의 가이드 RNA는 하기의 서열번호 3의 사람(Homo sapiens) KRAS의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 5의 KRAS의 일부 DNA 염기서열을 타겟으로 한다(서열번호 3과 서열번호 5는 상보적인 염기서열을 가짐). 상기 서열번호 2의 가이드 RNA는 하기의 서열번호 4의 KRAS의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 6의 KRAS의 일부 DNA 염기서열을 타겟으로 한다(서열번호 4와 서열번호 6은 상보적인 염기서열을 가짐). The guide RNA of SEQ ID NO: 1 is derived from a partial DNA nucleotide sequence of human ( Homo sapiens ) KRAS of SEQ ID NO: 3 below, and targets a partial DNA nucleotide sequence of KRAS of SEQ ID NO: 5 (SEQ ID NO: 3 And SEQ ID NO: 5 have complementary nucleotide sequences). Will of the SEQ ID NO: 2 of the guide RNA is derived from a part of the DNA sequence of the KRAS of SEQ ID NO: 4, and some DNA sequence of the KRAS of SEQ ID NO: 6 to a target (SEQ ID NO: 4 and SEQ ID NO: 6 Having complementary sequences).
서열번호 3 : CTGAATTAGCTGTATCGTCA SEQ ID NO: 3 CTGAATTAGCTGTATCGTCA
서열번호 4 : GAATATAAACTTGTGGTAGT SEQ ID NO: 4 GAATATAAACTTGTGGTAGT
서열번호 5 : TGACGATACAGCTAATTCAG SEQ ID NO: 5 TGACGATACAGCTAATTCAG
서열번호 6 : CTTATATTTGAACACCATCA SEQ ID NO: 6 CTTATATTTGAACACCATCA
상기 서열번호 1 또는 2의 가이드 RNA 염기서열 이후에는 Cas9 단백질과 복합체를 형성하기 위해 스캐폴드 염기서열(scaffold sequence)이 포함될 수 있다. 이 때 스캐폴드 염기서열의 종류는 크게 제한되지 않으며, 가이드 RNA의 제조에 이용되는 통상적인 염기서열이라면 어떤 것이든지 사용될 수 있다. After the guide RNA nucleotide sequence of SEQ ID NO: 1 or 2, a scaffold sequence may be included to form a complex with the Cas9 protein. At this time, the type of scaffold base sequence is not particularly limited, and any base sequence can be used as long as it is a conventional base sequence used for the production of guide RNA.
따라서, 본 발명의 나노 리포좀에 적용되는 가이드 RNA는 하기의 Therefore, the guide RNA applied to the nano liposome of the present invention is
서열번호 7 : SEQ ID NO: 7
CUGAAUUAGCUGUAUCGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU CUGAAUUAGCUGUAUCGUCA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
또는, 서열번호 8 :Or SEQ ID NO:
GAAUAUAAACUUGUGGUAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU GAAUAUAAACUUGUGGUAGU GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
가 적용된 나노 리포좀을 제공할 수 있다. Nano liposomes can be applied.
상기 서열번호 1 또는 2의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 5 또는 6의 DNA 염기서열은 사람의 상기 서열번호 1 또는 2의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 5 또는 6의 DNA 염기서열은 KRAS (Homo sapiens Chromosome 12, Genbank No. NC_000012.12)의 Exon2에 존재하는 염기서열이며, 서열번호 1 또는 2의 가이드 RNA를 통해 상기 Exon2의 DNA가 잘려지게 된다. The DNA base sequence of SEQ ID NO: 5 or 6 targeted by the base sequence of the guide RNA of SEQ ID NO: 1 or 2 is the sequence of SEQ ID NO: 5 or 6 targeted by the base sequence of the guide RNA of SEQ ID NO: 1 or 2 of human The DNA sequence is a nucleotide sequence present in Exon2 of KRAS ( Homo sapiens Chromosome 12, Genbank No. NC_000012.12), and the DNA of Exon2 is cut through the guide RNA of SEQ ID NO: 1 or 2.
상기 KRAS 유전자의 돌연변이는 인간 게놈 DNA의 KRAS exon 2의 codon 12번 서열에서 일어나며, 이를 대장암 세포인 SW480, SNU407 세포주에서 확인하여 도 1a와 도 1b에 모식화하여 나타내었다. Mutation of the KRAS gene occurs in the codon 12 sequence of KRAS exon 2 of human genomic DNA, which was identified in the SW480 and SNU407 cell lines, which are colon cancer cells, and is schematically shown in FIGS. 1A and 1B.
상기 서열번호 1, 2, 7, 8의 가이드 RNA는 T7 RNA 폴리머라아제(polymerase)를 사용한 시험관 내 전사 반응 과정(in vitro transcription)을 통하여 합성할 수 있다.The guide RNAs of SEQ ID NO: 1, 2, 7, 8 can be synthesized through in vitro transcription using a T7 RNA polymerase.
상기 양이온성 폴리머로서 바람직하게는 폴리-L-리신, 폴리아미도아민, 폴리[2-(N,N-디메틸아미노)에틸 메타아크릴레이트], 키토산, 폴리-L-오르니틴, 시클로덱스트린, 히스톤, 콜라겐, 덱스트란 및 폴리에틸렌이민으로 선택되는 것 1종 이상이 사용될 수 있으며, 가장 바람직하게는 폴리에틸렌이민이 사용될 수 있다. The cationic polymer is preferably poly-L-lysine, polyamidoamine, poly [2- (N, N-dimethylamino) ethyl methacrylate], chitosan, poly-L-ornithine, cyclodextrin, histone, One or more selected from collagen, dextran and polyethyleneimine may be used, most preferably polyethyleneimine.
상기 나노 리포좀은 레시틴(lecithin, α-phosphatidylcholin), 양이온성 인지질, 콜레스테롤 및 메탈 킬레이팅 지질을 포함할 수 있으며, 이를 통해, 상기 레시틴, 양이온성 인지질, 콜레스테롤 및 메탈 킬레이팅 지질이 나노 리포좀을 형성하는 막을 이룰 수 있다. The nano liposomes may include lecithin (α-phosphatidylcholin), cationic phospholipids, cholesterol and metal chelating lipids, whereby the lecithin, cationic phospholipids, cholesterol and metal chelating lipids form nano liposomes. This can be done.
레시틴은 동/식물계에 널리 분포되어 있어 생체 적합성이 우수하며 그 안정성에 있어서도 이미 검증되어 식품과 제약의 전달체 기술에 널리 활용되고 있다. 또한 나노 리포좀의 크기 조절과 변형을 용이하게 하는 재료로 사용될 수 있다. Lecithin is widely distributed in animal and plant systems, so it has excellent biocompatibility and has already been proven in its stability, and has been widely used in food and pharmaceutical delivery technologies. It can also be used as a material to facilitate the size control and modification of nano liposomes.
상기 양이온성 인지질은 디올레오일 포스파티딜에탄올아민(DOPE), 1,2-디피타노일-sn-글리세로-3-포스포에탄올아민(DPhPE), 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민(DSPE), 1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민(DPPE) 및 1,2-디올레오일-sn-글리세로-3-포스포콜린(DOPC)로 이루어진 군으로부터 1종 이상 선택될 수 있다. 바람직하게는 1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민(DPPE)을 사용하는 것이 좋다. The cationic phospholipids are dioleoyl phosphatidylethanolamine (DOPE), 1,2-dipitanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,2-distearoyl-sn-glycer Rho-3-phosphoethanolamine (DSPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) and 1,2-dioleoyl-sn-glycero-3- It may be selected from the group consisting of phosphocholine (DOPC). Preferably, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) is used.
메탈 킬레이팅 지질로는 바람직하게는 DOGS-NTA-Ni 지질, DMPE-DTPA-Gd 지질, DMPE-DTPA-Cu 지질로 이루어진 군 중에서 선택되는 1종 이상을 사용할 수 있다. 상기 DOGS-NTA-Ni 지질은 하기의 화학식 1의 화학구조를 갖는 지질로서,As the metal chelating lipid, at least one selected from the group consisting of DOGS-NTA-Ni lipid, DMPE-DTPA-Gd lipid, and DMPE-DTPA-Cu lipid can be used. The DOGS-NTA-Ni lipid is a lipid having the chemical structure of Formula 1,
[화학식 1] [Formula 1]
Figure PCTKR2017014453-appb-I000001
Figure PCTKR2017014453-appb-I000001
1,2-디올레오일-sn-글리세로-3-[(N-(5-아미노-1-카르복시펜틸)이미노디아세트산)숙시닐](니켈염)이라 한다. 1,2- dioleoyl - sn -glycero-3-[(N- (5-amino-1-carboxypentyl) iminodiacetic acid) succinyl] (nickel salt).
*1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl](nikel salt) * 1,2-dioleoyl- sn -glycero-3-[(N- (5-amino-1-carboxypentyl) iminodiacetic acid) succinyl] (nikel salt)
DMPE-DTPA-Gd 지질은 하기의 화학식 2의 화학구조를 갖는 지질로서,DMPE-DTPA-Gd lipid is a lipid having the chemical structure of Formula 2,
[화학식 2][Formula 2]
Figure PCTKR2017014453-appb-I000002
Figure PCTKR2017014453-appb-I000002
1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(가돌리늄염)이라 한다. 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt).
*1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(gadolinium salt)* 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt)
DMPE-DTPA-Cu 지질은 하기의 화학식 3의 화학구조를 갖는 지질로서,DMPE-DTPA-Cu lipid is a lipid having the chemical structure of Formula 3
[화학식 3][Formula 3]
Figure PCTKR2017014453-appb-I000003
Figure PCTKR2017014453-appb-I000003
1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(구리염)이라 한다. 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (copper salt).
*1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(copper salt)* 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (copper salt)
상기 DOGS-NTA-Ni 지질은 단백질 정제 방법에서 사용되는 His-Tag(6X histidin)과 Ni2 + 친연성(affinity)을 활용하여 Cas9 단백질(His-Tag 포함된 것)이 효과적으로 나노 리포좀 내부로 봉입(encapsulation)되게 하는 역할을 할 수 있다. 더 자세하게는 상기 DOGS-NTA-Ni은 18개의 탄소에 이중결합이 1개 있는 구조로 레시틴과 함께 지질(lipid)를 형성할 수 있고, 끝에 Ni2 +가 결합되어 있어, Cas9 단백질에 붙어있는 His-tag 2개와 Ni2 + 1개가 결합하여 Cas9 단백질이 좀 더 효율적으로 나노 리포좀 안으로 봉입되게 한다. DMPE-DTPA-Gd 지질과 DMPE-DTPA-Cu 지질 또한 이와 동일한 역할을 하며 Cas9 단백질이 포함된 복합체의 나노 리포좀 내 봉입을 효과적으로 유도한다. The DOGS-NTA-Ni lipids are encapsulated into the nano-liposomes (that contained His-Tag) to take advantage of the His-Tag (6X histidin) and Ni 2 + chinyeonseong (affinity) that is used in the protein purification methods Cas9 protein is efficiently ( encapsulation). More specifically His in the DOGS-NTA-Ni may form a lipid (lipid) along with the lecithin with one double bond structures in the 18 carbon, at the end there is Ni 2 + is coupled, attached to Cas9 protein dog 2 dog coupled -tag Ni 2 + 1 to Cas9 causes the protein encapsulated in nanoliposomes more effectively. DMPE-DTPA-Gd lipids and DMPE-DTPA-Cu lipids also play the same role, effectively inducing the encapsulation of nanoliposomes in complexes containing Cas9 proteins.
본 발명의 나노 리포좀 내에는 서열번호 1의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질과, 서열번호 2의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질이 혼재되어 존재할 수도 있다. In the nano liposome of the present invention, a Cas9 protein coupled with a guide RNA comprising a nucleotide sequence of SEQ ID NO: 1 and a Cas9 protein coupled with a guide RNA comprising a nucleotide sequence of SEQ ID NO: 2 may be present.
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. 나노 리포좀의 크기가 10 nm 미만일 경우, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 상기 나노 리포좀에 봉입되기 어려울 수 있으며, 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. 또한 2,000 nm를 초과할 경우에도 상기 나노 리포좀이 포함된 조성물이 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. The nano liposomes may have a particle size of 10 ~ 2,000 nm. When the size of the nano liposomes is less than 10 nm, it may be difficult to encapsulate the complexes of the Cas9 protein, the guide RNA and the cationic polymer that inhibit the expression of the KRAS gene, and the stability may be lowered when injected into the body. Not desirable In addition, even if it exceeds 2,000 nm when the composition containing the nano liposomes are injected into the body it is not preferable because the stability can be lowered.
상기 나노 리포좀에는 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군 중에서 1종 이상 선택되는 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합될 수 있다. The nano liposomes may recognize proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epitope cell adhesion molecule (EpCAM), carcinoembryonic antigen (CEA), and annexin (Annexins) expressed in colorectal cancer cells. Monoclonal or polyclonal antibodies can be combined.
상기 항체를 생성하는 것은 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다. 상기 다클론성 항체는 EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질을 동물에 주사한 뒤 채혈한 혈청에서 얻을 수 있다. 상기 동물로는 염소, 토끼, 돼지 등 임의의 동물 숙주를 이용할 수 있다. 상기 단클론성 항체는, 본 발명이 속하는 기술분야에 널리 알려진 대로, 하이브리도마 방법(Kohler G. and Milstein C.), 또는, 파지 항체 라이브러리(Clackson et al.; Marks et al.) 기술을 이용하여 제조할 수 있다. 상기 하이브리도마 방법을 수행하기 위해서는 마우스와 같은 면역학적으로 적합한 숙주동물의 세포와, 암 또는 골수종 세포주를 이용할 수 있다. 이 후, 폴리에틸렌글라이콜 등을 이용하는 방법, 즉, 본 발명이 속하는 기술분야에 널리 공지된 방법으로, 이러한 두 종류의 세포들을 융합시킨 후, 항체 생산 세포를 표준적인 조직 배양방법으로 증식시킬 수 있다. 이 후, 한계 희석법(limited dilution technique)에 의한 서브클로닝에 의해 균일한 세포 집단을 얻은 후, EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질에 대해 특이적인 항체를 생산할 수 있는 하이브리도마를 표준 기술에 따라 시험관 내 또는 생체 내에서 대량 배양할 수 있다. 상기 파지 항체 라이브러리 방법은, EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질에 대한 항체 유전자를 획득하여, 이를 파지(phage)의 표면에 융합 단백질 형태로 발현하여 항체 라이브러리를 시험관 내에서 제작하고, 상기 라이브러리로부터 EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질과 결합하는 단클론성 항체를 분리 및 제작하여 수행할 수 있다. 상기 방법들에 의하여 제조된 항체는 전기영동, 투석, 이온교환 크로마토그래피, 친화 크로마토그래피 등의 방법으로 분리할 수 있다.Producing such antibodies can be readily prepared using techniques well known in the art. The polyclonal antibody may be obtained from a blood sample obtained by injecting one kind of protein such as EGFR, EpCAM, CEA, annexin, or the like into an animal. The animal may be any animal host such as goat, rabbit, or pig. The monoclonal antibodies, as is well known in the art, use hybridoma methods (Kohler G. and Milstein C.) or phage antibody library (Clackson et al .; Marks et al.) Technology. Can be prepared. In order to perform the hybridoma method, cells of an immunologically suitable host animal such as a mouse and cancer or myeloma cell line may be used. Thereafter, by using a method such as polyethylene glycol, that is, a method well known in the art to which the present invention belongs, after fusion of these two types of cells, the antibody-producing cells can be propagated by a standard tissue culture method. have. Subsequently, after obtaining a uniform cell population by subcloning by the limited dilution technique, hybridomas capable of producing antibodies specific for one protein such as EGFR, EpCAM, CEA, Annexin, etc. Mass culture can be performed in vitro or in vivo according to standard techniques. The phage antibody library method, by obtaining an antibody gene for one protein, such as EGFR, EpCAM, CEA, Annexin, and expressing it in the form of a fusion protein on the surface of the phage (phage) to produce an antibody library in vitro From the library, monoclonal antibodies that bind to one protein such as EGFR, EpCAM, CEA, Annex, and the like can be isolated and produced. Antibodies prepared by the above methods can be separated by electrophoresis, dialysis, ion exchange chromatography, affinity chromatography and the like.
상기 항체는 2개의 전체 길이 경쇄(light chain) 및 2개의 전체 길이 중쇄(heavy chain)를 가지는 완전한 형태 뿐만 아니라, 항체 분자의 기능적인 단편을 포함할 수 있다. 항체 분자의 기능적 단편이란 적어도 항원 결합기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2, F(ab)2, Fv 등이 있다.The antibody may include functional fragments of antibody molecules, as well as complete forms having two full length light chains and two full length heavy chains. The functional fragment of an antibody molecule means the fragment which has at least antigen binding function, and includes Fab, F (ab '), F (ab') 2, F (ab) 2, Fv.
본 발명에서 상기 항체는 1,4-비스-말레이미도부탄, 1,11-비스-말레이미도테트라에틸렌글리콜, 1-에틸-3-[3-디메틸 아미노프로필] 카보디이미드 하이드로클로라이드, 숙시니미딜-4-[N-말레이미도메틸시클로헥산-1-카복시-[6-아미도카프로에이트]] 및 그의 설폰화염(sulfo-SMCC), 숙시미딜 6-[3-(2-피리딜디티오)-로피오나미도] 헥사노에이트] 및 그의 설폰화염(sulfo-SPDP), m-말레이미도벤조일-N-하이드로시숙시니미드 에스터 및 그의 설폰화염(sulfo-MBS), 및 숙시미딜[4-(p-말레이미도페닐) 부틸레이트] 및 그의 설폰화염(sulfo-SMPB)으로 구성된 군에서 선택된 1종 이상의 가교제가 링커로 이용되어 결합될 수 있다. In the present invention, the antibody is 1,4-bis-maleimidobutane, 1,11-bis-maleimidotetraethylene glycol, 1-ethyl-3- [3-dimethyl aminopropyl] carbodiimide hydrochloride, succinimidyl -4- [N-maleimidomethylcyclohexane-1-carboxy- [6-amidocaproate]] and its sulfonates (sulfo-SMCC), succimidyl 6- [3- (2-pyridyldithio ) -Lopionamido] hexanoate] and its sulfonate (sulfo-SPDP), m-maleimidobenzoyl-N-hydrosuccisinimide ester and its sulfonate (sulfo-MBS), and succimidyl [4- (p-maleimidophenyl) butyrate] and one or more crosslinking agents selected from the group consisting of sulfonated salts (sulfo-SMPB) can be used as linkers and bound.
상기 링커는 나노 리포좀의 양이온성 인지질과 항체를 연결하는 것을 특징으로 한다. The linker is characterized in that connecting the cationic phospholipid of the nano liposomes and the antibody.
본 발명의 나노 리포좀은 중성의 물, 세포 배양액, 혈액 등에서 수시간 이상 안정하게 분산될 수 있다. Nano liposomes of the present invention can be stably dispersed in neutral water, cell culture, blood and the like for several hours or more.
본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 대장암의 개선 또는 치료용 조성물을 제공할 수 있다. 상기 조성물은 Cetuximab을 더 포함할 수 있다. 상기 대장암은 KRAS 정상 유전자 또는 돌연변이 유전자형을 갖는 대장암일 수 있다. 상기 나노 리포좀 전달체 조성물은 KRAS 돌연변이 유전자형을 가져 Cetuximab에 약물 저항성을 갖는 대장암의 치료에 효과적이다. The present invention can provide a composition for improving or treating colorectal cancer containing the nano-liposomal delivery composition. The composition may further comprise Cetuximab. The colorectal cancer may be colorectal cancer having a KRAS normal gene or a mutant genotype. The nano liposome carrier composition has a KRAS mutant genotype and is effective in treating colorectal cancer having drug resistance to Cetuximab.
본 발명은 또한 하기와 같은 대장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법을 제공한다. 바람직하게는, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 제조하고, 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; 상기 지질 필름 조성물에, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 넣어 초음파 처리하는 제2단계; 상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계; 상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및, 상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제5단계;를 포함할 수 있다. The present invention also provides a method for preparing a nanoliposome transporter composition capable of selectively recognizing colon cancer cells as follows. Preferably, a preparation for preparing a lipid film composition by preparing a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipid on chloroform Stage 1; A second step of sonicating the lipid film composition by inserting a complex of a Cas9 protein, a guide RNA that inhibits the expression of the KRAS gene, and a cationic polymer; A third step of freezing and melting the sonicated lipid film composition and then again ultrasonicating; A fourth step of centrifuging the lipid film composition sonicated in the third step and recovering the nano liposomes in the precipitate; And a fifth step of binding the antibody to the nano liposome in the precipitate obtained in the fourth step through a crosslinking agent.
상기 제1단계의 복합체 제조시, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머는 1:1~3:30~70의 몰 비로 혼합될 수 있다. 이 때의 혼합비를 벗어나게 되면 복합체의 제조가 잘 되지 않을 수 있다. When preparing the complex of the first step, the guide RNA and the cationic polymer that inhibits the expression of the Cas9 protein, KRAS gene may be mixed in a molar ratio of 1: 1 to 3:30 to 70. If the mixing ratio at this time is out of production of the composite may not be good.
상기 제1단계의 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질은 2:0.1~5:0.01~0.5:0.01~0.5 몰 비로 혼합될 수 있다. 마찬가지로 이 때의 혼합비를 벗어나게 되면 나노 리포좀을 구성하는 지질의 제조가 잘 되지 않을 수 있다. Lecithin, metal chelating lipids, cholesterol and cationic phospholipids of the first step may be mixed in a ratio of 2: 0.1 to 5: 0.01 to 0.5: 0.01 to 0.5 mole. Likewise, if the mixing ratio is out of this time, the preparation of lipids constituting the nano liposomes may not be performed well.
이 때, 상기 제3단계에서 동결하고 융해하는 과정은 1~12회 반복할 수 있다. 지질 필름 조성물을 동결하고 융해하는 단계를 반복함으로써 보다 균일한 크기의 나노 리포좀 분산액이 형성될 수 있고, 나노 리포좀의 약물 봉입 효율을 높일 수 있다. 단, 12회를 초과할 경우에는 나노 리포좀의 봉입 효율이 오히려 줄어들 수 있기 때문에 12회 이내가 바람직하다. At this time, the process of freezing and thawing in the third step may be repeated 1 to 12 times. By repeating the step of freezing and thawing the lipid film composition, nano liposome dispersions of more uniform size can be formed, and the drug encapsulation efficiency of the nano liposomes can be improved. However, if it exceeds 12 times, since the encapsulation efficiency of the nano liposomes may be rather reduced, less than 12 times is preferable.
상기 제5단계에서 나노 리포좀에 가교제를 1~5시간 동안 혼합한 다음 항체를 첨가하여 1~5시간 동안 혼합하는 것을 특징으로 한다. In the fifth step, the cross-linking agent is mixed in the nanoliposome for 1 to 5 hours, and then, the antibody is added and mixed for 1 to 5 hours.
상기 제5단계에서 나노 리포좀, 가교제 및 항체는 10~30:1~5:1의 중량비로 결합될 수 있다. In the fifth step, the nano liposomes, the crosslinking agent and the antibody may be combined in a weight ratio of 10 to 30: 1 to 5: 1.
본 발명의 나노 리포좀 제조시, 메탈 킬레이팅 지질은 음전하(-)를 띄기 때문에, Cas9과 KRAS 유전자의 발현을 억제하는 가이드 RNA의 혼성체의 음전하(-)에 반응하여 리포좀의 캡슐화가 잘 되지 않을 수 있다. 따라서 이를 극복하기 위하여 양전하(+)를 갖는 양이온성 고분자를 결합시킨 복합체를 제조함으로써 나노 리포좀의 캡슐화를 강화할 수 있다. In preparing the nano liposomes of the present invention, since the metal chelating lipids have a negative charge (−), the encapsulation of the liposomes may not be well performed in response to the negative charge (−) of the hybrid of the guide RNA that suppresses the expression of the Cas9 and KRAS genes. Can be. Therefore, in order to overcome this, it is possible to enhance the encapsulation of the nano liposomes by preparing a complex in which a cationic polymer having a positive charge (+) is bound.
본 발명은 또한 상기 나노 리포좀 전달체 조성물을 함유하는 약학 조성물을 제공할 수 있는데, 상기 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. The present invention can also provide a pharmaceutical composition containing the nano-liposomal delivery composition, wherein the pharmaceutical composition is oral, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc. according to conventional methods, respectively. It may be used in the form of a dosage form, an external preparation, a suppository, and a sterile injectable solution. Carriers, excipients and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid form preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid form preparations include at least one excipient such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1㎎/㎏/일 내지 500㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, weight of the subject to be treated, the specific disease or pathology to be treated, the severity of the disease or pathology, the route of administration and the judgment of the prescriber. Dosage determination based on these factors is within the level of skill in the art and generally dosages range from 0.01 mg / kg / day to approximately 2000 mg / kg / day. More preferred dosage is 1 mg / kg / day to 500 mg / kg / day. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.
본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, humans, etc. by various routes. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.
본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암 치료제에 관한 것이다. 현재 전이성 대장암 치료제로 사용되고 있는 Cetuximab의 경우 KRAS 정상형 대장암 환자에게만 효과가 있고 KRAS 정상형 대장암 환자이더라도 지속적으로 Cetuximab의 치료를 받으면, 60~80%의 환자가 KRAS 돌연변이형으로 발전할 수 있는 치명적인 단점을 가지고 있다. 그렇지만, 본 발명의 나노 리포좀 조성물을 이용할 경우, 대장암 유발 유전자인 KRAS의 돌연변이를 근본적으로 억제할 수 있을 뿐만 아니라, KRAS 돌연변이형 전이성 대장암의 치료를 매우 효과적으로 수행할 수 있다.The present invention relates to a nanoliposome carrier composition encapsulated with a complex of Cas9 protein, guide RNA that inhibits KRAS gene expression, and a cationic polymer, or an anticancer drug-resistant colorectal cancer therapeutic agent according to KRAS mutations. Cetuximab, currently used as a treatment for metastatic colorectal cancer, is effective only for patients with normal KRAS colon cancer, and even if KRAS patients with normal colorectal cancer continue to receive Cetuximab treatment, 60% to 80% of patients can develop a KRAS mutation. It has a disadvantage. However, when using the nano liposome composition of the present invention, it is possible not only to fundamentally suppress the mutation of KRAS , which is a colon cancer-causing gene, but also to effectively treat the KRAS mutant metastatic colorectal cancer.
도 1a와 도1b는 대장암 세포 HT29, SW480, SNU407 cell line에서 Exon2, codon 12번 자리에 KRAS가 정상 서열(GGT)인지 돌연변이(GTT 또는 GAT)가 일어났는지 확인하기 위하여 각 cell의 genomic DNA의 KRAS exon 2의 codon 12번 서열을 확인한 결과이다.Figures 1a and 1b shows the genomic DNA of each cell in order to determine whether KRAS is a normal sequence (GGT) or mutation (GTT or GAT) at Exon2, codon 12 in colon cancer cells HT29, SW480, SNU407 cell line This is the result of confirming codon sequence of KRAS exon 2.
도 2는 본 발명의 단일 가닥 상태의 가이드 RNA(sgRNAs) 1번과 2번 서열의 효율을 plasmid system 및 KRAS의 mRNA 발현을 통해 확인한 결과를 나타낸다. Figure 2 shows the results confirmed the mRNA expression of the plasmid system and KRAS sequence efficiency of the guide RNA (sgRNAs) 1 and 2 of the single strand state of the present invention.
도 3a는 본 발명의 단일 가닥 상태의 가이드 RNA(sgRNAs, 서열번호 1)의 염기서열 구조를 도식화한 것이다. Figure 3a is a schematic diagram of the nucleotide sequence structure of the guide RNA (sgRNAs, SEQ ID NO: 1) of the single-stranded state of the present invention.
도 3b는 본 발명에서 사용한 Cas9 단백질을 정제하여 SDS-PAGE(Sodium dodecyl sulphate polyacrylamide gel electrophoresis)를 수행한 후 Coomassie blue 용액으로 염색하여 단백질의 존재를 확인한 결과를 나타낸다.Figure 3b shows a result of confirming the presence of the protein purified by Cas9 protein used in the present invention and subjected to SDS-PAGE (Sodium dodecyl sulphate polyacrylamide gel electrophoresis) and stained with Coomassie blue solution.
도 4는 in vitro transcriptied sgRNAs와 정제한 Cas9 단백질을 실험실 내에서 결합시켜 혼성체로 제조하고(Cas9/sgRNA 혼성체), 이 혼성체를 이용하여 KRAS 유전자가 실제 잘리는지 확인한 결과를 나타낸다. Figure 4 shows the results of in vitro transcriptied sgRNAs and purified Cas9 protein to be hybridized in the laboratory to prepare a hybrid (Cas9 / sgRNA hybrid), the actual truncation of the KRAS gene using this hybrid.
도 5는 본 발명 실시예 2의 나노 리포좀 구조를 도식화한 것으로서, 상기 나노 리포좀은 Cas9 단백질, 가이드 RNA(sgRNA) 및 폴리에틸렌이민(PEI, Polyethylenimine) 이 결합된 복합체가 봉입되어 있으며, 리포좀을 구성하는 막은 레시틴(Lecithin), 콜레스테롤(Cholestrol), DPPE(1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine) 및 DOGS-NTA-Ni 지질로 구성된다. 이 때, 리포좀 외부의 표면에 노출되어 있는 DPPE의 아민기에는 Sulfo-SMCC(Sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate)를 링커(linker)로 하여 대장암 세포를 목표로 하는 EGFR 항체(anti-EGFR)가 결합되어 있다.  Figure 5 is a schematic of the nano liposome structure of Example 2 of the present invention, the nano liposome is a complex containing a combination of Cas9 protein, guide RNA (sgRNA) and polyethyleneimine (PEI, Polyethylenimine), constituting the liposome The membrane consists of lecithin, cholesterol (Cholestrol), DPPE (1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine) and DOGS-NTA-Ni lipids. At this time, the amine group of DPPE exposed on the surface of the liposome is EGFR antibody which targets colon cancer cells by using Sulfo-SMCC (Sulfosuccinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate) as a linker. (anti-EGFR) is bound.
도 6은 본 발명 실시예 2의 나노 리포좀의 대장암 세포로의 유입 과정을 확인하기 위해, 세포 내 유입을 억제하는 억제제들을 처리한 후 Cas9에 대한 항체로 면역염색하고 공초점 형광 현미경(Confocal Laser Scanning Microscopy)으로 찍은 사진을 나타낸다. FIG. 6 is an immunostained with an antibody against Cas9 and treated with confocal fluorescence microscopy after treating the inhibitors for inhibiting the influx into cells to confirm the inflow process of the nanoliposome of the present invention Example 2 into colorectal cancer cells. Photo taken with Scanning Microscopy.
도 7a는 본 발명의 sgRNA 1 및 sgRNA 2가 목표로 삼는 인간 게놈의 KRAS 유전자 내의 위치를 도식화하여 나타낸 그림이다. Figure 7a is a diagram showing the location in the KRAS gene of the human genome targeted by sgRNA 1 and sgRNA 2 of the present invention.
도 7b는 본 발명 실시예 2의 나노 리포좀을 처리하여 KRAS 유전자의 20개의 염기서열이 잘려지는 것을 도식화하여 나타낸 그림이다. Figure 7b is a diagram showing the 20 nucleotide sequence of the KRAS gene is cut by processing the nano liposome of Example 2 of the present invention.
도 7c는 본 발명 실시예 2의 나노 리포좀이 처리된 각 대장암 세포(KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480 및 SNU407 세포)에서의 KRAS의 mRNA 발현 억제효과를 나타낸다. Figure 7c shows the effect of inhibiting the mRNA expression of KRAS in each colorectal cancer cells (HT29 cells with KRAS normal gene, SW480 and SNU407 cells with KRAS mutant gene) treated with nano liposomes of Example 2 of the present invention.
도 7d는 본 발명 실시예 2의 나노 리포좀이 처리된 SW480세포에서의 Ras의 단백질 발현 정도와 Erk 1/2 신호전달을 확인한 결과를 나타낸다. Figure 7d shows the results of confirming the protein expression level and Erk 1/2 signaling of Ras in SW480 cells treated with the nanoliposome of Example 2 of the present invention.
도 7e와 도 7f는 K-ras, Cetuximab, Cas9/sgRNA와 관련되는 cell signaling 과정을 도식화한 것이다. 7E and 7F illustrate cell signaling processes associated with K-ras, Cetuximab, and Cas9 / sgRNA.
도 8a는 Cetuximab만 처리한 세포 실험군에 대한 결과로서, KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포에서의 세포 생존과 증식을 WST-1 assay 방법을 통해 나타낸 것이다. Figure 8a is a result of the cell group treated only with Cetuximab, cell survival and proliferation in HT29 cells with KRAS normal gene, SW480 with KRAS mutant gene, SNU407 cells is shown by the WST-1 assay method.
도 8b는 본 발명 실시예 2의 나노 리포좀을 처리하여 KRAS 유전자가 편집된 세포에 Cetuximab을 처리한 실험군에 대한 결과로서, KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포에서의 세포 생존과 증식을 WST-1 assay 방법을 통해 나타낸 것이다. Figure 8b is a result of the experimental group treated with Cetuximab to the KRAS gene-edited cells treated with the nano liposome of Example 2 of the present invention, HT29 cells with KRAS normal gene, SW480, SNU407 cells with KRAS mutant gene Cell survival and proliferation of the cells were shown by the WST-1 assay method.
도 9는 Cas9, sgRNAs 및 폴리에틸렌이민 복합체가 봉입되지 않은 비교예 1의 나노 리포좀과 Cas9, sgRNAs 및 폴리에틸렌이민 복합체가 봉입된 본 발명 실시예 2의 나노 리포좀을 처리한 것에서의 세포 자살(cell apoptosis) 과정을 확인하여 차이가 나는 단백질 발현 결과를 나타낸다. Figure 9 shows cell apoptosis in the treatment of the nano liposomes of Comparative Example 1 in which Cas9, sgRNAs and polyethyleneimine complexes were not encapsulated and the nano liposomes of Example 2 in which Cas9, sgRNAs and polyethyleneimine complexes were encapsulated. Check the process to show the difference in protein expression results.
도 10은 본 발명 실시예 2의 나노 리포좀이 처리된 대장암 세포에서의 Cetuximab으로 인한 apoptosis를 확인하기 위해 caspase-3 activity를 측정한 결과를 나타낸다.  10 shows the results of measuring caspase-3 activity to confirm apoptosis due to Cetuximab in the colorectal cancer cells treated with the nanoliposome of Example 2 of the present invention.
도 11은 나노리포좀 제조 후 여액에 남은 Cas9 단백질의 양을 확인하여 나노 리포좀의 봉입 효율을 확인한 결과를 나타낸다. 11 shows the results of confirming the encapsulation efficiency of the nano liposomes by confirming the amount of Cas9 protein remaining in the filtrate after the production of nano liposomes.
도 12는 plasmid Cas guide vector의 구조를 나타낸다. 12 shows the structure of a plasmid Cas guide vector.
도 13은 pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)의 구조를 나타낸다. Fig. 13 shows the structure of pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261).
도 14는 [Wu S et al]에서 발췌한 half-antibody를 제조하는 과정을 나타내는 모식도이다. 14 is a schematic diagram showing a process of preparing a half-antibody extracted from [Wu S et al].
이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to fully convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thoroughly and completely.
<실시예 1. 가이드 RNA 제조 및 Cas9 단백질 정제> <Example 1. Guide RNA Preparation and Cas9 Protein Purification>
실시예 1-1. Example 1-1. KRASKRAS 를 목표유전자로 하는 가이드 RNA 제조 Guide RNA production with target genes
T7 RNA polymerase(NEB)를 활용한 in vitro transcription 방법을 이용하여 KRAS를 목표유전자로 하는 가이드 RNA를 제조하였다. 이를 위해 표 1의 T7 promoter 염기서열과 KRAS 유전자의 20 b.p. 염기서열인 서열번호 3 : CTGAATTAGCTGTATCGTCA, 서열번호 4 : GAATATAAACTTGTGGTAGT을 포함하는 '69 mer forward primer' 2개, 가이드 RNA에 연결될 스캐폴드 염기서열을 포함하는 '20 mer reverse primer' 1개, plasmid Cas guide vector(origene)를 사용하여 PCR법으로 140 b.p.의 DNA　주형(template)을 제조하였다. 이 DNA 주형, rNTP mixture, T7 RNA polymerase, RNAase inhibitor를 포함하여 37℃에서 2시간 전사 반응을 통하여 가이드 RNA를 제작하였고 RNA 정제 과정을 거쳐 RNA 순도를 높였다. A guide RNA was prepared using KRAS as a target gene by in vitro transcription using T7 RNA polymerase (NEB). To this end, the T7 promoter sequence of Table 1 and the 20 bp sequence of the KRAS gene, SEQ ID NO: 3: CTGAATTAGCTGTATCGTCA, SEQ ID NO: 4: '69 mer forward primer 'including GAATATAAACTTGTGGTAGT, and the scaffold sequence to be linked to the guide RNA One 140 bp DNA template was prepared by PCR using a plasmid Cas guide vector (origene). Including this DNA template, rNTP mixture, T7 RNA polymerase and RNAase inhibitor, guide RNA was prepared by transcriptional reaction at 37 ° C for 2 hours, and RNA purity was increased through RNA purification.
* T7 promoter 염기서열은 아래 표 1의 밑줄 친 부분에 해당됨. * T7 promoter sequence corresponds to the underlined portion of Table 1 below.
* 표 1의 굵은 글씨의 염기 서열은 KRAS 유전자를 인식하는 부위이며, 스캐폴드 염기서열의 주형(plasmid Cas guide vector)을 인식하여 가이드 RNA 합성이 되며, 최종 제조된 가이드 RNA의 서열과 이 염기서열이 같은(T 대신 U로 치환된) 염기서열 구조를 가짐. * The bold nucleotide sequence of Table 1 is a region for recognizing the KRAS gene, and guide RNA is synthesized by recognizing a template of the scaffold nucleotide (plasmid Cas guide vector), and the sequence of the finally prepared guide RNA and this nucleotide sequence It has this same (substituted by U instead of T) nucleotide sequence.
* F 프라이머 뒤의 GTTTTAGAGCTAGAAATAGCA는 스캐폴드 염기 서열 일부분임.GTTTTAGAGCTAGAAATAGCA after the F primer is part of the scaffold base sequence.
* plasmid Cas guide vector에 스캐폴드 염기서열의 주형이 포함되어 있음. * The plasmid Cas guide vector contains the template of the scaffold sequence.
* 이 실험에 사용된 plasmid Cas guide vector의 구조는 도 12와 같음. * The structure of the plasmid Cas guide vector used in this experiment is shown in FIG.
출처 : http://www.origene.com/CRISPR-CAS9/Detail.aspx?sku=GE100001 Source: http://www.origene.com/CRISPR-CAS9/Detail.aspx?sku=GE100001
forward primerforward primer KRAS sgRNA 1_FKRAS sgRNA 1_F GCGGCCTCTAATACGACTCACTATAGGG CTGAATTAGCTGTATCGTCAGTTTTAGAGCTAGAAATAGCA GCGGCCTCTAATACGACTCACTATAGGG CTGAATTAGCTGTATCGTCA GTTTTAGAGCTAGAAATAGCA
KRAS sgRNA 2_FKRAS sgRNA 2_F GCGGCCTCTAATACGACTCACTATAGGG GAATATAAACTTGTGGTAGTGTTTTAGAGCTAGAAATAGCA GCGGCCTCTAATACGACTCACTATAGGG GAATATAAACTTGTGGTAGT GTTTTAGAGCTAGAAATAGCA
reverse primer(sg RNA_R)reverse primer (sg RNA_R) AAAAGCACCGACTCGGTGCCAAAAAGCACCGACTCGGTGCCA
상기 실험을 통해 하기 표 2의 염기서열을 갖는 가이드 RNA를 제조하였다. Through the experiment to prepare a guide RNA having the base sequence of Table 2 below.
서열번호 7(KRAS 타겟) SEQ ID NO: 7 (KRAS target) CUGAAUUAGCUGUAUCGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU CUGAAUUAGCUGUAUCGUCA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
서열번호 8(KRAS 타겟) SEQ ID NO: 8 (KRAS target) GAAUAUAAACUUGUGGUAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU GAAUAUAAACUUGUGGUAGU GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU
본 발명에서 제조한 표 2의 단일 가닥 상태의 가이드 RNA(sgRNA)의 구조 도식화는 도 3a에 개시되어 있다. The structural schematic of the single stranded guide RNA (sgRNA) of Table 2 prepared in the present invention is shown in Figure 3a.
최종 제조된 상기 가이드 RNA는 사람 KRAS 유전자의 서열번호 5 : TGACGATACAGCTAATTCAG 또는 서열번호 6 : CTTATATTTGAACACCATCA의 염기서열을 타겟으로 인식하여 각 KRAS 유전자의 발현을 억제하는 역할을 한다.The guide RNA is the final manufacturing of the KRAS gene From SEQ ID NO: 5: TGACGATACAGCTAATTCAG or SEQ ID NO: 6: recognizing the target base sequence of CTTATATTTGAACACCATCA serves to inhibit the expression of each of KRAS gene.
실시예 1-2. Cas9 단백질 정제Example 1-2. Cas9 Protein Purification
pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)를 대장균(DH5α)에 형질전환하여 0.5 mM IPTG(isopropyl β- D -1-thiogalactopyranoside)와 28℃ 조건에서 Cas9 단백질을 과발현하였고, Cas9 단백질이 과발현된 대장균을 lysis buffer(20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1x protease inhibitor cocktail, 1 mg/mL lysozyme)와 함께 초음파 처리하였다. 초음파 처리하여 얻은 분쇄물을 원심분리하여 단백질이 포함된 액상을 얻었다. Ni-NTA agarose bead 추출법(elution buffer : 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1x protease inhibitor cocktail)으로 상기 액상에 포함된 Cas9 단백질을 분리하였다. 이후 분리물을 storage buffer(50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol)에 혼합한 상태로 투석하여(cut off 10K) 이미다졸을 제거한 후 단백질 농도를 정량하였다(BCA법 이용). 이 때, 투석하여 얻은 Cas9 단백질을 SDS-PAGE하여 확인하여 Cas9 단백질이 잘 생성되었음을 확인하였다(도 3b). pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261) was transformed into Escherichia coli (DH5α) to overexpress Cas9 protein under 0.5 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) and 28 ° C, and overexpress Cas9 protein. E. coli was sonicated with lysis buffer (20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1x protease inhibitor cocktail, 1 mg / mL lysozyme). The pulverized product obtained by sonication was centrifuged to obtain a liquid phase containing protein. Cas9 protein in the liquid phase was isolated by Ni-NTA agarose bead extraction (elution buffer: 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1x protease inhibitor cocktail). The isolate was then dialyzed (cut off 10K) in a mixed buffer in a storage buffer (50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol). After removing the protein concentration was quantified (using BCA method). At this time, the Cas9 protein obtained by dialysis was confirmed by SDS-PAGE to confirm that the Cas9 protein was well generated (FIG. 3B).
** pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)의 구조 : 도 13 참조, 출처 : Addgene (http://www.addgene.org/)** Structure of pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261): see FIG. 13, Source: Addgene (http://www.addgene.org/)
<실시예 2. 나노 리포좀 제작><Example 2. Nano liposome preparation>
실시예 1에서 제조한 Cas9 단백질, 가이드 RNA 및 폴리에틸렌이민을 1:2:50의 몰 비(mole ratio)로 혼합하여 복합체를 제조하였다. 이 때 가이드 RNA로는 스캐폴드 염기서열이 포함된 서열번호 7 또는 8을 사용하였다(서열번호 1 또는 2 내포). The complex was prepared by mixing the Cas9 protein, guide RNA and polyethyleneimine prepared in Example 1 in a mole ratio of 1: 2: 50. At this time, as the guide RNA, SEQ ID NO: 7 or 8 including the scaffold base sequence was used (SEQ ID NO: 1 or 2 nested).
다음으로 레시틴(Lecithin, Sigma Aldrich), DOGS-NTA-Ni 지질(Avanti polar lipids), 콜레스테롤(Cholesterol, Sigma Aldrich) 및 DPPE(Sigma Aldrich)를 2:1:0.1:0.05 몰 비로 클로로포름(chloroform) 상에서 섞은 후 Rotary evaporator를 활용하여 지질필름(lipid film)화 하였다. Next, lecithin (Sigma Aldrich), DOGS-NTA-Ni lipids (Avanti polar lipids), cholesterol (Cholesterol, Sigma Aldrich) and DPPE (Sigma Aldrich) were added on chloroform in a 2: 1: 0.1: 0.05 molar ratio. After mixing, a lipid film was formed by using a rotary evaporator.
여기에 Cas9 단백질/가이드 RNA/폴리에틸렌이민의 복합체를 넣어 초음파를 가하며 혼합하였다. 액체질소를 활용하여 동결하고 융해하는 과정(freeze thaw cycle)을 10차례 반복하고 이후 초음파(probe 방식) 처리하여 좀 더 작은 사이즈이면서도 균일한 상태의 나노 리포좀 조성물을 제작하였다. Here, the complex of Cas9 protein / guide RNA / polyethyleneimine was added and mixed with ultrasonic waves. The freeze thaw cycle was repeated 10 times using liquid nitrogen and then ultrasonicated (probe method) to produce nanoliposome compositions with a smaller size and a uniform state.
이후 원심분리 방법으로 침전된 나노 리포좀 조성물(lipid의 총량 19.82mg, Cas9과 gRNA의 총량 0.034mg)을 회수하여 항체 결합을 위한 링커로 사용될 Sulfo-SMCC(ProteoChem) 2.5mg을 PBS 상에서 2시간 동안 25℃ 상온에서 혼합하였다. Afterwards, the nano liposome composition precipitated by centrifugation (19.82 mg total amount of lipid, 0.034 mg total amount of Cas9 and gRNA) was recovered, and 2.5 mg of Sulfo-SMCC (ProteoChem) to be used as a linker for antibody binding was used for 25 hours in PBS. Mix at room temperature.
다음으로는 나노 리포좀에 결합하기 위한 정제 항체를 준비하였는데, 상기 나노 리포좀에 결합할 항체는 대장암 세포에서 과발현하는 것으로 알려진 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins) 등(Belov L et al., 2010)을 인식할 수 있는 단클론성 또는 다클론성 항체를 선택하였다. 특히 이 중에서도 EGFR 항체(Anti-EGFR)(abcam, ab2430)를 선택하여 2-Mercaptoethylamine(Thermo)과 10mM EDTA 상에서 2시간 동안 37℃에서 혼합한 뒤, PD-10 desalting column(GE Healthcare)으로 정제하였다(EGFR 항체와 2-Mercaptoethylamine은 1mg:0.6mg으로 혼합). 이 때, 항체의 정제과정은 하기의 그림으로 설명할 수 있다(Y 모양을 가지는 동일한 2개의 사슬로 이루어져 있는 항체에 2-Mercaptoethylamine을 첨가하여 half-antibody를 만들어 다시 정제한 뒤 이를 나노 리포좀에 결합시킴 - Wu S et al., Highly sensitive nanomechanical immunosensor using half antibody fragment, Anal Chem, 2014, 86(9), 4271-4277). * 도 14 참조. Next, a purified antibody for binding to nanoliposomes was prepared, wherein the antibody to bind to nanoliposomes is epidermal growth factor receptor (EGFR), epipithelial cell adhesion molecule (EpCAM), and carcinoembryonic (CEA), which are known to be overexpressed in colorectal cancer cells. Monoclonal or polyclonal antibodies were selected that were able to recognize antigen and Annexins et al. (Belov L et al., 2010). Among them, EGFR antibody (Anti-EGFR) (abcam, ab2430) was selected and mixed with 2-Mercaptoethylamine (Thermo) at 37 ° C for 2 hours on 10 mM EDTA, and then purified by PD-10 desalting column (GE Healthcare). (EGFR antibody and 2-Mercaptoethylamine are mixed at 1mg: 0.6mg). At this time, the purification process of the antibody can be described by the following figure (The antibody is composed of the same two chains having a Y shape, 2-Mercaptoethylamine is added to make a half-antibody and purified again, and then bound to the nano liposomes. Sikkim-Wu S et al., Highly sensitive nanomechanical immunosensor using half antibody fragment, Anal Chem, 2014, 86 (9), 4271-4277). See FIG. 14.
위 그림과 같이 half anti-body를 만들어주면 -SH가 생성된다. 나노 리포좀을 구성하는 DPPE 지질에 -NH2가 존재하기 때문에 여기에 sulfo-SMCC(linker)가 반응하게 되고, 이렇게 만들어진 나노 리포좀의 sulfo-SMCC와 half-antibody의 -SH 부분이 결합하게 된다. 이렇게 half-antibody의 제조를 통해 나노리포좀의 대장암 세포에 대한 인식능력을 배로 증가시킬 수 있다. If you make half anti-body like the picture above, -SH is produced. Because of the presence of -NH2 in the DPPE lipids that make up the nano liposomes, sulfo-SMCC (linker) reacts with it, and the sulfo-SMCC and half -antibody's -SH portion of the nano liposomes are combined. Thus, half-antibody production can double the recognition capacity of nanoliposomes for colon cancer cells.
이렇게 정제된 항체(anti-EGFR) 1mg을 링커가 결합되어 있는 나노 리포좀 조성물과 4℃에서 12시간 동안 혼합하고, 이후 원심분리 방법으로 침전된 것만을 회수하여 대장암 세포를 선택적으로 인식할 수 있는 항체가 결합된 본 발명의 나노 리포좀을 얻었고, 진행 buffer(세포배양용 배지 또는 PBS[Phosphate Buffered Saline])에 섞어 다음 실험에 사용하였다. 1 mg of the purified antibody (anti-EGFR) is mixed with a linker-bound nano liposome composition at 4 ° C. for 12 hours, and only the precipitated material is recovered by centrifugation to selectively recognize colon cancer cells. Nano liposomes of the present invention to which the antibody is bound were obtained and mixed in a progress buffer (cell culture medium or PBS [Phosphate Buffered Saline]) and used in the following experiment.
<비교예 1. 비교 나노 리포좀 제조> Comparative Example 1. Comparative Nano Liposome Preparation
실시예 2에 기재된 방법으로 나노 리포좀을 제조하였으나, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체를 첨가하는 과정은 제외하였다. Nano liposomes were prepared by the method described in Example 2, but the process of adding a complex of Cas9 protein / guide RNA / polyethylenimine was excluded.
<비교예 2. DOGS-NTA-Ni 지질과 폴리에틸렌이민을 포함하지 않은 나노 리포좀> Comparative Example 2 Nanoliposomes without DOGS-NTA-Ni Lipid and Polyethylenimine
나노 리포좀 제조시 DOGS-NTA-Ni 지질을 제외하고 나노 리포좀을 제조하였고, 이후는 실시예 2의 과정을 수행하되, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체 대신 Cas9 단백질/가이드 RNA의 혼성체가 나노 리포좀에 봉입되게 하였다. Nano liposomes were prepared except for DOGS-NTA-Ni lipids in preparation of nano liposomes, and then the procedure of Example 2 was performed, but the hybrid of Cas9 protein / guide RNA was replaced with the complex of Cas9 protein / guide RNA / polyethylenimine. Encapsulated in liposomes.
<비교예 3. 폴리에틸렌이민을 포함하지 않은 나노 리포좀> Comparative Example 3 Nanoliposomes without Polyethylenimine
실시예 2에서처럼 나노 리포좀을 제조하되, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체 대신 Cas9 단백질/가이드 RNA의 혼성체가 나노 리포좀에 봉입되게 하였다. Nano liposomes were prepared as in Example 2, but a hybrid of Cas9 protein / guide RNA was encapsulated in nano liposomes instead of the complex of Cas9 protein / guide RNA / polyethylenimine.
<비교예 4. 항체를 결합하지 않은 나노 리포좀> Comparative Example 4. Nanoliposomes Not Attached to Antibody
실시예 2에서처럼 나노 리포좀을 제조하되, 항체 및 링커를 결합하지 않았다. Nano liposomes were prepared as in Example 2 but did not bind antibodies and linkers.
<실험예 1. Experimental Example 1. KRASKRAS 발현 및 활성 측정> Expression and Activity Measurement>
실험예 1-1. 가이드 RNA와 Cas9 단백질의 활성 확인Experimental Example 1-1. Confirmation of Guide RNA and Cas9 Protein Activity
가이드 RNA 제조와 Cas9 단백질 정제(도 3b)가 잘 되었는지 확인하기 위해, SW480 세포를 수집하여 DNA를 추출하고 Foward primer : TGAAGTACAGTTCATTACGATACACG, Reverse primer : GGAAAGTAAAGTTCCCATATTAATGGT를 이용하여 PCR법을 통해 template fragment (500bp)를 만들었다. 다음으로 fragment에 정제된 Cas9 단백질만, 정제된 Cas9 단백질과 sgRNA 1(서열번호 1, 도 3a)을 혼합하여 넣어주었다. In order to confirm that the guide RNA preparation and Cas9 protein purification (FIG. 3b) were performed well, SW480 cells were collected and DNA was extracted. . Next, only the purified Cas9 protein in the fragment was mixed with the purified Cas9 protein and sgRNA 1 (SEQ ID NO: 1, FIG. 3A).
도 4를 참고하면, 정제된 Cas9 단백질만 넣어준 실험군에서는 가이드 RNA가 존재하지 않기 때문에 Cas9 단백질이 fragment를 자르지 못하였고, 정제된 Cas9 단백질과 sgRNA 1(서열번호 1)을 혼합한 실험군에서는 sgRNA 1이 fragment 안의 서열번호 5의 서열을 인식하여, Cas9 단백질이 fragment를 잘라주었음을 보여주는 결과가 확인된다. Referring to FIG. 4, in the experimental group in which only the purified Cas9 protein was added, the Cas9 protein could not cut the fragment because no guide RNA was present, and in the experimental group in which the purified Cas9 protein was mixed with sgRNA 1 (SEQ ID NO: 1), sgRNA 1 Recognizing the sequence of SEQ ID NO: 5 in this fragment, the result showing that the Cas9 protein cut the fragment was confirmed.
실험예 1-2. Experimental Example 1-2. KRASKRAS 의 유전자 돌연변이 확인Genetic mutations
대장암 세포(HT29, SW480, SNU407) 세포에서 DNA를 추출하고, Foward primer : TGAAGTACAGTTCATTACGATACACG, Reverse primer : GGAAAGTAAAGTTCCCATATTAATGGT를 이용하여 PCR법을 통해 template fragment를 만들었다. 다음으로는 T-blunt PCR cloning kit(solgent)를 이용하여 template fragment를 T-blunt vector안에 삽입시켜 준 뒤, (주)바이오니아에 Sequencing service를 요청하여 template fragment 부분의 서열을 분석하였다. 분석결과는 도 1에 나타내었으며, KRAS의 유전자 Exon 2번, codon 12번 자리에서 HT29 세포는 정상, SW480 세포와 SNU407 세포는 KRAS 돌연변이가 일어났음을 확인할 수 있다.DNA was extracted from colon cancer cells (HT29, SW480, SNU407) cells, and template fragments were prepared by PCR using Foward primer: TGAAGTACAGTTCATTACGATACACG and Reverse primer: GGAAAGTAAAGTTCCCATATTAATGGT. Next, after inserting the template fragment into the T-blunt vector using a T-blunt PCR cloning kit (solgent), the sequence of the template fragment was analyzed by requesting a sequencing service from Bioneer. Analysis results are shown in Figure 1, the gene Exon 2 times of KRAS, codon No. 12 in the top spot HT29 cells, SW480 cells and cells SNU407 has taken place to determine the KRAS mutation has occurred.
실험예 1-3. 가이드 RNA의 Experimental Example 1-3. Guide RNA KRASKRAS 발현 효율 비교 Expression efficiency comparison
대장암 세포 HT29(control ; KRAS 정상 세포)와 SW480(KRAS mutation 세포) 에서의 sgRNA 1(서열번호 1)과 sgRNA 2(서열번호 2)의 효율비교를 위해 pCas plasmid(실시예 1-1에 있는 pCas-Guide plasmid에 서열번호 3과 서열번호 4를 넣어주어 세포에 처리해 주었다. To compare the efficiency of sgRNA 1 (SEQ ID NO: 1) and sgRNA 2 (SEQ ID NO: 2) in colon cancer cells HT29 (control; KRAS normal cells) and SW480 (KRAS mutation cells), pCas plasmid (see Example 1-1). SEQ ID NO: 3 and SEQ ID NO: 4 were put into the pCas-Guide plasmid and treated in the cells.
처리한 세포를 수집하여 Trizol(invitrogen)을 이용하여 총RNA를 추출하였고, SuprimeScript RT premix 2x(GeNetBio)를 이용하여 cDNA를 합성하였다. Treated cells were collected and total RNA was extracted using Trizol (invitrogen), and cDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).
KRAS의 mRNA 발현 확인을 위한 Real-time PCR은 SYBR green 2x Premix(Applied Biosystems)와 AB step one plus real-time PCR system(Applied Biosystems)을 활용하여 측정하였다. 이 때 검출에 사용한 primer의 염기서열은 다음과 같다. Real-time PCR for KRAS mRNA expression was measured using SYBR green 2x Premix (Applied Biosystems) and AB step one plus real-time PCR system (Applied Biosystems). At this time, the nucleotide sequence of the primer used for detection is as follows.
KRAS sense : GACTGAATATAAACTTGTGGTAGTTGGA KRAS sense: GACTGAATATAAACTTGTGGTAGTTGGA
KRAS antisense : TCCTCTTGACCTGCTGTGTCGKRAS antisense: TCCTCTTGACCTGCTGTGTCG
GAPDH sense : GCACCGTCAAGGCTGAGAAGAPDH sense: GCACCGTCAAGGCTGAGAA
GAPDH antisense : AGGGATCTCGCTCCTGGAAGAPDH antisense: AGGGATCTCGCTCCTGGAA
상기 결과는 도 2에 나타냈으며 HT29 세포와 SW480 세포에서 sgRNA 1과 sg RNA 2의 효율 비교를 한 결과 공통적으로 sgRNA 1(서열번호 1) 이 가장 효율적으로 KRAS의 mRNA 발현을 줄었으므로, 이후의 실험은 모두 서열번호 1의 가이드 RNA가 포함된 것을 사용하였다. The results are shown in FIG. 2. As a result of comparing the efficiency of sgRNA 1 and sg RNA 2 in HT29 cells and SW480 cells, sgRNA 1 (SEQ ID NO: 1) most effectively reduced mRNA expression of KRAS . In all cases, the guide RNA of SEQ ID NO: 1 was used.
한편, 서열번호 1 또는 2의 가이드 RNA가 인식하는 인간 게놈 DNA의 위치는 도 7a에 나타내었고, 이에 대한 모식도를 서열번호 1을 포함하는 나노 리포좀을 대표로 하여 도 7b에 나타내었는데, 이를 참고하면, 본 발명의 나노 리포좀을 통해, 가이드 RNA가 염기서열 20개를 인식하게 되고, Cas9 단백질이 PAM(protospacer adjacent motif)(TGG 서열 등) 부위를 자르게 됨으로써, 잘려진 DNA가 스스로 회복(repair)되는 과정 중에 20개의 DNA 염기서열이 잘려나간 것이 확인된다(실시예 1-2의 방법으로 나노 리포좀이 처리된 세포의 게놈 DNA를 직접 추출하고, 이를 (주)바이오니아에 Sequencing service를 요청하여 도 7b에서 제시된 잘려진 서열의 위치를 확인하였음). On the other hand, the position of the human genomic DNA recognized by the guide RNA of SEQ ID NO: 1 or 2 is shown in Figure 7a, a schematic diagram is shown in Figure 7b representing a nano liposome comprising SEQ ID NO: 1, referring to this , Through the nano-liposomes of the present invention, the guide RNA recognizes 20 nucleotide sequences, and the Cas9 protein cuts the PAM (protospacer adjacent motif) (TGG sequence, etc.) site, thereby repairing the cut DNA by itself. It was confirmed that 20 DNA sequences were cut out (the genomic DNA of the cells treated with the nano liposomes was directly extracted by the method of Example 1-2, and the sequencing service was requested to Bioneer Co., Ltd. as shown in FIG. 7B. Location of the truncated sequence was identified).
실험예 1-4. 나노 리포좀의 대장암 세포로의 유입 확인Experimental Example 1-4. Confirmation of Nanoliposome Inflow into Colon Cancer Cells
실시예 2의 나노 리포좀의 대장암 세포로의 유입을 확인하기 위해, 실시예 2의 나노 리포좀을 대장암 세포(SW480 세포)에 24시간 동안 Cas9:gRNA(24.7㎍:9.3㎍ - 총 배양액 내에 Cas9 24.7㎍ 및 gRNA 9.3㎍)의 농도로 처리 후 Cas9에 대한 항체로 면역염색하여 도 6에 공초점 형광 현미경 사진을 나타내었다. 이 때 유입 과정을 차단할 수 있는 약물을 각각 대장암 세포에 처리하여 비교군으로 확인하였다. 면역염색을 위해 CFL-488의 Cas9 1차 항체(Rabbit)를 이용하여 세포 내 Cas9 단백질을 표지하고 공초점 형광 현미경으로 이미지화하였다. 상기 결과는 서열번호 1의 가이드 RNA가 포함된 것을 대표로 하여 도 6에 나타내었다. 도 6에서 DIC는 세포의 전자 이미지 사진, DAPI는 DNA 염색 사진, Cas9은 Cas9 단백질의 CFL-488 염색 사진, Merge는 이들을 모두 결합시킨 이미지 사진을 나타낸다. 이 때, 각 흡입 경로를 막는 약물로서 genistein(400μM), chlorpromazine(20㎍/ml), nocodazole (100μM), cytochalasin B(10μM)로 세포에 처리 후, 30분 동안 37℃에서 배양한 뒤, 실시예 2의 나노 리포좀을 처리하여 세포내 흡입 작용을 보았다. In order to confirm the influx of the nano liposomes of Example 2 into colon cancer cells, the nano liposomes of Example 2 were transferred to colon cancer cells (SW480 cells) for 24 hours in Cas9: gRNA (24.7 μg: 9.3 μg − Cas9 in total culture). Confocal fluorescence micrographs are shown in FIG. 6 by immunostaining with an antibody against Cas9 after treatment at concentrations of 24.7 μg and 9.3 μg gRNA). At this time, the drugs that can block the influx process were treated in colon cancer cells, respectively, and identified as a comparison group. For immunostaining, Cas9 protein of CFL-488 (Rabbit) was used to label intracellular Cas9 protein and image it with confocal fluorescence microscopy. The results are shown in Figure 6 representatively containing the guide RNA of SEQ ID NO: 1. In FIG. 6, DIC is an electron image photograph of a cell, DAPI is a DNA staining photograph, Cas9 is a CFL-488 staining photograph of the Cas9 protein, and Merge is an image photograph combining all of them. At this time, as a drug blocking each inhalation route, the cells were treated with genistein (400 μM), chlorpromazine (20 μg / ml), nocodazole (100 μM), cytochalasin B (10 μM), and then incubated at 37 ° C. for 30 minutes. The nano liposomes of Example 2 were treated to see intracellular inhalation.
도 6을 참고하면, Control에서는 실시예 2의 나노 리포좀 처리로 인해 대장암 세포의 핵 내로 RITC와 Cas9 단백질이 잘 주입되어 있음을 알 수 있으며, genistein, chloropromazine, nocodazole 등의 약물 처리군, 세포가 에너지를 사용하지 못하는 4℃에서 약물의 세포내 흡입작용이 억제된 것을 나타내며, 이를 통해 본 발명의 나노 리포좀은 클라스린 의존성 세포내흡입, 대음세포작용, 에너지 의존적으로 세포내흡입을 한다는 것을 확인할 수가 있다. Referring to FIG. 6, the control shows that RITC and Cas9 proteins are well injected into the nucleus of colorectal cancer cells due to the nanoliposome treatment of Example 2, and drug treatment groups such as genistein, chloropromazine, nocodazole, and cells Intracellular inhalation of the drug is inhibited at 4 ° C. in which no energy is used. Through this, the nanoliposome of the present invention can be confirmed that the intracellular intake of clathrin-dependent intracellular inhalation, macrophage, and energy dependence. have.
외부 물질이 세포 안으로 들어가는 흡입 경로는 크게 5가지로 나눌 수가 있는데, 세포의 표면에서 막의 일부가 밖으로 돌출되면서 입자를 둘러싸서 삼키는 식세포작용(phagocytosis), 막루플링(membrane ruffling)으로 인해 액틴필라멘트(actin filament)가 활발하게 중합하면서 입자를 흡입하는 대음세포작용(macropinocytosis), 세포질 쪽의 클라스린(chlatrin)이라는 단백질을 이용하는 클라스린 의존성 세포내흡입(chlatrin mediated endocytosis), 콜레스테롤과 카베올린(caveolin)이라는 막단백질의 농도가 높은 곳을 이용하는 카베올린 의존성 세포내흡입(caveolin-dependent endocytosis), 클라스린과 카베올린 등과 같은 단백질을 사용하지 않는 흡입방법 (clatrin and caveolin independent endocytosis)이 있다. 이러한 각각의 흡입 경로를 막는 약물들이 있는데, genistein은 카베올린 의존성 세포내 흡입을 방해하고, chloropromazine 은 클라스린 의존성 세포내흡입을 방해, nocodazole은 대음세포작용을 억제, cytochalasin B 는 식세포작용을 억제한다. 한편, 4℃ 에서는 세포가 에너지를 사용하지 못하므로 에너지 의존적으로 세포내흡입작용을 억제할 수가 있다(Dos Santos T et al., 2011). There are five major inhalation pathways through which foreign material enters the cell: actin filaments due to phagocytosis and membrane ruffling, which encircle the particles as part of the membrane protrudes out of the cell's surface filament polymerizes the macromolecules (macropinocytosis) that actively inhales the particles, chlartrin-mediated endocytosis using the protein called clastrin on the cytoplasm, cholesterol and caveolin Caveolin-dependent endocytosis using high concentrations of membrane proteins, and clarinet and caveolin independent endocytosis without proteins such as clathrin and caveolin. There are drugs that block each of these inhalation pathways: genistein interferes with caveolin-dependent intracellular inhalation, chloropromazine interferes with claslin-dependent intracellular intake, nocodazole inhibits phagocytosis, and cytochalasin B inhibits phagocytosis. . On the other hand, at 4 ° C., cells do not use energy and thus can inhibit energy intake in a cell-dependent manner (Dos Santos T et al., 2011).
실험예 1-5. Experimental Example 1-5. KRASKRAS 발현 측정 - mRNA 발현량 확인  Expression Measurement-Confirmation of mRNA Expression
대장암 세포(HT29, SW480, SNU407)에 본 발명에서 제조한 각 나노 리포좀을 24시간 동안 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 처리 후 수집된 세포에 Trizol(invitrogen)을 이용하여 총RNA를 추출하였고, SuprimeScript RT premix 2x(GeNetBio)를 이용하여 cDNA를 합성하였다. Each of the liposomes prepared in the present invention was treated with colorectal cancer cells (HT29, SW480, SNU407) at a concentration of Cas9: gRNA (24.7 μg: 9.3 μg) for 24 hours, and then total cells were collected using Trizol (invitrogen). RNA was extracted and cDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).
KRAS의 mRNA 발현 확인을 위한 Real-time PCR은 SYBR green 2x Premix(Applied Biosystems)와 AB step one plus real-time PCR system(Applied Biosystems)을 활용하여 측정하였다. 이 때 검출에 사용한 primer의 염기서열은 다음과 같다. Real-time PCR for KRAS mRNA expression was measured using SYBR green 2x Premix (Applied Biosystems) and AB step one plus real-time PCR system (Applied Biosystems). At this time, the nucleotide sequence of the primer used for detection is as follows.
KRAS sense : GACTGAATATAAACTTGTGGTAGTTGGA KRAS sense: GACTGAATATAAACTTGTGGTAGTTGGA
KRAS antisense : TCCTCTTGACCTGCTGTGTCGKRAS antisense: TCCTCTTGACCTGCTGTGTCG
GAPDH sense : GCACCGTCAAGGCTGAGAAGAPDH sense: GCACCGTCAAGGCTGAGAA
GAPDH antisense : AGGGATCTCGCTCCTGGAAGAPDH antisense: AGGGATCTCGCTCCTGGAA
상기 결과는 도 7c에 나타냈으며 실시예 2의 나노리포좀 처리로 인해 모든 대장암 세포에서 KRAS 단백질 발현이 현저하게 감소되는 결과를 확인할 수 있다.The results are shown in Figure 7c and can be confirmed that the results of the KRAS protein expression is significantly reduced in all colon cancer cells due to the nanoliposomal treatment of Example 2.
한편, 실시예 2의 나노 리포좀 외에 각 비교예 나노 리포좀의 mRNA 발현량은 하기에 나타내었다. On the other hand, in addition to the nano liposomes of Example 2, the mRNA expression amount of each comparative nano liposome is shown below.
KRAS mRNA　발현량 KRAS mRNA expression HT29 세포 실험 (fold)HT29 cell experiment (fold) SW480 세포 실험 (fold)SW480 cell experiment (fold) SNU407 세포 실험 (fold)SNU407 cell experiment (fold)
대조군Control 1.001.00 1.001.00 1.001.00
실시예 2Example 2 0.050.05 0.130.13 0.200.20
비교예 1Comparative Example 1 0.980.98 0.990.99 1.001.00
비교예 2Comparative Example 2 0.490.49 0.720.72 0.620.62
비교예 3Comparative Example 3 0.780.78 0.810.81 0.720.72
비교예 4Comparative Example 4 0.470.47 0.480.48 0.670.67
실험예 1-6. Experimental Example 1-6. KRASKRAS 관련 세포 신호 전달 물질의 단백질 발현량 확인  Confirmation of Protein Expression of Related Cell Signal Transmitters
mRNA 발현 확인 실험과 동일한 조건으로 나노 리포좀을 처리한 대장암 세포(SW480) 처리군과 함께, 이 이외에도 나노 리포좀 처리 24시간 후 배양액을 교체하여 Cetuximab(10㎍/mL) 24시간 동안 추가 처리한 군, Cetuximab(10㎍/mL) 24시간 단일 처리군을 준비한 후, 세포를 수집하고, 상기 세포에 RIPA Buffer(Sigma)를 처리하여 단백질을 추출한 후 단백질의 발현을 확인하였다. In addition to the group treated with colon cancer cells (SW480) treated with nano liposomes under the same conditions as the mRNA expression confirming experiment, the group was further treated for 24 hours with Cetuximab (10 µg / mL) by replacing the culture solution after 24 hours of nano liposome treatment. After preparing a single treatment group, Cetuximab (10 μg / mL) for 24 hours, cells were collected, the cells were treated with RIPA Buffer (Sigma), and the protein was extracted and the expression of the protein was confirmed.
각 단백질은 대장암 세포에서 나타나는 Cetuximab 관련 세포 신호전달(도 7e 및 도 7f)에 따라, Ras, 인산화된 Erk1/2, 인산화된 Akt의 신호전달 관계를 anti-Ras(rabbit), anti-p-Akt(rabbit), anti-p-Erk1/2(rabbit), anti-GAPDH(mouse)로 확인하였다. 이 때, KRAS 만을 인식하는 항체 대신 Ras family(KRAS, NRAS, HRAS)의 총 단백질을 인식하는 항체를 사용하였는데, 본 발명의 나노 리포좀은 KRAS 단백질의 발현에만 영향을 주기 때문에 Ras 전체 단백질에서 나노 리포좀 처리 후 줄어든 단백질의 양은 KRAS가 줄어든 양과 일치한다. Each protein is responsible for the anti-Ras (rabbit), anti-p- signal transduction relationships between Ras, phosphorylated Erk1 / 2, and phosphorylated Akt, according to Cetuximab-related cell signaling (Figure 7e and 7f) in colorectal cancer cells. Akt (rabbit), anti-p-Erk1 / 2 (rabbit), anti-GAPDH (mouse) was confirmed. At this time, KRAS Ras instead of only recognizing antibodies Antibodies that recognize the total protein of the family (KRAS, NRAS, HRAS) was used, the nano liposome of the present invention is KRAS Because it only affects protein expression, the amount of protein reduced after nanoliposomal treatment in the entire Ras protein is consistent with the amount of KRAS reduction.
도 7d를 참고하면 Cetuximab 실시예 2의 나노 리포좀만 처리된 대장암 세포에서 Erk 1/2와 Akt 단백질의 인산화 정도가 현저하게 줄어들어 본 발명의 나노 리포좀은 Cetuximab에 대한 약물 저항성이 있는 대장암에서 KRAS 발현 과정을 제어하는 것으로 확인된다. Referring to FIG. 7D, the degree of phosphorylation of Erk 1/2 and Akt protein was significantly reduced in colorectal cancer cells treated with only the nanoliposomes of Cetuximab Example 2, and thus, the nanoliposomes of the present invention were KRAS in colorectal cancers resistant to Cetuximab. It is found to control the expression process.
한편, 이 때의 KRAS, Erk 1/2 및 Akt가 Cetuximab 처리된 대장암 세포에서 일어나는 과정을 도 7e와 도 7f의 a~e에 나타내었다. On the other hand, KRAS, Erk 1/2 and Akt at this time occurs in Cetuximab-treated colon cancer cells are shown in Figures 7e and 7f a-e.
도 7e의 a에서는 정상 대장암 세포(KRAS 정상)에서는 세포막에 EGFR 이라는 receptor가 존재하여 EGFR ligand에 의해서 dimer 형태가 되면서 auto-phosphorylation에 의해 하위 단백질(PI3K, KRAS)들에 신호를 주게 되는데, 그 신호 중 PI3K 단백질은 Akt 단백질을 인산화하여 세포의 생존(survival)에 영향을 주게 되고, KRAS 단백질이 Erk 단백질을 인산화하여 암세포의 증식에 영향을 주는 것을 나타낸다. In a of FIG. 7E, in a normal colon cancer cell (normal KRAS ), a receptor called EGFR is present in the cell membrane, which forms a dimer by the EGFR ligand, thereby signaling lower proteins (PI3K, KRAS) by auto-phosphorylation. In the signal, PI3K protein phosphorylates Akt protein, which affects the survival of cells, and KRAS protein phosphorylates Erk protein, indicating that it affects the proliferation of cancer cells.
도 7e의 b는 도 7e의 a에서와 같이 대장암 세포가 증식되는 것을 억제하기 위해 개발된 약물이 항체 치료제인 Cetuximab인데, 이 Cetuximab은 EGFR에 결합하여 EGFR이 dimer를 형성하지 못하게 차단하여, EGFR의 신호를 받는 하위 단백질인 PI3K나 KRAS가 작용하지 않아 세포의 생존과 증식이 억제되는 것을 설명한다. FIG. 7E b is Cetuximab, an antibody therapeutic drug developed to inhibit the proliferation of colorectal cancer cells as in a of FIG. 7E, which binds to EGFR and blocks EGFR from forming dimers. Explain that the survival and proliferation of cells are suppressed because PI3K or KRAS, which is a sub-protein that receives the signal of, does not work.
도 7e의 c에서는 Cetuximab을 처리 하더라도 대장암 세포가 죽지 않는 이유는 Cetuximab에 의해 EGFR의 신호를 받지 못 하더라도 KRAS 유전자에 돌연변이가 일어나 KRAS 단백질이 계속 활성화되어 Erk 단백질을 인산화하여 세포의 증식에 영향을 주는 과정을 설명한다. In FIG. 7E, even when Cetuximab is treated, colon cancer cells do not die even though they do not receive EGFR signal by Cetuximab, but mutation of the KRAS gene causes KRAS protein to be activated, which phosphorylates Erk protein to affect cell proliferation. Explain the giving process.
도 7f의 d에서는 실시예 2의 Cas9 단백질과 KRAS 유전자를 편집할 수 있는 가이드 RNA가 포함되어 있는 나노 리포좀을 세포에 전달하여 대장암 세포에서의 KRAS 단백질을 억제하는 과정을 설명한다. 7F illustrates a process of inhibiting KRAS protein in colorectal cancer cells by delivering a nanoliposome containing the RNA of the Cas9 protein and the KRAS gene of Example 2 to the cell.
도 7f의 e에서는 나노 리포좀에 의해 유전자 편집된 대장암 세포에 Cetuximab을 처리 하면 도 7e의 b와 같이 2가지 세포 신호전달 과정이 차단되어 KRAS 돌연변이가 있는 대장암 환자에게서도 Cetuximab의 효과를 볼 수 있음을 설명한다. In FIG. 7F, the treatment of Cetuximab in colorectal cancer cells genetically edited by nanoliposomes blocks two cellular signaling processes as shown in b of FIG. 7E, and thus the effect of Cetuximab can be seen in colorectal cancer patients with KRAS mutations. Explain.
<실험예 2. 세포 생존율 및 증가율 확인>Experimental Example 2. Confirmation of Cell Viability and Growth Rate
세포 생존율의 확인은 WST-1 어세이(EZ-cytox Cell Viability Assay Kit)를 통해 진행하였다. 대장암 세포(HT29, SW480, SNU407)를 96well plate에 1x104/well의 밀도로 24시간 배양하였다. 이 후 실시예 2의 나노 리포좀을 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 처리하고 24시간 후, Cetuximab이 농도별(0.1㎍/mL, 1㎍/mL, 10㎍/mL, 100㎍/mL)로 처리된 배지로 교체하고 다시 24시간 후 그대로 WST-1 시약을 첨가하였다. WST-1 시약을 배양액의 10% 넣고, 1시간 후에 460 nm에서 흡광도를 측정하여 세포 생존 및 증식을 대조군(비처리군)과 비교 하였다. 세포 생존 평가는 나노 리포좀 처리 후 72시간 동안 24시간을 주기로 측정하였다. Confirmation of cell viability was performed through the WST-1 assay (EZ-cytox Cell Viability Assay Kit). Colon cancer cells (HT29, SW480, SNU407) were incubated for 24 hours at a density of 1 × 10 4 / well in 96well plate. Subsequently, the nano liposomes of Example 2 were treated with the concentration of Cas9: gRNA (24.7 μg: 9.3 μg), and after 24 hours, the Cetuximab concentrations (0.1 μg / mL, 1 μg / mL, 10 μg / mL, 100 μg / mL) and the WST-1 reagent was added intact after 24 hours. 10% of the WST-1 reagent was added to the culture solution, and after 1 hour, the absorbance was measured at 460 nm, and cell survival and proliferation were compared with the control (untreated group). Cell survival evaluation was measured at 24 hours for 72 hours after nano liposome treatment.
이 때, 도 8a는 Cetuximab만 처리한 세포 실험군에 대한 결과이며, 도 8b는 본 발명 실시예 2의 나노 리포좀을 처리한 후 Cetuximab을 처리한 세포 실험군에 대한 결과로서, 실시예 2의 나노 리포좀을 처리한 KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포의 생존 및 증식이 현저하게 감소하는 것이 확인된다. 이러한 결과는 본 발명의 실시예 2의 나노 리포좀이 KRAS 돌연변이형 세포에서 Cetuximab의 대장암 세포 사멸 효과를 효과적으로 유도할 수 있음을 뜻한다. At this time, Figure 8a is a result for the cell experimental group treated with only Cetuximab, Figure 8b is a result for the cell experimental group treated with Cetuximab after the nano liposome of Example 2 of the present invention, the nano liposome of Example 2 Survival and proliferation of SW480 and SNU407 cells with the treated KRAS mutant gene were significantly reduced. These results indicate that the nano liposomes of Example 2 of the present invention can effectively induce the effect of Cetuximab colon cancer cell death in KRAS mutant cells.
한편, 도 8a와 도 8b의 그래프의 각 농도 표시는 Cetuximab의 처리농도를 의미한다. Meanwhile, each concentration display in the graphs of FIGS. 8A and 8B means a treatment concentration of Cetuximab.
<실험예 4. 세포 자살 단백질 확인>Experimental Example 4. Confirmation of Cell Suicide Protein
비교예 1의 나노 리포좀과 실시예 2의 나노 리포좀을 SW480 세포에 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 처리하고 24시간 후, Cetuximab 10㎍/mL이 처리된 배지로 교체하여 Human Apoptosis Array Kit(R&D Systems Inc, ARY009)를 이용하여 세포자살(apoptosis) 관련 단백질들의 발현 여부를 확인하였다. 비교예 1의 나노 리포좀을 control로 삼은 것은 나노 리포좀 자체에 의해서 세포자살이 일어나지 않음을 비교하기 위해서이다. The nano liposomes of Comparative Example 1 and the nano liposomes of Example 2 were treated with SW9 cells at a concentration of Cas9: gRNA (24.7 μg: 9.3 μg) and replaced with medium treated with 10 μg / mL of Cetuximab after 24 hours. An array kit (R & D Systems Inc, ARY009) was used to confirm the expression of apoptosis-related proteins. The control of the nano liposomes of Comparative Example 1 is to compare the apoptosis does not occur by the nano liposomes themselves.
상기 결과는 도 9에 나타냈으며 실시예 2의 나노 리포좀을 처리한 실험군에서 세포 자살 관련 단백질들이 증가하였음을 확인할 수 있다. cleaved caspase-3 단백질은 pro-caspase-3가 잘린 형태로서 세포자살 과정에서 생성되는 최종 단백질이다. 이는 세포자살과정에 중요한 역할을 하는 단백질로서 cleaved caspase-3 단백질이 증가한다는 것은 apoptosis 과정이 진행된다는 것을 알 수가 있다. 또한Fas/TNFRSF6/CD95 단백질은 외부 신호에 인해 세포자살이 진행되었다는 것을 나타내며, SMAC/Diablo와 HTRA2/Omi 단백질 또한, anti-apoptosis 단백질을 억제하는 역할을 하는데, 이 단백질들이 증가하였다는 것은 세포자살이 진행되었다는 것을 알 수가 있다. 따라서, 본 발명의 나노 리포좀과 함께 Cetuximab을 처리하였을 때, Cetuximab에 대한 약물저항성이 있던 대장암 세포의 사멸이 효과적으로 수행됨을 알 수 있다. The results are shown in Figure 9, it can be seen that the cell suicide-related proteins increased in the experimental group treated with the nano liposome of Example 2. Cleaved caspase-3 protein is a truncated form of pro-caspase-3 and is the final protein produced during apoptosis. This is a protein that plays an important role in the apoptosis process. The increase of cleaved caspase-3 protein indicates that apoptosis progresses. In addition, the Fas / TNFRSF6 / CD95 protein indicates that apoptosis has progressed due to an external signal, and the SMAC / Diablo and HTRA2 / Omi proteins also play a role in inhibiting anti-apoptosis proteins. You can see that this is done. Therefore, it can be seen that when Cetuximab is treated with the nanoliposomes of the present invention, the death of colorectal cancer cells having drug resistance to Cetuximab is effectively performed.
<실험예 5. Caspase-3 활성 측정>Experimental Example 5. Measurement of Caspase-3 Activity
Caspase-3 활성을 Caspase-3 assay kit(Cell Signaling)를 사용하여 확인하였다. 실시예 2의 나노 리포좀을 대장암 세포(HT29, SW480, SNU407)에 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 24시간 동안 처리 후, Cetuximab(10㎍)이 포함된 배지로 교체하고 24시간 동안 처리하였다. 이 후, 각 세포로부터 단백질을 추출하고 추출 단백질에 1x assay buffer A와 substrate solution B를 200㎕ 넣어 혼합하고, 37℃에서 30분간 반응하였다. 반응 후 excitation 380nm와 emission 440nm 에서 형광값을 측정하여 활성을 측정한다. Caspase-3 activity Caspase-3 assay kit (Cell Signaling) was confirmed using. The nano liposomes of Example 2 were treated with colorectal cancer cells (HT29, SW480, SNU407) at a concentration of Cas9: gRNA (24.7 μg: 9.3 μg) for 24 hours, and then replaced with medium containing Cetuximab (10 μg). Treated for hours. Thereafter, the protein was extracted from each cell, 200 μl of 1x assay buffer A and substrate solution B were added to the extracted protein, mixed, and reacted at 37 ° C. for 30 minutes. After the reaction, the activity was measured by measuring the fluorescence value at excitation 380 nm and emission 440 nm.
상기 결과는 도 10에 나타냈으며, KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포 모두에서 나노 리포좀과 Cetuximab이 모두 처리시 Caspase-3 활성이 증가된 것을 확인할 수 있다. The results are shown in Figure 10, it can be confirmed that the Caspase-3 activity was increased when both the nano liposomes and Cetuximab in both HT29 cells with the KRAS normal gene, SW480, SNU407 cells with the KRAS mutant gene.
<실험예 6. 나노 리포좀의 봉입 효율 확인>Experimental Example 6. Confirmation of Encapsulation Efficiency of Nano-Liposomes
나노 리포좀을 합성 시작 시에 넣은 Cas9 단백질의 총량과, 나노 리포좀 합성 후 여액에 남은 Cas9 단백질 양을 웨스턴 블롯 실험 방법으로 측정하여 나노 리포좀의 봉입 효율을 확인하였다. 이 때 나노 리포좀을 제조 후, 원심분리기를 이용하여 13000rpm에 원심분리하면 나노 리포좀이 가라앉게 되고, 나노 리포좀에 봉입되지 않은 Cas9 단백질은 여액에 그대로 존재하기 때문에, 상기 여액을 취해서 나노 리포좀에 들어가지 않은 Cas9 단백질으로만 웨스턴 블롯 실험을 진행하였다. 나노 리포좀 제조 후 남은 여액에 잔류한 Cas9 단백질의 함량 비교를 통해 나노 리포좀의 봉입 효율이 용이하게 확인된다. The total amount of Cas9 protein added at the start of the synthesis of the nano liposomes and the amount of Cas9 protein remaining in the filtrate after the synthesis of the nano liposomes were measured by Western blot experiment to confirm the encapsulation efficiency of the nano liposomes. At this time, after preparing the nano liposomes, centrifugation at 13000 rpm using a centrifuge to sink the nano liposomes, and the Cas9 protein not encapsulated in the nano liposomes remain in the filtrate, so that the filtrate is taken into the nano liposomes. Western blot experiments were conducted with only Cas9 protein. Encapsulation efficiency of the nano liposomes is easily confirmed by comparing the content of the Cas9 protein remaining in the filtrate remaining after the preparation of the nano liposomes.
상기 봉입효율 결과는 서열번호 1의 가이드 RNA가 포함된 것을 대표로 하여 표 4 및 도 11에 나타내었다. The encapsulation efficiency results are shown in Table 4 and FIG. 11 with representative of the guide RNA of SEQ ID NO.
조건Condition 봉입효율 (%)Encapsulation Efficiency (%)
실시예 2Example 2 82.382.3
비교예 1Comparative Example 1 --
비교예 2Comparative Example 2 57.457.4
비교예 3Comparative Example 3 29.929.9
비교예 4Comparative Example 4 79.479.4
표 4는 도 11의 결과를 수치화하여 나타낸 것으로서, 가이드 RNA가 포함된 혼성체 또는 복합체의 봉입효율은 실시예 2와 비교예 4(항체/링커만 결합되지 않은 것)의 나노 리포좀에서 가장 좋음을 알 수 있다(비교예 1의 나노 리포좀 제조시 Cas9 단백질을 첨가하지 않았기에, 여액에도 역시 Cas9 단백질은 전혀 확인되지 않음 - 비교군으로 제시함) Table 4 shows the numerical results of Figure 11, the encapsulation efficiency of the hybrids or complexes containing the guide RNA was the best in the nano liposomes of Example 2 and Comparative Example 4 (without binding to the antibody / linker only) (Cas9 protein was not added in the preparation of nano liposomes of Comparative Example 1, so no Cas9 protein was also identified in the filtrate.)
<실험예 7. 나노 리포좀의 표면 전하, 크기 및 분산도 확인>Experimental Example 7. Confirmation of Surface Charge, Size and Dispersity of Nanoliposomes>
본 발명에서 제조한 나노 리포좀들의 표면 전하 변화(zeta potential, mV)와 크기 및 분산도를 Dynamic Light Scattering(DLS)로 측정하였으며, 서열번호 1의 가이드 RNA가 포함된 것을 대표로 하여 그 결과를 표 5에 나타내었다. Surface charge change (zeta potential, mV), size, and dispersion of the nano liposomes prepared in the present invention were measured by Dynamic Light Scattering (DLS). 5 is shown.
조건Condition 표면전하(mV)Surface charge (mV) 나노 입자 분포(nm)Nanoparticle distribution (nm) 나노 입자 평균 크기 (nm)Nanoparticle Average Size (nm)
실시예 2Example 2 -2.09-2.09 90 ~ 110090-1100 330330
비교예 2Comparative Example 2 -4.08-4.08 50~150, 800~430050 ~ 150, 800 ~ 4300 981981
비교예 3Comparative Example 3 -7.89-7.89 60~140, 1100~5200, 7800~820060 ~ 140, 1100 ~ 5200, 7800 ~ 8200 420420
비교예 4Comparative Example 4 -2.25-2.25 90 ~ 110090-1100 411411
세포 내로 가이드 RNA가 포함된 나노 리포좀을 전달하기 위해서는 (-) 전하를 띄는 표면전하값이 최대한 감소하는 것이 좋은데, 표 4를 참고하면 실시예 2의 나노 리포좀은 표면전하값이 낮은 편에 속한다. 비교예 2의 나노 리포좀 조건도 표면전하가 낮지만, 시간의 흐름에 따라 분산도가 낮아져 나노 리포좀의 안정성이 좋지 않음이 확인된다(분산도는 표에 기재하지 않음). 또한, 나노 리포좀의 입자크기 또한 실시예 2와 비교예 4의 나노 리포좀에 비해 비교예 2와 비교예 3의 나노 리포좀은 크기 분포가 균일하지 않은 것을 알 수 있다. In order to deliver the nano liposomes containing the guide RNA into the cell, it is desirable to reduce the surface charge value with negative charge as much as possible. Referring to Table 4, the nano liposomes of Example 2 belong to the lower surface charge value. The nano liposome condition of Comparative Example 2 also has a low surface charge, but it is confirmed that the dispersion degree is lowered with time, so that the stability of the nano liposome is not good (dispersion degree is not shown in the table). In addition, the particle size of the nano liposomes also compared to the nano liposomes of Example 2 and Comparative Example 4 it can be seen that the nano liposomes of Comparative Example 2 and Comparative Example 3 is not uniform in size distribution.

Claims (8)

  1. Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 것을 특징으로 하는 나노 리포좀 전달체 조성물. A nanoliposome carrier composition comprising a complex of a Cas9 protein, a guide RNA that inhibits the expression of the KRAS gene, and a cationic polymer.
  2. 제1항에 있어서,The method of claim 1,
    상기 KRAS 유전자의 발현을 억제하는 가이드 RNA는 서열번호 1 또는 2의 염기서열을 포함하는 것을 특징으로 하는 나노 리포좀 전달체 조성물.Guide RNA for inhibiting the expression of the KRAS gene is a nano liposome delivery composition, characterized in that it comprises a nucleotide sequence of SEQ ID NO: 1 or 2.
  3. 제1항에 있어서,The method of claim 1,
    상기 나노 리포좀은 레시틴, 콜레스테롤, 양이온성 인지질 및 메탈 킬레이팅 지질을 포함하는 것을 특징으로 하는 나노 리포좀 전달체 조성물. The nano liposome is a nano liposome carrier composition, characterized in that it comprises lecithin, cholesterol, cationic phospholipids and metal chelating lipids.
  4. 제1항에 있어서,The method of claim 1,
    상기 나노 리포좀에는 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합된 것을 특징으로 하는 나노 리포좀 전달체 조성물. The nano liposomes may recognize one or more proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epithelial cell adhesion molecule (EpCAM), carcinoembryonic antigen (CEA), and annexin (Annexins) expressed in colorectal cancer cells. Nanoliposome delivery composition, characterized in that the monoclonal or polyclonal antibody can be bound.
  5. 제1항에 있어서,The method of claim 1,
    상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 갖는 것을 특징으로 하는 나노 리포좀 전달체 조성물. The nano liposome is a nano liposome delivery composition, characterized in that having a particle size of 10 ~ 2,000 nm.
  6. 제1항 내지 제5항 중 어느 한 항의 나노 리포좀 전달체 조성물을 함유하는 것을 특징으로 하는 대장염의 개선 또는 치료용 조성물. A composition for improving or treating colitis, comprising the nanoliposome carrier composition of any one of claims 1 to 5.
  7. 제6항에 있어서, The method of claim 6,
    상기 나노 리포좀 전달체 조성물에 세툭시맵(Cetuximab)이 첨가된 것을 특징으로 하는 대장염의 개선 또는 치료용 조성물. Cetuximab (Cetuximab) is added to the nano liposome delivery composition composition for improving or treating colitis.
  8. Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 제조하고, 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; Preparing a lipid film composition by preparing a complex of Cas9 protein, guide RNA that inhibits expression of KRAS gene and cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipid on chloroform;
    상기 지질 필름 조성물에, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 넣어 초음파 처리하는 제2단계; A second step of sonicating the lipid film composition by inserting a complex of a Cas9 protein, a guide RNA that inhibits the expression of the KRAS gene, and a cationic polymer;
    상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계;A third step of freezing and melting the sonicated lipid film composition and then again ultrasonicating;
    상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및,A fourth step of centrifuging the lipid film composition sonicated in the third step and recovering the nano liposomes in the precipitate; And,
    상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제5단계; A fifth step of binding the antibody to the nano liposome in the precipitate obtained in the fourth step through a crosslinking agent;
    를 포함하는 것을 특징으로 하는 대장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법.Method for producing a nano liposome delivery composition that can selectively recognize a colon cancer cell comprising a.
PCT/KR2017/014453 2016-12-29 2017-12-11 Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation WO2018124538A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201780067497.0A CN110325176B (en) 2016-12-29 2017-12-11 Nanoliposome carrier compositions

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160182153A KR101796036B1 (en) 2016-12-29 2016-12-29 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance
KR10-2016-0182153 2016-12-29

Publications (1)

Publication Number Publication Date
WO2018124538A1 true WO2018124538A1 (en) 2018-07-05

Family

ID=60386387

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/014453 WO2018124538A1 (en) 2016-12-29 2017-12-11 Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation

Country Status (3)

Country Link
KR (1) KR101796036B1 (en)
CN (1) CN110325176B (en)
WO (1) WO2018124538A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112359060A (en) * 2020-11-11 2021-02-12 吉林医药学院 Recombinant vector containing targeted mutant KRAS fusion gene, fusion protein and protein complex, and construction method and application thereof

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101796036B1 (en) * 2016-12-29 2017-11-10 주식회사 무진메디 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance
KR102206676B1 (en) 2017-06-14 2021-01-26 한국과학기술원 Nonviral genome editing CRISPR nanocomplex and fabrication method thereof
JP2023516225A (en) * 2020-04-24 2023-04-18 アーディジェン， エルエルシー Compositions and uses thereof for treating cancers with KRAS mutations
KR102328197B1 (en) 2021-03-09 2021-11-17 주식회사 무진메디 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204728A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
US8940486B2 (en) * 2010-01-12 2015-01-27 Siemens Healthcare Diagnostics Inc. Oligonucleotides and methods for detecting KRAS and PIK3CA mutations
WO2016049024A2 (en) * 2014-09-24 2016-03-31 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo
KR101796036B1 (en) * 2016-12-29 2017-11-10 주식회사 무진메디 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2011503070A (en) * 2007-11-09 2011-01-27 ノースイースタン・ユニバーシティ Self-assembled micelle-like nanoparticles for systemic gene delivery
CN105899658B (en) * 2013-12-12 2020-02-18 布罗德研究所有限公司 Delivery, use and therapeutic applications of CRISPR-CAS systems and compositions for HBV and viral diseases and disorders
CA2981508A1 (en) * 2015-04-01 2016-10-06 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating duchenne muscular dystrophy and becker muscular dystrophy
KR101710026B1 (en) 2016-08-10 2017-02-27 주식회사 무진메디 Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA
CN106109417A (en) * 2016-08-24 2016-11-16 李因传 A kind of bionical lipidosome drug carrier of liver plasma membrane, manufacture method and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8940486B2 (en) * 2010-01-12 2015-01-27 Siemens Healthcare Diagnostics Inc. Oligonucleotides and methods for detecting KRAS and PIK3CA mutations
WO2014204728A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
WO2016049024A2 (en) * 2014-09-24 2016-03-31 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo
KR101796036B1 (en) * 2016-12-29 2017-11-10 주식회사 무진메디 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DI FIORE, F.: "Clinical relevance of KRAS mutation detection in metastatic colorectal cancer treated by Cetuximab plus chemotherapy", BRITISH JOURNAL OF CANCER, vol. 96, no. 8, 2007, pages 1166 - 1169 , 1166-1168, XP055612832 *
HUANG, S.-L.: "Acoustically active liposomes for drug encapsulation and ultrasound-triggered release", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1665, 2004, pages 134 - 141 135 137, XP004592242 *
KEE, P. H.: "Synthesis, acoustic stability, and pharmacologic activities of papaverine-loaded echogenic liposomes for ultrasound controlled drug delivery", JOURNAL OF LIPOSOME RESEARCH, 2008, pages 263 - 277, XP055603832, DOI: doi:10.1080/08982100802354558 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112359060A (en) * 2020-11-11 2021-02-12 吉林医药学院 Recombinant vector containing targeted mutant KRAS fusion gene, fusion protein and protein complex, and construction method and application thereof
CN112359060B (en) * 2020-11-11 2022-12-23 吉林医药学院 Recombinant vector containing targeted mutant KRAS fusion gene, fusion protein and protein complex, and construction method and application thereof

Also Published As

Publication number Publication date
KR101796036B1 (en) 2017-11-10
CN110325176B (en) 2021-08-24
CN110325176A (en) 2019-10-11

Similar Documents

Publication Publication Date Title
WO2018124538A1 (en) Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation
WO2018030608A1 (en) Nanoliposome carrier composition containing hybrid of cas9 protein and guide rna
Mäkelä et al. Alternative forms of Max as enhancers or suppressors of Myc-ras cotransformation
WO2022191431A1 (en) Nanoliposome carrier composition having kras and p53 gene editing function
BR112012013662B1 (en) LIPOCALIN MUTEINS ASSOCIATED WITH HUMAN NEUTROPHIL GELATINASE (LCN2, HNGAL), THEIR USE AND THEIR GENERATION AND PRODUCTION METHODS, NUCLEIC ACID MOLECULE, HOST CELL, PHARMACEUTICAL COMPOSITION AND DIAGNOSIS OR ANALYTICAL KIT
CA3017701C (en) Use of pten-long leader sequence for transmembrane delivery of molecules
WO2019212324A1 (en) Targeting m2-like tumor-associated macrophages by using melittin-based pro-apoptotic peptide
JP5973035B2 (en) Identification of extracellular forms of PTEN that can be used to treat tumors
WO2009134027A2 (en) Anti-nucleic acid antibody inducing cell death of cancer cells and composition for preventing or treating cancers comprising the same
WO2019078611A1 (en) Nanoliposome-microbubble conjugate having cas9 protein, guide rna for inhibiting expression of srd5a2 gene and cationic polymer complex encapsulated therein, and hair loss relieving or treating composition containing same
WO2014183491A1 (en) Polypeptide having anti-tumor activity and use thereof
WO2015005723A1 (en) Cell-penetrating peptide and conjugate comprising same
AU2006244080B2 (en) Use of peptides derived from the growth factor AMP-18 for the treatment of mucositis
EP0977580B1 (en) MATERIALS AND METHODS RELATING TO INHIBITING THE INTERACTION OF p53 AND mdm2
EP2754451A1 (en) The use of ache as nuclease
WO2011013912A2 (en) Pharmaceutical composition for enhancing radiation therapy for cancer, and method for screening active material for enhancing radiation therapy for cancer
WO2021194186A1 (en) Composition comprising vgll1 peptide for treatment of cancer
WO2020165570A1 (en) Methods relating to disrupting the binding of af9 partner proteins to af9 and/or enl
WO2022065725A1 (en) Polynucleotide for cancer treatment, encoding 5&#39;-nucleotidase modified protein
WO2022065724A1 (en) Cd47 binder and liposome complex for treating cancer
WO2022065726A1 (en) Liposome complex for cancer treatment, comprising novel cd47 binder and polynucleotide
WO2021025352A1 (en) Anticancer virus expressing fgf2- or api5-derived peptide, and use thereof
CN111100189B (en) Polypeptide for treating cancer and pharmaceutical composition thereof
WO2023195802A1 (en) Novel-peptide-based anticancer immunotherapeutic agent
AU4373599A (en) Human homologue of unc-53 protein of (c. elegans)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17888183

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205N DATED 16.10.2019)

122 Ep: pct application non-entry in european phase

Ref document number: 17888183

Country of ref document: EP

Kind code of ref document: A1