WO2023118294A1

WO2023118294A1 - Inhibition of mitoferrin 2 as means for inhibiting cancer and cancer metastasis

Info

Publication number: WO2023118294A1
Application number: PCT/EP2022/087235
Authority: WO
Inventors: Sarah-Maria FENDT; Alejandro CUADROS
Original assignee: Vib Vzw; Katholieke Universiteit Leuven
Priority date: 2021-12-22
Filing date: 2022-12-21
Publication date: 2023-06-29

Abstract

The invention relates to inhibition of mitoferrin 2 as a means for treating cancer, for preventing or inhibiting cancer metastasis, and for treating established metastases.

Description

INHIBITION OF MITOFERRIN 2 AS MEANS FOR INHIBITING CANCER AND CANCER METASTASIS

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

The majority of cancer patients dies due to metastasis formation in distant organs. To date effective therapies for preventing or treating an already developed metastatic disease are largely lacking. The effect of this lack of treatment options against metastatic cancers is dramatically illustrated for breast cancer. At early-stage disease the 5-year survival rate for breast cancer patients is more than 90%, however once metastases arise this drops to less than 20%, resulting in over 685 000 deaths per year. Thus, there is an urgent need to develop novel therapeutic options that can prevent or treat metastases in multiple organs.

Interfering with iron metabolism as a way to treat cancer is known already for some time. This often relies on systemic administration of iron chelators, which have been demonstrated to inhibit growth of (at least some) primary tumors, and suggested to potentially inhibit metastatic spread (e.g. Torti et al. 2013, Nat Rev Cancer 13:342). Systemic iron chelation, however, and not unexpectedly, appears to come with an unfavorable toxicity profile (including hypersensitivity reactions, liver dysfunction, renal dysfunction and neuronal hearing loss for e.g. desferoxamine and deferasirox; Crielaard et al. 2017, Nat Rev Drug Discov 16:400). Using a targeted strategy (delivery of therapeutics to specific tissues/more specific target) in order to limit off-target activity is therefore recommended.

The solute carrier (SLC) family of proteins spans over 400 different proteins and information on most of these is still scarce. Mitoferrin 1 (MFRN1) and mitoferrin 2 (MFRN2) both are mitochondrial SLCs: SLC25A37 and SLC25A28, respectively; both are encoded by nuclear genes. Mfrn 2 knockout mice are viable and have very few and minor phenotypic changes. Importantly, Mfrn2 is ubiquitously expressed in tissues whereas the Mfrnl isoform is preferentially and highly expressed in red blood cells, and when knocked out in adult hematopoietic tissues leads to severe anaemia due to a deficit in erythroblast formation (Seguin et al. 2020, J Biol Chem 295:11002-11020; Troadec et al. 2011, Blood 117:5494-5502). Li et al. 2018 (Dev Cell 46 :441-455) and Kang et al. 2019 (Autophagy 15:172-173) studied the effects of PINK1 and PARK2 mutation on the development and metastasis of pancreatic cancer (PDAC). The multifactorial consequences of PINK1 and PARK2 mutation include, amongst other, higher pancreatic mitochondrial iron loading, increased levels of multiple proteins including mitochondrial iron importers (SLC25A37 [mitoferrin 1] and SLC25A28 [mitoferrin 2]), mitochondrial stress markers (HSPD1 [heat shock protein family D (Hsp60) member 1] and HSPA9 [heat shock protein family A (Hsp70) member 9]), mitophagy deficiency-associated markers (VDAC [voltage dependent anion channel], COX4I1/COXIV [cytochrome C oxidase subunit 411], and TOMM20 [translocase of outer mitochondrial membrane 20]), and to increased expression of Cd274 (PD-L1). Depletion of mitoferrin 1 (Slc25a37) and mitoferrin 2 (Slc25a28) by RNAi in PINK1-/- PDAC cells restored mitochondrial iron to normal wild-type levels. Pharmacological administration of mitochondrial iron chelator, anti-HMGBl antibody, or genetic depletion of Hifla or Aim2 in pinkl⁷" and park2⁷" mice confers protection against pancreatic tumorigenesis.

Ni et al. 2020 (Cancer Cell Int 20:399) reported the role of mitochondrial iron accumulation (involving mitoferrins 1 and 2) in promoting osteosarcoma and suggest iron deprivation (iron chelation) as potential strategy in osteosarcoma treatment. Knock-down of mitoferrin 1 and mitoferrin 2 decreased the production of ROS. The antitumoral role of miR-7 in rhabdomyosarcoma was reported to be partially linked to SLC25A37 (mitoferrin 1) (Yang et al. 2020, BBA Mol Cell Res 1867:118826).

SUMMARY OF THE INVENTION

The invention in one aspect relates to an inhibitor of mitoferrin 2 for use in treating cancer, for use in inhibiting progression of cancer, for use in preventing or inhibiting metastasis, or for use in treating or inhibiting progression of established metastasis. In an embodiment thereto the cancer is a primary cancer. In a further embodiment, the inhibitor of mitoferrin 2 is a DNA nuclease specifically knocking out or disrupting MFRN2 expression, an RNase specifically targeting MFRN2 expression, or an inhibitory oligonucleotide specifically targeting MFRN2 expression. Further specifically, the DNA nuclease is selected from a zinc-finger nuclease, a TALEN, a CRISPR-Cas, or a meganuclease; or the RNase is selected form a ribozyme or a CRISPR-C2c2; or the oligonucleotide is selected from an antisense oligomer, a siRNA, a shRNA, a gapmer, or a nucleic acid aptamer.

Furthermore, the inhibitor of mitoferrin 2 for use as outlined hereinabove can be combined with cancer resection or radiation, or can be combined with a therapy comprising a further anti-cancer agent. In one embodiment, the further anti-cancer agent is an immunotherapeutic agent.

The invention further relates to pharmaceutical compositions comprising a DNA nuclease specifically knocking out or disrupting MFRN2 expression, an RNase specifically targeting MFRN2 expression, and/or an inhibitory oligonucleotide specifically targeting MFRN2 expression. Such pharmaceutical composition in particular are for use as medicament. LEGENDS TO THE FIGURES

FIGURE 1. In-vivo CRISPR knockout identifies Mitoferrin-2 (Slc25a28) as a metastatic dependency

Metastatic burden of 4T1 (hydrodynamic delivery, h.d) in lung (A) and liver (B) after genetic knockout of Slc25a28 using CRISPR single-guide RNAs. Data represent total metastatic areas of quantified H&E slides from individual mouse lung and liver. Two-way Anova (n = 12). (C) Metastatic burden in 4T1 (mammary fat pad delivery, m.f) lungs upon genetic knockout of Mfrn2. Two-tailed unpaired Student's t test (n = 12).

FIGURE 2. In-vivo CRISPR knockout of Mitoferrin-1 {Slc25a37)

Metastatic burden of 4T1 (h.d) lung and liver after genetic knockout of Slc25a37 using CRISPR singleguide RNAs. Data represent total metastatic areas of quantified H&E slides from individual mouse lung and liver. Two-way Anova (n = 12)

FIGURE 3. Mitoferrin-2 knockout reduces tumor growth.

Primary tumor growth kinetics after orthotopic injection of 4T1 cells (m.f) into Balb/c mice. Individual data points represent the mean tumor sizes each day of n=12 mice. Two-tailed unpaired Student's t-test.

FIGURE 4. Mitoferrin-2 knockout reduces tumor spheroid formation in various cancers models.

(A) Quantification of the total average spheroid area of >100 tumor spheroids in 4T1 and MCF7 breast cancer cell lines. Two-way ANOVA with Bonferroni correction (n=6). (B-C) Quantification of the total average spheroid area of >100 tumor spheroids in human colorectal carcinoma HCT-116 (B) and human liver carcinoma HUH7 (C) cancer cell lines and corresponding representative images. Unpaired students t-test (n=5).

FIGURE 5. Mitoferrin-2 knockout reduces protein lipoylation and inhibition of lipoylation phenocopies MFRN2

(A) Western blot from duplicate 4T1 tumor spheroid lysates of Control or Mitoferrin-2 KO cells. Protein lipoylation on pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) was assessed using an anti-lipoic acid antibody (a lipoic acid) while total levels of lipoylated proteins were also assessed (aPDH and aOGDH). Vinculin was used as loading control (a vinculin). (B) Representative hematoxylin and eosin-stained tissue slides from lungs and livers bearing 4T1 (control and lipoyltransferase 1 [Liptl] knockout) metastasis. (C) Representative images of 4T1 Control and Mitoferrin-2 KO tumor spheroids transduced with mito-LplA (mitochondrial targeting signal + bacterial lipoate ligase A) or empty vector constructs supplemented with or without lOOuM lipoic acid.

FIGURE 6. Survival analysis of renal cancer patients with either high or low SLC25A28 expression. Data obtained from the Human Protein Atlas and represent statistically significant associations (p<0.001). Figure adapted from Human Protein Atlas https://www.proteinatlas.org/ENSG00000155287- SLC25A28/pathology/renal+cancer). FIGURE 7. Schematic representation of relevant part of 1067_pLentiPGK mitoLplA-FLAG vector map; mito-LplA: mitochondrial targeting signal + bacterial lipoate ligase A.

FIGURE 8. Gene expression level of Mfrn2, upon incubation of HCT-116 cells with ASOs targeting Mfrn2. FIGURE 9. Growth of Mfrn2-expressing (shSCR) and Mfrn2-knockdown (shMFRN2_#l) liver metastases over time, measured using BLL ROI, region of interest. Dox: doxycycline. "Put on Dox": start of doxycycline administration to induce Mfrn2 knockdown.

FIGURE 10. Growth of Mfrn2-expressing (shSCR) and Mfrn2-knockdown (shMFRN2_#l, shMFRN2_#2; or generally shMFRN2) multi-organ metastases over time, measured using BLI. ROI, region of interest. Dox: doxycycline. "Off Dox": time point at which doxycycline administration to induce Mfrn2 knockdown is stopped, therewith normalizing Mfrn2 expression.

FIGURE 11. Mitoferrin-2 knockout reduces growth in various cancers cell lines. Cell culture growth (2D: 2-dimensional) of wild-type bone cancer cells ("143B"), colorectal cancer cells ("HCT-116") and liver cancer cells ("HUH-7") in which Mfrn2 expression was knocked out/down by means of Crispr/Cas ("MFRN2 KO sg2"; right bars of the different cancer types) was compared with growth of their Mfrn2- expressing counterparts ("sg control"; left bars of the different cancer types).

DETAILED DESCRIPTION

In initial work leading to the current invention, it was found that silencing Mfrn2 expression in 4T1 breast cancer cells (by Crispr-Cas knockout of MFRN2) inhibits formation of lung and liver metastasis in a mouse model of experimental metastasis - unexpectedly the effect of Mfrn2 silencing was not phenocopied by silencing of Mfrnl expression. Moreover, the massive reduction in metastases could not be explained by the (moderate) reduction in primary 4T1 breast tumor size upon Mfrn2 knockout in the tumor cells, an observation that brings within reach the option to treat already established/developed metastasis/metastases. The effect on primary tumor growth appears to extend to other cancers as Mfrn2 knockout reduced the size of in vitro 3-dimensional tumor spheroids derived from breast, colorectal, and liver cancer cells, and reduced the growth of in vitro 2-dimensional growth of bone, colorectal and liver cancer cells. The effect of Mfrn2 knock out/down or silencing on suppressing and even eradicating established metastases was confirmed for liver, brain and bone metastasis.

Therefore, in a first aspect, the invention relates to an inhibitor of mitoferrin 2 (MFRN2) for use in treating or inhibiting cancer or a tumor, for use in inhibiting progression of cancer or of a tumor, for use in treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, and/or for use in treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases.

Alternatively, the invention relates to an inhibitor of mitoferrin 2 (MFRN2) for use in the manufacture of a medicine or medicament for treating or inhibiting cancer or a tumor, for inhibiting progression of cancer or of a tumor, for treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, and/or for treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases.

Further alternatively, the invention relates to methods of or for treating or inhibiting cancer or a tumor, of or for inhibiting progression of cancer or of a tumor, of or for treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, and/or of or for treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases, in a subject or individual (in particular a mammalian subject or mammal, such as a human subject or human) having cancer, a tumor or metastasis/metastases, such methods comprising administering an inhibitor of MFRN2 to the subject or individual. The administration of the MFRN2 inhibitor, such as a therapeutically effective amount of the MFRN2 inhibitor, to the subject or individual results: in the treatment or inhibition of the cancer or tumor, in the inhibition of progression of the cancer or tumor, in the treatment, prevention, inhibition, or inhibition of progression of metastasis/metastases or of metastasis/metastases formation or development, and/or in the treatment, inhibition, or inhibition of progression of established or (already) developed metastasis/metastases.

In one embodiment to the above, the tumor or cancer is a primary tumor or cancer, such as breast, colon, liver or renal cancer.

In one embodiment to the above, the inhibitor of mitoferrin 2 can be a DNA nuclease specifically knocking out, targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression, an RNase specifically targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression, or an inhibitory oligonucleotide specifically targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression. A DNA nuclease specifically knocking out, targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression can be a zinc-finger nuclease, a TALEN, a CRISPR-Cas, or a meganuclease. An RNase specifically targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression can be a ribozyme or a CRISPR-C2c2. An inhibitory oligonucleotide specifically targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression can be an antisense oligomer, a siRNA, a shRNA, a gapmer, or a nucleic acid aptamer. The nature of these inhibitor modalities is explained in more detail hereinafter. As mitoferrin 2 is encoded by the nuclear genome (and not by the mitochondrial genome), these inhibitor modalities are able to interfere with mitoferrin 2 expression in a way similar as other such inhibitor modalities interfering with expression of any other target encoded by the nuclear genome.

In another aspect, the invention relates to pharmaceutical compositions comprising an inhibitor of mitoferrin 2, in particular an inhibitor of mitoferrin 2 being a DNA nuclease specifically knocking out, targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression, an RNase specifically targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression, or an inhibitory oligonucleotide specifically targeting, inhibiting, disrupting, blocking, or silencing MFRN2 expression. Such pharmaceutical compositions in particular are for use as a medicament. Such pharmaceutical compositions more in particular are for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating or inhibiting cancer or a tumor, for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) inhibiting progression of cancer or of a tumor, for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, and/or for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases.

Mitoferrins

In referring to genes or proteins herein, no distinction is necessarily made in the annotation. Thus, whereas for example the human MFRN2 gene would be referred to as the MFRN2 gene, the mRNA as MFRN2 mRNA, and the protein as MFRN2, such distinction is not, or not always, made hereinabove or hereinafter.

Mitoferrin 2 is also known as SLC25A28 (solute carrier family 25 member 28), MRS3/4 (Mitochondrial RNA-Splicing Protein 3/4), MRS4L, Mitochondrial Iron Transporter 2, Mitoferrin-2, HMRS3/4, MFRN2, or NPD016. NCBI reference mRNA sequences is given in GenBank accession no NM_031212.4. The human MFRN2 gene is located on chrl0:99, 610, 522-99, 659, 507 (GRCh38/hg38; minus strand) or chrl0:101, 370, 279-101, 380, 196 (GRCh37/hgl9; minus strand).

Mitoferrin 1 is also known as SLC25A37 (solute carrier family 25 member 37), MSCP (Mitochondrial Solute Carrier Protein), MFRN, Mitochondrial Iron Transporter 1, Mitoferrin-1, MFRN1, or HT015. NCBI reference mRNA sequences are given in GenBank accession nos NM_001317812.2 ; NM_001317813.2 ; NM_001317814.2 ; NM_016612.4 ; NM_018579.2 ; and NM_018586.1. The human MFRN1 gene is located on chr8:23, 528, 956-23, 575, 463 (GRCh38/hg38; plus strand) or chr8:23, 386, 469-23, 432, 976 (GRCh37/hgl9; plus strand).

Tumor, cancer, neoplasm, metastasis/metastases

The terms tumor (or tumour) and cancer are sometimes used interchangeably but can be distinguished from each other. A tumor refers to "a mass" which can be benign (more or less harmless) or malignant (cancerous). A cancer is a threatening type of tumor. A tumor is sometimes referred to as a neoplasm characterized by an abnormal cell growth, usually faster compared to growth of normal cells. Benign tumors or neoplasms are non-malignant/non-cancerous, are usually localized and usually do not spread/metastasize to other locations. Because of their size, they can affect neighboring organs and may therefore need removal and/or treatment. A cancer, malignant tumor or malignant neoplasm is cancerous in nature, can metastasize, and sometimes re-occurs at the site from which it was removed or surgically resected (relapse).

The initial site where a cancer starts to develop gives rise to the primary cancer. When cancer cells break away from the primary cancer ("seed"), they can move (via blood or lymph fluid) to another site even remote from the initial site. If the other site allows settlement and growth of these moving cancer cells ("soil"), a new cancer, called secondary cancer, can emerge. The process leading to secondary cancer is also termed metastasis, and secondary cancers are also termed metastases. For instance, liver cancer can arise as primary cancer, but can also be a secondary cancer originating from a primary breast cancer, bowel cancer or lung cancer; some types of cancer show an organ-specific pattern of metastasis.

Formation or development of metastasis/metastases, and thus also inhibition thereof or inhibition of progression thereof, theoretically can begin as soon as a primary cancer is formed or forming. In clinical practice, the presence of tumor cells in e.g. lymphatic vessels or lymph nodes in the vicinity of a primary tumor e.g. as determined upon surgical resection of a primary tumor can be an indication for the metastasis process having started. In other cases, metastasis or metastases are detected only when already established or developed. Most cancer deaths are in fact caused by metastases, rather than by primary tumors (Chambers et al. 2002, Nature Rev Cancer 2:563-572). Genetic inhibition of a target of interest

Downregulating expression of a gene encoding a target is feasible through gene therapy or gene therapeutic agents, in particular gene therapeutic antagonist agents. Such agents include such entities as antisense oligonucleotides, gapmers, siRNA, shRNA, zinc-finger nucleases, meganucleases, Argonaute (at least the forms exhibiting endonuclease activity), TAL effector nucleases, CRISPR-Cas effectors, and nucleic acid aptamers. In particular, any of these agents is specifically or exclusively acting on or antagonizing the target of interest; or any of these agents is designed for specifically or exclusively acting on or antagonizing the target of interest. Action of some of these agents may be controlled by means of a cell-, tissue- or organ-specific gene promotor or targeting moiety, or by means of an inducible gene promotor.

One process of modulating/downregulating expression of a gene/target gene of interest relies on antisense oligonucleotides (ASOs), or variants thereof such as gapmers. An antisense oligonucleotide (ASO) is a short strand of nucleotides and/or nucleotide analogues that hybridizes with the complementary mRNA in a sequence-specific manner. Formation of the ASO-mRNA complex ultimately results in downregulation of target protein expression (Chan et al. 2006, Clin Exp Pharmacol Physiol 33:533-540; this reference also describes some of the software available for assisting in design of ASOs). Modifications to ASOs can be introduced at one or more levels: phosphate linkage modification (e.g. introduction of one or more of phosphodiester, phosphoramidate or phosphorothioate bonds), sugar modification (e.g. introduction of one or more of LNA (locked nucleic acids), 2'-O-methyl, 2'-O-methoxy- ethyl, 2'-fluoro, S-constrained ethyl or tricyclo-DNA and/or non-ribose modifications (e.g. introduction of one or more of phosphorodiamidate morpholinos or peptide nucleic acids). The introduction of 2'- modifications has been shown to enhance safety and pharmacologic properties of antisense oligonucleotides. Antisense strategies relying on degradation of mRNA by RNase H requires the presence of nucleotides with a free 2' -oxygen, i.e. not all nucleotides in the antisense molecule should be 2'- modified. The gapmer strategy has been developed to this end. A gapmer antisense oligonucleotide consists of a central DNA region (usually a minimum of 7 or 8 nucleotides) with (usually 2 or 3) 2'- modified nucleosides flanking both ends of the central DNA region. This is sufficient for the protection against exonucleases while allowing RNAseH to act on the (2'-modification free) gap region. Antidote strategies are available as demonstrated by administration of an oligonucleotide fully complementary to the antisense oligonucleotide (Crosby et al. 2015, Nucleic Acid Ther 25:297-305). Such oligonucleotides can enter (target) cells freely, or this process can be assisted by e.g. transfection, liposome encapsulation, etc. (see further).

Aptamers have been selected against small molecules, toxins, peptides, proteins, viruses, bacteria, and even against whole cells. DNA/RNA/XNA aptamers (nucleic acid aptamers) are single stranded oligonucleotides and are typically around 15-60 nucleotides in length, although longer sequences of 220nt have been selected; they can contain non-natural nucleotides (XNA) as described for antisense RNA. A nucleotide aptamer binding to the vascular endothelial growth factor (VEGF) was approved by FDA for treatment of macular degeneration. Variants of RNA aptamers are spiegelmers and are composed entirely of an unnatural L-ribonucleic acid backbone. A spiegelmer of the same sequence has the same binding properties of the corresponding RNA aptamer, except it binds to the mirror image of its target molecule.

Another process to modulate expression of a gene/target gene of interest is based on the natural process of RNA interference. It relies on double-stranded RNA (dsRNA) that is cut by an enzyme called Dicer, resulting in double stranded small interfering RNA (siRNA) molecules which are 20-25 nucleotides long. siRNA then binds to the cellular RNA-lnduced Silencing Complex (RISC) separating the two strands into the passenger and guide strand. While the passenger strand is degraded, RISC is cleaving mRNA specifically at a site instructed by the guide strand. Destruction of the mRNA prevents production of the protein of interest and the gene is 'silenced'. siRNAs are dsRNAs with 2 nt 3' end overhangs whereas shRNAs are dsRNAs that contains a loop structure that is processed to siRNA. shRNAs are introduced into the nuclei of target cells using a vector (e.g. bacterial or viral) that optionally can stably integrate into the genome. Apart from checking for lack of cross-reactivity with non-target genes, manufacturers of RNAi products provide guidelines for designing siRNA/shRNA. siRNA sequences between 19-29 nt are generally the most effective. Sequences longer than 30 nt can result in nonspecific silencing. Ideal sites to target include AA dinucleotides and the 19 nt 3' of them in the target mRNA sequence. Typically, siRNAs with 3' dlldll or dTdT dinucleotide overhangs are more effective. Other dinucleotide overhangs could maintain activity but GG overhangs should be avoided. Also to be avoided are siRNA designs with a 4-6 poly(T) tract (acting as a termination signal for RNA pol III), and the G/C content is advised to be between 35-55%. shRNAs should comprise sense and antisense sequences (advised to each be 19-21 nt in length) separated by loop structure, and a 3' AAAA overhang. Effective loop structures are suggested to be 3-9 nt in length. It is suggested to follow the sense-loop-antisense order in designing the shRNA cassette and to avoid 5' overhangs in the shRNA construct. shRNAs are usually transcribed from vectors, e.g. driven by the Pol III U6 promoter or Hl promoter. Vectors allow for inducible shRNA expression, e.g. relying on the Tet-on and Tet-off inducible systems commercially available, or on a modified U6 promoter that is induced by the insect hormone ecdysone. A Cre-Lox recombination system has been used to achieve controlled expression in mice. Synthetic shRNAs can be chemically modified to affect their activity and stability. Plasmid DNA or dsRNA can be delivered to a cell by means of transfection (lipid transfection, cationic polymer-based nanoparticles, lipid or cell-penetrating peptide conjugation) or electroporation. Vectors include viral vectors such as lentiviral, retroviral, adenoviral and adeno- associated viral vectors.

Ribozymes (ribonucleic acid enzymes) are another type of molecules that can be used to modulate expression of a gene/target gene of interest. They are RNA molecules capable of catalyzing specific biochemical reactions, in the current context capable of targeted cleavage of nucleotide sequences, in particular targeted cleavage of a RNA/RNA target of interest. Examples of ribozymes include the hammerhead ribozyme, the Varkud Satellite ribozyme, Leadzyme and the hairpin ribozyme.

Besides the use of the inhibitory RNA technology, modulation of expression of a gene of interest can be achieved at DNA level such as by gene therapy to knock-out, knock-down or disrupt the target gene/gene of interest. As used herein, a "gene knock-out" can be a gene knockdown or the gene can be knocked out, knocked down, disrupted or modified by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques such as described hereafter, including, but not limited to, retroviral gene transfer. One way in which genes can be knocked out, knocked down, disrupted or modified is by the use of zinc finger nucleases. Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target a desired DNA sequence/DNA sequence of interest, which enable zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of the endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms.

Other technologies for genome customization that can be used to specifically or selectively knock out, knock down or disrupt a gene/gene of interest are meganucleases and TAL effector nucleases (TALENs, Cellectis bioresearch). A TALEN® is composed of a TALE DNA binding domain for sequence-specific recognition fused to the catalytic domain of an endonuclease that introduces double strand breaks (DSB). The DNA binding domain of a TALEN® is capable of targeting with high precision a large recognition site (for instance 17bp). Meganucleases are sequence-specific endonucleases, naturally occurring "DNA scissors", originating from a variety of single-celled organisms such as bacteria, yeast, algae and some plant organelles. Meganucleases have long recognition sites of between 12 and 30 base pairs. The recognition site of natural meganucleases can be modified in order to target native genomic DNA sequences (such as endogenous genes) or DNA sequences of interest. Another recent genome editing technology is the CRISPR/Cas system, which can be used to achieve RNA-guided genome engineering (including knock-out, knock-down or disruption of a gene of interest). CRISPR interference is a genetic technique which allows for sequence-specific control of expression of a gene of interest in prokaryotic and eukaryotic cells. It is based on the bacterial immune system-derived CRISPR (clustered regularly interspaced palindromic repeats) pathway. Recently, it was demonstrated that the CRISPR-Cas editing system can also be used to target RNA. It has been shown that the Class 2 type Vl-A CRISPR-Cas effector C2c2 (Casl3a; CRISPR-Casl3a or CRISPR-C2c2) can be programmed to cleave single stranded RNA targets carrying complementary protospacers (Abudayyeh et al. 2016 Science353/science.aaf5573). C2c2 is a single-effector endoRNase mediating ssRNA cleavage once it has been guided by a single crRNA guide toward a target RNA/RNA of interest.

Methods for administering nucleic acids include methods applying non-viral (DNA or RNA) or viral nucleic acids (DNA or RNA viral vectors). Methods for non-viral gene therapy include the injection of naked DNA (circular or linear), electroporation, the gene gun, sonoporation, magnetofection, the use of oligonucleotides, lipoplexes (e.g. complexes of nucleic acid with DOTAP or DOPE or combinations thereof, complexes with other cationic lipids), lipid nanoparticles (LNPs), dendrimers, viral-like particles, inorganic nanoparticles, hydrodynamic delivery, photochemical internalization (Berg et al. 2010, Methods Mol Biol 635:133-145) or combinations thereof.

Many different vectors have been used in human nucleic acid or gene therapy trials and a listing can be found on http://www.abedia.com/wilev/vectors.php. Currently the major groups are adenovirus or adeno-associated virus vectors (in about 21% and 7% of the clinical trials), retrovirus vectors (about 19% of clinical trials), naked or plasmid DNA (about 17% of clinical trials), and lentivirus vectors (about 6% of clinical trials). Combinations are also possible, e.g. naked or plasmid DNA combined with adenovirus, or RNA combined with naked or plasmid DNA to list just a few. Other viruses (e.g. alphaviruses, vaccinia viruses such as vaccinia virus Ankara) are used in nucleic acid therapy and are not excluded in the context of the current invention.

Administration may be aided by specific formulation of the nucleic acid e.g. in liposomes (lipoplexes), polymersomes (synthetic variants of liposomes) or lipid nanoparticles (LNPs), as polyplexes (nucleic acid complexed with polymers), carried on dendrimers, in inorganic (nano)particles (e.g. containing iron oxide in case of magnetofection), or combined with a cell penetrating peptide (CPP) to increase cellular uptake. Organ- or cellular-targeting strategies may also be applied to the nucleic acid (nucleic acid combined with organ- or cell-targeting moiety); these include passive targeting (mostly achieved by adapted formulation) or active targeting (e.g. by coupling a nucleic acid-comprising nanoparticle with any compound (e.g. an aptamer or antibody or antigen binding molecule) binding to a target organ- or cellspecific antigen) (e.g. Steichen et al. 2013, Eur J Pharm Sci 48:416-427).

CPPs enable translocation of the drug of interest coupled to them across the plasma membrane. CPPs are alternatively termed Protein Transduction Domains (TPDs), usually comprise 30 or less (e.g. 5 to 30, or 5 to 20) amino acids, and usually are rich in basic residues, and are derived from naturally occurring CPPs (usually longer than 20 amino acids), or are the result of modelling or design. A non-limiting selection of CPPs includes the TAT peptide (derived from HIV-1 Tat protein), penetratin (derived from Drosophila Antennapedia - Antp), pVEC (derived from murine vascular endothelial cadherin), signalsequence based peptides or membrane translocating sequences, model amphipathic peptide (MAP), transportan, MPG, polyarginines; more information on these peptides can be found in Torchilin 2008 (Adv Drug Deliv Rev 60:548-558) and references cited therein. CPPs can be coupled to carriers such as nanoparticles, liposomes, micelles, or generally any hydrophobic particle. Coupling can be by absorption or chemical bonding, such as via a spacer between the CPP and the carrier. To increase target specificity an antibody binding to a target-specific antigen can further be coupled to the carrier (Torchilin 2008, Adv Drug Deliv Rev 60:548-558). CPPs have already been used to deliver payloads as diverse as plasmid DNA, oligonucleotides, siRNA, peptide nucleic acids (PNA), proteins and peptides, small molecules and nanoparticles inside the cell (Stalmans et al. 2013, PloS One 8:e71752).

Any other modification of the DNA or RNA to enhance efficacy of nucleic acid or gene therapy is likewise envisaged to be useful in the context of the applications of the genetic inhibitor as outlined herein. The enhanced efficacy can reside in enhanced expression, enhanced delivery properties, enhanced stability and the like. The applications of the genetic inhibitor as outlined herein may thus rely on using a modified nucleic acid as described above. Further modifications of the nucleic acid may include those suppressing inflammatory responses (hypo-inflammatory nucleic acids).

Treatment / therapeutically effective amount

The terms therapeutic modality, therapeutic agent, and agent are used interchangeably herein, and likewise relate to immunotherapeutic compounds or agents. All refer to a therapeutically active compound, to a combination of therapeutically active compounds, or to a therapeutically active composition (comprising one or more therapeutically active compounds) such as a pharmaceutical composition.

"Treatment"/"treating" refers to any rate of reduction, delaying or retardation of the progress of the disease or disorder, or a single symptom thereof, compared to the progress or expected progress of the disease or disorder, or single symptom thereof, when left untreated. This implies that a therapeutic modality on its own may not result in a complete or partial response (or may even not result in any response), but may, in particular when combined with other therapeutic modalities (such as, but not limited thereto: surgery, radiation, etc.), contribute to a complete or partial response (e.g. by rendering the disease or disorder more sensitive to therapy). More desirable, the treatment results in no/zero progression of the disease or disorder, or singe symptom thereof (i.e. "inhibition" or "inhibition of progression"), or even in any rate of regression of the already developed disease or disorder, or singe symptom thereof. "Suppression/suppressing" can in this context be used as alternative for "treatment/treating". Treatment/treating also refers to achieving a significant amelioration of one or more clinical symptoms associated with a disease or disorder, or of any single symptom thereof. Depending on the situation, the significant amelioration may be scored quantitatively or qualitatively. Qualitative criteria may e.g. by patient well-being. In the case of quantitative evaluation, the significant amelioration is typically a 10% or more, a 20% or more, a 25% or more, a 30% or more, a 40% or more, a 50% or more, a 60% or more, a 70% or more, a 75% or more, a 80% or more, a 95% or more, or a 100% improvement over the situation prior to treatment. The time-frame over which the improvement is evaluated will depend on the type of criteria/disease observed and can be determined by the person skilled in the art.

A "therapeutically effective amount" refers to an amount of a therapeutic agent to treat or prevent a disease or disorder, or any single symptom thereof, in a subject (such as a mammal). In the case of cancers, the therapeutically effective amount of the therapeutic agent may reduce the number of cancer cells; reduce the primary tumor size; inhibit (i.e., slow down to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow down to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the disorder. To the extent the drug may prevent growth and/or kill existing cancer cells, it may be cytostatic and/or cytotoxic. For cancer therapy, efficacy in vivo can, e.g., be measured by assessing the duration of survival (e.g. overall survival), time to disease progression (TTP), response rates (e.g., complete response and partial response, stable disease), length of progression-free survival (PFS), duration of response, and/or quality of life.

The term "effective amount" or "therapeutically effective amount" may depend on the dosing regimen of the agent/therapeutic agent or composition comprising the agent/therapeutic agent (e.g. medicament or pharmaceutical composition). The effective amount will generally depend on and/or will need adjustment to the mode of contacting or administration. The effective amount of the agent or composition comprising the agent is the amount required to obtain the desired clinical outcome or therapeutic effect without causing significant or unnecessary toxic effects (often expressed as maximum tolerable dose, MTD). To obtain or maintain the effective amount, the agent or composition comprising the agent may be administered as a single dose or in multiple doses. The effective amount may further vary depending on the severity of the condition that needs to be treated (and may, under controlled circumstances, even exceed the MTD); this may depend on the overall health and physical condition of the subject or patient and usually the treating doctor's or physician's assessment will be required to establish what is the effective amount. The effective amount may further be obtained by a combination of different types of contacting or administration. The aspects and embodiments described above in general may comprise the administration of one or more therapeutic compounds to a subject (such as a mammal) in need thereof, i.e., harboring a tumor, cancer, neoplasm or metastasis/metastases in need of treatment. In general a (therapeutically) effective amount of (a) therapeutic compound(s) is administered to the mammal in need thereof in order to obtain the described clinical response(s).

"Administering" means any mode of contacting that results in interaction between an agent (e.g. a therapeutic compound or agent) or composition comprising the agent (such as a medicament or pharmaceutical composition) and an object (e.g. cell, tissue, organ, body lumen) with which said agent or composition is contacted. The interaction between the agent or composition and the object can occur starting immediately or nearly immediately with the administration of the agent or composition, can occur over an extended time period (starting immediately or nearly immediately with the administration of the agent or composition), or can be delayed relative to the time of administration of the agent or composition (controlled release / controlled release formulation). More specifically the "contacting" results in delivering an effective amount of the agent or composition comprising the agent to the object.

Combinations

The invention further relates to a combination of an inhibitor of MFRN2 and a further anti-cancer compound or agent. Alternatively, the invention relates to a combination of a composition, such as a pharmaceutically acceptable composition, comprising an inhibitor of MFRN2; and of a composition, such as a pharmaceutically acceptable composition, comprising a further anti-cancer agent. In one embodiment thereto, the invention relates to a combination of an inhibitor of MFRN2 and a further anticancer compound or agent which is an immune checkpoint inhibitor.

The invention further relates to any composition comprising a combination of an inhibitor of MFRN2 and a further anti-cancer compound or agent as described hereinabove for use as a medicine or medicament. Alternatively, the invention relates to a medicine or medicament comprising a combination of an inhibitor of MFRN2 and a further anti-cancer compound or agent as described hereinabove. In one embodiment thereto, these compositions, medicines or medicaments are for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating or inhibiting cancer or a tumor, for use in inhibiting progression of cancer or of a tumor, for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, or for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases. "Combination", "combination in any way" or "combination in any appropriate way" as referred to herein is meant to refer to any sequence of administration of two (or more) therapeutic modalities, i.e. the administration of the two (or more) therapeutic modalities can occur concurrently in time or separated from each other for any amount of time; and/or "combination", "combination in any way" or "combination in any appropriate way" as referred to herein can refer to the combined or separate formulation of the two (or more) therapeutic modalities, i.e. the two (or more) therapeutic modalities can be individually provided in separate vials or (other suitable) containers, or can be provided combined in the same vial or (other suitable) container. When combined in the same vial or (other suitable) container, the two (or more) therapeutic modalities can each be provided in the same vial/container chamber of a single-chamber vial/container or in the same vial/container chamber of a multi-chamber vial/container; or can each be provided in a separate vial/container chamber of a multi-chamber vial/container.

In yet a further aspect, the invention relates to an inhibitor of mitoferrin 2 (MFRN2) for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating or inhibiting cancer or a tumor, for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) inhibiting progression of cancer or of a tumor, for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases, or for use in (optionally a method of/for; optionally in the manufacture of a medicine or medicament for) treating, inhibiting, or inhibiting progression of established metastasis/metastases, this in combination with a further anti-cancer therapy, or in combination with a therapy comprising a further anti-cancer compound or agent, or in combination with (a therapy comprising) administration of a further anti-cancer compound or agent (to the subject or individual having the cancer, tumor, or metastasis/metastases).

Alternatively, the invention relates to use of an inhibitor of mitoferrin 2 (MFRN2) in the manufacture of a medicament for use in combination with (administration of) a further compound or agent for treating or inhibiting cancer or a tumor, for inhibiting progression of cancer or of a tumor, for treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, or for treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases (in a subject or individual having the cancer, tumor, or metastasis/metastases); or wherein medicament is for use in combination with a therapy comprising a further anti-cancer compound or agent or is for use in combination with administration of a further anticancer compound or agent (to the subject or individual having the cancer, tumor, metastasis/metastases). Alternatively, the invention relates to use of an inhibitor of mitoferrin 2 (MFRN2) in the manufacture of a medicament for treating or inhibiting cancer or a tumor, for inhibiting progression of cancer or of a tumor, for treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, or for treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases (in a subject or individual having the cancer) in combination with (administering, such as administering to the subject or individual having the cancer, tumor, or metastasis/metastases) a further anti-cancer therapy (for treating or inhibiting cancer or a tumor, for inhibiting progression of cancer or of a tumor, for treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, or for treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases).

In any of the above, the cancer or tumor in one embodiment is a primary cancer or tumor.

The further anti-cancer compound or agent in particular is a compound or agent different from an inhibitor of MFRN2.

Pharmaceutical compositions / pharmaceutically acceptable compositions

In yet a further aspect, the invention relates to pharmaceutical compositions comprising any inhibitor of mitoferrin 2 according to the invention as described above. In particular, such pharmaceutical composition comprises besides the MFRN2 inhibitor a carrier which is pharmaceutically acceptable (which can be administered to a subject without in itself causing severe side effects) and optionally suitable for supporting any of efficacy (the carrier in itself usually being devoid of any therapeutic effect), stability, and storage of the MFRN2 inhibitor. Such pharmaceutical compositions in particular are for use as a medicament, or for use in treating or inhibiting cancer or a tumor, for use in inhibiting progression of cancer or of a tumor, for use in treating, preventing, inhibiting, or inhibiting progression of metastasis/metastases or of metastasis/metastases formation or development, and/or for use in treating, inhibiting, or inhibiting progression of established or (already) developed metastasis/metastases. Such pharmaceutical compositions can comprise a further anticancer agent (as detailed herein).

Kits

The invention further relates to kits comprising a container or vial (any suitable container or vial, such as a pharmaceutically acceptable container or vial) comprising an inhibitor of MFRN2 or comprising a composition comprising an inhibitor of MFRN2; and optionally comprising a container or vial (any suitable container or vial, such as a pharmaceutically acceptable container or vial) comprising a further anti-cancer compound or agent. Alternatively, such kits are comprising a container or vial (any suitable container or vial, such as a pharmaceutically acceptable container or vial) comprising a combination of an inhibitor of MFRN2 and a further anti-cancer compound or agent (see discussion on "combination in any way" on how such combination in a single container, e.g., vial can be defined).

Other optional components of such kit include one or more diagnostic agents capable of predicting, prognosing, or determining the success of a therapy comprising one of the therapies according to the invention; use instructions; one or more containers with sterile pharmaceutically acceptable carriers, excipients or diluents [such as for producing or formulating a (pharmaceutically acceptable) composition of the invention]; one or more syringes; one or more needles; etc. In particular, such kits may be pharmaceutical kits.

Pharmaceutical kits

A pharmaceutical kit refers in general to a packed pharmaceutical compound or to a packed pharmaceutical composition. Besides the one or more vials or containers comprising the pharmaceutical compound or composition, such kits can comprise one or more vials of reconstitution fluid in case the pharmaceutical compound or composition is provided as powder. A pharmaceutical kit in general also comprises a kit insert which, in case of an authorized medicine, itself also has been reviewed and approved by the health authorities (such as US FDA or EMEA). Thus, in a further aspect, the invention relates to pharmaceutical kits comprising as one component at least one of the compounds inhibiting mitoferrin 2 according to the invention, or at least one of the pharmaceutical compositions comprising an inhibitor of mitoferrin 2 according to the invention. Such pharmaceutical kits can optionally further comprise one or more anticancer agents (detailed herein) wherein the further anti-cancer compound(s) or agent(s) in particular is (are) a compound(s) or agent(s) different from an inhibitor of MFRN2.

Anti-cancer therapy/agents lin any of the aspects and embodiments of the invention, the MFRN2-inhibiting therapeutic modality of the current invention may be further combined with another therapy against the tumor, cancer, neoplasm, or metastasis/metastases. Such other therapies include for instance surgery, radiation, chemotherapy, immune checkpoint or other immunostimulating therapy, neo-antigen or neo-epitope vaccination, cancer vaccine administration, oncolytic virus therapy, antibody therapy, or any other nucleic acid therapy targeting the tumor, cancer, neoplasm, or metastasis/metastases. The term anticancer agent is construed herein broadly (with the limitation that it is an agent other than the MFRN2 inhibiting compound or agent) as any agent which is useful or applicable in the treatment of a tumor or cancer in a subject. Anticancer agents comprise chemotherapeutic agents (usually small molecules) such as alkylating antineoplastic agents, anti-metabolites, anti-microtubule agents, topoisomerase inhibitors, and cytotoxic agents. The term further includes biological anticancer agents and immunotherapeutic drugs (such as immune checkpoint inhibitors) which are usually more specifically targeting the tumor or cancer (targeted therapy). Chemotherapeutic agents may be one of the following compounds, or a derivative or analog thereof: doxorubicin and analogues [such as N-(5,5- diacetoxypent-l-yl)doxorubicin: Farquhar et al. 1998, J Med Chem 41:965-972; epirubicin (4'- epidoxorubicin), 4'-deoxydoxorubicin (esorubicin), 4'-iodo-4'-deoxydoxorubicin, and 4'-O- methyldoxorubicin: Arcamone et al. 1987, Cancer Treatment Rev 14:159-161 & Giuliani et al. 1980, Cancer Res 40:4682-4687; DOX-F-PYR (pyrrolidine analog of DOX), DOX-F-PIP (piperidine analog of DOX), DOX-F-MOR (morpholine analog of DOX), DOX-F-PAZ (N-methylpiperazine analog of DOX), DOX-F-HEX (hexamehtyleneimine analog of DOX), oxazolinodoxorubicin (3'deamino-3'-N, 4'-O- methylidenodoxorubicin, O-DOX): Denel-Bobrowska et al. 2017, Life Sci 178:1-8)], daunorubicin (or daunomycin) and analogues thereof [such as idarubicin (4'-demethoxydaunorubicin): Arcamone et al. 1987, Cancer Treatment Rev 14:159-161; 4'-epidaunorubicin; analogues with a simplified core structure bound to the monosaccharide daunosamine, acosamine, or 4-amino-2,3,6-trideoxy-L-threo- hexopyranose: see compounds 8-13 in Fan et al. 2007, J Organic Chem 72:2917-2928], amrubicin, vinblastine, vincristine, calicheamicin, etoposide, etoposide phosphate, CC-1065 (Boger et al. 1995, Bioorg Med Chem 3:611-621), duocarmycins (such as duocarmycin A and duocarmycin SA; Boger et al. 1995, Proc Natl Acad Sci USA 92:3642-3649), the duocarmycin derivative KW-2189 (Kobayashi et al. 1994, Cancer Res 54:2404-2410), methotrexate, methopterin, aminopterin, dichloromethotrexate, docetaxel, paclitaxel, epithioIone, combretastatin, combretastatin A4 phosphate, dolastatin 10, dolastatin 10 analogues (such as auristatins, e.g. auristatin E, auristatin-PHE, monomethyl auristatin D, monomethyl auristatin E, monomethyl auristatin F; see e.g. Maderna et al. 2014, J Med Chem 57:10527- 10534), dolastatin 11, dolastatin 15, topotecan, camptothecin, mitomycin C, porfiromycin, 5- fluorouracil, 6-mercaptopurine, fludarabine, tamoxifen, cytosine arabinoside, adenosine arabinoside, colchicine, halichondrin B, cisplatin, carboplatin, mitomycin C, bleomycin and analogues thereof (e.g. liblomycin, Takahashi et al. 1987, Cancer Treatment Rev 14:169-177), melphalan, chloroquine, cyclosporin A, and maytansine (and maytansinoids and analogues thereof such as analogues comprising a disulfide or thiol substituent: Widdison et al. 2006, J Med Chem 49:4392-4408; maytansin analogs DM1 and DM4). By derivative is intended a compound that results from reacting the named compound with another chemical moiety, and includes a pharmaceutically acceptable salt, acid, base, ester or ether of the named compound.

Other therapeutic agents or drugs include: vindesine, vinorelbine, 10-deacetyltaxol, 7-epi-taxol, baccatin III, 7-xylosyltaxol, isotaxel, ifosfamide, chloroaminophene, procarbazine, chlorambucil, thiophosphoramide, busulfan, dacarbazine (DTIC), geldanamycin, nitroso ureas, estramustine, BCNU, CCNU, fotemustine, streptonigrin, oxaliplatin, methotrexate, aminopterin, raltitrexed, gemcitabine, cladribine, clofarabine, pentostatin, hydroxyureas, irinotecan, topotecan, 9- dimethylaminomethyl- hydroxy-camptothecin hydrochloride, teniposide, amsacrine; mitoxantrone; L-canavanine, THP- adriamycin, idarubicin, rubidazone, pirarubicin, zorubicin, aclarubicin, epiadriamycin (4'epi- adriamycin or epirubicin), mitoxantrone, bleomycins, actinomycins including actinomycin D, streptozotocin, calicheamycin; L- asparaginase; hormones; pure inhibitors of aromatase; androgens, proteasome inhibitors; farnesyl-transferase inhibitors (FTI); epothilones; discodermolide; fostriecin; inhibitors of tyrosine kinases such as STI 571 (imatinib mesylate); receptor tyrosine kinase inhibitors such as erlotinib, sorafenib, vandetanib, canertinib, PKI 166, gefitinib, sunitinib, lapatinib, EKB-569; Bcr-Abl kinase inhibitors such as dasatinib, nilotinib, imatinib; aurora kinase inhibitors such as VX-680, CYC116, PHA- 739358, SU-6668, JNJ-7706621, MLN8054, AZD-1152, PHA-680632; CDK inhibitors such as flavopirodol, seliciclib, E7070, BMS- 387032; MEK inhibitors such as PD184352, U-0126; mTOR inhibitors such as CCI- 779 or AP23573; kinesin spindle inhibitors such as ispinesib or MK-0731; RAF/MEK inhibitors such as sorafenib, CHIR-265, PLX-4032, CI-1040, PD0325901 or ARRY-142886; bryostatin; L-779450; LY333531; endostatins; the HSP 90 binding agent geldanamycin, macrocyclic polyethers such as halichondrin B, eribulin, or an analogue or derivative of any thereof.

Monoclonal antibodies employed as anti-cancer agents include alemtuzumab ( chronic lymphocytic leukemia), bevacizumab (colorectal cancer), cetuximab (colorectal cancer, head and neck cancer), denosumab (solid tumor's bony metastases), gemtuzumab (acute myelogenous leukemia), ipilumab (melanoma), ofatumumab (chronic lymphocytic leukemia), panitumumab (colorectal cancer), rituximab (Non-Hodgkin lymphoma), tositumomab (Non-Hodgkin lymphoma) and trastuzumab (breast cancer). Other antibodies include for instance abagovomab (ovarian cancer), adecatumumab (prostate and breast cancer), afutuzumab (lymphoma), amatuximab, apolizumab (hematological cancers), blinatumomab, cixutumumab (solid tumors), dacetuzumab (hematologic cancers), elotuzumab (multiple myeloma), farletuzumab (ovarian cancer), intetumumab (solid tumors), muatuzumab (colorectal, lung and stomach cancer), onartuzumab, parsatuzumab, pritumumab (brain cancer), tremelimumab, ublituximab, veltuzumab (non-Hodgkin's lymphoma), votumumab (colorectal tumors), zatuximab and anti-placental growth factor antibodies such as described in WO 2006/099698. Drug moieties known to induce immunogenic cell death include bleomycin, bortezomib, cyclophosphamide, doxorubicin, epirubicin, idarubicin, mafosfamide, mitoxantrone, oxaliplatin, and patupilone (Bezu et al. 2015, Front Immunol 6:187).

A particular class of antitumor, anticancer or antineoplastic agents are designed to stimulate the immune system (immune checkpoint or other immunostimulating therapy). These include so-called immune checkpoint inhibitors or inhibitors of co-inhibitory receptors and include PD-1 (Programmed cell death 1) inhibitors (e.g. pembrolizumab, nivolumab, pidilizumab), PD-L1 (Programmed cell death 1 ligand) inhibitors (e.g. atezolizumab, avelumab, durvalumab), CTLA-4 (Cytotoxic T-lymphocyte associated protein 4; CD152) inhibitors (e.g. ipilimumab, tremelimumab) (e.g. Sharon et al. 2014, Chin J Cane 33:434-444). PD-1 and CTLA-4 are members of the immunoglobulin superfamily of co-receptors expressed on T-cells. Inhibition of other co-inhibitory receptors under evaluation as antitumor, anticancer or antineoplastic agents include inhibitors of Lag-3 (lymphocyte activation gene 3), Tim-3 (T cell immunoglobulin 3) and TIGIT (T cell immunoglobulin and ITM domain) (Anderson et al. 2016, Immunity 44:989-1004). Stimulation of members of the TNFR superfamily of co-receptors expressed on T-cells, such as stimulation of 4-1BB (CD137), 0X40 (CD134) or GITR (glucocorticoid-induced TNF receptor family-related gene), is also evaluated for antitumor, anticancer or antineoplastic therapy (Peggs et al. 2009, Clin Exp Immunol 157:9-19).

Further antitumor, anticancer or antineoplastic agents include immune-stimulating agents such as neoantigen or neo-epitope cancer vaccines (neo-antigen or neo-epitope vaccination; based on commonly occurring neo-epitopes in some cancers, or based on the patient's sequencing data to look for tumorspecific mutations, thus leading to a form of personalized immunotherapy; Kaiser 2017, Science 356:112; Sahin et al. 2017, Nature 547:222-226) and some Toll-like receptor (TLR) ligands (Kaczanowska et al. 2013, J Leukoc Biol 93:847-863).

Yet further antitumor, anticancer or antineoplastic agents include oncolytic viruses (oncolytic virus therapy) such as employed in oncolytic virus immunotherapy (Kaufman et al. 2015, Nat Rev Drug Discov 14:642-662), any other cancer vaccine (cancer vaccine administration; Guo et al. 2013, Adv Cancer Res 119:421-475), and any other anticancer nucleic acid therapy (wherein "other" refers to it being different from therapy with a nucleic acid or nucleic acid comprising compound already specifically envisaged in the current invention).

Lipoylation

In view of the downstream effect on protein lipoylation caused by mitoferrin 2 knockout, a nucleic acid construct was made such as to express a bacterial lipoate ligase A (an enzyme lacking in mammalian cells) in mitochondria of cells, such as cancer cells. Lipoate Ligase A (LplA) cDNA from E. coli was mouse codon-optimized and a mitochondrial targeting sequence from the mouse Complex IV was added upstream of LplA ORF to direct translated protein to the mitochondria (mito-LplA). This construct was subcloned into a pLentiPGK Hygro backbone (Addgene 19066). The nucleotide sequence of the resulting construct is given in SEQ ID NO:6, and is encoding the protein given in SEQ ID NO:7 (see Example 1).

As such, the invention further relates to a nucleic acid/an expression cassette comprising a mitochondrial targeting signal encoding nucleic acid sequence and a lipoate ligase encoding nucleic acid sequence. In one embodiment, the lipoate ligase is a bacterial enzyme, such as an E. coli lipoate ligase. In a further embodiment, the codons of the bacterial lipoate ligase are optimized for expression in a mammalian cell. In one embodiment the expression cassette is encoding the protein spanning amino acids 1 to 361 of SEQ ID NO:5. In a further embodiment, the expression cassette is further comprising a suitable promoter (such as inducible promoter or cell- or tissue-specific promoter) and a suitable terminator such as to enable expression of the encoded lipoate ligase in a host cell transformed or transfected with a nucleic acid comprising the expression cassette. The expression cassette can be part of any type of vector suitable to be introduced into a host cell by any known means in any known formulation.

The invention further relates to methods of restoring protein lipoylation in lipoylation deficient cells (such as in mitoferrin 2 deficient cells), such methods including introducing in said cells the hereinabove described nucleic acid/expression cassette comprising a mitochondrial targeting signal encoding nucleic acid sequence and a lipoate ligase encoding nucleic acid sequence. In one embodiment to such methods, lipoate is supplemented to the lipoylation deficient cells.

Other Definitions

The present invention is described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are nonlimiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., current Protocols in Molecular Biology (Supplement 100), John Wiley & Sons, New York (2012), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

The term "defined by SEQ ID NO:X" as used herein refers to a biological sequence consisting of the sequence of amino acids or nucleotides given in the SEQ ID NO:X. For instance, a nucleotide sequence defined in/by SEQ ID NO:X consists of the sequence of nucleotides given in SEQ ID NO:X. A further example is a nucleotide sequence comprising SEQ ID NO:X, which refers to a nucleotide sequence longer than the nucleotide sequence given in SEQ ID NO:X but entirely comprising the nucleotide sequence given in SEQ ID NO:X, or to a nucleotide sequence consisting of nucleotide sequence given in SEQ ID NO:X.

The subject in particular is a mammal. The group of mammals includes, besides humans, mammals such as primates, cattle, horses, sheep, goats, pigs, rabbits, mice, rats, guinea pigs, llama's, dromedaries and camels.

EXAMPLES

EXAMPLE 1. Materials and methods.

Cell culture

4T1, MCF7, HUH7 and HCT-116 cell lines were purchased from ATCC. 4T1 cells were grown in Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal bovine serum, 1% penicillin (50 units/mL and 1% streptomycin (50 pg/mL). MCF7, HUH7, and HCT-116 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin (50 units/mL) and 1% streptomycin (50 pg/mL). All cells were maintained at 37°C and 5% CO2 and 95% relative humidity and regularly tested negative for mycoplasma infection by Mycoalert detection kit (Lonza). For 3D growth conditions, 6-well plates were coated with 0.5% soft-agar by mixing 1% agar 1:1 with culture medium and left to solidify at room temperature. Cells were plated on top of the base agar and incubated for 3-5 days. R-a-Lipoic Acid (Sigma) was dissolved in ethanol and conjugated with BSA for 30min at 37C before adding to culture medium for the lipoic acid rescue experiments.

Cell proliferation assays

Growth was assessed based on cell number and cell confluency (two-dimensional, 2D) or spheroid size (three-dimensional, 3D). Specifically, to measure cell proliferation in 2D cultures, growth rates were calculated by measuring confluency after 72h hours by detaching cells with 0.25% trypsin and counting each well in duplicate. To measure 3D growth, spheroids were cultured in 6-well plates according to the above specified conditions for 3-5 days. Representative pictures of each well were taken at experimental endpoints. Spheroids area was analyzed using Image Studio Lite 5.2 of >5 representative pictures per experimental condition. All growth experiments were performed in n>3 biological replicates.

Generation of CRISPR knockout cell lines

Murine Slc25a28 knockout cell lines were generated by first establishing parental cell lines with doxycycline-inducible Cas9 expression using the Dharmacon Edit-R Inducible Lentiviral Cas9 vector (Horizon Discovery). Cas9-expressing cells were selected by Blasticidin selection for 7 days (10 ug/ml). Complementary sgRNA oligonucleotides targeting two different exons of either Slc25a28 or EGFP (control) were designed and cloned into the LentiGuide Puro sgRNA expression vector (Addgene plasmid #52963) and delivered to cells via lentiviral infection. For human cell lines, sgRNA's targeting human SLC25A28 or EGFP were cloned into the LentiCRISPRv2 Puro vector (Addgene #98290) and delivered via lentiviral infection. Lentiviral particles were produced in HEK293T cells. Transduction of cells was performed overnight for 16h and the medium was replaced the next day. Polyclonal cells were selected for one week with puromycin, 2 pg/mL for 4T1 and MCF7, 5ug/ml for HCT-116 and 8 pg/mL for HUH7 cells. Protein knockout was confirmed by western blot.

CRISPR sgRNA targeting sequences

Target organism Target gene Sequence 5' - 3'

A. victoria EGFP GAGCTGGACGGCGACGTAAA (SEQ ID NO:1)

Mouse Slc25a28 CCCGAACACAGTCTGTCACG (SEQ ID NO:2)

Mouse Slc25a28 CAGTCTGTCACGCGGTGGTA (SEQ ID NO:3)

Human Slc25a28 GTACAACTCACCATACCACC (SEQ ID NO:4)

Human Slc25a28 AGTGATGTAATCCACCCTGG (SEQ ID NO:5)

Generation of mito-LplA Construct

Lipoate Ligase A (LplA) cDNA from E. coli was mouse codon-optimized and a mitochondrial targeting sequence from the mouse Complex IV was added upstream of LplA ORF to direct translated protein to the mitochondria (mito-LplA). Mito-LplA was ordered as a gene block fragment from IDT and subcloned into the pLentiPGK Hygro backbone (Addgene 19066). The nucleotide sequence of the resulting construct is given in SEQ ID NO:6 wherein:

- MTS, mitochondrial targeting sequence is underlined (nucleotides 1-72); encoded protein 100% identical to e.g. amino acids 1-24 of the human COX4I1 protein (AAH47869.1); followed by

- lipoate ligase open reading frame (nucleotides 73-1083); encoded protein 100% identical to e.g. amino acids 2-338 of the Escherichia coli lipoate-protein ligase LplA (MXH93393.1); followed by

- a (GlyGlySer or GGS)3 linker encoding sequence in italics (nucleotides 1084-1110); followed by

- a methionine codon (nucleotides 1111-1113); followed by

- the FLAG tag encoding sequence (nucleotides 1114-1137); and followed by - a stop codon (nucleotides 1138-1140):

1 ATGCTGGCCA CAAGAGTATT CTCACTCGTG GGTAAAAGGG CAATCTCAAC

51 AAGCGTCTGC GTGCGCGCAC AC-

73 TCCACCCTGA GGTTGCTCAT CAGCGACTCC TACGACCCCT GGTTTAACTT

123 GGCAGTAGAA GAGTGTATAT TTCGACAAAT GCCTGCAACT CAGCGGGTCC

173 TGTTCCTTTG GAGAAACGCA GACACTGTTG TGATTGGTCG GGCACAGAAT

223 CCCTGGAAAG AGTGCAATAC CAGGAGGATG GAGGAGGACA ATGTGCGCCT

273 TGCCAGGCGC TCATCTGGAG GTGGAGCCGT GTTTCACGAC CTCGGCAATA

323 CCTGCTTTAC ATTCATGGCA GGTAAGCCAG AATATGATAA AACCATCTCA

373 ACTTCCATCG TTCTTAACGC ACTGAATGCA CTCGGAGTGT CCGCCGAGGC

423 TAGCGGAAGA AATGATCTGG TCGTAAAAAC AGTTGAGGGG GATAGAAAAG

473 TCTCCGGCTC AGCATACAGA GAGACAAAGG ACCGGGGATT CCATCATGGA

523 ACATTGTTGC TTAATGCAGA CCTTTCAAGG CTCGCTAATT ACCTCAACCC

573 CGATAAGAAG AAGTTGGCCG CCAAGGGAAT TACTAGCGTC AGGTCACGAG

623 TAACCAACCT CACTGAGCTG CTTCCTGGCA TTACTCATGA ACAGGTGTGC

673 GAAGCTATTA CAGAGGCATT CTTTGCACAC TACGGAGAAA GGGTGGAAGC

723 TGAGATCATC AGCCCAAACA AAACCCCTGA TCTCCCCAAC TTTGCTGAAA

773 CTTTTGCAAG GCAGAGTTCT TGGGAATGGA ATTTTGGGCA GGCTCCCGCC

823 TTCTCTCATC TTCTTGACGA GCGATTCACT TGGGGCGGCG TTGAACTTCA

873 TTTTGATGTC GAGAAAGGAC ATATTACACG AGCCCAAGTT TTCACTGATT

923 CCCTGAACCC CGCACCACTC GAGGCTCTGG CAGGACGCTT GCAGGGCTGC

973 CTTTACCGAG CCGATATGCT GCAGCAGGAA TGCGAGGCAT TGCTTGTGGA

1023 CTTTCCCGAA CAGGAAAAAG AGCTTCGAGA ATTGTCCGCA TGGATGGCCG

1073 GTGCAGTTAG G- 1084 GGTGGATCTG GTGGATCTGG TGGATCT- 1111 ATG-

1114 GATTACAAGG ATGACGATGA CAAG- 1138 TAA ( SEQ ID NO : 6 )

The resulting protein sequence is given in SEQ ID NO:7, wherein:

- the mitochondrial targeting sequence is underlined (amino acids 1-24); followed by

- lipoate ligase enzyme (amino acids 25-361); followed by

- a (GlyGlySer or GGS)3 linker in italics (amino acids 362-370); followed by

- a methionine (amino acid 371); and followed by

- the underlined FLAG tag (amino acids 372-379).

355 WMAGA VR- 362 GGSGG SGGS-

371 M-

372 DYKDD DDK ( SEQ ID NO : 7 ) In-vivo syngeneic metastasis models

All animal experiments complied with ethical regulations and were approved by the Institutional Animal Care and Research Advisory Committee of KU Leuven, Belgium (ECD number P145-2020). Sample size was determined using power calculations with B = 0.8 and P < 0.05 based on preliminary data and in compliance with the 3R system: Replacement, Reduction, Refinement. 6-8 weeks old female BALB/c mice were inoculated with 4T1 cells either in the mammary fat pad (m.f.; 1 x 10⁶ cells) or hydrodynamically (h.d.; 5 x 10⁵ cells). For hydrodynamic experiments, mice were sacrificed at day 10 and lung and liver metastases were collected for further analysis. To follow primary tumor growth, tumor volumes were measured during the experiment using a caliper until humane endpoints at day 21-23. Humane endpoints were determined as follows: tumor size of 1.8 cm³, loss of ability to ambulate, labored respiration, surgical infection, or weight loss over 10% of initial body weight. Mice were monitored and upon detection of one of the previously mentioned symptoms, the animal was euthanized.

Hematoxylin and eosin staining of tumor sections

Hematoxylin and eosin (H&E) staining of pulmonary and liver metastasis was performed by first gently infusing lungs via the trachea with 10% neutral-buffered formalin while livers were excised and washed with saline. Tissues were placed into histology cassettes, fixed in 10% neutral-buffered formalin overnight, and immersed in 70% ethanol for 24 hours. Then, 6-pm thick (lung) or 4-pm thick (liver) paraffin-embedded tissue sections were cut and stained with hematoxylin and eosin. Scanned slides were analyzed using QuPath 2.0 by running cell detection, followed by training object classifiers for tumor and stromal cells to calculate the metastatic area. Metastatic index was calculated by dividing the metastatic area by the primary tumor weight. All i.v.-injected animals were analyzed. All samples were analyzed blinded.

Western Blotting

To assess lipoylation, 4T1 tumor spheroids were collected and lysed using IX RIPA buffer + protease inhibitors (Roche) with mechanical disruption. Cells were incubated on ice for 15min and then centrifuged at 12,000xg for 5min at 4C to remove insoluble debris. Lysates were then quantified using Pierce BCA assay (Thermo Fisher 23225) and 30ug was run on a 4-12% Bis-Tris SDS-PAGE gel. Proteins were transferred to nitrocellulose membranes using iBlot2 standard transfer protocols. Membranes were then blocked for lh at RT using 5% milk and incubated in primary antibody for l-2h at 25C while shaking. Membranes were then washed three times with IX TBST (0.05%) and then incubated in antirabbit HRP-linked secondary antibody 1:5000 for lh at 25C. Membranes were then washed three times in IX TBST and then incubated in Pierce ECL Chemiluminescent development solution (Thermo Fisher 32106) Target Antibody Supplier Catalog # lipoic acid Merck-Milipore 437695

PDH Cell Signaling Technology 3205S

OGDH Cell Signaling Technology 26865S

Vinculin Cell Signaling Technology 13901S

Statistical analysis

Statistical data analysis was performed using GraphPad Prism 7 (GraphPad Software) on n > 3 biological replicates. Details of statistical tests and post-tests are presented in the figure legends. Determination of mathematical outliers was performed using Grubb's test. Sample size for all in vitro experiments was chosen empirically. For in vivo experiments, sample size was determined using power calculations with P = 0.8 and P < 0.05, based on preliminary data. Data are presented as mean ± s.e.m

EXAMPLE 2. Results.

Mitoferrin 1 (Mfrnl; SLC25A37) and mitoferrin 2 (Mfrn 2; SLC25A28) both are mitochondrial iron transporters . An extended pooled CRISPR screen was performed (not shown) from which it was found that Mfrn2 silencing in 4T1 breast cancer inhibits formation of lung and liver metastasis in a model of experimental metastasis (Figure 1A, IB). These data were confirmed for lung metastases in a model of spontaneous metastases from a primary 4T1 breast tumor (Figure 1C). Importantly and unexpectedly, silencing of the paralogue Mfrnl in 4T1 breast cancer cells did not phenocopy Mfrn2 silencing as inhibition of formation of metastasis was limited to liver metastasis (Figure 2).

Moreover, Mfrn2 knockout reduces primary 4T1 breast tumor size by 29.96% (Figure 3). In addition, under circumstances promoting in vitro 3D spheroid growth more accurately resembling tumor characteristics (e.g. Caleb & Yong 2020, Front Mol Biol Sci 7:33), Mfrn2 knockout reduced the size of tumor spheroids derived from breast (4T1, MCF7, Figure 4A), colorectal (HCT166, Figure 4B) and liver (HUH7, Figure 4C) cancer cells. Likewise, 2D growth of bone cancer cells ("143B"), colorectal cancer cells ("HCT-116") and liver cancer cells ("HUH-7") in which Mfrn2 expression was knocked out/down by means of Crispr/Cas was inhibited compared to such cancer cells subjected to Crispr/Cas with an irrelevant guide RNA (Figure 11). Mfrn2 expression furthermore was found to be correlated with poor prognosis in patients with renal cancer (Figure 6; adapted from https://www.proteinatlas.org/ENSG00000155287- SLC25A28/pathology/renal+cancer).

Mechanistically, it was elucidated that Mfrn2 enables iron-dependent lipoylation of mitochondrial enzymes (Figure 5A). Accordingly, Liptl knockout phenocopies Mfrn2 silencing and inhibits metastasis formation (Figure 5B). Moreover, ectopic expression of lipoate-protein ligase A (LplA) from E.coli (a gene not expressed in mammals that can activate and transfer dietary lipoate to proteins) combined with lipoate supplementation rescued 3D growth of Mfrn2 knockout breast cancer cells (Figure 5C).

EXAMPLE 3. Evaluating antisense oligonucleotides (ASOs) as a treatment modality for Mfrn2

To evaluate the use of ASOs to target Mfrn2, a panel of 8 constructs targeting human Mfrn2 (Qiagen) with different targeting regions was screened using decreased mRNA levels (PCR) and for the best hits Mfrn2 protein levels as a readout in colorectal cancer HCT-116 cells. In this experiment, the HCT-116 cells were incubated with 2pM of ASOs for 96h, to interrogate their ability to inhibit Mfrn2. In particular, the HCT-116 cells were incubated in the presence of the ASOs thus also assessing free uptake of the ASOs by the cells. This approach reflects the drug delivery method in a more accurate way than the commonly used process of transfecting the cells for nucleic acid incorporation. Results are shown in Figure 8 indicating that ASOs 4 and 5 decrease Mfrn2 expression. These ASOs are relevant candidates for examining further the effects of knocking down MFRN2 expression on tumor growth in in vitro and in vivo experiments.

HCT-116 cells were seeded in 96-well plates at a concentration of 5000 cells per 90pL/well of DMEM supplemented with 10% fetal bovine serum. After 24h, 2pM of each ASO were added to the cells. After incubation with the ASOs for 96h, we used the Cells-to-CT™ 1-Step Power SYBR™ Green Kit (Invitrogen™) to lyse the cells, convert mRNA-to-cDNA and amplify the genes of interest (Mfrn-2, and RPL19 - used as housekeeping gene), according to the manufacturer's protocol.

EXAMPLE 4. Inhibition of Mfrn2 is treating and inhibiting established liver metastases.

Liver metastatic burden after intrasplenic injection of colorectal HCT-116 cancer cells was followed up. Upon establishment of liver metastases, determined by bioluminescence imaging, the animals were transferred to doxycycline-containing feed to induce Mfrn2 silencing. Metastases established in animals with silenced Mfrn2 were growing slower than Mfrn2-expressing metastases (Figure 9). These results suggest that Mfrn2 inhibition is suitable for metastases treatment.

NMRI/Nu female mice (Envigo) at 6 weeks were used for intrasplenic injection of HCT-116 cells. Mice were anaesthetized with inhaling isoflurane, an incision was made on the right abdomen, and the spleen carefully exposed. HCT-116 cells were suspended in cold PBS and 50pL of cell suspension (1x10^s cells) were injected into the spleen followed by splenectomy and immediate suture.

In vivo metastasis progression was monitored via real-time BLI using the IVIS SpectrumCT Imaging System (PerkinElmer) on a weekly basis. Mice were anaesthetized with inhaling isoflurane, injected intraperitoneally (i.p) with D-Luciferin (150 mg/kg), and imaged with the auto-exposure setting in prone position. BLI analysis was performed using Living Image software (v.4.5, PerkinElmer). 1 EXAMPLE 5. Inhibition of Mfrn2 is treating and inhibiting established multi-organ metastases.

Multi-organ metastasis upon intracardiac injections of control and Mfrn2-silenced human MDA-MB-231 breast cancer cell lines (expressing luciferase) was assessed using bioluminescence imaging. Upon establishment of metastases, knockdown of Mfrn2 expression was induced by administering doxycycline to the mice.

The results surprisingly show that inhibition of Mfrn2 has a significant beneficial impact on survival, by doubling the animals' overall survival (Figure 10A). Particularly, the Mfrn2-knockdown group survived in median for 28 days upon metastasis formation, while the control group survived for 14 days only. Of note, one mouse with inhibited Mfrn2 expression has survived for over 130 days upon formation of systemic metastases (Figure 10B). Specifically, this mouse developed metastases in the brain and leg bone regions, and the metastasis BLI signals consistently decreased over time and surprisingly eventually disappeared (Figures 10C & 10D). To test whether the effect of Mfrn2 inhibition in the regression of metastasis was permanent, this mouse who was cured from systemic metastasis upon Mfrn2-inhibition was transferred back to chow diet (therewith normalizing Mfrn2 expression). The animal has been in remission for 36-days as no tumor signal reappeared even after re-expressing of Mfrn2 (Figures 10B-D), suggesting that targeting mitoferrin-2 is a potentially interesting anti-metastatic approach, and that this strategy is effective in established metastases, possibly excluding the need of a long-term preventive approach. Moreover, its effect in eliminating brain metastasis further strengthens its potential as a therapeutical target, given that brain infiltration of tumor cells is associated with poor-prognosis and currently efficient therapies to treat metastatic tumors to the brain are lacking.

NMRI/Nu female mice (Envigo) at 6 weeks were used for intracardiac injection MDA-MB-231 cells. Mice were anaesthetized with Ketamine/Xylazine injected IP at lOOpL/lOg bodyweight. MDA-MB-231 cells were suspended in cold PBS and 200pL of cell suspension (lxlO⁵ cells) and injected into the left ventricle. In vivo metastasis progression was monitored via real-time BLI using the IVIS SpectrumCT Imaging System (PerkinElmer) on a weekly basis. Mice were anaesthetized with inhaling isoflurane, injected intraperitoneally (i.p) with D-Luciferin (150 mg/kg), and imaged with the auto-exposure setting in prone position. BLI analysis was performed using Living Image software (v.4.5, PerkinElmer).

EXAMPLE 6. Effect of MFRN2 knockdown (KD) on renal cell carcinoma (RCC).

Two renal cell carcinoma (RCC) cell lines are used: the wild-type 786-0 cell line (ATCC CRL-1932) ("control") and a MFRN2 KD786-O cell line modified from the wild-type 786-0 cell line such that MFRN2 knockdown can be induced by administering doxycycline ("KD"). A first group of mice is injected with 4.4 x 10⁶ control (control RCC) or KD RCC cells suspended in 0.2 mL in the opposite flanks of the same mouse. Starting 15 days after tumor cell injection, the developing RCC tumors are measured twice a week with a digital caliper based on two perpendicular diameters. Tumor volume is calculated as [Dxdxd]/2 wherein D is the larger, and d the shorter diameter of the two perpendicular diameters. When tumor volumes reach a volume of 80-100 mm3, the mice subgroups are further split in two and one of the further groups receives doxycycline in the drinking water while the other of the further groups receives doxycycline in the feed. Seven days later, tumors are harvested and flash frozen. The efficacy of induced shRNA silencing is determined in all groups.

A second group of mice is then injected with the control (control RCC) or KD RCC cells and split in two, as described above. One group is then fed a normal diet without doxycycline, and the second group is receiving doxycycline in the regimen providing most efficient MFRN2 knockdown as determined based on the outcome of the experiment with the first group of mice. Tumor volumes are measured until a human endpoint (defined by either tumor size or overall health of the mouse) is reached, upon which the mice are sacrificed. Tumor material is resected and weighed (animals are weighed as well), and either flash frozen and/or preserved by formalin-fixed paraffin embedding for further analysis. Tumor development in the KD RCC group of mice is inhibited compared to tumor development in the control RCC group of mice.

Claims

1. An inhibitor of mitoferrin 2 for use in treating cancer, for use in inhibiting progression of cancer, for use in preventing or inhibiting metastasis, or for use in treating or inhibiting progression of established metastasis.

2. The inhibitor of mitoferrin 2 for use according to claim 1 wherein the cancer is a primary cancer.

3. The inhibitor of mitoferrin 2 for use according to claim 1 or 2 wherein the inhibitor is a DNA nuclease specifically knocking out or disrupting MFRN2 expression, an RNase specifically targeting MFRN2 expression, or an inhibitory oligonucleotide specifically targeting MFRN2 expression.

4. The inhibitor of mitoferrin 2 for use according to claim 3 wherein the DNA nuclease is a zinc-finger nuclease, a TALEN, a CRISPR-Cas, or a meganuclease.

5. The inhibitor of mitoferrin 2 for use according to claim 3 wherein the RNase is a ribozyme or a CRISPR-C2c2.

6. The inhibitor of mitoferrin 2 for use according to claim 3 wherein the oligonucleotide is an antisense oligomer, a siRNA, a shRNA, a gapmer, or a nucleic acid aptamer.

7. The inhibitor of mitoferrin 2 for use according to any of the foregoing claims in combination with cancer resection or radiation, or in combination with a therapy comprising a further anti-cancer agent.

8. The inhibitor of mitoferrin 2 for use according to claim 7 wherein the further anti-cancer agent is an immunotherapeutic agent.

9. A pharmaceutical composition comprising a DNA nuclease specifically knocking out or disrupting MFRN2 expression, an RNase specifically targeting MFRN2 expression, and/or an inhibitory oligonucleotide specifically targeting MFRN2 expression.

10. The pharmaceutical composition according to claim 9 for use as medicament.