KR101796036B1 - Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance - Google Patents

Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance Download PDF

Info

Publication number
KR101796036B1
KR101796036B1 KR1020160182153A KR20160182153A KR101796036B1 KR 101796036 B1 KR101796036 B1 KR 101796036B1 KR 1020160182153 A KR1020160182153 A KR 1020160182153A KR 20160182153 A KR20160182153 A KR 20160182153A KR 101796036 B1 KR101796036 B1 KR 101796036B1
Authority
KR
South Korea
Prior art keywords
nanoliposome
kras
guide rna
cas9 protein
gene
Prior art date
Application number
KR1020160182153A
Other languages
Korean (ko)
Inventor
류지연
유경남
Original Assignee
주식회사 무진메디
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 무진메디 filed Critical 주식회사 무진메디
Priority to KR1020160182153A priority Critical patent/KR101796036B1/en
Application granted granted Critical
Publication of KR101796036B1 publication Critical patent/KR101796036B1/en
Priority to CN201780067497.0A priority patent/CN110325176B/en
Priority to PCT/KR2017/014453 priority patent/WO2018124538A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6863—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from stomach or intestines cancer cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A61K47/6913—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome the liposome being modified on its surface by an antibody
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1277—Processes for preparing; Proliposomes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Dispersion Chemistry (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Endocrinology (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a nanoliposome carrier composition encapsulating Cas9 protein, a guide RNA suppressing the expression of KRAS gene, and a cationic polymer; or to a therapeutic agent for anticancer drug-resistant colorectal cancer induced by KRAS mutation comprising the same. Cetuximab, which is currently used as a drug for metastatic colorectal cancer, is only effective in patients with KRAS-normal colorectal cancer, and has a critical disadvantage that even in the patients with KRAS-normal colorectal cancer, when continuously treated with Cetuximab, 60-80% of these patients may develop into KRAS-mutant type. However, by using the nanoliposome composition of the present invention, mutations of KRAS, a colorectal cancer-causing gene, can be fundamentally prevented, and the treatment of KRAS-mutant metastatic colorectal cancer can be carried out very effectively.

Description

Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암 치료제 {Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance}The present invention relates to a nanoliposome transporter composition containing a complex of Cas9 protein, a guide RNA for inhibiting the expression of the KRAS gene and a complex of a cationic polymer or a therapeutic agent for cancer-resistant colon cancer comprising the KRAS gene mutation containing the same, , guide RNA for repressing gene expression or KRAS gene and cationic polymer, or KRAS mutation colon cancer with anticancer drug resistance}

본 발명은 Cas9 단백질, 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. 보다 자세하게는 본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암의 개선 또는 치료용 조성물에 관한 것이다. The present invention relates to a nanoliposome carrier composition in which a complex of Cas9 protein, guide RNA and cationic polymer is encapsulated. More particularly the invention Cas9 protein, KRAS KRAS composition for the improvement or treatment of chemotherapy-resistant cancer of the mutation to the guide RNA and cationic polymers to inhibit the expression of genes that contain the nano-liposome delivery system composition or it filled composite .

유전자 편집 기술은 미생물의 적응면역에서 비롯된 기술이다. 박테리오파지 감염에 박테리오파지의 단편을 DNA로 기억하고 있다가 재감염 되었을 때 유전자 가위 역할을 하는 누클레아제(nuclease)인 Cas9(CRISPR associated protein 9 : RNA-guided DNA endonuclease enzyme)으로 잘라 없애는 면역 시스템에서 시작되었다. 이는 유전체에서도 특정 염기 서열을 가이드 RNA(guide RNA, gRNA)에 의해서 인식 가능하면 원하는 부위를 잘라 고칠 수 있는 유전자 교정 기술로 발전하였다(Woo JW et al., 2015).Genetic editing technology is a technology derived from adaptive immunization of microorganisms. In the immune system, which recruits bacteriophage fragments to bacteriophage infections and then cleaves them with Cas9 ( C RISPR as sociated protein 9 ), a nuclease that acts as a gene scissor when reinfected, It started. This has led to the development of genetic engineering techniques that can cut out the desired site if the specific nucleotide sequence is recognized by the guide RNA (gRNA) (Woo JW et al., 2015).

이는 불치병으로 분리되었던 유전자 이상으로 유도된 질환에서 질병의 근본원인을 치료할 수 있는 방법으로 각광받고 있다. 하지만 유전자 편집 시스템의 효율적인 체내 전달과 목표 유전자가 아닌 다른 유전자를 자르는 off targeting 등의 해결해야 하는 문제점들을 가지고 있다. 특히 초기 방식인 Cas9 플라스미드를 사용한 유전자 편집 시스템은 체내 전달시의 항생제 저항성, 여러 면역 반응 등의 안전성에 대한 검증이 필요하였다. 최근에는 단백질로 이뤄진 유전자 가위(Cas9)와 가이드 RNA를 실험관내에서 만들어 전달하는 시스템이 그 대안으로 적용되고 있으나 이 또한 세포내 효율적인 전달과 단백질과 RNA의 안정성에 대한 문제가 제기되고 있다(Ramakrishna S et al., 2014). It is being watched as a way to treat the root cause of the disease in diseases induced by gene disorders that have been isolated as incurable diseases. However, it has problems to be solved such as efficient delivery of the gene editing system in the body and off targeting of genes other than the target gene. Especially, the gene editing system using Cas9 plasmid, which is an early method, needs to verify the safety of antibiotic resistance and various immune responses in the body. In recent years, a system for delivering and delivering gene cassettes (Cas9) and guide RNAs in a laboratory has been applied as an alternative, but this also raises the problem of efficient intracellular delivery and stability of protein and RNA (Ramakrishna S et al., 2014).

대장암은 대장에 생긴 암세포로 이루어진 악성 종양을 말한다. 대장은 소장에서 넘어온 음식물로부터 수분을 모두 흡수 한 뒤 직장에 모아 두었다가 대변의 형태로 배설시키는 역할을 하고 있기 때문에 영양 성분 보다는 발암 물질을 포함하는 노폐물이나 우리 몸에서 불필요한 물질들이 대장에 모여 상대적으로 다른 기관에 비해 암세포가 자라기 쉽다. Colon cancer refers to a malignant tumor consisting of cancer cells in the large intestine. Because the colon absorbs all the water from the food in the small intestine and collects it in the rectum and excretes it in the form of feces, waste materials containing carcinogens rather than nutrients or unnecessary substances in the body are collected in the colon Cancer cells are more likely to grow compared to organs.

기존 대장암 치료는 외과적인 수술과 항암화학요법이 이루어지는데, 대표적 표적 치료 요법으로 'Cetuximab(Erbitux) 주사제'가 쓰이고 있다. Cetuximab은 표피성장인자수용체(Epidermal growth factor receptor, EGFR)를 표적으로 하는 단일클론항체로 대장암 세포 표면의 EGFR에 특이적으로 결합하여, 암세포 증식을 일으키는 신호 전달 과정 중 특정 부분을 억제하여 암세포의 전반적인 증식을 억제한다. 하지만 대장암 유발 유전자인 KRAS에 돌연변이를 가지고 있는 환자(전체 대장암 환자의 40~50%)들은 이 주사제로 치료가 어렵다. 또한, KRAS 유전자가 정상적인 대장암 환자이더라도 지속적으로 Cetuximab 치료를 받게 되면, 60~80%가 KRAS 유전자에 돌연변이가 생긴다. Existing colorectal cancer treatment is performed through surgical operation and chemotherapy. Cetuximab (Erbitux) injection is used as a typical target therapy. Cetuximab is a monoclonal antibody that targets Epidermal Growth Factor Receptor (EGFR), specifically binds to EGFR on the surface of colon cancer cells, inhibiting certain parts of the signal transduction that cause cancer cell proliferation, It suppresses overall proliferation. However, patients with mutations in the colorectal cancer-causing mutation KRAS (40-50% of all colorectal cancer patients) are difficult to treat with this injection. In addition, even if the KRAS gene is a normal colorectal cancer patient, 60-80% of KRAS genes mutate when it is continuously treated with Cetuximab.

KRAS 유전자는 대장암의 발생에 연관된 여러 유전자 중 하나이며, Cetuximab과 같은 맞춤치료의 효과 여부를 판단하기 위해 본 유전자의 돌연변이 여부로 대장암 환자의 약물의 반응 및 생존 기간을 의미 있게 개선시키는 것으로 알려져 있어 매우 중요하게 여겨지고 있다. The KRAS gene is one of several genes involved in the development of colorectal cancer, and it is known that mutation of this gene significantly improves the response and survival period of drugs in patients with colorectal cancer in order to determine the effectiveness of customized therapies such as Cetuximab It is considered very important.

한편 세포 내 약물 전달 시스템에서 요구되는 중요 두가지 성질은 효율성과 세포 독성(안전성)으로서, 콜레스테롤이나 지질 등으로 구성된 나노 리포좀 전달체 기술이 폭넓게 사용되고 있다(Zuris JA et al., 2015). On the other hand, two important properties required in intracellular drug delivery systems are efficiency and cytotoxicity (safety), and nanoliposome transporter technology consisting of cholesterol and lipid is widely used (Zuris JA et al., 2015).

이에 본 발명자들은 유전자 편집을 통한 대장암 치료를 위해 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 나노 리포좀에 봉입함으로써 약물전달 효율이 좋은 세포 전달체를 제조하고, 이를 대장암 체료제로서 이용함으로써 본 발명을 완성할 수 있었다. Accordingly, the present inventors prepared a cell transporter having a good drug delivery efficiency by encapsulating a complex of Cas9 protein, a guide RNA for inhibiting the expression of the KRAS gene and a cationic polymer into a nanoliposome for colon cancer treatment through gene editing, The present invention can be completed by using it as a cancer agent.

대한민국 공개특허 제10-2015-0101476호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)Korean Patent Laid-Open No. 10-2015-0101476 (the title of the invention: a composition for cleaving a target DNA comprising a nucleic acid encoding a guide RNA specific to a target DNA and a Cas protein, or a Cas protein, and its use, applicant: Tulsa, released on September 03, 2015) 대한민국 공개특허 제10-2015-0101477호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)Korean Patent Laid-Open No. 10-2015-0101477 (title of the invention: a composition for cleaving a target DNA comprising a nucleic acid or Cas protein encoding a guide RNA and Cas protein specific to a target DNA, and its use, applicant: Tulsa, released on September 03, 2015) 대한민국 공개특허 제10-2015-0101478호 (발명의 명칭 : 표적 DNA에 특이적인 가이드 RNA 및 Cas 단백질을 암호화하는 핵산 또는 Cas 단백질을 포함하는, 표적 DNA를 절단하기 위한 조성물 및 이의 용도, 출원인 : 주식회사 툴젠, 공개일 : 2015년09월03일)Korean Patent Laid-Open No. 10-2015-0101478 (the title of the invention: a composition for cleaving a target DNA comprising a nucleic acid or Cas protein encoding a guide RNA and Cas protein specific to a target DNA, and its use, applicant: Tulsa, released on September 03, 2015)

Belov L et al., Cell surface markers in colorectal cancer prognosis, Int J Mol Sci, 2010, 12(1), 78-113.Belov L et al., Cell surface markers in colorectal cancer prognosis, Int J Mol Sci, 2010, 12 (1), 78-113. Dos Santos T et al., Effects of transport inhibitors on the cellular uptake of carboxylated polystyrene nanoparticles in different cell lines, PLoS One, 2011, 6(9):e24438.Dos Santos T et al., Effects of transport inhibitors on the cellular uptake of carboxylated polystyrene nanoparticles in different cell lines, PLoS One, 2011, 6 (9): e24438. Dow LE et al., Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer, Cell, 2015, 161(7), 1539-1552.Dow LE et al., Apc Restoration Promotes Cellular Differentiation and Reestablishes Crypt Homeostasis in Colorectal Cancer, Cell, 2015, 161 (7), 1539-1552. Lee J et al., Effect of simvastatin on Cetuximab resistance in human colorectal cancer with KRAS mutations, J Natl Cancer Inst, 2011, 103(8), 674-688.Lee J et al., Effect of simvastatin on Cetuximab resistance in human colorectal cancer with KRAS mutations, J Natl Cancer Inst, 2011, 103 (8), 674-688. Lievre et al., KRAS mutation status is predictive of response to Cetuximab therapy in colorectal cancer, Cancer Res, 2006, 66(8), 3992-3995.Lievre et al., KRAS mutation status is predictive of response to Cetuximab therapy in colorectal cancer, Cancer Res, 2006, 66 (8), 3992-3995. Matano M et al., Modeling colorectal cancer using CRISPR-Cas9-mediated engineering of human intestinal organoids, Nat Med, 2015, 21(3), 256-262.Matano M et al., Modeling colorectal cancer using CRISPR-Cas9-mediated engineering of human intestinal organoids, Nat Med, 2015, 21 (3), 256-262. Montagut C et al., Identification of a mutation in the extracellular domain of the Epidermal Growth Factor Receptor conferring Cetuximab resistance in colorectal cancer, Nat Med, 2012, 18(2), 221-223.Montagut C et al., Identification of a Mutation in the Extracellular Domain of the Epidermal Growth Factor Receptor Conferring Cetuximab resistance in colorectal cancer, Nat Med, 2012, 18 (2), 221-223. Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24(6), 1020-1027.Ramakrishna S et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA, Genome Res, 2014, 24 (6), 1020-1027. Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33(11), 1162-1164.Woo JW et al., DNA-free genome editing in plants with preassembled CRISPR-Cas9 ribonucleoproteins, Nat Biotechnol, 2015, 33 (11), 1162-1164. Zuris JA et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33(1), 73-80.Zuris JA et al., Cationic lipid-mediated delivery of protein enables efficient protein-based genome editing in vitro and in vivo, Nat Biotechnol, 2015, 33 (1), 73-80.

본 발명의 목적은 Cas9 단백질, 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물을 제공하는 데에 있다. 보다 자세하게는 본 발명의 목적은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암의 개선 또는 치료용 조성물을 제공하는 데에 있다. It is an object of the present invention to provide a nanoliposome transporter composition in which a complex of Cas9 protein, guide RNA and cationic polymer is encapsulated. More specifically, the object of the present invention is to provide a nanoliposome transporter composition in which a complex of a Cas9 protein, a guide RNA for inhibiting the expression of the KRAS gene and a cationic polymer is encapsulated, or an improvement or remedy for an anticancer drug resistant colorectal cancer And to provide a composition for use in the present invention.

본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. The present invention relates to a nanoliposome transporter composition in which a complex of a Cas9 protein, a guide RNA for inhibiting expression of KRAS gene and a cationic polymer is encapsulated.

상기 KRAS 유전자의 발현을 억제하는 가이드 RNA는 서열번호 1 또는 2의 염기서열을 포함할 수 있다. The guide RNA that inhibits the expression of the KRAS gene may include the nucleotide sequence of SEQ ID NO: 1 or 2.

상기 나노 리포좀은 레시틴, 콜레스테롤, 양이온성 인지질 및 메탈 킬레이팅 지질을 포함할 수 있다. The nanoliposomes may include lecithin, cholesterol, cationic phospholipids and metal chelating lipids.

상기 나노 리포좀에는 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합될 수 있다. The nanoliposome recognizes one or more proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epidermal cell adhesion molecule (EpCAM), carcinoembryonic antigen (CEA), and Annexins expressed in colon cancer cells Or a polyclonal antibody capable of binding to a monoclonal antibody.

상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. The nanoliposome may have a particle size of 10 to 2,000 nm.

본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 대장암의 개선 또는 치료용 조성물을 제공할 수 있다. The present invention can provide a composition for improving or treating colorectal cancer containing the nanoliposome transporter composition.

상기 대장암의 개선 또는 치료용 조성물에는 세툭시맵(Cetuximab)이 첨가될 수 있다. Cetuximab may be added to the composition for improving or treating colorectal cancer.

본 발명은 또한 하기와 같은 대장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법을 제공한다. The present invention also provides a method for producing a nanoliposome carrier composition capable of selectively recognizing colon cancer cells as described below.

바람직하게는, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 제조하고, 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; Preferably, a preparation of a lipid film composition is prepared by preparing a complex of a Cas9 protein, a guide RNA for inhibiting the expression of KRAS gene and a cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipids in chloroform, Stage 1;

상기 지질 필름 조성물에, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 넣어 초음파 처리하는 제2단계; A second step of ultrasonically treating the lipid film composition with a complex of a Cas9 protein, a guide RNA for inhibiting the expression of the KRAS gene and a cationic polymer;

상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계;A third step of freezing and melting the ultrasound-treated lipid film composition, and then ultrasonifying again;

상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및,A fourth step of centrifuging the lipophilic film composition sonicated in the third step and recovering the nanoliposome in the form of a precipitate; And

상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제5단계; A fifth step of binding the antibody to the nanoliposome in the precipitate state obtained in the fourth step through a cross-linking agent;

를 포함할 수 있다. . ≪ / RTI >

이하 본 발명을 보다 자세하게 설명한다. Hereinafter, the present invention will be described in more detail.

본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물에 관한 것이다. The present invention relates to a nanoliposome transporter composition in which a complex of a Cas9 protein, a guide RNA for inhibiting expression of KRAS gene and a cationic polymer is encapsulated.

상기 Cas9 단백질은 pET28a/Cas9-Cys 플라스미드(pET28a(+) 벡터에 Cas9-Cys가 삽입된 것)가 형질전환된 세포 또는 균주에서 획득할 수 있다. 바람직하게는 pET28a/Cas9-Cys 플라스미드를 대장균에 형질전환하여 Cas9 단백질을 과발현하여 얻을 수 있다. The Cas9 protein can be obtained from cells or strains transformed with pET28a / Cas9-Cys plasmid (Cas9-Cys inserted into pET28a (+) vector). Preferably, pET28a / Cas9-Cys plasmid is transformed into E. coli to overexpress Cas9 protein.

본 발명에서 적용할 수 있는 가이드 RNA는 하기의 서열번호 1 또는 2의 염기서열을 포함하는 가이드 RNA이며, 이러한 가이드 RNA가 포함된 나노 리포좀 전달체 조성물은 KRAS 정상 유전자 또는 돌연변이 유전자의 발현을 억제하여 대장암을 개선 또는 치료할 수 있는 기능을 한다. The guide RNA applicable in the present invention is a guide RNA comprising the nucleotide sequence of SEQ ID NO: 1 or 2 below. The nanoliposome transporter composition containing the guide RNA suppresses the expression of KRAS normal gene or mutant gene, It can function to improve or treat cancer.

서열번호 1 : CUGAAUUAGCUGUAUCGUCA SEQ ID NO: 1: CUGAAUUAGCUGUAUCGUCA

서열번호 2 : GAAUAUAAACUUGUGGUAGU SEQ ID NO: 2: GAAUAUAAACUUGUGGUAGU

상기 서열번호 1의 가이드 RNA는 하기의 서열번호 3의 사람(Homo sapiens) KRAS의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 5의 KRAS의 일부 DNA 염기서열을 타겟으로 한다(서열번호 3과 서열번호 5는 상보적인 염기서열을 가짐). 상기 서열번호 2의 가이드 RNA는 하기의 서열번호 4의 KRAS의 일부 DNA 염기서열로부터 유래된 것이며, 하기의 서열번호 6의 KRAS의 일부 DNA 염기서열을 타겟으로 한다(서열번호 4와 서열번호 6은 상보적인 염기서열을 가짐). The guide RNA of SEQ ID NO: 1 is derived from a partial DNA sequence of a human ( Homo sapiens ) KRAS of SEQ ID NO: 3 below and is targeted to a partial nucleotide sequence of KRAS of SEQ ID NO: 5 (SEQ ID NO: And SEQ ID NO: 5 have a complementary base sequence). Will of the SEQ ID NO: 2 of the guide RNA is derived from a part of the DNA sequence of the KRAS of SEQ ID NO: 4, and some DNA sequence of the KRAS of SEQ ID NO: 6 to a target (SEQ ID NO: 4 and SEQ ID NO: 6 Complementary base sequence).

서열번호 3 : CTGAATTAGCTGTATCGTCA SEQ ID NO: 3: CTGAATTAGCTGTATCGTCA

서열번호 4 : GAATATAAACTTGTGGTAGT SEQ ID NO: 4: GAATATAAACTTGTGGTAGT

서열번호 5 : TGACGATACAGCTAATTCAG SEQ ID NO: 5: TGACGATACAGCTAATTCAG

서열번호 6 : CTTATATTTGAACACCATCA SEQ ID NO: 6: CTTATATTTGAACACCATCA

상기 서열번호 1 또는 2의 가이드 RNA 염기서열 이후에는 Cas9 단백질과 복합체를 형성하기 위해 스캐폴드 염기서열(scaffold sequence)이 포함될 수 있다. 이 때 스캐폴드 염기서열의 종류는 크게 제한되지 않으며, 가이드 RNA의 제조에 이용되는 통상적인 염기서열이라면 어떤 것이든지 사용될 수 있다. A scaffold sequence may be included to form a complex with the Cas9 protein after the nucleotide sequence of the guide RNA of SEQ ID NO: 1 or 2. At this time, the kind of the scaffold base sequence is not limited, and any conventional base sequence used for the production of the guide RNA can be used.

따라서, 본 발명의 나노 리포좀에 적용되는 가이드 RNA는 하기의 Therefore, the guide RNA to be applied to the nanoliposome of the present invention is preferably

서열번호 7 : SEQ ID NO: 7:

CUGAAUUAGCUGUAUCGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU CUGAAUUAGCUGUAUCGUCA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUUU

또는, 서열번호 8 :Or SEQ ID NO: 8:

GAAUAUAAACUUGUGGUAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU GAAUAUAAACUUGUGGUAGU GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUUU

가 적용된 나노 리포좀을 제공할 수 있다. Can be provided.

상기 서열번호 1 또는 2의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 5 또는 6의 DNA 염기서열은 사람의 상기 서열번호 1 또는 2의 가이드 RNA의 염기서열이 타겟으로 하는 서열번호 5 또는 6의 DNA 염기서열은 KRAS (Homo sapiens Chromosome 12, Genbank No. NC_000012.12)의 Exon2에 존재하는 염기서열이며, 서열번호 1 또는 2의 가이드 RNA를 통해 상기 Exon2의 DNA가 잘려지게 된다. The DNA sequence of SEQ ID NO: 5 or 6, in which the nucleotide sequence of the guide RNA of SEQ ID NO: 1 or 2 is targeted, is a nucleotide sequence of SEQ ID NO: 5 or 6 of SEQ ID NO: The DNA base sequence is the base sequence existing in Exon2 of KRAS ( Homo sapiens Chromosome 12, Genbank No. NC_000012.12), and the DNA of Exon2 is cut through the guide RNA of SEQ ID NO: 1 or 2.

상기 KRAS 유전자의 돌연변이는 인간 게놈 DNA의 KRAS exon 2의 codon 12번 서열에서 일어나며, 이를 대장암 세포인 SW480, SNU407 세포주에서 확인하여 도 1에 모식화하여 나타내었다. The mutation of the KRAS gene occurs in the codon 12 sequence of KRAS exon 2 of the human genomic DNA, and it is shown in FIG. 1 in the SW480 and SNU407 cell lines of the colon cancer cells.

상기 서열번호 1, 2, 7, 8의 가이드 RNA는 T7 RNA 폴리머라아제(polymerase)를 사용한 시험관 내 전사 반응 과정(in vitro transcription)을 통하여 합성할 수 있다.The guide RNAs of SEQ ID NOS: 1, 2, 7, and 8 can be synthesized through in vitro transcription using T7 RNA polymerase.

상기 양이온성 폴리머로서 바람직하게는 폴리-L-리신, 폴리아미도아민, 폴리[2-(N,N-디메틸아미노)에틸 메타아크릴레이트], 키토산, 폴리-L-오르니틴, 시클로덱스트린, 히스톤, 콜라겐, 덱스트란 및 폴리에틸렌이민으로 선택되는 것 1종 이상이 사용될 수 있으며, 가장 바람직하게는 폴리에틸렌이민이 사용될 수 있다. Preferred examples of the cationic polymer include poly-L-lysine, polyamidoamine, poly [2- (N, N-dimethylamino) ethylmethacrylate], chitosan, poly-L- ornithine, cyclodextrin, histone, Collagen, dextran, and polyethyleneimine, and most preferably, polyethyleneimine can be used.

상기 나노 리포좀은 레시틴(lecithin, α-phosphatidylcholin), 양이온성 인지질, 콜레스테롤 및 메탈 킬레이팅 지질을 포함할 수 있으며, 이를 통해, 상기 레시틴, 양이온성 인지질, 콜레스테롤 및 메탈 킬레이팅 지질이 나노 리포좀을 형성하는 막을 이룰 수 있다. The nanoliposomes may include lecithin, alpha-phosphatidylcholin, cationic phospholipids, cholesterol and metal chelating lipids, whereby the lecithin, cationic phospholipids, cholesterol and metal chelating lipids form nanoliposomes Can be achieved.

레시틴은 동/식물계에 널리 분포되어 있어 생체 적합성이 우수하며 그 안정성에 있어서도 이미 검증되어 식품과 제약의 전달체 기술에 널리 활용되고 있다. 또한 나노 리포좀의 크기 조절과 변형을 용이하게 하는 재료로 사용될 수 있다. Lecithin is widely distributed in copper / vegetable field and has excellent biocompatibility. Its stability has already been verified and widely used in food and pharmaceutical carrier technology. It can also be used as a material to facilitate size control and modification of nanoliposomes.

상기 양이온성 인지질은 디올레오일 포스파티딜에탄올아민(DOPE), 1,2-디피타노일-sn-글리세로-3-포스포에탄올아민(DPhPE), 1,2-디스테아로일-sn-글리세로-3-포스포에탄올아민(DSPE), 1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민(DPPE) 및 1,2-디올레오일-sn-글리세로-3-포스포콜린(DOPC)로 이루어진 군으로부터 1종 이상 선택될 수 있다. 바람직하게는 1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민(DPPE)을 사용하는 것이 좋다. The cationic phospholipid is selected from the group consisting of dioleoylphosphatidylethanolamine (DOPE), 1,2-dipitanoyl-sn-glycero-3-phosphoethanolamine (DPhPE), 1,2-distearoyl- Phosphoethanolamine (DSPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) and 1,2-dioloyo-sn- And phosphocholine (DOPC). Preferably, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) is used.

메탈 킬레이팅 지질로는 바람직하게는 DOGS-NTA-Ni 지질, DMPE-DTPA-Gd 지질, DMPE-DTPA-Cu 지질로 이루어진 군 중에서 선택되는 1종 이상을 사용할 수 있다. 상기 DOGS-NTA-Ni 지질은 하기의 화학식 1의 화학구조를 갖는 지질로서,The metal chelating lipid may preferably be at least one selected from the group consisting of DOGS-NTA-Ni lipid, DMPE-DTPA-Gd lipid, and DMPE-DTPA-Cu lipid. The DOGS-NTA-Ni lipid is a lipid having a chemical structure represented by the following formula (1)

[화학식 1] [Chemical Formula 1]

Figure 112016128990864-pat00001
Figure 112016128990864-pat00001

1,2-디올레오일-sn-글리세로-3-[(N-(5-아미노-1-카르복시펜틸)이미노디아세트산)숙시닐](니켈염)이라 한다. (Nickel salt) of 1,2- diolureo - sn -glycero-3 - [(N- (5-amino-1-carboxypentyl) iminodiacetic acid) succinyl].

*1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl](nikel salt) * 1,2-dioleoyl- sn -glycero-3 - [(N- (5-amino-1-carboxypentyl) iminodiacetic acid succinyl]

DMPE-DTPA-Gd 지질은 하기의 화학식 2의 화학구조를 갖는 지질로서,The DMPE-DTPA-Gd lipid is a lipid having a chemical structure represented by the following formula (2)

[화학식 2](2)

Figure 112016128990864-pat00002
Figure 112016128990864-pat00002

1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(가돌리늄염)이라 한다. Di-myristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriamine pentaacetic acid (gadolinium salt).

*1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(gadolinium salt)1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (gadolinium salt)

DMPE-DTPA-Cu 지질은 하기의 화학식 3의 화학구조를 갖는 지질로서,The DMPE-DTPA-Cu lipid is a lipid having a chemical structure represented by the following formula (3)

[화학식 3](3)

Figure 112016128990864-pat00003
Figure 112016128990864-pat00003

1,2-디미리스토일-sn-글리세로-3-포스포에탄올라민-N-디에틸렌트리아민펜타아세트산(구리염)이라 한다. Di-myristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriamine pentaacetic acid (copper salt).

*1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid(copper salt)* 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-diethylenetriaminepentaacetic acid (copper salt)

상기 DOGS-NTA-Ni 지질은 단백질 정제 방법에서 사용되는 His-Tag(6X histidin)과 Ni2+ 친연성(affinity)을 활용하여 Cas9 단백질(His-Tag 포함된 것)이 효과적으로 나노 리포좀 내부로 봉입(encapsulation)되게 하는 역할을 할 수 있다. 더 자세하게는 상기 DOGS-NTA-Ni은 18개의 탄소에 이중결합이 1개 있는 구조로 레시틴과 함께 지질(lipid)를 형성할 수 있고, 끝에 Ni2+가 결합되어 있어, Cas9 단백질에 붙어있는 His-tag 2개와 Ni2+ 1개가 결합하여 Cas9 단백질이 좀 더 효율적으로 나노 리포좀 안으로 봉입되게 한다. DMPE-DTPA-Gd 지질과 DMPE-DTPA-Cu 지질 또한 이와 동일한 역할을 하며 Cas9 단백질이 포함된 복합체의 나노 리포좀 내 봉입을 효과적으로 유도한다. The DOGS-NTA-Ni lipids were prepared by incorporating His-Tag (6X histidine) and Ni 2+ affinity into the nanoliposome encapsulation. More specifically, the DOGS-NTA-Ni has one double bond at 18 carbons and can form a lipid together with lecithin. Ni.sup.2 + is bonded to the end, and His -tag and Ni 2+ are combined to allow the Cas9 protein to be more efficiently encapsulated in the nanoliposome. DMPE-DTPA-Gd lipid and DMPE-DTPA-Cu lipid also play the same role and effectively induce encapsulation of the complex containing Cas9 protein in the nanoliposome.

본 발명의 나노 리포좀 내에는 서열번호 1의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질과, 서열번호 2의 염기서열을 포함하는 가이드 RNA와 결합된 Cas9 단백질이 혼재되어 존재할 수도 있다. In the nanoliposome of the present invention, Cas9 protein bound to the guide RNA including the nucleotide sequence of SEQ ID NO: 1 and Cas9 protein linked to the guide RNA including the nucleotide sequence of SEQ ID NO: 2 may be mixed.

상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 가질 수 있다. 나노 리포좀의 크기가 10 nm 미만일 경우, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 상기 나노 리포좀에 봉입되기 어려울 수 있으며, 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. 또한 2,000 nm를 초과할 경우에도 상기 나노 리포좀이 포함된 조성물이 체내로 주입될 경우에 안정성이 낮아질 수 있어 바람직하지 않다. The nanoliposome may have a particle size of 10 to 2,000 nm. When the size of the nanoliposome is less than 10 nm, the complex of the guide RNA and the cationic polymer that inhibits Cas9 protein, the expression of KRAS gene may be difficult to be encapsulated in the nanoliposome, and the stability may be lowered when injected into the body It is not preferable. Also, when it exceeds 2,000 nm, stability may be lowered when the composition containing the nanoliposome is injected into the body, which is not preferable.

상기 나노 리포좀에는 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군 중에서 1종 이상 선택되는 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합될 수 있다. The nanoliposome recognizes one or more proteins selected from the group consisting of epidermal growth factor receptor (EGFR), epidermal cell adhesion molecule (ECPR), carcinoembryonic antigen (CEA), and annexins expressed in colon cancer cells Or a polyclonal antibody capable of binding to a monoclonal antibody.

상기 항체를 생성하는 것은 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다. 상기 다클론성 항체는 EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질을 동물에 주사한 뒤 채혈한 혈청에서 얻을 수 있다. 상기 동물로는 염소, 토끼, 돼지 등 임의의 동물 숙주를 이용할 수 있다. 상기 단클론성 항체는, 본 발명이 속하는 기술분야에 널리 알려진 대로, 하이브리도마 방법(Kohler G. and Milstein C.), 또는, 파지 항체 라이브러리(Clackson et al.; Marks et al.) 기술을 이용하여 제조할 수 있다. 상기 하이브리도마 방법을 수행하기 위해서는 마우스와 같은 면역학적으로 적합한 숙주동물의 세포와, 암 또는 골수종 세포주를 이용할 수 있다. 이 후, 폴리에틸렌글라이콜 등을 이용하는 방법, 즉, 본 발명이 속하는 기술분야에 널리 공지된 방법으로, 이러한 두 종류의 세포들을 융합시킨 후, 항체 생산 세포를 표준적인 조직 배양방법으로 증식시킬 수 있다. 이 후, 한계 희석법(limited dilution technique)에 의한 서브클로닝에 의해 균일한 세포 집단을 얻은 후, EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질에 대해 특이적인 항체를 생산할 수 있는 하이브리도마를 표준 기술에 따라 시험관 내 또는 생체 내에서 대량 배양할 수 있다. 상기 파지 항체 라이브러리 방법은, EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질에 대한 항체 유전자를 획득하여, 이를 파지(phage)의 표면에 융합 단백질 형태로 발현하여 항체 라이브러리를 시험관 내에서 제작하고, 상기 라이브러리로부터 EGFR, EpCAM, CEA, 아넥신스 등의 1종 단백질과 결합하는 단클론성 항체를 분리 및 제작하여 수행할 수 있다. 상기 방법들에 의하여 제조된 항체는 전기영동, 투석, 이온교환 크로마토그래피, 친화 크로마토그래피 등의 방법으로 분리할 수 있다.The production of the antibody can be easily carried out using techniques well known in the art. The polyclonal antibody can be obtained from a serum obtained by injecting an animal with a protein such as EGFR, EpCAM, CEA, or anexcis, and collecting the animal. The animal may be any animal host such as chlorine, rabbit, and pig. Said monoclonal antibodies may be obtained using the hybridoma method (Kohler G. and Milstein C.) or the phage antibody library (Clackson et al .; Marks et al.) Technique, as is well known in the art to which this invention belongs. . In order to carry out the hybridoma method, cells of an immunologically appropriate host animal such as a mouse and a cancer or myeloma cell line can be used. After these two types of cells are fused by a method using polyethylene glycol or the like, i.e., a method widely known in the art to which the present invention belongs, the antibody producing cells can be proliferated by a standard tissue culture method have. Subsequently, a uniform cell population was obtained by subcloning by the limited dilution technique, and a hybridoma capable of producing a specific antibody to a single protein such as EGFR, EpCAM, CEA, and anexcis It can be cultured in vitro or in vivo according to standard techniques. The above-mentioned phage antibody library method comprises the steps of obtaining an antibody gene for one kind of protein such as EGFR, EpCAM, CEA and anexcis and expressing it in the form of a fusion protein on the surface of a phage to prepare an antibody library in vitro , And isolating and preparing a monoclonal antibody that binds to one kind of protein such as EGFR, EpCAM, CEA, and anexcis from the library. The antibodies prepared by the above methods can be separated by electrophoresis, dialysis, ion exchange chromatography, affinity chromatography, or the like.

상기 항체는 2개의 전체 길이 경쇄(light chain) 및 2개의 전체 길이 중쇄(heavy chain)를 가지는 완전한 형태 뿐만 아니라, 항체 분자의 기능적인 단편을 포함할 수 있다. 항체 분자의 기능적 단편이란 적어도 항원 결합기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2, F(ab)2, Fv 등이 있다.The antibody may comprise a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab) 2, F (ab) 2, Fv and the like.

본 발명에서 상기 항체는 1,4-비스-말레이미도부탄, 1,11-비스-말레이미도테트라에틸렌글리콜, 1-에틸-3-[3-디메틸 아미노프로필] 카보디이미드 하이드로클로라이드, 숙시니미딜-4-[N-말레이미도메틸시클로헥산-1-카복시-[6-아미도카프로에이트]] 및 그의 설폰화염(sulfo-SMCC), 숙시미딜 6-[3-(2-피리딜디티오)-로피오나미도] 헥사노에이트] 및 그의 설폰화염(sulfo-SPDP), m-말레이미도벤조일-N-하이드로시숙시니미드 에스터 및 그의 설폰화염(sulfo-MBS), 및 숙시미딜[4-(p-말레이미도페닐) 부틸레이트] 및 그의 설폰화염(sulfo-SMPB)으로 구성된 군에서 선택된 1종 이상의 가교제가 링커로 이용되어 결합될 수 있다. In the present invention, the antibody is selected from the group consisting of 1,4-bis-maleimidobutane, 1,11-bis-maleimidotetraethylene glycol, 1-ethyl- 3- [3- dimethylaminopropyl] carbodiimide hydrochloride, succinimidyl 4- [N-maleimidomethylcyclohexane-1-carboxy- [6-amidocaproate]] and sulfo-SMCC, succinimidyl 6- [3- (2-pyridyldithio ) -Lofionamido] hexanoate] and its sulfone-SPDP, m-maleimidobenzoyl-N-hydroosuccinimide ester and its sulfone-MBS, and succinimid [4- (p-maleimidophenyl) butylate] and its sulfonated flame (sulfo-SMPB) may be used as a linker.

상기 링커는 나노 리포좀의 양이온성 인지질과 항체를 연결하는 것을 특징으로 한다. The linker is characterized by linking the cationic phospholipid of the nanoliposome with the antibody.

본 발명의 나노 리포좀은 중성의 물, 세포 배양액, 혈액 등에서 수시간 이상 안정하게 분산될 수 있다. The nanoliposome of the present invention can be stably dispersed in neutral water, a cell culture solution, blood or the like for several hours or more.

본 발명은 상기 나노 리포좀 전달체 조성물을 함유하는 대장암의 개선 또는 치료용 조성물을 제공할 수 있다. 상기 조성물은 Cetuximab을 더 포함할 수 있다. 상기 대장암은 KRAS 정상 유전자 또는 돌연변이 유전자형을 갖는 대장암일 수 있다. 상기 나노 리포좀 전달체 조성물은 KRAS 돌연변이 유전자형을 가져 Cetuximab에 약물 저항성을 갖는 대장암의 치료에 효과적이다. The present invention can provide a composition for improving or treating colorectal cancer containing the nanoliposome transporter composition. The composition may further comprise Cetuximab. The colorectal cancer may be a KRAS normal gene or a colon cancer having a mutant genotype. The nanoliposome transporter composition has a KRAS mutant genotype and is effective for the treatment of colorectal cancer having drug resistance to Cetuximab.

본 발명은 또한 하기와 같은 대장암 세포를 선택적으로 인식할 수 있는 나노 리포좀 전달체 조성물의 제조방법을 제공한다. 바람직하게는, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 제조하고, 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계; 상기 지질 필름 조성물에, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체를 넣어 초음파 처리하는 제2단계; 상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계; 상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및, 상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 항체를 결합하는 제5단계;를 포함할 수 있다. The present invention also provides a method for producing a nanoliposome carrier composition capable of selectively recognizing colon cancer cells as described below. Preferably, a preparation of a lipid film composition is prepared by preparing a complex of a Cas9 protein, a guide RNA for inhibiting the expression of KRAS gene and a cationic polymer, and mixing lecithin, metal chelating lipid, cholesterol and cationic phospholipids in chloroform, Stage 1; A second step of ultrasonically treating the lipid film composition with a complex of a Cas9 protein, a guide RNA for inhibiting the expression of the KRAS gene and a cationic polymer; A third step of freezing and melting the ultrasound-treated lipid film composition, and then ultrasonifying again; A fourth step of centrifuging the lipophilic film composition sonicated in the third step and recovering the nanoliposome in the form of a precipitate; And a fifth step of binding the antibody to the nanoliposome in the precipitate state obtained in the fourth step through a cross-linking agent.

상기 제1단계의 복합체 제조시, Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머는 1:1~3:30~70의 몰 비로 혼합될 수 있다. 이 때의 혼합비를 벗어나게 되면 복합체의 제조가 잘 되지 않을 수 있다. In preparing the complex of the first step, the Cas9 protein, the guide RNA that inhibits the expression of the KRAS gene, and the cationic polymer may be mixed in a molar ratio of 1: 1-3: 30-70. If the mixing ratio is out of this range, the composite may not be manufactured well.

상기 제1단계의 레시틴, 메탈 킬레이팅 지질, 콜레스테롤 및 양이온성 인지질은 2:0.1~5:0.01~0.5:0.01~0.5 몰 비로 혼합될 수 있다. 마찬가지로 이 때의 혼합비를 벗어나게 되면 나노 리포좀을 구성하는 지질의 제조가 잘 되지 않을 수 있다. The lecithin, the metal chelating lipid, the cholesterol, and the cationic phospholipid in the first step may be mixed in a molar ratio of 2: 0.1-5: 0.01-0.5: 0.01-0.5. Likewise, if the mixing ratio is deviated, the lipid constituting the nanoliposome may not be produced well.

이 때, 상기 제3단계에서 동결하고 융해하는 과정은 1~12회 반복할 수 있다. 지질 필름 조성물을 동결하고 융해하는 단계를 반복함으로써 보다 균일한 크기의 나노 리포좀 분산액이 형성될 수 있고, 나노 리포좀의 약물 봉입 효율을 높일 수 있다. 단, 12회를 초과할 경우에는 나노 리포좀의 봉입 효율이 오히려 줄어들 수 있기 때문에 12회 이내가 바람직하다. In this case, the process of freezing and melting in the third step may be repeated 1 to 12 times. By repeating the steps of freezing and melting the lipid film composition, a more uniform sized nanoliposome dispersion can be formed and the drug encapsulation efficiency of the nanoliposome can be increased. However, if it exceeds 12 times, the sealing efficiency of the nanoliposome may be reduced rather than 12 times.

상기 제5단계에서 나노 리포좀에 가교제를 1~5시간 동안 혼합한 다음 항체를 첨가하여 1~5시간 동안 혼합하는 것을 특징으로 한다. In the fifth step, the cross-linking agent is mixed with the nanoliposome for 1 to 5 hours, and then the antibody is added thereto and mixed for 1 to 5 hours.

상기 제5단계에서 나노 리포좀, 가교제 및 항체는 10~30:1~5:1의 중량비로 결합될 수 있다. In the fifth step, the nanoliposome, the cross-linking agent and the antibody may be combined at a weight ratio of 10 to 30: 1 to 5: 1.

본 발명의 나노 리포좀 제조시, 메탈 킬레이팅 지질은 음전하(-)를 띄기 때문에, Cas9과 KRAS 유전자의 발현을 억제하는 가이드 RNA의 혼성체의 음전하(-)에 반응하여 리포좀의 캡슐화가 잘 되지 않을 수 있다. 따라서 이를 극복하기 위하여 양전하(+)를 갖는 양이온성 고분자를 결합시킨 복합체를 제조함으로써 나노 리포좀의 캡슐화를 강화할 수 있다. In the preparation of the nanoliposome of the present invention, since the metal chelating lipid is negatively charged (-), encapsulation of the liposome is not easily performed in response to the negative charge (-) of the guide RNA hybridizing with the expression of Cas9 and KRAS genes . Therefore, in order to overcome this problem, it is possible to enhance the encapsulation of the nanoliposome by preparing a complex in which a cationic polymer having positive charge (+) is bound.

본 발명은 또한 상기 나노 리포좀 전달체 조성물을 함유하는 약학 조성물을 제공할 수 있는데, 상기 약학 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 상기 약학 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. The present invention also provides a pharmaceutical composition containing the nanoliposome transporter composition, wherein the pharmaceutical composition is administered orally or parenterally in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, And may be formulated in the form of a tablet, an external preparation, a suppository, and a sterile injection solution. Examples of carriers, excipients and diluents that can be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient, such as starch, calcium carbonate, sucrose or lactose, Gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like.

본 발명의 약학 조성물의 투여량은 치료받을 대상의 연령, 성별, 체중, 치료할 특정 질환 또는 병리 상태, 질환 또는 병리 상태의 심각도, 투여경로 및 처방자의 판단에 따라 달라질 것이다. 이러한 인자에 기초한 투여량 결정은 당업자의 수준 내에 있으며, 일반적으로 투여량은 0.01㎎/㎏/일 내지 대략 2000㎎/㎏/일의 범위이다. 더 바람직한 투여량은 1㎎/㎏/일 내지 500㎎/㎏/일이다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. The dosage of the pharmaceutical composition of the present invention will vary depending on the age, sex, body weight, the specific disease or condition to be treated, the severity of the disease or condition, the route of administration, and the judgment of the prescriber. Dosage determinations based on these factors are within the level of ordinary skill in the art and generally the dosage ranges from 0.01 mg / kg / day to approximately 2000 mg / kg / day. A more preferable dosage is 1 mg / kg / day to 500 mg / kg / day. The administration may be carried out once a day or divided into several times. The dose is not intended to limit the scope of the invention in any way.

본 발명의 약학 조성물은 쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, humans, and the like in various routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine dural or intracerebral injection.

본 발명은 Cas9 단백질, KRAS 유전자의 발현을 억제하는 가이드 RNA 및 양이온성 폴리머의 복합체가 봉입된 나노 리포좀 전달체 조성물 또는 이를 함유하는 KRAS 유전자 변이에 따른 항암제 저항성 대장암 치료제에 관한 것이다. 현재 전이성 대장암 치료제로 사용되고 있는 Cetuximab의 경우 KRAS 정상형 대장암 환자에게만 효과가 있고 KRAS 정상형 대장암 환자이더라도 지속적으로 Cetuximab의 치료를 받으면, 60~80%의 환자가 KRAS 돌연변이형으로 발전할 수 있는 치명적인 단점을 가지고 있다. 그렇지만, 본 발명의 나노 리포좀 조성물을 이용할 경우, 대장암 유발 유전자인 KRAS의 돌연변이를 근본적으로 억제할 수 있을 뿐만 아니라, KRAS 돌연변이형 전이성 대장암의 치료를 매우 효과적으로 수행할 수 있다. The present invention relates to a nanoliposome transporter composition in which a complex of a Cas9 protein, a guide RNA for inhibiting the expression of KRAS gene and a cationic polymer is encapsulated, or an anticancer drug-resistant colon cancer cancer agent comprising the KRAS gene mutation containing the same. In the case of Cetuximab that currently used by metastatic colorectal cancer KRAS wild type, even colon cancer only is there KRAS wild type colorectal cancer effects patients continue to receive treatment of Cetuximab, lethal in the 60 to 80% of patients may develop a KRAS mutation type It has disadvantages. However, when the nanoliposome composition of the present invention is used, it is possible to fundamentally inhibit the mutation of KRAS , which is a colorectal cancer-inducing gene, and to treat KRAS mutant metastatic colorectal cancer very effectively.

도 1은 대장암 세포 HT29, SW480, SNU407 cell line에서 Exon2, codon 12번 자리에 KRAS가 정상 서열(GGT)인지 돌연변이(GTT 또는 GAT)가 일어났는지 확인하기 위하여 각 cell의 genomic DNA의 KRAS exon 2의 codon 12번 서열을 확인한 결과이다.
도 2는 본 발명의 단일 가닥 상태의 가이드 RNA(sgRNAs) 1번과 2번 서열의 효율을 plasmid system 및 KRAS의 mRNA 발현을 통해 확인한 결과를 나타낸다.
도 3a는 본 발명의 단일 가닥 상태의 가이드 RNA(sgRNAs, 서열번호 1)의 염기서열 구조를 도식화한 것이다.
도 3b는 본 발명에서 사용한 Cas9 단백질을 정제하여 SDS-PAGE(Sodium dodecyl sulphate polyacrylamide gel electrophoresis)를 수행한 후 Coomassie blue 용액으로 염색하여 단백질의 존재를 확인한 결과를 나타낸다.
도 4는 in vitro transcriptied sgRNAs와 정제한 Cas9 단백질을 실험실 내에서 결합시켜 혼성체로 제조하고(Cas9/sgRNA 혼성체), 이 혼성체를 이용하여 KRAS 유전자가 실제 잘리는지 확인한 결과를 나타낸다.
도 5는 본 발명 실시예 2의 나노 리포좀 구조를 도식화한 것으로서, 상기 나노 리포좀은 Cas9 단백질, 가이드 RNA(sgRNA) 및 폴리에틸렌이민(PEI, Polyethylenimine) 이 결합된 복합체가 봉입되어 있으며, 리포좀을 구성하는 막은 레시틴(Lecithin), 콜레스테롤(Cholestrol), DPPE(1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine) 및 DOGS-NTA-Ni 지질로 구성된다. 이 때, 리포좀 외부의 표면에 노출되어 있는 DPPE의 아민기에는 Sulfo-SMCC(Sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate)를 링커(linker)로 하여 대장암 세포를 목표로 하는 EGFR 항체(anti-EGFR)가 결합되어 있다.
도 6은 본 발명 실시예 2의 나노 리포좀의 대장암 세포로의 유입 과정을 확인하기 위해, 세포 내 유입을 억제하는 억제제들을 처리한 후 Cas9에 대한 항체로 면역염색하고 공초점 형광 현미경(Confocal Laser Scanning Microscopy)으로 찍은 사진을 나타낸다.
도 7a는 본 발명의 sgRNA 1 및 sgRNA 2가 목표로 삼는 인간 게놈의 KRAS 유전자 내의 위치를 도식화하여 나타낸 그림이다.
도 7b는 본 발명 실시예 2의 나노 리포좀을 처리하여 KRAS 유전자의 20개의 염기서열이 잘려지는 것을 도식화하여 나타낸 그림이다.
도 7c는 본 발명 실시예 2의 나노 리포좀이 처리된 각 대장암 세포(KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480 및 SNU407 세포)에서의 KRAS의 mRNA 발현 억제효과를 나타낸다.
도 7d는 본 발명 실시예 2의 나노 리포좀이 처리된 SW480세포에서의 Ras의 단백질 발현 정도와 Erk 1/2 신호전달을 확인한 결과를 나타낸다.
도 7e와 도 7f는 K-ras, Cetuximab, Cas9/sgRNA와 관련되는 cell signaling 과정을 도식화한 것이다.
도 8a는 Cetuximab만 처리한 세포 실험군에 대한 결과로서, KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포에서의 세포 생존과 증식을 WST-1 assay 방법을 통해 나타낸 것이다.
도 8b는 본 발명 실시예 2의 나노 리포좀을 처리하여 KRAS 유전자가 편집된 세포에 Cetuximab을 처리한 실험군에 대한 결과로서, KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포에서의 세포 생존과 증식을 WST-1 assay 방법을 통해 나타낸 것이다.
도 9는 Cas9, sgRNAs 및 폴리에틸렌이민 복합체가 봉입되지 않은 비교예 1의 나노 리포좀과 Cas9, sgRNAs 및 폴리에틸렌이민 복합체가 봉입된 본 발명 실시예 2의 나노 리포좀을 처리한 것에서의 세포 자살(cell apoptosis) 과정을 확인하여 차이가 나는 단백질 발현 결과를 나타낸다.
도 10은 본 발명 실시예 2의 나노 리포좀이 처리된 대장암 세포에서의 Cetuximab으로 인한 apoptosis를 확인하기 위해 caspase-3 activity를 측정한 결과를 나타낸다.
도 11은 나노리포좀 제조 후 여액에 남은 Cas9 단백질의 양을 확인하여 나노 리포좀의 봉입 효율을 확인한 결과를 나타낸다. 1 is colon cancer cells HT29, SW480, SNU407 cell line in Exon2, codon of the genomic DNA in each cell is 12 times KRAS in place to ensure the normal sequence (GGT) that the mutation (GTT or GAT) has happened KRAS exon 2 Of the codon 12 sequence.
FIG. 2 shows the results of confirming the efficiency of the single stranded guide RNA (sgRNAs) 1 and 2 sequences of the present invention through plasmid system and KRAS mRNA expression.
FIG. 3A schematically shows the nucleotide sequence structure of the single stranded guide RNA (sgRNAs, SEQ ID NO: 1) of the present invention.
FIG. 3B shows the results of SDS-PAGE (sodium dodecyl sulphate polyacrylamide gel electrophoresis) followed by staining with Coomassie blue solution to confirm the presence of the protein.
FIG. 4 shows the result of confirming whether the KRAS gene was actually cut using the hybrid (Cas9 / sgRNA hybrid) prepared by combining in vitro transcripted sgRNAs and purified Cas9 protein in a laboratory.
FIG. 5 is a schematic representation of the nanoliposome structure of Example 2 of the present invention. The nanoliposome is encapsulated with a complex of Cas9 protein, guide RNA (sgRNA) and polyethyleneimine (PEI) bonded thereto, The membranes consist of lecithin, cholesterol, DPPE (1,2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine) and DOGS-NTA-Ni lipids. In this case, the amine group of DPPE exposed on the surface of the liposome is composed of EGFR antibody targeting a colon cancer cell using Sulfo-SMCC (N-maleimidomethyl) cyclohexane-1-carboxylate as a linker (anti-EGFR).
FIG. 6 is a graph showing the results of immunocytochemistry of confocal laser microscope (CAM) with antibodies against Cas9, followed by treatment with inhibitors that inhibit intracellular infiltration in order to confirm the inflow of the nanoliposome into colon cancer cells of Example 2 of the present invention. Scanning Microscopy).
FIG. 7A is a diagram illustrating the positions of the ssRNA 1 and sgRNA 2 of the present invention in the KRAS gene of the human genome targeted by the present invention.
FIG. 7B is a diagram showing that 20 nucleotide sequences of the KRAS gene are truncated by treating the nanoliposome of Example 2 of the present invention. FIG.
FIG. 7C shows KRAS mRNA expression inhibitory effect in each colorectal cancer cell treated with the nanoliposome of Example 2 of the present invention (HT29 cells having the KRAS normal gene, SW480 and SNU407 cells having the KRAS mutant type gene).
FIG. 7d shows the results of confirming the degree of protein expression of Ras and Erk1 / 2 signaling in SW480 cells treated with nanoliposome of Example 2 of the present invention.
Figures 7e and 7f are schematic representations of cell signaling processes involving K-ras, Cetuximab, and Cas9 / sgRNA.
FIG. 8A shows the cell survival and proliferation of HT29 cells with the KRAS normal gene, SW480 and SNU407 cells with the KRAS mutant gene through the WST-1 assay method as a result of the cell treatment group treated with only Cetuximab.
FIG. 8B is a graph showing the results of the treatment of Cetuximab-treated cells treated with the KRAS gene by treating the nanoliposome of Example 2 of the present invention. As a result, HT29 cells with the KRAS normal gene, SW480 and SNU407 cells with the KRAS mutant gene Cell survival and proliferation in the WST-1 assay.
FIG. 9 shows cell apoptosis in the nanoliposome treated with the nanoliposome of Example 2 in which Cas9, sgRNAs, and polyethyleneimine complex are not encapsulated and the nanoliposome of Comparative Example 1 encapsulated with Cas9, sgRNAs and polyethyleneimine complexes. Confirmation of the process indicates the result of differential protein expression.
FIG. 10 shows the result of measuring caspase-3 activity to confirm apoptosis caused by Cetuximab in the nanoliposome-treated colon cancer cells of Example 2 of the present invention.
FIG. 11 shows the result of confirming the efficiency of encapsulation of nanoliposome by confirming the amount of Cas9 protein remaining in the filtrate after preparation of the nanoliposome.

이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the invention to those skilled in the art.

<실시예 1. 가이드 RNA 제조 및 Cas9 단백질 정제> &Lt; Example 1: Preparation of guide RNA and purification of Cas9 protein >

실시예 1-1. Example 1-1. KRASKRAS 를 목표유전자로 하는 가이드 RNA 제조 As a target gene

T7 RNA polymerase(NEB)를 활용한 in vitro transcription 방법을 이용하여 KRAS를 목표유전자로 하는 가이드 RNA를 제조하였다. 이를 위해 표 1의 T7 promoter 염기서열과 KRAS 유전자의 20 b.p. 염기서열인 서열번호 3 : CTGAATTAGCTGTATCGTCA, 서열번호 4 : GAATATAAACTTGTGGTAGT을 포함하는 '69 mer forward primer' 2개, 가이드 RNA에 연결될 스캐폴드 염기서열을 포함하는 '20 mer reverse primer' 1개, plasmid Cas guide vector(origene)를 사용하여 PCR법으로 140 b.p.의 DNA　주형(template)을 제조하였다. 이 DNA 주형, rNTP mixture, T7 RNA polymerase, RNAase inhibitor를 포함하여 37℃에서 2시간 전사 반응을 통하여 가이드 RNA를 제작하였고 RNA 정제 과정을 거쳐 RNA 순도를 높였다. In vitro transcription method using T7 RNA polymerase (NEB) was used to prepare a guide RNA using KRAS as a target gene. For this, two '69 mer forward primers' including the T7 promoter base sequence in Table 1, the 20 bp nucleotide sequence of KRAS gene, the CTGAATTAGCTGTATCGTCA and the GAATATAAACTTGTGGTAGT, and the scaffold base sequence to be connected to the guide RNA , A 20 mer reverse primer and a plasmid Cas guide vector (origene) were used to prepare a DNA template of 140 bp by PCR. The DNA template, rNTP mixture, T7 RNA polymerase, and RNAase inhibitor were incubated at 37 ° C for 2 hours for transcriptional reaction. The RNA was purified and RNA purity was increased.

* T7 promoter 염기서열은 아래 표 1의 밑줄 친 부분에 해당됨. * The sequence of the T7 promoter corresponds to the underlined part of Table 1 below.

* 표 1의 굵은 글씨의 염기 서열은 KRAS 유전자를 인식하는 부위이며, 스캐폴드 염기서열의 주형(plasmid Cas guide vector)을 인식하여 가이드 RNA 합성이 되며, 최종 제조된 가이드 RNA의 서열과 이 염기서열이 같은(T 대신 U로 치환된) 염기서열 구조를 가짐. * The nucleotide sequence shown in bold in Table 1 is a region recognizing the KRAS gene. It recognizes a plasmid Cas guide vector and forms a guide RNA. The nucleotide sequence of the finally prepared guide RNA and the nucleotide sequence This has the same base sequence (replaced by U instead of T).

* F 프라이머 뒤의 GTTTTAGAGCTAGAAATAGCA는 스캐폴드 염기 서열 일부분임.* GTTTTAGAGCTAGAAATAGCA behind F primer is part of the scaffold base sequence.

* plasmid Cas guide vector에 스캐폴드 염기서열의 주형이 포함되어 있음. * The plasmid Cas guide vector contains the template of the scaffold base sequence.

* 이 실험에 사용된 plasmid Cas guide vector의 구조는 하기와 같음. * The structure of the plasmid Cas guide vector used in this experiment is as follows.

Figure 112016128990864-pat00004
Figure 112016128990864-pat00004

출처 : http://www.origene.com/CRISPR-CAS9/Detail.aspx?sku=GE100001 Source: http://www.origene.com/CRISPR-CAS9/Detail.aspx?sku=GE100001


forward primer
forward primer KRAS sgRNA 1_FKRAS sgRNA 1_F GCGGCCTCTAATACGACTCACTATAGGG CTGAATTAGCTGTATCGTCAGTTTTAGAGCTAGAAATAGCA GCGGCCTCTAATACGACTCACTATAGGG CTGAATTAGCTGTATCGTCA GTTTTAGAGCTAGAAATAGCA KRAS sgRNA 2_FKRAS sgRNA 2_F GCGGCCTCTAATACGACTCACTATAGGG GAATATAAACTTGTGGTAGTGTTTTAGAGCTAGAAATAGCA GCGGCCTCTAATACGACTCACTATAGGG GAATATAAACTTGTGGTAGT GTTTTAGAGCTAGAAATAGCA reverse primer(sg RNA_R)reverse primer (sg RNA_R) AAAAGCACCGACTCGGTGCCAAAAAGCACCGACTCGGTGCCA

상기 실험을 통해 하기 표 2의 염기서열을 갖는 가이드 RNA를 제조하였다. A guide RNA having the nucleotide sequence shown in Table 2 below was prepared through the above-described experiment.

서열번호 7
(KRAS 타겟) SEQ ID NO: 7
(KRAS target) CUGAAUUAGCUGUAUCGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU CUGAAUUAGCUGUAUCGUCA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUUU 서열번호 8
(KRAS 타겟) SEQ ID NO: 8
(KRAS target) GAAUAUAAACUUGUGGUAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU GAAUAUAAACUUGUGGUAGU GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUUU

본 발명에서 제조한 표 2의 단일 가닥 상태의 가이드 RNA(sgRNA)의 구조 도식화는 도 3a에 개시되어 있다. The structural representation of the single stranded guide RNA (sgRNA) of Table 2 prepared in the present invention is shown in Fig.

최종 제조된 상기 가이드 RNA는 사람 KRAS 유전자의 서열번호 5 : TGACGATACAGCTAATTCAG 또는 서열번호 6 : CTTATATTTGAACACCATCA의 염기서열을 타겟으로 인식하여 각 KRAS 유전자의 발현을 억제하는 역할을 한다.The final prepared guide RNA recognizes the nucleotide sequence of the human KRAS gene of SEQ ID NO: 5: TGACGATACAGCTAATTCAG or SEQ ID NO: 6: CTTATATTTGAACACCATCA as a target and inhibits the expression of each KRAS gene.

실시예 1-2. Cas9 단백질 정제Examples 1-2. Cas9 protein purification

pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)를 대장균(DH5α)에 형질전환하여 0.5 mM IPTG(isopropyl β- D -1-thiogalactopyranoside)와 28℃ 조건에서 Cas9 단백질을 과발현하였고, Cas9 단백질이 과발현된 대장균을 lysis buffer(20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 20 mM imidazole, 1x protease inhibitor cocktail, 1 mg/mL lysozyme)와 함께 초음파 처리하였다. 초음파 처리하여 얻은 분쇄물을 원심분리하여 단백질이 포함된 액상을 얻었다. Ni-NTA agarose bead 추출법(elution buffer : 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1x protease inhibitor cocktail)으로 상기 액상에 포함된 Cas9 단백질을 분리하였다. 이후 분리물을 storage buffer(50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol)에 혼합한 상태로 투석하여(cut off 10K) 이미다졸을 제거한 후 단백질 농도를 정량하였다(BCA법 이용). 이 때, 투석하여 얻은 Cas9 단백질을 SDS-PAGE하여 확인하여 Cas9 단백질이 잘 생성되었음을 확인하였다(도 3b). The Cas9 protein was overexpressed with 0.5 mM IPTG (isopropyl [beta] -D-1-thiogalactopyranoside) at 28 [deg.] C, and Cas9 protein was overexpressed in E. coli (DH5 [alpha]) by addition of pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261) Escherichia coli was sonicated with lysis buffer (20 mM Tris-Cl pH 8.0, 300 mM NaCl, 20 mM imidazole, 1x protease inhibitor cocktail, and 1 mg / mL lysozyme). The pulverized material obtained by ultrasonication was centrifuged to obtain a liquid phase containing the protein. The cas9 protein contained in the liquid phase was isolated by Ni-NTA agarose bead extraction (elution buffer: 20 mM Tris-Cl at pH 8.0, 300 mM NaCl, 300 mM imidazole, 1x protease inhibitor cocktail). Then, the separated product was dialyzed (cut off 10K) in a storage buffer (50 mM Tris-HCl at pH 8.0, 200 mM KCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM PMSF, 20% glycerol) And the protein concentration was quantified (using the BCA method). At this time, the Cas9 protein obtained by dialysis was confirmed by SDS-PAGE, confirming that Cas9 protein was well formed (FIG. 3B).

** pET28a/Cas9-Cys plasmid(Addgene plasmid # 53261)의 구조 : ** Structure of pET28a / Cas9-Cys plasmid (Addgene plasmid # 53261)

Figure 112016128990864-pat00005
Figure 112016128990864-pat00005

출처 : Addgene (http://www.addgene.org/)Source: Addgene (http://www.addgene.org/)

<실시예 2. 나노 리포좀 제작>&Lt; Example 2: Preparation of nanoliposome >

실시예 1에서 제조한 Cas9 단백질, 가이드 RNA 및 폴리에틸렌이민을 1:2:50의 몰 비(mole ratio)로 혼합하여 복합체를 제조하였다. 이 때 가이드 RNA로는 스캐폴드 염기서열이 포함된 서열번호 7 또는 8을 사용하였다(서열번호 1 또는 2 내포). The Cas9 protein prepared in Example 1, the guide RNA and the polyethyleneimine were mixed at a molar ratio of 1: 2: 50 to prepare a complex. As the guide RNA, SEQ ID NO: 7 or 8 containing the scaffold base sequence was used (SEQ ID NO: 1 or 2 inclusion).

다음으로 레시틴(Lecithin, Sigma Aldrich), DOGS-NTA-Ni 지질(Avanti polar lipids), 콜레스테롤(Cholesterol, Sigma Aldrich) 및 DPPE(Sigma Aldrich)를 2:1:0.1:0.05 몰 비로 클로로포름(chloroform) 상에서 섞은 후 Rotary evaporator를 활용하여 지질필름(lipid film)화 하였다. Next, a mixture of lecithin (Lecithin, Sigma Aldrich), DOGS-NTA-Ni lipid (Avanti polar lipids), cholesterol (Sigma Aldrich) and DPPE (Sigma Aldrich) in chloroform at a molar ratio of 2: 1: After mixing, a lipid film was formed using a rotary evaporator.

여기에 Cas9 단백질/가이드 RNA/폴리에틸렌이민의 복합체를 넣어 초음파를 가하며 혼합하였다. 액체질소를 활용하여 동결하고 융해하는 과정(freeze thaw cycle)을 10차례 반복하고 이후 초음파(probe 방식) 처리하여 좀 더 작은 사이즈이면서도 균일한 상태의 나노 리포좀 조성물을 제작하였다. The complex of Cas9 protein / guide RNA / polyethyleneimine was added thereto and mixed with ultrasonic waves. The freeze thaw cycle using liquid nitrogen was repeated 10 times and then subjected to an ultrasonic probe treatment to prepare a nanoliposome composition with a smaller size and uniformity.

이후 원심분리 방법으로 침전된 나노 리포좀 조성물(lipid의 총량 19.82mg, Cas9과 gRNA의 총량 0.034mg)을 회수하여 항체 결합을 위한 링커로 사용될 Sulfo-SMCC(ProteoChem) 2.5mg을 PBS 상에서 2시간 동안 25℃ 상온에서 혼합하였다. Then, 2.5 mg of Sulfo-SMCC (ProteoChem) to be used as a linker for antibody binding was recovered from the nanoliposome composition (total amount of lipid: 19.82 mg, Cas9 and gRNA: 0.034 mg) Lt; 0 &gt; C.

다음으로는 나노 리포좀에 결합하기 위한 정제 항체를 준비하였는데, 상기 나노 리포좀에 결합할 항체는 대장암 세포에서 과발현하는 것으로 알려진 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins) 등(Belov L et al., 2010)을 인식할 수 있는 단클론성 또는 다클론성 항체를 선택하였다. 특히 이 중에서도 EGFR 항체(Anti-EGFR)(abcam, ab2430)를 선택하여 2-Mercaptoethylamine(Thermo)과 10mM EDTA 상에서 2시간 동안 37℃에서 혼합한 뒤, PD-10 desalting column(GE Healthcare)으로 정제하였다(EGFR 항체와 2-Mercaptoethylamine은 1mg:0.6mg으로 혼합). 이 때, 항체의 정제과정은 하기의 그림으로 설명할 수 있다(Y 모양을 가지는 동일한 2개의 사슬로 이루어져 있는 항체에 2-Mercaptoethylamine을 첨가하여 half-antibody를 만들어 다시 정제한 뒤 이를 나노 리포좀에 결합시킴 - Wu S et al., Highly sensitive nanomechanical immunosensor using half antibody fragment, Anal Chem, 2014, 86(9), 4271-4277). Next, purified antibodies for binding to nanoliposomes were prepared. Antibodies to be bound to the nanoliposomes were identified as epidermal growth factor receptor (EGFR), epidermal cell adhesion molecule (EPCAM), carcinoembryonic (CEA) Antibodies and Annexins (Belov L et al., 2010) were selected for the detection of monoclonal or polyclonal antibodies. Particularly, EGFR antibody (abcam, ab2430) was selected and mixed with 2-mercaptoethylamine (Thermo) and 10 mM EDTA for 2 hours at 37 ° C and purified with PD-10 desalting column (GE Healthcare) (EGFR antibody and 2-mercaptoethylamine are mixed at 1 mg: 0.6 mg). In this case, the purification process of the antibody can be illustrated by the following figure (2-mercaptoethylamine is added to the antibody consisting of the same two chains having the Y-shape to make a half-antibody and then the antibody is further purified and bound to the nanoliposome Sikim-Wu S et al., Highly sensitive nanomechanical immunosensor using half antibody fragment, Anal Chem, 2014, 86 (9), 4271-4277).

Figure 112016128990864-pat00006
Figure 112016128990864-pat00006

위 그림과 같이 half anti-body를 만들어주면 -SH가 생성된다. 나노 리포좀을 구성하는 DPPE 지질에 -NH2가 존재하기 때문에 여기에 sulfo-SMCC(linker)가 반응하게 되고, 이렇게 만들어진 나노 리포좀의 sulfo-SMCC와 half-antibody의 -SH 부분이 결합하게 된다. 이렇게 half-antibody의 제조를 통해 나노리포좀의 대장암 세포에 대한 인식능력을 배로 증가시킬 수 있다. If you create a half anti-body as shown above, -SH is generated. The sulfo-SMCC (linker) reacts with the -NH2 in the DPPE lipid constituting the nanoliposome, and the sulfo-SMCC of the thus-prepared nanoliposome binds to the -SH portion of the half-antibody. The production of half-antibodies can double the cognitive capacity of nanoliposome for colon cancer cells.

이렇게 정제된 항체(anti-EGFR) 1mg을 링커가 결합되어 있는 나노 리포좀 조성물과 4℃에서 12시간 동안 혼합하고, 이후 원심분리 방법으로 침전된 것만을 회수하여 대장암 세포를 선택적으로 인식할 수 있는 항체가 결합된 본 발명의 나노 리포좀을 얻었고, 진행 buffer(세포배양용 배지 또는 PBS[Phosphate Buffered Saline])에 섞어 다음 실험에 사용하였다. 1 mg of the thus purified antibody (anti-EGFR) was mixed with the nanoliposome composition to which the linker was attached at 4 ° C for 12 hours, and then only those precipitated by centrifugation were collected to selectively recognize colon cancer cells The antibody-bound nanoliposome of the present invention was obtained and mixed with an advancing buffer (cell culture medium or PBS [Phosphate Buffered Saline]) to be used in the following experiment.

<비교예 1. 비교 나노 리포좀 제조> &Lt; Comparative Example 1 > Preparation of comparative nanoliposome &gt;

실시예 2에 기재된 방법으로 나노 리포좀을 제조하였으나, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체를 첨가하는 과정은 제외하였다. Nanoliposomes were prepared by the method described in Example 2, except for the addition of Cas9 protein / guide RNA / polyethyleneimine complex.

<비교예 2. DOGS-NTA-Ni 지질과 폴리에틸렌이민을 포함하지 않은 나노 리포좀> &Lt; Comparative Example 2: Nano-liposome without DOGS-NTA-Ni lipid and polyethyleneimine >

나노 리포좀 제조시 DOGS-NTA-Ni 지질을 제외하고 나노 리포좀을 제조하였고, 이후는 실시예 2의 과정을 수행하되, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체 대신 Cas9 단백질/가이드 RNA의 혼성체가 나노 리포좀에 봉입되게 하였다. Nano liposomes were prepared except for the DOGS-NTA-Ni lipids in the preparation of nanoliposomes, and then the procedure of Example 2 was carried out. After that, a mixture of Cas9 protein / guide RNA instead of Cas9 protein / guide RNA / To be encapsulated in liposomes.

<비교예 3. 폴리에틸렌이민을 포함하지 않은 나노 리포좀> &Lt; Comparative Example 3: Nano liposome not containing polyethyleneimine >

실시예 2에서처럼 나노 리포좀을 제조하되, Cas9 단백질/가이드 RNA/ 폴리에틸렌이민의 복합체 대신 Cas9 단백질/가이드 RNA의 혼성체가 나노 리포좀에 봉입되게 하였다. Nanoliposomes were prepared as in Example 2 except that the Cas9 protein / guide RNA hybridized to the nanoliposome instead of the Cas9 protein / guide RNA / polyethyleneimine complex.

<비교예 4. 항체를 결합하지 않은 나노 리포좀> &Lt; Comparative Example 4: Nano liposome without antibody binding >

실시예 2에서처럼 나노 리포좀을 제조하되, 항체 및 링커를 결합하지 않았다. Nanoliposomes were prepared as in Example 2 but no antibody or linker was conjugated.

<실험예 1. Experimental Example 1 KRASKRAS 발현 및 활성 측정> Expression and activity measurement>

실험예 1-1. 가이드 RNA와 Cas9 단백질의 활성 확인Experimental Example 1-1. Activation of guide RNA and Cas9 protein

가이드 RNA 제조와 Cas9 단백질 정제(도 3b)가 잘 되었는지 확인하기 위해, SW480 세포를 수집하여 DNA를 추출하고 Foward primer : TGAAGTACAGTTCATTACGATACACG, Reverse primer : GGAAAGTAAAGTTCCCATATTAATGGT를 이용하여 PCR법을 통해 template fragment (500bp)를 만들었다. 다음으로 fragment에 정제된 Cas9 단백질만, 정제된 Cas9 단백질과 sgRNA 1(서열번호 1, 도 3a)을 혼합하여 넣어주었다. SW480 cells were harvested, DNA was extracted, and template fragment (500 bp) was prepared by PCR using Foward primer: TGAAGTACAGTTCATTACGATACACG and reverse primer: GGAAAGTAAAGTTCCCATATTAATGGT in order to confirm whether the preparation of guide RNA and Cas9 protein purification (Fig. 3b) . Next, only the purified Cas9 protein in the fragment was mixed with the purified Cas9 protein and sgRNA 1 (SEQ ID NO: 1, FIG. 3A).

도 4를 참고하면, 정제된 Cas9 단백질만 넣어준 실험군에서는 가이드 RNA가 존재하지 않기 때문에 Cas9 단백질이 fragment를 자르지 못하였고, 정제된 Cas9 단백질과 sgRNA 1(서열번호 1)을 혼합한 실험군에서는 sgRNA 1이 fragment 안의 서열번호 5의 서열을 인식하여, Cas9 단백질이 fragment를 잘라주었음을 보여주는 결과가 확인된다. Referring to FIG. 4, Cas9 protein did not cleave the fragment because the guide RNA was not present in the case of the purified Cas9 protein alone. In the case of the mixture of purified Cas9 protein and sgRNA 1 (SEQ ID NO: 1), sgRNA 1 Recognizing the sequence SEQ ID NO: 5 in this fragment, results confirming that the Cas9 protein cleaves the fragment.

실험예 1-2. Experimental Example 1-2. KRASKRAS 의 유전자 돌연변이 확인Identification of mutations in genes

대장암 세포(HT29, SW480, SNU407) 세포에서 DNA를 추출하고, Foward primer : TGAAGTACAGTTCATTACGATACACG, Reverse primer : GGAAAGTAAAGTTCCCATATTAATGGT를 이용하여 PCR법을 통해 template fragment를 만들었다. 다음으로는 T-blunt PCR cloning kit(solgent)를 이용하여 template fragment를 T-blunt vector안에 삽입시켜 준 뒤, (주)바이오니아에 Sequencing service를 요청하여 template fragment 부분의 서열을 분석하였다. 분석결과는 도 1에 나타내었으며, KRAS의 유전자 Exon 2번, codon 12번 자리에서 HT29 세포는 정상, SW480 세포와 SNU407 세포는 KRAS 돌연변이가 일어났음을 확인할 수 있다.DNA was extracted from colon cancer cells (HT29, SW480, SNU407) cells, and template fragments were prepared by PCR using Foward primer: TGAAGTACAGTTCATTACGATACACG and reverse primer: GGAAAGTAAAGTTCCCATATTAATGGT. Next, the template fragment was inserted into the T-blunt vector using the T-blunt PCR cloning kit (solgent), and the sequence of the template fragment was analyzed by requesting sequencing service from Bionania. Analysis results are shown in Figure 1, the gene Exon 2 times of KRAS, codon No. 12 in the top spot HT29 cells, SW480 cells and cells SNU407 has taken place to determine the KRAS mutation has occurred.

실험예 1-3. 가이드 RNA의 Experimental Examples 1-3. Guide RNA KRASKRAS 발현 효율 비교 Expression efficiency comparison

대장암 세포 HT29(control ; KRAS 정상 세포)와 SW480(KRAS mutation 세포) 에서의 sgRNA 1(서열번호 1)과 sgRNA 2(서열번호 2)의 효율비교를 위해 pCas plasmid(실시예 1-1에 있는 pCas-Guide plasmid에 서열번호 3과 서열번호 4를 넣어주어 세포에 처리해 주었다. To compare the efficiency of sgRNA 1 (SEQ ID NO: 1) and sgRNA 2 (SEQ ID NO: 2) in colorectal cancer cells HT29 (control KRAS normal cells) and SW480 (KRAS mutation cells), pCas plasmid The pCas-guide plasmid was treated with cells of SEQ ID NO: 3 and SEQ ID NO: 4.

처리한 세포를 수집하여 Trizol(invitrogen)을 이용하여 총RNA를 추출하였고, SuprimeScript RT premix 2x(GeNetBio)를 이용하여 cDNA를 합성하였다. The treated cells were harvested and total RNA was extracted using Trizol (Invitrogen). CDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).

KRAS의 mRNA 발현 확인을 위한 Real-time PCR은 SYBR green 2x Premix(Applied Biosystems)와 AB step one plus real-time PCR system(Applied Biosystems)을 활용하여 측정하였다. 이 때 검출에 사용한 primer의 염기서열은 다음과 같다. Real-time PCR for KRAS mRNA expression was performed using SYBR green 2x Premix (Applied Biosystems) and AB step one plus real-time PCR system (Applied Biosystems). The nucleotide sequence of the primer used for detection was as follows.

KRAS sense : GACTGAATATAAACTTGTGGTAGTTGGA KRAS sense: GACTGAATATAAACTTGTGGTAGTTGGA

KRAS antisense : TCCTCTTGACCTGCTGTGTCGKRAS antisense: TCCTCTTGACCTGCTGTGTCG

GAPDH sense : GCACCGTCAAGGCTGAGAAGAPDH sense: GCACCGTCAAGGCTGAGAA

GAPDH antisense : AGGGATCTCGCTCCTGGAAGAPDH antisense: AGGGATCTCGCTCCTGGAA

상기 결과는 도 2에 나타냈으며 HT29 세포와 SW480 세포에서 sgRNA 1과 sg RNA 2의 효율 비교를 한 결과 공통적으로 sgRNA 1(서열번호 1) 이 가장 효율적으로 KRAS의 mRNA 발현을 줄었으므로, 이후의 실험은 모두 서열번호 1의 가이드 RNA가 포함된 것을 사용하였다. The results are shown in FIG. 2. As a result of comparing the efficiency of sgRNA 1 and sg RNA 2 in HT29 cells and SW480 cells, it was found that sgRNA 1 (SEQ ID NO: 1) showed the most efficient reduction of KRAS mRNA expression, All of which contained the guide RNA of SEQ ID NO: 1.

한편, 서열번호 1 또는 2의 가이드 RNA가 인식하는 인간 게놈 DNA의 위치는 도 7a에 나타내었고, 이에 대한 모식도를 서열번호 1을 포함하는 나노 리포좀을 대표로 하여 도 7b에 나타내었는데, 이를 참고하면, 본 발명의 나노 리포좀을 통해, 가이드 RNA가 염기서열 20개를 인식하게 되고, Cas9 단백질이 PAM(protospacer adjacent motif)(TGG 서열 등) 부위를 자르게 됨으로써, 잘려진 DNA가 스스로 회복(repair)되는 과정 중에 20개의 DNA 염기서열이 잘려나간 것이 확인된다(실시예 1-2의 방법으로 나노 리포좀이 처리된 세포의 게놈 DNA를 직접 추출하고, 이를 (주)바이오니아에 Sequencing service를 요청하여 도 7b에서 제시된 잘려진 서열의 위치를 확인하였음). On the other hand, the position of the human genomic DNA recognized by the guide RNA of SEQ ID NO: 1 or 2 is shown in FIG. 7A, and a schematic diagram thereof is shown in FIG. 7B as a representative of a nanoliposome containing SEQ ID NO: 1, , The guide RNA recognizes 20 nucleotide sequences through the nanoliposome of the present invention and the Cas9 protein cleaves the PAM (protospacer adjacent motif) (TGG sequence, etc.) site, thereby repairing the cut DNA itself (The genomic DNA of the nanoliposome-treated cells was directly extracted by the method of Example 1-2, and a sequencing service was requested from Bionania Co., Ltd.) I have confirmed the position of the cut sequence).

실험예 1-4. 나노 리포좀의 대장암 세포로의 유입 확인Experimental Examples 1-4. Confirmation of entry of nanoliposome into colon cancer cells

실시예 2의 나노 리포좀의 대장암 세포로의 유입을 확인하기 위해, 실시예 2의 나노 리포좀을 대장암 세포(SW480 세포)에 24시간 동안 Cas9:gRNA(24.7㎍:9.3㎍ - 총 배양액 내에 Cas9 24.7㎍ 및 gRNA 9.3㎍)의 농도로 처리 후 Cas9에 대한 항체로 면역염색하여 도 6에 공초점 형광 현미경 사진을 나타내었다. 이 때 유입 과정을 차단할 수 있는 약물을 각각 대장암 세포에 처리하여 비교군으로 확인하였다. 면역염색을 위해 CFL-488의 Cas9 1차 항체(Rabbit)를 이용하여 세포 내 Cas9 단백질을 표지하고 공초점 형광 현미경으로 이미지화하였다. 상기 결과는 서열번호 1의 가이드 RNA가 포함된 것을 대표로 하여 도 6에 나타내었다. 도 6에서 DIC는 세포의 전자 이미지 사진, DAPI는 DNA 염색 사진, Cas9은 Cas9 단백질의 CFL-488 염색 사진, Merge는 이들을 모두 결합시킨 이미지 사진을 나타낸다. 이 때, 각 흡입 경로를 막는 약물로서 genistein(400μM), chlorpromazine(20㎍/ml), nocodazole (100μM), cytochalasin B(10μM)로 세포에 처리 후, 30분 동안 37℃에서 배양한 뒤, 실시예 2의 나노 리포좀을 처리하여 세포내 흡입 작용을 보았다. In order to confirm the inflow of the nanoliposome of Example 2 into the colon cancer cells, the nanoliposome of Example 2 was inoculated into colorectal cancer cells (SW480 cells) for 24 hours with Cas9: gRNA (24.7 占 퐂: 24.7 [mu] g and gRNA 9.3 [mu] g), followed by immunostaining with Cas9 antibody, and a confocal fluorescence microscope photograph is shown in Fig. At this time, drugs that can block the inflow process were treated with colorectal cancer cells, respectively. Intracellular Cas9 protein was labeled using a Cas9 primary antibody (Rabbit) of CFL-488 for immunostaining and imaged by confocal fluorescence microscopy. The results are shown in Fig. 6, which is representative of the inclusion of the guide RNA of SEQ ID NO: 1. In FIG. 6, DIC is an electron image photograph of a cell, DAPI is a DNA staining photograph, Cas9 is a CFL-488 staining photograph of Cas9 protein, and Merge is an image photograph combining all of them. At this time, cells were treated with genistein (400 μM), chlorpromazine (20 μg / ml), nocodazole (100 μM) and cytochalasin B (10 μM) as the blocking agents for each of the inhalation pathways and cultured for 30 minutes at 37 ° C. The nanoliposome of Example 2 was treated to show intracellular inhalation action.

도 6을 참고하면, Control에서는 실시예 2의 나노 리포좀 처리로 인해 대장암 세포의 핵 내로 RITC와 Cas9 단백질이 잘 주입되어 있음을 알 수 있으며, genistein, chloropromazine, nocodazole 등의 약물 처리군, 세포가 에너지를 사용하지 못하는 4℃에서 약물의 세포내 흡입작용이 억제된 것을 나타내며, 이를 통해 본 발명의 나노 리포좀은 클라스린 의존성 세포내흡입, 대음세포작용, 에너지 의존적으로 세포내흡입을 한다는 것을 확인할 수가 있다. Referring to FIG. 6, it can be seen that RITC and Cas9 proteins are well injected into the nucleus of colorectal cancer cells by the nanoliposome treatment of Example 2 in Control, and the drug treatment groups such as genistein, chloropromazine and nocodazole, Indicating that the intracellular inhalation action of the drug is inhibited at 4 캜 at which energy can not be used. Thus, it was confirmed that the nanoliposome of the present invention is inhaled into the cluster-dependent cells, have.

외부 물질이 세포 안으로 들어가는 흡입 경로는 크게 5가지로 나눌 수가 있는데, 세포의 표면에서 막의 일부가 밖으로 돌출되면서 입자를 둘러싸서 삼키는 식세포작용(phagocytosis), 막루플링(membrane ruffling)으로 인해 액틴필라멘트(actin filament)가 활발하게 중합하면서 입자를 흡입하는 대음세포작용(macropinocytosis), 세포질 쪽의 클라스린(chlatrin)이라는 단백질을 이용하는 클라스린 의존성 세포내흡입(chlatrin mediated endocytosis), 콜레스테롤과 카베올린(caveolin)이라는 막단백질의 농도가 높은 곳을 이용하는 카베올린 의존성 세포내흡입(caveolin-dependent endocytosis), 클라스린과 카베올린 등과 같은 단백질을 사용하지 않는 흡입방법 (clatrin and caveolin independent endocytosis)이 있다. 이러한 각각의 흡입 경로를 막는 약물들이 있는데, genistein은 카베올린 의존성 세포내 흡입을 방해하고, chloropromazine 은 클라스린 의존성 세포내흡입을 방해, nocodazole은 대음세포작용을 억제, cytochalasin B 는 식세포작용을 억제한다. 한편, 4℃ 에서는 세포가 에너지를 사용하지 못하므로 에너지 의존적으로 세포내흡입작용을 억제할 수가 있다(Dos Santos T et al., 2011). There are five major ways in which foreign substances can enter the cell: the phagocytosis, which swells around the particle as a part of the membrane protrudes from the surface of the cell, and the actin filaments (actin filaments) due to membrane ruffling. filament is macropinocytosis which inhales particles while actively polymerizing, chlullrin mediated endocytosis using a protein called cylati (chlatrin), cholesterol and caveolin Caveolin-dependent endocytosis using high membrane protein concentrations, and clathrin and caveolin independent endocytosis without using proteins such as classin and caveolin. There are drugs blocking each of these inhalation pathways: genistein interferes with caveolin-dependent intracellular inhalation, chloropromazine interferes with classin-dependent intracellular inhalation, nocodazole inhibits ocular cell function, and cytochalasin B inhibits phagocytosis . On the other hand, at 4 ° C, cells can not use energy, so they can inhibit intracellular inhalation actions in an energy-dependent manner (Dos Santos T et al., 2011).

실험예Experimental Example 1-5.  1-5. KRASKRAS 발현 측정 -  Expression measurement - mRNAmRNA 발현량 확인  Check the expression level

대장암 세포(HT29, SW480, SNU407)에 본 발명에서 제조한 각 나노 리포좀을 24시간 동안 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 처리 후 수집된 세포에 Trizol(invitrogen)을 이용하여 총RNA를 추출하였고, SuprimeScript RT premix 2x(GeNetBio)를 이용하여 cDNA를 합성하였다. Each of the nanoliposomes prepared in the present invention was treated with Cas9: gRNA (24.7 g: 9.3 g) for 24 hours in colon cancer cells (HT29, SW480, SNU407) RNA was extracted and cDNA was synthesized using SuprimeScript RT premix 2x (GeNetBio).

KRAS의 mRNA 발현 확인을 위한 Real-time PCR은 SYBR green 2x Premix(Applied Biosystems)와 AB step one plus real-time PCR system(Applied Biosystems)을 활용하여 측정하였다. 이 때 검출에 사용한 primer의 염기서열은 다음과 같다. Real-time PCR for KRAS mRNA expression was performed using SYBR green 2x Premix (Applied Biosystems) and AB step one plus real-time PCR system (Applied Biosystems). The nucleotide sequence of the primer used for detection was as follows.

KRAS sense : GACTGAATATAAACTTGTGGTAGTTGGA KRAS sense: GACTGAATATAAACTTGTGGTAGTTGGA

KRAS antisense : TCCTCTTGACCTGCTGTGTCGKRAS antisense: TCCTCTTGACCTGCTGTGTCG

GAPDH sense : GCACCGTCAAGGCTGAGAAGAPDH sense: GCACCGTCAAGGCTGAGAA

GAPDH antisense : AGGGATCTCGCTCCTGGAAGAPDH antisense: AGGGATCTCGCTCCTGGAA

상기 결과는 도 7c에 나타냈으며 실시예 2의 나노리포좀 처리로 인해 모든 대장암 세포에서 KRAS 단백질 발현이 현저하게 감소되는 결과를 확인할 수 있다.The results are shown in FIG. 7C. As a result, the expression of KRAS protein in all colorectal cancer cells is remarkably reduced due to the treatment with nanoliposome of Example 2. FIG.

한편, 실시예 2의 나노 리포좀 외에 각 비교예 나노 리포좀의 mRNA 발현량은 하기에 나타내었다. On the other hand, the mRNA expression levels of the respective comparative nanoliposomes in addition to the nanoliposome of Example 2 are shown below.

KRAS mRNA　발현량 KRAS mRNA expression level HT29 세포 실험
(fold)HT29 cell experiment
(fold) SW480 세포 실험
(fold)SW480 cell experiment
(fold) SNU407 세포 실험 (fold)SNU407 cell experiment (fold) 대조군Control group 1.001.00 1.001.00 1.001.00 실시예 2Example 2 0.050.05 0.130.13 0.200.20 비교예 1Comparative Example 1 0.980.98 0.990.99 1.001.00 비교예 2Comparative Example 2 0.490.49 0.720.72 0.620.62 비교예 3Comparative Example 3 0.780.78 0.810.81 0.720.72 비교예 4Comparative Example 4 0.470.47 0.480.48 0.670.67

실험예 1-6. Experimental Example 1-6. KRASKRAS 관련 세포 신호 전달 물질의 단백질 발현량 확인  Confirmation of protein expression level of related cell signaling substance

mRNA 발현 확인 실험과 동일한 조건으로 나노 리포좀을 처리한 대장암 세포(SW480) 처리군과 함께, 이 이외에도 나노 리포좀 처리 24시간 후 배양액을 교체하여 Cetuximab(10㎍/mL) 24시간 동안 추가 처리한 군, Cetuximab(10㎍/mL) 24시간 단일 처리군을 준비한 후, 세포를 수집하고, 상기 세포에 RIPA Buffer(Sigma)를 처리하여 단백질을 추출한 후 단백질의 발현을 확인하였다. In addition to the treatment with nanoliposome-treated colon cancer cells (SW480) treated with the same conditions as the mRNA expression confirmation experiment, 24 hours after the treatment with the nanoliposome, the cultures were further replaced and treated with Cetuximab (10 μg / , And Cetuximab (10 μg / mL) for 24 hours. Then, the cells were harvested and treated with RIPA buffer (Sigma) for protein extraction.

각 단백질은 대장암 세포에서 나타나는 Cetuximab 관련 세포 신호전달(도 7e 및 도 7f)에 따라, Ras, 인산화된 Erk1/2, 인산화된 Akt의 신호전달 관계를 anti-Ras(rabbit), anti-p-Akt(rabbit), anti-p-Erk1/2(rabbit), anti-GAPDH(mouse)로 확인하였다. 이 때, KRAS 만을 인식하는 항체 대신 Ras family(KRAS, NRAS, HRAS)의 총 단백질을 인식하는 항체를 사용하였는데, 본 발명의 나노 리포좀은 KRAS 단백질의 발현에만 영향을 주기 때문에 Ras 전체 단백질에서 나노 리포좀 처리 후 줄어든 단백질의 양은 KRAS가 줄어든 양과 일치한다. Each protein expresses the signal transduction relationship of Ras, phosphorylated Erk1 / 2, phosphorylated Akt as anti-Ras (rabbit), anti-p- (Rabbit), anti-p-Erk1 / 2 (rabbit) and anti-GAPDH (mouse). At this time, KRAS Instead of antibodies that recognize only Ras family (KRAS, NRAS, HRAS), the nanoliposome of the present invention was identified as KRAS The amount of protein reduced after nanoliposome treatment in Ras whole protein is in agreement with that of KRAS because it only affects protein expression.

도 7d를 참고하면 Cetuximab 실시예 2의 나노 리포좀만 처리된 대장암 세포에서 Erk 1/2와 Akt 단백질의 인산화 정도가 현저하게 줄어들어 본 발명의 나노 리포좀은 Cetuximab에 대한 약물 저항성이 있는 대장암에서 KRAS 발현 과정을 제어하는 것으로 확인된다. 7d, the degree of phosphorylation of Erk1 / 2 and Akt protein in the naliposome-treated colon cancer cells of Example 2 of Cetuximab was remarkably reduced. Thus, the nanoliposome of the present invention was found to have KRAS Lt; RTI ID = 0.0 &gt; expression &lt; / RTI &gt;

한편, 이 때의 KRAS, Erk 1/2 및 Akt가 Cetuximab 처리된 대장암 세포에서 일어나는 과정을 도 7e와 도 7f의 a~e에 나타내었다. Meanwhile, the processes in which KRAS, Erk 1/2, and Akt occur in Cetuximab-treated colon cancer cells are shown in FIGS. 7E and 7F a to e.

도 7e의 a에서는 정상 대장암 세포(KRAS 정상)에서는 세포막에 EGFR 이라는 receptor가 존재하여 EGFR ligand에 의해서 dimer 형태가 되면서 auto-phosphorylation에 의해 하위 단백질(PI3K, KRAS)들에 신호를 주게 되는데, 그 신호 중 PI3K 단백질은 Akt 단백질을 인산화하여 세포의 생존(survival)에 영향을 주게 되고, KRAS 단백질이 Erk 단백질을 인산화하여 암세포의 증식에 영향을 주는 것을 나타낸다. In FIG. 7 (a), a receptor called EGFR is present in the cell membrane of normal colorectal cancer cells ( KRAS normal), and it becomes a dimer form by the EGFR ligand and signals the sub proteins (PI3K, KRAS) by auto-phosphorylation. Among the signals, PI3K protein phosphorylates Akt protein and affects cell survival, indicating that KRAS protein phosphorylates Erk protein and affects the proliferation of cancer cells.

도 7e의 b는 도 7e의 a에서와 같이 대장암 세포가 증식되는 것을 억제하기 위해 개발된 약물이 항체 치료제인 Cetuximab인데, 이 Cetuximab은 EGFR에 결합하여 EGFR이 dimer를 형성하지 못하게 차단하여, EGFR의 신호를 받는 하위 단백질인 PI3K나 KRAS가 작용하지 않아 세포의 생존과 증식이 억제되는 것을 설명한다. FIG. 7 (b) shows Cetuximab, which is a therapeutic drug for inhibiting the proliferation of colon cancer cells as shown in FIG. 7 (a), which binds to EGFR and blocks EGFR from forming a dimer, Of the PI3K or KRAS, which is a sub-protein that receives the signal of the cell, does not act, thereby suppressing cell survival and proliferation.

도 7e의 c에서는 Cetuximab을 처리 하더라도 대장암 세포가 죽지 않는 이유는 Cetuximab에 의해 EGFR의 신호를 받지 못 하더라도 KRAS 유전자에 돌연변이가 일어나 KRAS 단백질이 계속 활성화되어 Erk 단백질을 인산화하여 세포의 증식에 영향을 주는 과정을 설명한다. In FIG. 7 (c), even if Cetuximab is treated, the colon cancer cells do not die because KRAS gene is mutated even when the signal of EGFR is not received by Cetuximab and KRAS protein is continuously activated and phosphorylation of Erk protein affects cell proliferation Explain the process of giving.

도 7f의 d에서는 실시예 2의 Cas9 단백질과 KRAS 유전자를 편집할 수 있는 가이드 RNA가 포함되어 있는 나노 리포좀을 세포에 전달하여 대장암 세포에서의 KRAS 단백질을 억제하는 과정을 설명한다. In FIG. 7f, the process of inhibiting the KRAS protein in colon cancer cells by transferring nanoliposome containing the guide RNA capable of editing Cas9 protein and KRAS gene of Example 2 into cells is described.

도 7f의 e에서는 나노 리포좀에 의해 유전자 편집된 대장암 세포에 Cetuximab을 처리 하면 도 7e의 b와 같이 2가지 세포 신호전달 과정이 차단되어 KRAS 돌연변이가 있는 대장암 환자에게서도 Cetuximab의 효과를 볼 수 있음을 설명한다. In FIG. 7F, when cetuximab is treated on the colon cancer cells genetically edited by the nanoliposome, the two cell signal transduction processes are blocked as shown in FIG. 7E (b), and the effect of Cetuximab is also observed in patients with colorectal cancer having KRAS mutation .

<실험예 2. 세포 생존율 및 증가율 확인>EXPERIMENTAL EXAMPLE 2. Identification of Cell Survival Rate and Growth Rate [

세포 생존율의 확인은 WST-1 어세이(EZ-cytox Cell Viability Assay Kit)를 통해 진행하였다. 대장암 세포(HT29, SW480, SNU407)를 96well plate에 1x104/well의 밀도로 24시간 배양하였다. 이 후 실시예 2의 나노 리포좀을 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 처리하고 24시간 후, Cetuximab이 농도별(0.1㎍/mL, 1㎍/mL, 10㎍/mL, 100㎍/mL)로 처리된 배지로 교체하고 다시 24시간 후 그대로 WST-1 시약을 첨가하였다. WST-1 시약을 배양액의 10% 넣고, 1시간 후에 460 nm에서 흡광도를 측정하여 세포 생존 및 증식을 대조군(비처리군)과 비교 하였다. 세포 생존 평가는 나노 리포좀 처리 후 72시간 동안 24시간을 주기로 측정하였다. Cell viability was determined using the WST-1 assay (EZ-cytox Cell Viability Assay Kit). Colorectal cancer cells (HT29, SW480, SNU407) were cultured on a 96-well plate at a density of 1 × 10 4 / well for 24 hours. Thereafter, the nanoliposome of Example 2 was treated with a concentration of Cas9: gRNA (24.7 g, 9.3 g), and after 24 hours, the concentration of Cetuximab (0.1 g / mL, 1 g / / mL). After 24 hours, the WST-1 reagent was added. The cell viability and proliferation were compared with the control (untreated group) by measuring the absorbance at 460 nm after putting 10% of the WST-1 reagent in the culture solution. Cell viability was measured at 24 hours after 72 hours of nanoliposome treatment.

이 때, 도 8a는 Cetuximab만 처리한 세포 실험군에 대한 결과이며, 도 8b는 본 발명 실시예 2의 나노 리포좀을 처리한 후 Cetuximab을 처리한 세포 실험군에 대한 결과로서, 실시예 2의 나노 리포좀을 처리한 KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포의 생존 및 증식이 현저하게 감소하는 것이 확인된다. 이러한 결과는 본 발명의 실시예 2의 나노 리포좀이 KRAS 돌연변이형 세포에서 Cetuximab의 대장암 세포 사멸 효과를 효과적으로 유도할 수 있음을 뜻한다. 8a shows the result of the cell test group treated only with Cetuximab. FIG. 8b shows the result of the cell test group treated with the Cetuximab after treating the nanoliposome of Example 2 of the present invention, and the nanoliposome of Example 2 It was confirmed that survival and proliferation of SW480 and SNU407 cells having the KRAS mutant type gene treated were remarkably decreased. These results indicate that the nanoliposome of Example 2 of the present invention can effectively induce colon cancer cell killing effect of Cetuximab in KRAS mutant type cells.

한편, 도 8a와 도 8b의 그래프의 각 농도 표시는 Cetuximab의 처리농도를 의미한다. Meanwhile, the respective concentration indications in the graphs of FIGS. 8A and 8B indicate the treatment concentration of Cetuximab.

<실험예 4. 세포 자살 단백질 확인>Experimental Example 4: Confirmation of cell suicide protein

비교예 1의 나노 리포좀과 실시예 2의 나노 리포좀을 SW480 세포에 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 처리하고 24시간 후, Cetuximab 10㎍/mL이 처리된 배지로 교체하여 Human Apoptosis Array Kit(R&D Systems Inc, ARY009)를 이용하여 세포자살(apoptosis) 관련 단백질들의 발현 여부를 확인하였다. 비교예 1의 나노 리포좀을 control로 삼은 것은 나노 리포좀 자체에 의해서 세포자살이 일어나지 않음을 비교하기 위해서이다. The nanoliposome of Comparative Example 1 and the nanoliposome of Example 2 were treated with a concentration of Cas9: gRNA (24.7 g: 9.3 g) in SW480 cells and replaced with a medium treated with 10 μg / mL of Cetuximab for 24 hours. Human Apoptosis Expression of apoptosis-related proteins was confirmed using Array Kit (R & D Systems Inc, ARY009). The nanoliposome of Comparative Example 1 was used as a control in order to compare that the cell suicide did not occur by the nanoliposome itself.

상기 결과는 도 9에 나타냈으며 실시예 2의 나노 리포좀을 처리한 실험군에서 세포 자살 관련 단백질들이 증가하였음을 확인할 수 있다. cleaved caspase-3 단백질은 pro-caspase-3가 잘린 형태로서 세포자살 과정에서 생성되는 최종 단백질이다. 이는 세포자살과정에 중요한 역할을 하는 단백질로서 cleaved caspase-3 단백질이 증가한다는 것은 apoptosis 과정이 진행된다는 것을 알 수가 있다. 또한Fas/TNFRSF6/CD95 단백질은 외부 신호에 인해 세포자살이 진행되었다는 것을 나타내며, SMAC/Diablo와 HTRA2/Omi 단백질 또한, anti-apoptosis 단백질을 억제하는 역할을 하는데, 이 단백질들이 증가하였다는 것은 세포자살이 진행되었다는 것을 알 수가 있다. 따라서, 본 발명의 나노 리포좀과 함께 Cetuximab을 처리하였을 때, Cetuximab에 대한 약물저항성이 있던 대장암 세포의 사멸이 효과적으로 수행됨을 알 수 있다. The results are shown in FIG. 9, and it can be confirmed that the cell suicide-related proteins were increased in the experimental group treated with the nanoliposome of Example 2. The cleaved caspase-3 protein is a truncated form of pro-caspase-3 and is the final protein produced during apoptosis. This is a protein that plays an important role in the apoptosis process. The increase of cleaved caspase-3 protein indicates that the apoptosis process proceeds. In addition, the Fas / TNFRSF6 / CD95 protein indicates that apoptosis has progressed due to an external signal. SMAC / Diablo and HTRA2 / Omi proteins also inhibit anti-apoptosis proteins, Can be seen. Therefore, when Cetuximab was treated together with the nanoliposome of the present invention, the death of colorectal cancer cells, which had drug resistance to Cetuximab, was effectively performed.

<실험예 5. Caspase-3 활성 측정>Experimental Example 5: Caspase-3 activity assay [

Caspase-3 활성을 Caspase-3 assay kit(Cell Signaling)를 사용하여 확인하였다. 실시예 2의 나노 리포좀을 대장암 세포(HT29, SW480, SNU407)에 Cas9:gRNA(24.7㎍:9.3㎍)의 농도로 24시간 동안 처리 후, Cetuximab(10㎍)이 포함된 배지로 교체하고 24시간 동안 처리하였다. 이 후, 각 세포로부터 단백질을 추출하고 추출 단백질에 1x assay buffer A와 substrate solution B를 200㎕ 넣어 혼합하고, 37℃에서 30분간 반응하였다. 반응 후 excitation 380nm와 emission 440nm 에서 형광값을 측정하여 활성을 측정한다. Caspase-3 activity Caspase-3 assay kit (Cell Signaling). The nanoliposome of Example 2 was treated with colon cancer cells (HT29, SW480, SNU407) for 24 hours at a concentration of Cas9: gRNA (24.7 g, 9.3 g) and then replaced with a medium containing 10 g of Cetuximab Lt; / RTI &gt; Then, proteins were extracted from each cell, and 200 μl of 1x assay buffer A and substrate solution B were added to the extracted protein, followed by reaction at 37 ° C for 30 minutes. After the reaction, fluorescence values were measured at excitation 380 nm and emission 440 nm to measure the activity.

상기 결과는 도 10에 나타냈으며, KRAS 정상 유전자를 가진 HT29 세포, KRAS 돌연변이형 유전자를 가진 SW480, SNU407 세포 모두에서 나노 리포좀과 Cetuximab이 모두 처리시 Caspase-3 활성이 증가된 것을 확인할 수 있다. The results are shown in FIG. 10, and it can be confirmed that caspase-3 activity was increased in both HT29 cells having the KRAS normal gene, SW480 having the KRAS mutant gene, and SNU407 cells when both the nanoliposome and Cetuximab were treated.

<실험예 6. 나노 리포좀의 봉입 효율 확인>EXPERIMENTAL EXAMPLE 6 Confirmation of Enclosure Efficiency of Nanoliposome [

나노 리포좀을 합성 시작 시에 넣은 Cas9 단백질의 총량과, 나노 리포좀 합성 후 여액에 남은 Cas9 단백질 양을 웨스턴 블롯 실험 방법으로 측정하여 나노 리포좀의 봉입 효율을 확인하였다. 이 때 나노 리포좀을 제조 후, 원심분리기를 이용하여 13000rpm에 원심분리하면 나노 리포좀이 가라앉게 되고, 나노 리포좀에 봉입되지 않은 Cas9 단백질은 여액에 그대로 존재하기 때문에, 상기 여액을 취해서 나노 리포좀에 들어가지 않은 Cas9 단백질으로만 웨스턴 블롯 실험을 진행하였다. 나노 리포좀 제조 후 남은 여액에 잔류한 Cas9 단백질의 함량 비교를 통해 나노 리포좀의 봉입 효율이 용이하게 확인된다. The total amount of Cas9 protein added at the start of the synthesis of nanoliposomes and the amount of Cas9 protein remaining in the filtrate after the synthesis of nanoliposomes were measured by a Western blot method to confirm the efficiency of encapsulation of the nanoliposome. After preparing the nanoliposome, the nanoliposome is submerged when centrifuged at 13000 rpm using a centrifuge. Since the Cas9 protein not contained in the nanoliposome is present in the filtrate, the filtrate is taken into the nanoliposome Western blot experiments were performed with only Cas9 protein. The efficiency of encapsulation of nanoliposomes is easily confirmed by comparing the content of Cas9 protein remaining in the remaining filtrate after preparation of nanoliposome.

상기 봉입효율 결과는 서열번호 1의 가이드 RNA가 포함된 것을 대표로 하여 표 4 및 도 11에 나타내었다. The results of the above encapsulation efficiency are shown in Table 4 and FIG. 11 as representative examples of the inclusion of the guide RNA of SEQ ID NO: 1.

조건Condition 봉입효율 (%)Enclosure Efficiency (%) 실시예 2Example 2 82.382.3 비교예 1Comparative Example 1 -- 비교예 2Comparative Example 2 57.457.4 비교예 3Comparative Example 3 29.929.9 비교예 4Comparative Example 4 79.479.4

표 4는 도 11의 결과를 수치화하여 나타낸 것으로서, 가이드 RNA가 포함된 혼성체 또는 복합체의 봉입효율은 실시예 2와 비교예 4(항체/링커만 결합되지 않은 것)의 나노 리포좀에서 가장 좋음을 알 수 있다(비교예 1의 나노 리포좀 제조시 Cas9 단백질을 첨가하지 않았기에, 여액에도 역시 Cas9 단백질은 전혀 확인되지 않음 - 비교군으로 제시함) Table 4 is a numerical representation of the results of FIG. 11, showing that the encapsulation efficiency of the hybrid or complex containing the guide RNA is best in the case of the nanoliposome of Example 2 and Comparative Example 4 (only antibody / linker is not bound) (Cas9 protein was not added at the time of preparing the nanoliposome of Comparative Example 1, and Cas9 protein was also not confirmed at all in the filtrate.

<실험예 7. 나노 리포좀의 표면 전하, 크기 및 분산도 확인>EXPERIMENTAL EXAMPLE 7. Confirmation of surface charge, size and dispersion of nanoliposome [

본 발명에서 제조한 나노 리포좀들의 표면 전하 변화(zeta potential, mV)와 크기 및 분산도를 Dynamic Light Scattering(DLS)로 측정하였으며, 서열번호 1의 가이드 RNA가 포함된 것을 대표로 하여 그 결과를 표 5에 나타내었다. The surface charge change (zeta potential, mV), size and dispersion of the nanoliposomes prepared in the present invention were measured by Dynamic Light Scattering (DLS) Respectively.

조건Condition 표면전하(mV)Surface charge (mV) 나노 입자 분포(nm)Nanoparticle distribution (nm) 나노 입자 평균 크기 (nm)Average size of nanoparticles (nm) 실시예 2Example 2 -2.09-2.09 90 ~ 110090 to 1100 330330 비교예 2Comparative Example 2 -4.08-4.08 50~150, 800~430050 to 150, 800 to 4300 981981 비교예 3Comparative Example 3 -7.89-7.89 60~140, 1100~5200, 7800~820060 to 140, 1100 to 5200, 7800 to 8200 420420 비교예 4Comparative Example 4 -2.25-2.25 90 ~ 110090 to 1100 411411

세포 내로 가이드 RNA가 포함된 나노 리포좀을 전달하기 위해서는 (-) 전하를 띄는 표면전하값이 최대한 감소하는 것이 좋은데, 표 4를 참고하면 실시예 2의 나노 리포좀은 표면전하값이 낮은 편에 속한다. 비교예 2의 나노 리포좀 조건도 표면전하가 낮지만, 시간의 흐름에 따라 분산도가 낮아져 나노 리포좀의 안정성이 좋지 않음이 확인된다(분산도는 표에 기재하지 않음). 또한, 나노 리포좀의 입자크기 또한 실시예 2와 비교예 4의 나노 리포좀에 비해 비교예 2와 비교예 3의 나노 리포좀은 크기 분포가 균일하지 않은 것을 알 수 있다. In order to transfer nanoliposome containing guide RNA into cells, it is preferable that the surface charge value having a (-) charge is reduced as much as possible. Referring to Table 4, the nanoliposome of Example 2 belongs to the lower surface charge value. Although the surface charge of the nanoliposome of Comparative Example 2 was low, it was confirmed that the stability of the nanoliposome was poor due to the lowering of the dispersibility with time (the degree of dispersion is not shown in the table). In addition, it can be seen that the particle size of the nanoliposome and the nanoliposome of Comparative Example 2 and Comparative Example 3 are not uniform in the size distribution as compared to the nanoliposome of Example 2 and Comparative Example 4. [

<110> Moogene Medi Co., Ltd. <120> Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance <130> P2016-0298 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Homo sapiens <400> 1 cugaauuagc uguaucguca 20 <210> 2 <211> 20 <212> RNA <213> Homo sapiens <400> 2 gaauauaaac uugugguagu 20 <210> 3 <211> 20 <212> DNA <213> Homo sapiens <400> 3 ctgaattagc tgtatcgtca 20 <210> 4 <211> 20 <212> DNA <213> Homo sapiens <400> 4 gaatataaac ttgtggtagt 20 <210> 5 <211> 20 <212> DNA <213> Homo sapiens <400> 5 tgacgataca gctaattcag 20 <210> 6 <211> 20 <212> DNA <213> Homo sapiens <400> 6 cttatatttg aacaccatca 20 <210> 7 <211> 104 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Homo sapiens <400> 7 cugaauuagc uguaucguca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuu 104 <210> 8 <211> 104 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Homo sapiens <400> 8 gaauauaaac uugugguagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuu 104 &Lt; 110 > Moogene Medi Co., Ltd. <120> Delivery carrier composition comprising nanoliposome          encapsulating complex of Cas9 protein, guide RNA for repressing          gene expression or KRAS gene and cationic polymer, or          KRAS mutation colon          가소 with anticancer drug resistance <130> P2016-0298 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> RNA <213> Homo sapiens <400> 1 cugaauuagc uguaucguca 20 <210> 2 <211> 20 <212> RNA <213> Homo sapiens <400> 2 gaauauaaac uugugguagu 20 <210> 3 <211> 20 <212> DNA <213> Homo sapiens <400> 3 ctgaattagc tgtatcgtca 20 <210> 4 <211> 20 <212> DNA <213> Homo sapiens <400> 4 gaatataaac ttgtggtagt 20 <210> 5 <211> 20 <212> DNA <213> Homo sapiens <400> 5 tgacgataca gctaattcag 20 <210> 6 <211> 20 <212> DNA <213> Homo sapiens <400> 6 cttatatttg aacaccatca 20 <210> 7 <211> 104 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Homo sapiens <400> 7 cugaauuagc uguaucguca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuu 104 <210> 8 <211> 104 <212> RNA <213> Artificial Sequence <220> <223> gRNA for Homo sapiens <400> 8 gaauauaaac uugugguagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu uuuu 104

Claims (8)

Cas9 단백질; 서열번호 1 또는 2의 염기서열을 포함하는 KRAS 유전자의 발현을 억제하는 가이드 RNA; 및, 폴리에틸렌이민의 복합체가 봉입된 나노 리포좀 전달체 조성물로서,
상기 나노 리포좀은 레시틴, 콜레스테롤, 1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민 및 1,2-디올레오일-sn-글리세로-3-[(N-(5-아미노-1-카르복시펜틸)이미노디아세트산)숙시닐](니켈염)을 포함하고,
대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체가 결합된 것을 특징으로 하는 나노 리포좀 전달체 조성물. Cas9 protein; A guide RNA that inhibits the expression of the KRAS gene comprising the nucleotide sequence of SEQ ID NO: 1 or 2; And a nanoliposome transporter composition in which a complex of polyethyleneimine is encapsulated,
Wherein said nanoliposome is selected from the group consisting of lecithin, cholesterol, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine and 1,2-dioloyoyl- Amino-1-carboxypentyl) iminodiacetic acid) succinyl] (nickel salt)
A monoclonal antibody capable of recognizing one or more proteins selected from the group consisting of Epidermal growth factor receptor (EGFR), epidermal cell adhesion molecule (EGFR), carcinoembryonic antigen (CEA), and Annexins expressed in colon cancer cells Or a polyclonal antibody is bound to the nanoliposome. 삭제delete 삭제delete 삭제delete 제1항에 있어서,
상기 나노 리포좀은 10 ~ 2,000 nm의 입자크기를 갖는 것을 특징으로 하는 나노 리포좀 전달체 조성물. The method according to claim 1,
Wherein the nanoliposome has a particle size of 10 to 2,000 nm. 제1항 또는 제5항의 나노 리포좀 전달체 조성물을 함유하는 것을 특징으로 하는 대장암의 개선 또는 치료용 조성물. A composition for improving or treating colorectal cancer, which comprises the nanoliposome transporter composition of claim 1 or 5. 제6항에 있어서,
상기 나노 리포좀 전달체 조성물에 세툭시맵(Cetuximab)이 첨가된 것을 특징으로 하는 대장암의 개선 또는 치료용 조성물. The method according to claim 6,
A composition for improving or treating colorectal cancer, wherein Cetuximab is added to the nanoliposome transporter composition. Cas9 단백질, 서열번호 1 또는 2의 염기서열을 포함하는 KRAS 유전자의 발현을 억제하는 가이드 RNA 및 폴리에틸렌이민의 복합체를 제조하고, 레시틴, 1,2-디올레오일-sn-글리세로-3-[(N-(5-아미노-1-카르복시펜틸)이미노디아세트산)숙시닐](니켈염), 콜레스테롤 및 1,2-디팔미토일-sn-글리세로-3-포스포에탄올아민을 클로로포름 상에서 혼합하여 지질 필름 조성물을 제조하는 제1단계;
상기 지질 필름 조성물에, Cas9 단백질, 서열번호 1 또는 2의 염기서열을 포함하는 KRAS 유전자의 발현을 억제하는 가이드 RNA 및 폴리에틸렌이민의 복합체를 넣어 초음파 처리하는 제2단계;
상기 초음파 처리된 지질 필름 조성물을 동결하고 융해한 후, 다시 초음파 처리하는 제3단계;
상기 제3단계에서 초음파 처리된 지질 필름 조성물을 원심분리하고 침전물 상태의 나노 리포좀을 회수하는 제4단계; 및,
상기 제4단계에서 얻은 침전물 상태의 나노 리포좀에 가교제를 통해 대장암 세포에서 발현하는 EGFR(Epidermal growth factor receptor), EpCAM(Epithelial cell adhesion molecule), CEA(Carcinoembryonic antigen) 및 아넥신스(Annexins)로 이루어진 군에서 선택되는 1종 이상의 단백질을 인식할 수 있는 단클론성 또는 다클론성 항체를 결합하는 제5단계;
를 포함하는 것을 특징으로 하는 대장암 세포를 선택적으로 인식할 수 있는 제1항의 나노 리포좀 전달체 조성물의 제조방법. Cas9 protein, a guide RNA which inhibits the expression of the KRAS gene comprising the nucleotide sequence of SEQ ID NO: 1 or 2, and a complex of polyethyleneimine are prepared and lecithin, 1,2-diolauryl-sn- (Nickel salt), cholesterol and 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine were mixed in chloroform A first step of preparing a lipid film composition;
A second step of ultrasonifying the lipid film composition with a complex of a guide RNA and a polyethyleneimine inhibiting the expression of the KRAS gene comprising the Cas9 protein, the nucleotide sequence of SEQ ID NO: 1 or 2;
A third step of freezing and melting the ultrasound-treated lipid film composition, and then ultrasonifying again;
A fourth step of centrifuging the lipophilic film composition sonicated in the third step and recovering the nanoliposome in the form of a precipitate; And
(Epidermal growth factor receptor), EpCAM (Epithelial cell adhesion molecule), CEA (carcinoembryonic antigen) and Annexins, which are expressed in colon cancer cells through a crosslinking agent in the precipitated nanoliposome obtained in the fourth step A fifth step of binding a monoclonal or polyclonal antibody capable of recognizing at least one protein selected from the group consisting of:
The method of claim 1, wherein the colon cancer cells are selectively recognized.
KR1020160182153A 2016-12-29 2016-12-29 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance KR101796036B1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
KR1020160182153A KR101796036B1 (en) 2016-12-29 2016-12-29 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance
CN201780067497.0A CN110325176B (en) 2016-12-29 2017-12-11 Nanoliposome carrier compositions
PCT/KR2017/014453 WO2018124538A1 (en) 2016-12-29 2017-12-11 Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160182153A KR101796036B1 (en) 2016-12-29 2016-12-29 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance

Publications (1)

Publication Number Publication Date
KR101796036B1 true KR101796036B1 (en) 2017-11-10

Family

ID=60386387

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160182153A KR101796036B1 (en) 2016-12-29 2016-12-29 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance

Country Status (3)

Country Link
KR (1) KR101796036B1 (en)
CN (1) CN110325176B (en)
WO (1) WO2018124538A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018124538A1 (en) * 2016-12-29 2018-07-05 주식회사 무진메디 Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation
KR20180136293A (en) * 2017-06-14 2018-12-24 한국과학기술원 Nonviral genome editing CRISPR nanocomplex and fabrication method thereof
WO2021217100A1 (en) * 2020-04-24 2021-10-28 Aadigen, Llc Compositions for treating cancer with kras mutations and uses thereof
KR102328197B1 (en) 2021-03-09 2021-11-17 주식회사 무진메디 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112359060B (en) * 2020-11-11 2022-12-23 吉林医药学院 Recombinant vector containing targeted mutant KRAS fusion gene, fusion protein and protein complex, and construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204728A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
WO2016049024A2 (en) * 2014-09-24 2016-03-31 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo
KR101710026B1 (en) 2016-08-10 2017-02-27 주식회사 무진메디 Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2010005089A (en) * 2007-11-09 2010-05-21 Univ Northeastern Self-assembling micelle-like nanoparticles for systemic gene delivery.
CA3113213A1 (en) * 2010-01-12 2011-07-21 Siemens Healthcare Diagnostics Inc. Oligonucleotides and methods for detecting kras mutations
KR20160089530A (en) * 2013-12-12 2016-07-27 더 브로드 인스티튜트, 인코퍼레이티드 Delivery, use and therapeutic applications of the crispr-cas systems and compositions for hbv and viral diseases and disorders
EP3277816B1 (en) * 2015-04-01 2020-06-17 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating duchenne muscular dystrophy and becker muscular dystrophy
CN106109417A (en) * 2016-08-24 2016-11-16 李因传 A kind of bionical lipidosome drug carrier of liver plasma membrane, manufacture method and application thereof
KR101796036B1 (en) * 2016-12-29 2017-11-10 주식회사 무진메디 Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014204728A1 (en) * 2013-06-17 2014-12-24 The Broad Institute Inc. Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
WO2016049024A2 (en) * 2014-09-24 2016-03-31 The Broad Institute Inc. Delivery, use and therapeutic applications of the crispr-cas systems and compositions for modeling competition of multiple cancer mutations in vivo
KR101710026B1 (en) 2016-08-10 2017-02-27 주식회사 무진메디 Composition comprising delivery carrier of nano-liposome having Cas9 protein and guide RNA

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018124538A1 (en) * 2016-12-29 2018-07-05 주식회사 무진메디 Nano-liposomal carrier composition with complex inclusive of cas9 protein, kras gene expression-inhibiting guide rna and cationic polymer loaded therein and therapeutic agent comprising same for colorectal cancer resistant to anticancer agent due to kras gene mutation
KR20180136293A (en) * 2017-06-14 2018-12-24 한국과학기술원 Nonviral genome editing CRISPR nanocomplex and fabrication method thereof
KR102206676B1 (en) 2017-06-14 2021-01-26 한국과학기술원 Nonviral genome editing CRISPR nanocomplex and fabrication method thereof
US11319533B2 (en) 2017-06-14 2022-05-03 Korea Advanced Institute Of Science And Technology CRISPR nanocomplex for nonviral genome editing and method for preparing the same
WO2021217100A1 (en) * 2020-04-24 2021-10-28 Aadigen, Llc Compositions for treating cancer with kras mutations and uses thereof
KR102328197B1 (en) 2021-03-09 2021-11-17 주식회사 무진메디 Nano-liposome delivery carrier composition having KRAS and P53 gene editing function
WO2022191431A1 (en) * 2021-03-09 2022-09-15 주식회사 무진메디 Nanoliposome carrier composition having kras and p53 gene editing function

Also Published As

Publication number Publication date
WO2018124538A1 (en) 2018-07-05
CN110325176A (en) 2019-10-11
CN110325176B (en) 2021-08-24

Similar Documents

Publication Publication Date Title
US11364201B2 (en) Nano-liposome carrier composition containing hybrid of Cas9 protein and guide RNA
KR101796036B1 (en) Delivery carrier composition comprising nanoliposome encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or KRAS gene and cationic polymer, or therapeutics comprising thereof for treating KRAS mutation colon cancer with anticancer drug resistance
EP2040728B1 (en) Fkbp-l and uses thereof as inhibitors of angiogenesis
EP3353309A1 (en) Compositions and methods for genome editing
US20150038429A1 (en) Etoposide and doxorubicin conjugates for drug delivery
US9074011B2 (en) Use of PTEN-long leader sequence for transmembrane delivery of molecules
BR112012013662B1 (en) LIPOCALIN MUTEINS ASSOCIATED WITH HUMAN NEUTROPHIL GELATINASE (LCN2, HNGAL), THEIR USE AND THEIR GENERATION AND PRODUCTION METHODS, NUCLEIC ACID MOLECULE, HOST CELL, PHARMACEUTICAL COMPOSITION AND DIAGNOSIS OR ANALYTICAL KIT
JP5973035B2 (en) Identification of extracellular forms of PTEN that can be used to treat tumors
KR101870694B1 (en) Nanoliposome-microbubble assemblies encapsulating complex of Cas9 protein, guide RNA for repressing gene expression or SRD5A2 gene and cationic polymer, and composition comprising the same for improving or treating hair loss
KR102328197B1 (en) Nano-liposome delivery carrier composition having KRAS and P53 gene editing function
Ryu et al. Gene editing particle system as a therapeutic approach for drug-resistant colorectal cancer
US20210100752A1 (en) Compositions for the treatment of drug-resistant tumors and methods of use thereof
IL292394A (en) Hla-h, hla-j, hla-l, hla-v and hla-y as therapeutic and diagnostic targets
CN113717252B (en) CD44 antagonistic polypeptide and derivative and application thereof
US20240009252A1 (en) Compositions and methods of treatment comprising tumor-targeting bacteria and chemotherapy or immunotherapy agent
Tang et al. Targeting DAD1 gene with CRISPR-Cas9 system transmucosally delivered by fluorinated polylysine nanoparticles for bladder cancer intravesical gene therapy
EP3662922A1 (en) Medication for inhibiting dna-pkcs
WO2024040229A2 (en) Combination therapies comprising myc modulators and checkpoint inhibitors
WO2023118294A1 (en) Inhibition of mitoferrin 2 as means for inhibiting cancer and cancer metastasis

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant