WO2022184067A1 - Application d'anticorps anti-tigit dans une combinaison de médicaments - Google Patents

Application d'anticorps anti-tigit dans une combinaison de médicaments Download PDF

Info

Publication number
WO2022184067A1
WO2022184067A1 PCT/CN2022/078682 CN2022078682W WO2022184067A1 WO 2022184067 A1 WO2022184067 A1 WO 2022184067A1 CN 2022078682 W CN2022078682 W CN 2022078682W WO 2022184067 A1 WO2022184067 A1 WO 2022184067A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
seq
antibody
antigen
binding fragment
Prior art date
Application number
PCT/CN2022/078682
Other languages
English (en)
Chinese (zh)
Inventor
黄俊杰
徐振前
符子艺
黄贤明
俞金泉
宋述强
李胜峰
Original Assignee
百奥泰生物制药股份有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 百奥泰生物制药股份有限公司 filed Critical 百奥泰生物制药股份有限公司
Publication of WO2022184067A1 publication Critical patent/WO2022184067A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39566—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against immunoglobulins, e.g. anti-idiotypic antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants

Definitions

  • the invention belongs to the field of biomedicine, and particularly relates to the application of an anti-TIGIT antibody in combined medicine.
  • TIGIT T cell immunoreceptor with Ig and ITIM domains
  • Ig immunoglobulin
  • ITIM tyrosine inhibitor motif
  • TIGIT is part of a co-stimulatory network consisting mainly of the activating receptor CD226 and the inhibitory receptor TIGIT on T cells, and the ligand CD155 (also known as the ligand CD155 expressed on the surface of APCs, tumor cells, infected cells) PVR, a poliovirus receptor protein encoded in humans by the PVR gene) and CD112. Binding of TIGIT to PVR or CD112 will lead to the phosphorylation of Tyr225 in the cytoplasm of TIGIT, and the binding of TIGIT to cell-adaptive growth factor receptor binding protein 2 (GRB2).
  • ligand CD155 also known as the ligand CD155 expressed on the surface of APCs, tumor cells, infected cells
  • PVR a poliovirus receptor protein encoded in humans by the PVR gene
  • GRB2 can recruit SHIP1 to inhibit phosphatidylinositol tri-kinase (PI3K) and mitogen-activated protein kinase (MAPK) signaling.
  • PI3K phosphatidylinositol tri-kinase
  • MAPK mitogen-activated protein kinase
  • phosphorylated TIGIT recruits SHIP1 via beta arrestin 2 ( ⁇ -arrestin2) and by blocking autoubiquitination of TNF receptor-associated factor 6 (TRAF6) and disrupts nuclear factor KB (NF-KB) activation , a series of signal transduction eventually lead to the inhibition of T cell or NK cell function and the inhibition of cytokine production.
  • PVR is both a ligand of TIGIT and a ligand of CD226 molecule.
  • Ser329 and Tyr322 of the intracellular domain of CD226 are phosphorylated; Ser329 phosphorylation promotes the activation of protein kinase (PKC) and the mutual binding of CD226 to lymphocyte-associated antigen 1 (LFA1). LFA1 is then used for TYN-mediated phosphorylation of Tyr322 and CD226-mediated downstream signaling. A series of signal transduction finally leads to the activation of T cell or NK cell function, which promotes the production of cytokines.
  • PDC protein kinase
  • LFA1 lymphocyte-associated antigen 1
  • TIGIT molecules can directly disrupt the formation of normal dimers of CD226, thereby destroying the normal physiological function of CD226.
  • TIGIT and CD226 are like two ends of the balance, through the pivot point of PVR, they skillfully regulate the immune function of the body through the transduction of co-stimulatory and co-inhibitory signals.
  • the present invention discloses a combination drug comprising an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent.
  • the present invention provides a combination drug comprising a therapeutically effective amount of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent.
  • the present invention discloses methods or uses of anti-TIGIT antibodies or antigen-binding fragments for combined treatment of tumors or cancers.
  • the method or use comprises administering to a patient in need thereof an effective amount of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent.
  • the present invention discloses the use of an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment in the preparation of a medicament for the treatment of tumors or cancer in combination with another therapeutic agent.
  • the present invention discloses the use of an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment and another therapeutic agent in the manufacture of a medicament for the treatment of tumor or cancer.
  • an anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • another therapeutic agent in the manufacture of a medicament for the treatment of tumor or cancer.
  • the present invention also discloses a kit, which comprises an anti-TIGIT antibody or antigen-binding fragment (or preparation) and is used to instruct a patient in need to administer the anti-TIGIT antibody or antigen-binding fragment (or preparation) and another Instructions for a therapeutic agent (or formulation).
  • the present invention also discloses a kit comprising an anti-TIGIT antibody or antigen-binding fragment (or preparation), another therapeutic agent (or preparation), and an anti-TIGIT antibody for guiding the administration of a patient in need thereof or an antigen-binding fragment (or formulation) and another therapeutic agent (or formulation).
  • the present invention also discloses a kit comprising a composition (or formulation) of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent and for instructing a patient in need to administer anti-TIGIT Instructions for a composition (or formulation) of an antibody or antigen-binding fragment and another therapeutic agent.
  • the present invention also discloses a pharmaceutical composition suitable for injection, such as a bolus injection type pharmaceutical composition or an infusion (drip) type pharmaceutical composition, comprising an anti-TIGIT antibody or an antigen-binding fragment and another therapeutic agent.
  • a pharmaceutical composition suitable for injection such as a bolus injection type pharmaceutical composition or an infusion (drip) type pharmaceutical composition, comprising an anti-TIGIT antibody or an antigen-binding fragment and another therapeutic agent.
  • the pharmaceutical composition comprises at least 0.1% anti-TIGIT antibody or antigen-binding fragment and 0.1% another therapeutic agent.
  • the percentages of antibody and another therapeutic agent can vary and are between about 2% and about 90% by weight of a given dosage form.
  • the amount of anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent in such a therapeutically useful pharmaceutical composition can be an effective amount for administration.
  • the present invention also discloses a preparation method of the above-mentioned pharmaceutical composition: respectively combining the anti-TIGIT antibody and another therapeutic agent (or the composition of the anti-TIGIT antibody and another therapeutic agent) described herein with a pharmaceutically
  • An acceptable carrier suitable for injection eg, water for injection, physiological saline, etc.
  • Methods for admixing the above-described anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent with a pharmaceutically acceptable carrier are generally known in the art.
  • the anti-TIGIT antibody or antigen-binding fragment is used in combination with another therapeutic agent to treat a tumor or cancer.
  • the present invention uses an anti-TIGIT antibody or antigen-binding fragment (or preparation) and another therapeutic agent (or preparation) in tumor or cancer treatment, which can alleviate symptoms.
  • the other therapeutic agent is an antibody or antigen-binding fragment or an antibody drug conjugate (ADC).
  • ADC antibody drug conjugate
  • an anti-TIGIT antibody or antigen-binding fragment (or formulation), another therapeutic agent (or formulation) is used in combination with other therapeutic methods for the treatment of tumors or cancers, such as chemotherapy, radiotherapy, surgery, and the like.
  • the anti-TIGIT antibody or antigen-binding fragment comprises at least HCDR1 set forth in SEQ ID NO:1, HCDR2 set forth in SEQ ID NO:2, HCDR3 set forth in SEQ ID NO:3, : one or more of LCDR1 shown in SEQ ID NO: 5, LCDR2 shown in SEQ ID NO: 6, and LCDR3 shown in SEQ ID NO: 6.
  • the anti-TIGIT antibody or antigen-binding fragment comprises HCDR1 set forth in SEQ ID NO:1, HCDR2 set forth in SEQ ID NO:2, HCDR3 set forth in SEQ ID NO:3, SEQ ID NO:3 LCDR1 shown in 4, LCDR2 shown in SEQ ID NO:5 and LCDR3 shown in SEQ ID NO:6.
  • the heavy chain variable region of the anti-TIGIT antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:7, or is at least 80% identical to the sequence set forth in SEQ ID NO:7
  • the amino acid sequence of SEQ ID NO: 7 has one or more conservative amino acid substitutions compared to the sequence shown in SEQ ID NO: 7.
  • the light chain variable region of the anti-TIGIT antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:8, or is at least 80% identical to the sequence set forth in SEQ ID NO:8
  • the amino acid sequence of SEQ ID NO: 8 has one or more conservative amino acid substitutions.
  • the heavy chain variable region of the anti-TIGIT antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:7, or is at least 80% identical to the sequence set forth in SEQ ID NO:7
  • the light chain variable region of the anti-TIGIT antibody or antigen-binding fragment comprises SEQ ID NO: 8
  • the heavy chain variable region of the anti-TIGIT antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:7
  • the light chain variable region of the anti-TIGIT antibody or antigen-binding fragment comprises SEQ ID NO: 7 The amino acid sequence shown in ID NO:8.
  • the heavy chain of the anti-TIGIT antibody comprises the amino acid sequence set forth in SEQ ID NO:9, or an amino acid sequence that is at least 80% identical to the sequence set forth in SEQ ID NO:9, or The sequence shown in SEQ ID NO: 9 is compared to an amino acid sequence with one or more conservative amino acid substitutions.
  • the light chain of the anti-TIGIT antibody comprises the amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence that is at least 80% identical to the sequence set forth in SEQ ID NO: 10, or is The sequence shown in SEQ ID NO: 10 is compared to an amino acid sequence with one or more conservative amino acid substitutions.
  • the heavy chain of the anti-TIGIT antibody comprises the amino acid sequence set forth in SEQ ID NO:9, or an amino acid sequence that is at least 80% identical to the sequence set forth in SEQ ID NO:9, or The amino acid sequence with one or more conservative amino acid substitutions compared to the sequence shown in SEQ ID NO:9;
  • the light chain of the anti-TIGIT antibody comprises the amino acid sequence shown in SEQ ID NO:10, or the amino acid sequence shown in SEQ ID NO:10.
  • the anti-TIGIT antibody is antibody h10D8OF or h10D8OFKF
  • the heavy chains of antibodies h10D8OF and h10D8OFKF comprise the amino acid sequence as set forth in SEQ ID NO: 9
  • the light chains of antibodies h10D8OF and h10D8OFKF comprise as shown in SEQ ID The amino acid sequence shown in NO:10.
  • antibodies h10D8OF and h10D8OFKF contain two heavy chains with identical sequences and two light chains with identical sequences, respectively.
  • Antibody protein can be expressed in CHO cells or HEK293 cells by genetic engineering and obtained by purification; purification can be carried out by conventional methods, such as centrifuging the cell suspension and collecting the supernatant, and centrifuging again to further remove impurities. Methods such as ProteinA affinity columns and ion exchange columns can be used to purify antibody proteins.
  • the anti-TIGIT antibody eg, antibody h10D8OFKF
  • antigen-binding fragment has a fucosylation level of 0-10%. In some embodiments, the anti-TIGIT antibody (eg, antibody h10D8OFKF) or antigen-binding fragment has a fucosylation level of 0-5%.
  • the anti-TIGIT antibody (eg, antibody h10D8OFKF) or antigen-binding fragment has a fucosylation level of about 0, about 0.1%, about 0.5%, about 0.8%, about 1%, about 1.3% , about 1.6%, about 2.1%, 2.9%, about 3%, about 3.3%, 3.8%, about 4%, about 4.2%, 4.3%, about 4.6%, about 5%, or any two of these values range between (including the endpoints) or any value therein.
  • the anti-TIGIT antibody (eg, antibody h10D8OFKF) or antigen-binding fragment does not bind fucose.
  • the anti-TIGIT antibody (eg, antibody h10D8OFKF) or antigen-binding fragment has an enhanced ADCC effect (antibody-dependent cell-mediated cytotoxicity).
  • the hypofucosylated or afucosylated anti-TIGIT antibody or antigen-binding fragment is expressed by an alpha-(1,6)-fucosyltransferase knockout cell line.
  • the antibody h10D8OFKF is expressed by an ⁇ -(1,6)-fucosyltransferase knockout cell line, eg, an ⁇ -(1,6)-fucosyltransferase knockout CHO cells.
  • the present invention discloses a method for treating a tumor or cancer in a patient in need thereof, comprising administering an effective amount of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent.
  • the anti-TIGIT antibody or antigen-binding fragment is administered at about 0.05 mg to 1200 mg, about 0.05 mg to 1000 mg, about 0.05 mg to 500 mg, about 0.05 mg to 100 mg, about 0.1 mg to 100 mg, about 0.1 mg to 50 mg, About 0.1 mg to 30 mg, about 0.1 mg to 10 mg, about 0.5 mg to 1 mg, about 9 mg to 1200 mg, about 1 mg to 900 mg, about 1 mg to 300 mg, about 1 mg to 100 mg, about 1 mg to 30 mg, about 1 mg to 10 mg, about 1 mg to 3 mg, about 3 mg to 900 mg, about 3 mg to 600 mg, about 3 mg to 100 mg, about 3 mg to 30 mg, about 3 mg to 10 mg, about 10 mg to 900 mg, about 10 mg to 600 mg, about 10 mg to 900 mg, about 10
  • the anti-TIGIT antibody or antigen-binding fragment is administered at about 0.001 mg/kg to 20 mg/kg, about 0.001 mg/kg to 2 mg/kg, about 0.001 mg/kg to 1 mg/kg, about 0.005 mg/kg to Doses are administered at 1 mg/kg, about 0.01 mg/kg to 1 mg/kg, about 0.01 mg/kg to 20 mg/kg.
  • the anti-TIGIT antibody or antigen-binding fragment is administered at a dose of about 0.05 mg to 1200 mg, about 0.05 mg to 1000 mg, about 0.05 mg to 500 mg, about 0.1 mg to 100 mg, about 0.1 mg to 50 mg, about 0.1 mg to 30 mg, about 0.1 mg to 10 mg, 0.5 mg to 1 mg, about 9 mg to 1200 mg, about 1 mg to 900 mg, about 1 mg to 300 mg, about 1 mg to 100 mg, about 1 mg to 30 mg, about 1 mg to 10 mg, about 1 mg to 3 mg, about 3 mg to 900 mg, about 3 mg to 600 mg, about 3 mg to 100 mg, about 3 mg to 30 mg, about 3 mg to 10 mg, about 10 mg to 900 mg, about 10 mg to 600 mg, about 10 mg to 300 mg, about 10 mg to 100 mg, about 10 mg to 30 mg, about Each treatment cycle.
  • the anti-TIGIT antibody or antigen-binding fragment is administered at a dose of about 0.001 mg/kg to 20 mg/kg, about 0.001 mg/kg to 2 mg/kg, about 0.001 mg/kg to 1 mg/kg, about 0.005 mg /kg to 1 mg/kg, about 0.01 mg/kg to 1 mg/kg, about 0.01 mg/kg to 20 mg/kg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • the anti-TIGIT antibody or antigen-binding fragment is administered once daily to once every 7 weeks.
  • the anti-TIGIT antibody or antigen-binding fragment is administered once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks Dosing once or every 7 weeks.
  • the anti-TIGIT antibody is the antibody h10D8OF or h10D8OFKF.
  • an anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • antigen-binding fragment and another therapeutic agent or a combination of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent
  • Pharmaceutical compositions can be formulated as Pharmaceutical compositions, and are administered to patients in a variety of forms suitable for the chosen route of administration, eg, by parenteral, intravenous (iv), intramuscular, topical or subcutaneous routes.
  • an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent may be administered intravenously, respectively.
  • anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent will depend on the nature of the drug, the extent to which internalization, transport and release of the drug is triggered on the cell surface, the disease being treated, and the condition of the patient (eg, age, gender, weight, etc.).
  • the anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • antigen-binding fragment or formulation containing this dose is about 0.001 mg/kg to 20 mg/kg per administration. In some embodiments, the anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment or formulation containing this dose is about 0.01 mg/kg to 20 mg/kg per administration.
  • the preparations containing the anti-TIGIT antibody or antigen-binding fragment can be those suitable for injectable use including sterile aqueous solutions (herein water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • suitable carriers include physiological saline, bacteriostatic or phosphate buffered saline (PBS), ethanol, solvents or dispersion media of polyols (eg, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and the like, and suitable mixture.
  • the formulation comprises at least 0.1% anti-TIGIT antibody or antigen-binding fragment.
  • the percentage of antibody can vary and can be between about 2% and 90% by weight for a given dosage form.
  • the anti-TIGIT antibody or antigen-binding fragment is about 0.001 mg/kg, about 0.002 mg/kg, about 0.003 mg/kg, about 0.004 mg/kg, about 0.005 mg/kg, about 0.006 mg/kg per administration mg/kg, about 0.007mg/kg, about 0.008mg/kg, about 0.009mg/kg, about 0.01mg/kg, about 0.012mg/kg, about 0.015mg/kg, about 0.018mg/kg, about 0.02mg/ kg, about 0.03mg/kg, about 0.04mg/kg, about 0.05mg/kg, about 0.06mg/kg, about 0.07mg/kg, about 0.08mg/kg, about 0.1mg/kg, about 0.3mg/kg, About 0.5mg/kg, about 0.8mg/kg, about 0.9mg/kg, about 1mg/kg, about 2mg/kg, about 3mg/kg, about 4m
  • the dose of anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment per administration is about 0.001 mg/kg to 20 mg/kg, about 0.001 mg/kg to 2 mg/kg, about 0.001 mg/kg kg to 1 mg/kg, about 0.005 mg/kg to 1 mg/kg, about 0.01 mg/kg to 1 mg/kg, about 0.01 mg/kg to 20 mg/kg once daily to once every 7 weeks; or weekly Dosing once, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks or once every 7 weeks; or every 2, Administer once every 3 or 4 weeks.
  • anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • the dose of anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment per administration is about 0.001 mg/kg, about 0.002 mg/kg, about 0.003 mg/kg, about 0.004 mg/kg, About 0.005mg/kg, about 0.006mg/kg, about 0.007mg/kg, about 0.008mg/kg, about 0.009mg/kg, about 0.01mg/kg, about 0.012mg/kg, about 0.015mg/kg, about 0.018 mg/kg, about 0.02mg/kg, about 0.03mg/kg, about 0.04mg/kg, about 0.05mg/kg, about 0.06mg/kg, about 0.07mg/kg, about 0.08mg/kg, about 0.1mg/kg kg, about 0.3 mg/kg, about 0.5 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1 mg/
  • the anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • the antigen-binding fragment is administered at a dose of about 0.05 mg to 1200 mg per dose.
  • the anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • the antigen-binding fragment is administered at a dose of about 9 mg to 1200 mg per dose.
  • the anti-PD-1 antibody or antigen-binding fragment is administered at a dose of about 1 mg to 600 mg per dose.
  • the anti-PD-1 antibody or antigen-binding fragment is administered at a dose of about 50 mg to 600 mg per dose.
  • the anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • the antigen-binding fragment is administered at a dose of about 0.05 mg to 1200 mg, about 0.05 mg to 500 mg, about 0.05 mg to 100 mg, about 0.1 mg to 100 mg, About 0.1 mg to 50 mg, about 0.1 mg to 30 mg, about 0.1 mg to 10 mg, about 0.5 mg to 1 mg, about 9 mg to 1200 mg, about 1 mg to 900 mg, about 1 mg to 300 mg, about 1 mg to 100 mg, about 1 mg to 30 mg, about 1 mg to 10 mg, about 1 mg to 3 mg, about 3 mg to 900 mg, about 3 mg to 600 mg, about 3 mg to 100 mg, about 3 mg to 30 mg, about 3 mg to 10 mg, about 10 mg to 900 mg, about 10 mg to 600 mg, about 10 mg to 300 mg, about 10 mg to 100 mg, about 10 mg to 30 mg, about 30 mg to 900 mg, about 30 mg to 600 mg, about 30 mg, about 3
  • the dose of anti-TIGIT antibody or antigen-binding fragment per administration is about 0.05 mg, about 0.08 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg , about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 30 mg, about 40 mg, about 50 mg, about 100 mg, about 300 mg, about 600 mg, about 900 mg, about 1000 mg, about 1200 mg are administered every 2, 3 or 4 weeks.
  • the dose of anti-TIGIT antibody or antigen-binding fragment per administration is about 0.05 mg, about 0.08 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg , about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 30 mg, about 100 mg, about 300 mg, about 600 mg, or about 900 mg are administered every 2, 3 or 4 weeks.
  • the anti-TIGIT antibody or antigen-binding fragment is administered at a dose of about 600 mg to 1200 mg per administration once every 2, 3, or 4 weeks. In some embodiments, the anti-TIGIT antibody or antigen-binding fragment is administered at a dose of about 700 mg, about 800 mg, 900 mg, or about 1200 mg per administration every 2, 3, or 4 weeks.
  • a therapeutically effective amount of another therapeutic agent and an anti-TIGTI antibody or antigen-binding fragment are administered to a patient separately or simultaneously.
  • the period of administration of the other therapeutic agent and the anti-TIGIT antibody or antigen-binding fragment can be the same or different.
  • the anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent are administered by subcutaneous (s.c.) injection, intraperitoneal (i.p.) injection, parenteral injection, intraarterial injection, or intravenous (i.v.) injection or infusion Dosing in other ways.
  • the anti-TIGIT antibody or antigen-binding fragment and the other therapeutic agent can be administered by the same or different means.
  • the anti-TIGIT antibody or antigen-binding fragment is administered by intravenous (i.v.) infusion.
  • the anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • the antigen-binding fragment and the another therapeutic agent are separate administration units, administered in combination.
  • the anti-TIGIT antibody or antigen-binding fragment may be administered prior to administration of the other therapeutic agent, may be administered after administration of the other therapeutic agent, or may be administered with the other therapeutic agent A therapeutic agent is administered concurrently.
  • the anti-TIGIT antibody eg, antibody h10D8OF or h10D8OFKF
  • the other therapeutic agent form a combined administration unit simultaneously, and are administered in combination.
  • the patient has a tumor or cancer.
  • tumors and cancers include, but are not limited to, hematological cancers, solid tumors.
  • hematological cancers include, but are not limited to, leukemia, lymphoma, and myeloma.
  • the leukemia includes acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), and myeloproliferative disorders/neoplastics (MPDS) ).
  • ALL acute lymphocytic leukemia
  • AML acute myeloid leukemia
  • CLL chronic lymphocytic leukemia
  • CML chronic myelogenous leukemia
  • MPDS myeloproliferative disorders/neoplastics
  • lymphomas include Hodgkin's lymphoma, indolent and aggressive non-Hodgkin's lymphoma, Burkitt's lymphoma, and follicular lymphoma (small cell and large cell).
  • the myeloma includes multiple myeloma (MM), giant cell myeloma, heavy chain myeloma, and light chain or Bence-Jones myeloma.
  • solid tumors include breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, melanoma, colorectal cancer, colon cancer, lung cancer, head and neck cancer, bladder cancer, esophageal cancer, liver cancer, and kidney cancer.
  • the tumor and cancer are pathologically confirmed locally advanced or metastatic malignant solid tumors for which there is no effective treatment.
  • the additional therapeutic agent is selected from the following antibodies or antigen-binding fragments or antibody drug conjugates (ADCs) directed against a target: EGFR (Epidermal Growth Factor Receptor), VEGF (Vascular Endothelial Growth Factor) ), VEGFR2 (vascular endothelial growth factor receptor 2), CTLA-4 (cytotoxic T lymphocyte-associated protein 4), PD-1 (programmed death receptor-1), PD-L1 (programmed death ligand- 1), HER2 (human epidermal growth factor receptor 2), CD20 (cluster of differentiation 20), Trop2 (human trophoblast cell surface antigen 2), Lag3 (lymphocyte activation gene-3 molecule), CD27 (cluster of differentiation 27), OX40 (tumor necrosis factor receptor superfamily member 4), ICOS (inducible costimulator), BTLA (B and T lymphocyte attenuating factor), TIM3 (T cell immunoglobulin mucin 3), BCMA (B cell maturation
  • the another therapeutic agent is selected from the group consisting of anti-EGFR antibody, anti-VEGF antibody, anti-VEGFR2 antibody, anti-CTLA-4 antibody, anti-PD-1 antibody, anti-PD-L1 antibody, anti-HER2 antibody, anti- CD20 antibody, anti-Trop2 antibody, anti-OX40 antibody and anti-ICOS antibody.
  • the other therapeutic agent is an antibody targeting T lymphocyte-associated antigen 4 (CTLA-4) (anti-CTLA-4 antibody) or an antigen-binding fragment, such as ipilimumab (Yervoy TM or its biosimilar) or defucosylated ipilimumab as described in WO2014089113.
  • CTLA-4 T lymphocyte-associated antigen 4
  • antigen-binding fragment such as ipilimumab (Yervoy TM or its biosimilar) or defucosylated ipilimumab as described in WO2014089113.
  • the heavy chain of the anti-CTLA-4 antibody comprises the amino acid sequence set forth in SEQ ID NO: 17 and the light chain of the anti-CTLA-4 antibody comprises the amino acid sequence set forth in SEQ ID NO: 18; anti-CTLA The -4 antibody contains two heavy chains with identical sequences and two light chains with identical sequences.
  • the anti-CTLA-4 antibody or antigen-binding fragment is expressed by CHO cells. In some embodiments, the anti-CTLA-4 antibody or antigen-binding fragment is expressed by an alpha-(1,6)-fucosyltransferase knockout cell line (eg, CHO cells).
  • an alpha-(1,6)-fucosyltransferase knockout cell line eg, CHO cells.
  • the anti-CTLA-4 antibody or antigen-binding fragment has ⁇ 5% total high mannose glycoforms and/or ⁇ 3% total sialylated glycoforms.
  • the total amount of high mannose glycoforms of the anti-CTLA-4 antibody or antigen-binding fragment is about 0.1%, about 0.3%, about 0.9%, about 1.18%, about 1.7%, about 2.6%, about 3.3% %, about 4.1%, about 4.9%, about 4.99%, or a range (including endpoints) between any two of these values or any value therein.
  • the anti-CTLA-4 antibody or antigen-binding fragment has a total amount of sialylated glycoforms of about 0.1%, 0.2%, about 0.36%, about 0.8%, about 1.5%, about 2.2%, about 2.7% %, about 2.9%, 2.99%, or a range (including endpoints) between any two of these values, or any value therein.
  • the anti-CTLA-4 antibody or antigen-binding fragment has ⁇ 2% total high mannose glycoforms and/or ⁇ 1% total sialylated glycoforms.
  • the anti-CTLA-4 antibody or antigen-binding fragment has a fucosylation level of 0-10%. In some embodiments, the anti-CTLA-4 antibody or antigen-binding fragment has a fucosylation level of 0-5%. In some embodiments, the anti-CTLA-4 antibody or antigen-binding fragment has a fucosylation level of about 0, about 0.1%, about 0.3%, about 0.4%, about 0.6%, about 1.3%, about 1.9% %, about 2.2%, about 2.8%, about 3.3%, about 3.7%, about 4.1%, about 4.5%, about 5%, or a range (including endpoints) between any two of these values or any value therein .
  • the dose of ipilimumab administered is about 30 mg to 300 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • ipilimumab is administered at a dose of 1 mg/kg, 3 mg/kg, or 10 mg/kg administered every 3, 6, or 12 weeks.
  • ipilimumab is administered at a dose of 1 mg/kg administered every 3 or 6 weeks.
  • ipilimumab is administered at a dose of 3 mg/kg administered every 3 or 6 weeks.
  • ipilimumab is administered at a dose of 10 mg/kg administered every 3 weeks or every 12 weeks.
  • each administration of ipilimumab is about 0.5 mg/kg to 10 mg/kg or a formulation containing such dose of ipilimumab.
  • the ipilimumab is about 0.5 mg/kg, about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6 mg/kg per administration mg/kg, about 4mg/kg, about 4.8mg/kg, about 5mg/kg, about 5.5mg/kg, about 6mg/kg, about 6.9mg/kg, about 7mg/kg, about 8.4mg/kg, about 9mg /kg, about 10 mg/kg, or a range between any two of these values (including the endpoints) or any value therein, or a formulation containing ipilimumab at this dose.
  • therapeutically effective amounts of ipilimumab and the anti-TIGIT antibody or antigen-binding fragment are administered to the patient separately or simultaneously.
  • the period of administration of ipilimumab and the anti-TIGIT antibody or antigen-binding fragment can be the same or different.
  • the other therapeutic agent is an anti-PD-1 antibody or antigen-binding fragment.
  • the anti-PD-1 antibody is nivolumab (eg Opdivo or OPDIVO or a biosimilar thereof), pembrolizumab (eg Keytruda or Keytruda or its biosimilars) biosimilars), camrelizumab (such as Erica or its biosimilars), sintilimab (such as or its biosimilars), toripalimab (toripalimab; such as Tuoyi or its biosimilars), or tislelizumab (tislelizumab; such as or its biological analogs).
  • nivolumab eg Opdivo or OPDIVO or a biosimilar thereof
  • pembrolizumab eg Keytruda or Keytruda or its biosimilars
  • camrelizumab such as Erica or its biosimilars
  • sintilimab such as or its biosimilars
  • toripalimab such
  • the anti-PD-1 antibody or antigen-binding fragment comprises HCDR1 set forth in SEQ ID NO:21, HCDR2 set forth in SEQ ID NO:22, HCDR3 set forth in SEQ ID NO:23, SEQ ID NO:23 LCDR1 shown in NO:24, LCDR2 shown in SEQ ID NO:25 and LCDR3 shown in SEQ ID NO:26.
  • the heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:27, or has at least 80 ⁇ compared to the sequence set forth in SEQ ID NO:27 % identical amino acid sequence, or amino acid sequence with one or more conservative amino acid substitutions compared to the sequence shown in SEQ ID NO: 27.
  • the light chain variable region of the anti-PD-1 antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:28, or has at least 80 ⁇ compared to the sequence set forth in SEQ ID NO:28 % identical amino acid sequence, or amino acid sequence with one or more conservative amino acid substitutions compared to the sequence shown in SEQ ID NO: 28.
  • the heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:27, or has at least 80 ⁇ compared to the sequence set forth in SEQ ID NO:27 % identical amino acid sequence, or amino acid sequence with one or more conservative amino acid substitutions compared with the sequence shown in SEQ ID NO: 27;
  • the light chain variable region of the anti-PD-1 antibody or antigen-binding fragment comprises SEQ ID NO: 27
  • the heavy chain of the anti-PD-1 antibody comprises the amino acid sequence set forth in SEQ ID NO:19 and the light chain of the anti-PD-1 antibody comprises the amino acid sequence set forth in SEQ ID NO:20.
  • it can be expressed in cells (eg, CHO) by genetic engineering and obtained by purification.
  • the anti-PD-1 antibody is tislelizumab.
  • the anti-PD-1 antibody or antigen-binding fragment is administered at about 1 to 600 mg, about 1 to 300 mg, about 1 to 100 mg, about 10 to 100 mg, about 10 to 50 mg, about 15 to 35 mg, Doses of about 50 mg to 600 mg are administered. In some embodiments, the anti-PD-1 antibody or antigen-binding fragment is administered at about 0.01 mg/kg to 10 mg/kg, about 0.1 mg/kg to 10 mg/kg, about 0.1 mg/kg to 1 mg/kg, Doses of about 1 mg/kg to 10 mg/kg are administered.
  • the anti-PD-1 antibody or antigen-binding fragment is administered at a dose of about 1 to 600 mg, about 50 to 600 mg, about 1 to 300 mg, about 1 to 100 mg, about 10 to 100 mg, about 10 to 50 mg, about 15mg to 35mg per treatment cycle. In some embodiments, the anti-PD-1 antibody or antigen-binding fragment is administered at a dose of about 0.01 mg/kg to 10 mg/kg, about 1 mg/kg to 10 mg/kg, about 0.1 mg/kg to 10 mg/kg, about 0.1 mg/kg mg/kg to 1 mg/kg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • the dose of anti-PD-1 antibody or antigen-binding fragment per administration is about 1 to 600 mg, about 50 to 600 mg, about 1 to 300 mg, about 1 to 100 mg, about 10 to 100 mg, about 10 to 50 mg , about 15 mg to 35 mg once daily to once every 7 weeks, or once weekly, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks Dosing once, every 6 weeks, or every 7 weeks; or every 2 weeks or every 3 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment per administration is about 0.01 mg/kg to 10 mg/kg, about 1 mg/kg to 10 mg/kg, about 0.1 mg/kg to 10 mg/kg, About 0.1 mg/kg to 1 mg/kg once daily to once every 7 weeks, or once weekly, once every 2 weeks, once every 3 weeks, once every 4 weeks, every Dosing every 5 weeks, every 6 weeks, or every 7 weeks; or every 2 weeks or every 3 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment per administration is about 0.01 mg/kg, about 0.02 mg/kg, about 0.03 mg/kg, about 0.04 mg/kg, about 0.05 mg/kg , about 0.06mg/kg, about 0.07mg/kg, about 0.08mg/kg, about 0.09mg/kg, about 0.1mg/kg, about 0.2mg/kg, about 0.3mg/kg, about 0.4mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg (or a range (including endpoints) between any two of these values, or any value therein ) every 2 weeks or every 3 weeks.
  • the anti-PD-1 antibody or antigen-binding fragment is administered at a dose of about 10 mg to about 600 mg per administration once every 2, 3, or 4 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment per administration is about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg , about 20 mg, about 30 mg, about 33 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg (or any of these values)
  • the range between any two values of (including endpoints) or any value therein) is administered every 2, 3 or 4 weeks.
  • the anti-PD-1 antibody or antigen-binding fragment per administration is about 0.1 mg/kg to 10 mg/kg or a formulation containing such dose of the anti-PD-1 antibody or antigen-binding fragment. In some embodiments, the anti-PD-1 antibody or antigen-binding fragment per administration is about 1 mg/kg to 10 mg/kg or a formulation containing such dose of the anti-PD-1 antibody or antigen-binding fragment.
  • the anti-PD-1 antibody or antigen-binding fragment per administration is about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, About 0.6mg/kg, about 0.7mg/kg, about 0.8mg/kg, about 0.9mg/kg, about 1mg/kg, about 1.2mg/kg, about 2mg/kg, about 2.4mg/kg, about 3mg/kg , about 3.6 mg/kg, about 4 mg/kg, about 4.8 mg/kg, about 5 mg/kg, about 5.5 mg/kg, about 7 mg/kg, about 10 mg/kg, or between any two of these values range (including endpoints) or any value therein, or a formulation containing this dose of anti-PD-1 antibody or antigen-binding fragment.
  • tislelizumab is 100 mg-300 mg per administration. In some embodiments, tislelizumab is about 200 mg per administration. In some embodiments, tislelizumab is administered every 2-4 weeks. In some embodiments, tislelizumab is administered about every 3 weeks.
  • therapeutically effective amounts of the anti-PD-1 antibody or antigen-binding fragment and the anti-TIGIT antibody or antigen-binding fragment are administered to the patient separately or simultaneously.
  • the period of administration of the anti-PD-1 antibody or antigen-binding fragment and the anti-TIGIT antibody or antigen-binding fragment may be the same or different.
  • the other therapeutic agent is an antibody that targets PD-L1 (anti-PD-L1 antibody) or an antigen-binding fragment, such as Atezolizumab, such as or its biosimilar), or durvalumab (Durvalumab, such as or its biological analogs).
  • Atezolizumab and Durvalumab can be expressed in cells (such as CHO) through genetic engineering and obtained through purification; the purification can be performed by conventional methods.
  • the other therapeutic agent is atezolizumab, which includes Tecentriq TM , its biosimilar, or ADCC effect-enhancing mAb or defucosylated mAb.
  • atezolizumab is administered at a dose of about 60 mg to 1200 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • atezolizumab is administered at a dose of about 1200 mg administered every 3 weeks.
  • each administration of atezolizumab is about 1 mg/kg to 20 mg/kg or a formulation containing such doses of atezolizumab.
  • the atezolizumab per administration is about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6 mg/kg, about 4mg/kg, about 4.8mg/kg, about 5mg/kg, about 5.5mg/kg, about 6mg/kg, about 9mg/kg, about 12mg/kg, about 15mg/kg, about 18mg/kg, about 20mg/kg , or a range (including endpoints) between any two of these values, or any value therein, or a formulation containing atezolizumab at this dose.
  • the other therapeutic agent is Durvalumab, including IMFINZI TM , a biosimilar thereof, or an ADCC effect-enhancing mAb or a defucosylated mAb.
  • Durvalumab is administered at a dose of about 60 mg to 900 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • Durvalumab is administered at a dose of about 5 mg/kg to 15 mg/kg administered every 2 weeks or every 3 weeks.
  • Durvalumab is administered at a dose of about 10 mg/kg administered every 2 weeks.
  • the Durvalumab per administration is about 1 mg/kg to 10 mg/kg or a formulation containing such dose of Durvalumab. In some embodiments, the Durvalumab per administration is about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6 mg/kg, about 4 mg/kg, about 4.8 mg/kg, about 5 mg/kg, about 5.5 mg/kg, about 6 mg/kg, about 9 mg/kg, about 10 mg/kg, or a range (including endpoints) between any two of these values or in which any value, or formulation containing this dose of Durvalumab.
  • therapeutically effective amounts of the anti-PD-L1 antibody or antigen-binding fragment and the anti-TIGIT antibody or antigen-binding fragment are administered to the patient separately or simultaneously.
  • the period of administration of the anti-PD-L1 antibody or antigen-binding fragment and the anti-TIGIT antibody or antigen-binding fragment may be the same or different.
  • the other therapeutic agent is a monoclonal antibody (anti-HER2 antibody) that specifically binds to the extracellular dimerization domain (subdomain II) of epidermal growth factor receptor 2 (HER2). ), such as Pertuzumab.
  • Pertuzumab can be expressed in cells (such as CHO) by genetic engineering and obtained by purification.
  • the other therapeutic agent is pertuzumab, which includes perjeta TM or a biosimilar thereof or an ADCC effect-enhancing mAb or a defucosylated mAb.
  • the dose of Pertuzumab administered is about 40 mg to 900 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • Pertuzumab is administered at a dose of about 840 mg initially, followed by 420 mg administered every 3 weeks.
  • the Pertuzumab per administration is about 1 mg/kg to 12 mg/kg or a formulation containing this dose of Pertuzumab. In some embodiments, the Pertuzumab per administration is about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6 mg/kg, about 4mg/kg, about 4.8mg/kg, about 5mg/kg, about 5.5mg/kg, about 6mg/kg, about 6.9mg/kg, about 7mg/kg, about 8.4mg/kg, about 9mg/kg, about 11mg /kg, about 12 mg/kg, or a range between any two of these values (including the endpoints) or any value therein, or a formulation containing Pertuzumab at this dose.
  • therapeutically effective amounts of Pertuzumab and the anti-TIGIT antibody or antigen-binding fragment are administered to the patient separately or simultaneously.
  • the period of administration of Pertuzumab and the anti-TIGIT antibody or antigen-binding fragment can be the same or different.
  • the other therapeutic agent is a recombinant humanized immunoglobulin G1 (IgG1) monoclonal antibody that binds VEGF-A and inhibits its interaction with VEGF receptor-2 (VEGFR-2) Binding (anti-VEGF antibody) such as bevacizumab.
  • IgG1 humanized immunoglobulin G1
  • VEGFR-2 VEGF receptor-2
  • Bevacizumab can be expressed in cells (eg, CHO) by genetic engineering and obtained by purification.
  • the other therapeutic agent is bevacizumab
  • bevacizumab includes Avastin TM or a biosimilar thereof, such as or BAT1706 (or or ), or ADCC effect-enhancing mAb or defucosylated mAb.
  • the dose of bevacizumab administered is about 50 mg to 400 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • bevacizumab is administered at a dose of about 5 mg/kg to 15 mg/kg administered every 2 weeks or every 3 weeks.
  • bevacizumab is administered at a dose of about 5 mg/kg, 7.5 mg/kg, 10 mg/kg, or 15 mg/kg administered every 2 weeks or every 3 weeks.
  • bevacizumab is administered at a dose of about 5 mg/kg every 2 weeks, 10 mg/kg every 2 weeks, 7.5 mg/kg every 3 weeks, 15 mg/kg Dosing every 3 weeks.
  • the bevacizumab per administration is about 1 mg/kg to 9 mg/kg or a formulation containing bevacizumab at this dose. In some embodiments, the bevacizumab per administration is about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6 mg/kg, about 4 mg/kg, about 4.8 mg/kg, about 5 mg/kg, about 5.5 mg/kg, about 6 mg/kg, about 6.9 mg/kg, about 7 mg/kg, about 8.4 mg/kg, about 9 mg/kg, or A range (including endpoints) between any two of these values, or any value therein, or a formulation containing bevacizumab at this dose.
  • a therapeutically effective amount of bevacizumab and an anti-TIGIT antibody or antigen-binding fragment is administered to the patient separately or simultaneously.
  • the period of administration of bevacizumab and the anti-TIGIT antibody or antigen-binding fragment can be the same or different.
  • the other therapeutic agent is an antibody that targets CD20 (anti-CD20 antibody), such as ofatumumab, or obinutuzumab.
  • anti-CD20 antibody such as ofatumumab, or obinutuzumab.
  • Ofatumumab and obinutuzumab can be expressed in cells (such as CHO) through genetic engineering and obtained through purification.
  • the other therapeutic agent is ofatumumab, and ofatumumab comprises Arzerra TM or Its biosimilar or ADCC effect-enhancing monoclonal antibody or defucosylated monoclonal antibody, such as BAT4406F disclosed in CN109096399A.
  • ofatumumab is administered at a dose of about 10 mg to 2000 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • ofatumumab is administered at a dose of about 20 mg administered weekly or monthly.
  • ofatumumab is administered at a dose of about 300 mg initially, 1000 mg after 1 week, and then 1000 mg administered every 4 weeks or every 8 weeks. In some embodiments, ofatumumab is administered at a dose of about 300 mg initially, 2000 mg after 1 week, and then 2000 mg administered every 1 week or every 4 weeks.
  • ofatumumab per administration is about 0.5 mg/kg to 18 mg/kg or a formulation containing such dose of ofatumumab. In some embodiments, ofatumumab per administration is about 0.5 mg/kg, about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6mg/kg, about 4mg/kg, about 4.8mg/kg, about 5mg/kg, about 5.5mg/kg, about 6mg/kg, about 6.9mg/kg, about 7mg/kg, about 8.4mg/kg, about 9 mg/kg, about 11 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, about 17 mg/kg, about 18 mg/kg, or a range between any two of these values (including endpoints) or any of these values, or a formulation containing this dose of ofatumumab.
  • a therapeutically effective amount of ofatumumab and an anti-TIGIT antibody or antigen-binding fragment is administered to a patient separately or simultaneously.
  • the period of administration of ofatumumab and the anti-TIGIT antibody or antigen-binding fragment can be the same or different.
  • the other therapeutic agent is obinutuzumab, comprising Its biosimilar, or ADCC effect-enhancing monoclonal antibody or defucosylated monoclonal antibody, such as BAT4306F described in CN109096399A.
  • the dose of obinutuzumab administered is about 10 mg to 2000 mg per treatment cycle.
  • a treatment cycle is 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 5 weeks, 6 weeks, 7 weeks, or a range between any two of these values (including endpoint) or any of its values.
  • obinutuzumab is administered at a dose of 100 mg on day 1, 900 mg on day 2, 1,000 mg on days 8, 15, and 1,000 mg per course thereafter.
  • the effective amount of obinutuzumab administered is 1,000 mg each on day 1, day 8, day 15, and then 1,000 mg per course of treatment thereafter. Each course of treatment can be 1 month or 2 months.
  • the obinutuzumab per administration is about 0.5 mg/kg to 15 mg/kg or a formulation containing such dose of obinutuzumab.
  • the obinutuzumab is about 0.5 mg/kg, about 1 mg/kg, about 1.2 mg/kg, about 2 mg/kg, about 2.4 mg/kg, about 3 mg/kg, about 3.6 mg/kg per administration , about 4mg/kg, about 4.8mg/kg, about 5mg/kg, about 5.5mg/kg, about 6mg/kg, about 6.9mg/kg, about 7mg/kg, about 8.4mg/kg, about 9mg/kg, About 11 mg/kg, about 13 mg/kg, about 14 mg/kg, about 15 mg/kg, or a range between any two of these values (including endpoints) or any value therein, or a formulation containing obinutuzumab at this dose.
  • a therapeutically effective amount of obinutuzumab and an anti-TIGIT antibody or antigen-binding fragment is administered to the patient separately or simultaneously.
  • the period of administration of obinutuzumab and the anti-TIGIT antibody or antigen-binding fragment can be the same or different.
  • the other therapeutic agent is an anti-HER2 antibody drug conjugate (HER2-ADC) or an anti-Trop2 antibody drug conjugate (Trop2-ADC), eg, ado-trastuzumab emtansine (T-DM1) , trastuzumab deruxtecan (DS-8201), the antibody drug conjugate described in CN103333246B and CN109078181A.
  • HER2-ADC anti-HER2 antibody drug conjugate
  • Trop2-ADC anti-Trop2 antibody drug conjugate
  • T-DM1 ado-trastuzumab emtansine
  • DS-8201 trastuzumab deruxtecan
  • the present invention discloses a method of treating a tumor or cancer, comprising administering to a patient in need thereof an effective amount of an anti-TIGIT antibody or antigen-binding fragment (or formulation) and another therapeutic agent (or formulation) ).
  • the anti-TIGIT antibody or antigen-binding fragment is administered at a dose of about 0.05 mg to 1200 mg.
  • the effective amount of the anti-TIGIT antibody or antigen-binding fragment is about 9 mg to 1200 mg (or a formulation containing such a dose of the anti-TIGIT antibody) in a single administration.
  • the other therapeutic agent is an anti-PD-1 antibody or antigen-binding fragment.
  • the anti-PD-1 antibody comprises HCDR1 shown in SEQ ID NO:21, HCDR2 shown in SEQ ID NO:22, HCDR3 shown in SEQ ID NO:23, HCDR3 shown in SEQ ID NO:24 LCDR1 shown in SEQ ID NO: 25, LCDR2 shown in SEQ ID NO: 25, and LCDR3 shown in SEQ ID NO: 26.
  • the heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment comprises the amino acid sequence set forth in SEQ ID NO:27, or has at least 80 ⁇ compared to the sequence set forth in SEQ ID NO:27 % identical amino acid sequence, or amino acid sequence with one or more conservative amino acid substitutions compared with the sequence shown in SEQ ID NO: 27; and/or the light chain variable of the anti-PD-1 antibody or antigen-binding fragment
  • the region comprises the amino acid sequence shown in SEQ ID NO: 28, or an amino acid sequence that is at least 80% identical to the sequence shown in SEQ ID NO: 28, or has one or more identities compared to the sequence shown in SEQ ID NO: 28. Amino acid sequence of multiple conservative amino acid substitutions.
  • the heavy chain of the anti-PD-1 antibody comprises the amino acid sequence set forth in SEQ ID NO:19 and the light chain of the anti-PD-1 antibody comprises the amino acid sequence set forth in SEQ ID NO:20.
  • the effective amount of the anti-PD-1 antibody or antigen-binding fragment is about 1 mg to 600 mg (or a formulation containing this dose of the anti-PD-1 antibody or antigen-binding fragment) in a single administration. Dosage schedule and mode of administration depend on benefit-risk assessment of anti-PD-1 antibody or antigen-binding fragment (or preparation), anti-TIGIT antibody or antigen-binding fragment (or preparation) in certain patient populations and general clinical practice guidelines .
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 0.05 mg to 1200 mg per treatment cycle (or a formulation containing such dose of anti-TIGIT antibody or antigen-binding fragment)
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered to patients per treatment cycle is about 1 mg to 600 mg (or a preparation containing this dose of anti-PD-1 antibody or antigen-binding fragment).
  • the patient is administered an anti-TIGIT antibody (e.g., antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 9 mg to 1200 mg (or a formulation containing such a dose of anti-TIGIT antibody or antigen-binding fragment) per treatment cycle
  • an anti-TIGIT antibody e.g., antibody h10D8OF or h10D8OFKF
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered to a patient per treatment cycle is about 50 mg to 600 mg (or a formulation containing such dose of anti-PD-1 antibody or antigen-binding fragment).
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 0.05 mg, about 0.08 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, About 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg , about 10 mg, about 12 mg, about 20 mg, about 30 mg, about 50 mg, about 60 mg, about 80 mg, about 100 mg, about 120 mg, about 200 mg, about 250 mg, about 290 mg, about 300 mg, about 330 mg, about 380 mg, about 400 mg, about 434 mg, about 480 mg, about 500 mg, about 567 mg, about 580 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg,
  • one treatment cycle is administered once every 1 week to 7 weeks.
  • the dose of anti-TIGIT antibody or antigen-binding fragment administered per treatment cycle is about 0.05 mg to 1200 mg, or a formulation containing such dose of anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 Week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or a range (including endpoints) between any two of these values or any value therein.
  • one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 1 mg to 30 mg per treatment cycle, or a formulation containing such dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 Week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or a range (including endpoints) between any two of these values or any value therein. In some embodiments, one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the dose of anti-TIGIT antibody or antigen-binding fragment administered in each treatment cycle is 9 mg to 100 mg, or a formulation containing such dose of anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or a range (including endpoints) between any two of these values or any value therein. In some embodiments, one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 100 mg to about 300 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 300 mg to about 600 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 600 mg to about 900 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the dose of the anti-TIGIT antibody or antigen-binding fragment administered to the patient per treatment cycle is about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 30 mg, about 50 mg, about 74 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 260 mg, about 300 mg, about 350 mg, about 400 mg, about 430 mg, about 460 mg, about 520 mg, about 600 mg, about 900 mg, or any two of these values A range between values (including endpoints) or any value therein, or a formulation comprising such dose of anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, about 2 weeks, about
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 0.8 mg to 2 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; For example, about 1 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 1 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 2 mg to 5 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 3 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 3 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 7 mg to 20 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 10 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 10 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 23 mg to 50 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 30 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 30 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 75 mg to 150 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 100 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 100 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 167 mg to 250 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 200 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 200 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 267 mg to 354 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 300 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 300 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 347 mg to 430 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 400 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 400 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 557 mg to 650 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 600 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 600 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment at a dose of about 877 mg to 950 mg per treatment cycle, or a formulation containing such a dose of an anti-TIGIT antibody or antigen-binding fragment; such as About 900 mg is administered once.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment at a dose of about 900 mg per treatment cycle, or a formulation containing this dose of an anti-TIGIT antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, About 2 weeks, about 3 weeks, or about 4 weeks.
  • the dose of anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment is about 0.05 mg to 1200 mg administered once every 3 weeks. In some embodiments, the dose of an anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment is about 1 mg to 900 mg administered every 3 weeks. In some embodiments, the dose of anti-TIGIT antibody (eg, antibody h10D8OF or h10D8OFKF) or antigen-binding fragment is about 10 mg to 900 mg administered once every 3 weeks.
  • the dose of anti-TIGIT antibody or antigen-binding fragment is about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 30 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, About 600 mg, about 700 mg, about 800 mg, or about 900 mg are administered every 3 weeks.
  • the dose of anti-TIGIT antibody or antigen-binding fragment is about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 30 mg, about 100 mg, about 300 mg, about 600 mg, or about 900 mg are administered every 3 weeks.
  • the dose of the anti-PD-1 antibody or antigen-binding fragment administered to the patient per treatment cycle is about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 30 mg, about 33 mg, about 40 mg, about 50 mg, about 60 mg, about 80 mg, about 120 mg, about 200 mg, about 250 mg, about 290 mg, about 300 mg, about 330 mg, about 380 mg, about 400 mg, about 434 mg, about 480 mg, about 500 mg, about 567 mg, about 580 mg, about 600 mg, or any of these values A range between, inclusive of the endpoints, or any value therein, or a formulation containing this dose of anti-PD-1 antibody or antigen-binding fragment.
  • one treatment cycle is administered once every 1 week to 7 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered per treatment cycle is 15 mg to 35 mg, 10 mg to 50 mg, 10 mg to 100 mg, 1 mg to 100 mg, 50 mg to 600 mg, or containing such dose of anti-PD -1 A preparation of an antibody or antigen-binding fragment; wherein one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or any of these values A range between two values (including the endpoints) or any value within it.
  • one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered in each treatment cycle is 10 mg to 200 mg, or a formulation containing such dose of anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or a range (including endpoints) between any two of these values or any value therein. In some embodiments, one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 10 mg to about 300 mg per treatment cycle, or a formulation containing such a dose of an anti-PD-1 antibody or antigen-binding fragment; wherein one of The treatment period is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered in each treatment cycle is 100 mg to 200 mg, or a formulation containing such dose of anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or a range (including endpoints) between any two of these values or any value therein. In some embodiments, one treatment cycle is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 200 mg to about 300 mg per treatment cycle, or a formulation containing such a dose of an anti-PD-1 antibody or antigen-binding fragment; wherein one of The treatment period is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered to the patient per treatment cycle is about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 30 mg, about 33 mg, about 40 mg, about 50 mg, about 60 mg, about 80 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, or a range between any two of these values (including endpoints) or any value therein, or a formulation containing such a dose of an anti-PD-1 antibody or antigen-binding fragment; wherein one The treatment period is about 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 10 mg to 20 mg per treatment cycle, or a formulation containing such a dose of an anti-PD-1 antibody or antigen-binding fragment; such as about 16 mg given medicine once.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 16 mg per treatment cycle, or a formulation containing this dose of anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 20 mg to 45 mg per treatment cycle, or a formulation containing such a dose of the anti-PD-1 antibody or antigen-binding fragment; such as about 33 mg administered medicine once.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 33 mg per treatment cycle, or a formulation containing this dose of anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 45 mg to 80 mg per treatment cycle, or a formulation containing such dose of the anti-PD-1 antibody or antigen-binding fragment; such as about 50 mg given medicine once.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 50 mg per treatment cycle, or a formulation containing this dose of the anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 87 mg to 130 mg per treatment cycle, or a formulation containing such a dose of an anti-PD-1 antibody or antigen-binding fragment; such as about 100 mg administered medicine once.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 100 mg per treatment cycle, or a formulation containing this dose of the anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 180 mg to 230 mg per treatment cycle, or a formulation containing such dose of the anti-PD-1 antibody or antigen-binding fragment; such as about 200 mg given medicine once.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 200 mg per treatment cycle, or a formulation containing this dose of the anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 267 mg to 343 mg per treatment cycle, or a formulation containing such dose of the anti-PD-1 antibody or antigen-binding fragment; such as about 300 mg given medicine once.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 300 mg per treatment cycle, or a formulation containing this dose of the anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-PD-1 antibody or antigen-binding fragment at a dose of about 300 mg to 700 mg per treatment cycle, or a formulation containing such dose of the anti-PD-1 antibody or antigen-binding fragment; such as about 600 mg given medicine once.
  • the dose of anti-PD-1 antibody or antigen-binding fragment administered to the patient per treatment cycle is about 600 mg, or a formulation containing such dose of anti-PD-1 antibody or antigen-binding fragment; wherein one treatment cycle is About 1 week, about 2 weeks, about 3 weeks, or about 4 weeks.
  • the patient is administered an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent (or a combination of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent once per treatment cycle) ).
  • the anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent are administered separately multiple times per treatment cycle, eg 2, 3, 4 or 5 times.
  • the patient is only dosed once or four times per treatment cycle.
  • the patient is treated with one treatment cycle. In some embodiments, the patient is treated with multiple (eg, 2, 3, or 4) treatment cycles. In some embodiments, the patient receives treatment until the condition resolves and no longer requires treatment.
  • the present invention discloses a method for treating a tumor or cancer, the method comprising: administering to a patient in need thereof about 0.05 mg to 10 mg, about 10 mg to 100 mg, about 100 mg to 300 mg, about 300 mg to 600 mg or about 600 mg to 1200 mg, such as about 0.05 mg, about 0.08 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 20 mg, about 30 mg, about 100 mg, about 120 mg, about 200 mg, about 300 mg , about 600 mg or about 900 mg of an anti-TIGIT antibody (e.g., antibody h10D8OF or h10D8OFKF) or antigen-binding fragment, a formulation containing this dose of an anti-TIGIT antibody (
  • the patient is treated with a single dose of an anti-TIGIT antibody or antigen-binding fragment, and a single dose of an anti-PD-1 antibody or antigen-binding fragment. In some embodiments, the patient is treated with a single dose of a combination of an anti-TIGIT antibody or antigen-binding fragment and an anti-PD-1 antibody or antigen-binding fragment.
  • the anti-TIGIT antibody or antigen-binding fragment and the anti-PD-1 antibody or antigen-binding fragment are administered every 3 weeks.
  • the patient's symptoms are relieved after a single dose is administered. In some embodiments, after a single dose is administered and the patient's symptoms are not relieved as expected, the patient is administered about 0.05 mg to 1200 mg of anti-TIGIT antibody or antigen-binding fragment and about 1 mg to 600 mg of anti-PD-1 antibody or antigen, respectively Combine fragments. In some embodiments, the patient's symptoms are relieved after a single dose is administered. In some embodiments, after a single dose is administered and the patient's symptoms are not relieved as expected, the patient is administered about 9 mg to 1200 mg of anti-TIGIT antibody or antigen-binding fragment and about 50 mg to 600 mg of anti-PD-1 antibody or antigen-binding fragment, respectively. Fragment.
  • the anti-TIGIT antibody or antigen-binding fragment (or formulation), anti-PD-1 antibody or antigen-binding fragment (or formulation) is administered by subcutaneous (s.c.) injection, intraperitoneal (i.p.) injection, parenteral injection, Administration by intra-arterial injection or intravenous (i.v.) injection.
  • the anti-TIGIT antibody or antigen-binding fragment (or formulation), anti-PD-1 antibody or antigen-binding fragment (or formulation) is administered by infusion.
  • the anti-TIGIT antibody or antigen-binding fragment (or formulation), anti-PD-1 antibody or antigen-binding fragment (or formulation) is administered as a bolus injection.
  • the anti-TIGIT antibody or antigen-binding fragment (or formulation), anti-PD-1 antibody or antigen-binding fragment (or formulation) is administered by intravenous (i.v.) infusion.
  • the duration of the intravenous infusion is about 50 minutes, about 55 minutes, about 60 minutes, about 65 minutes, about 70 minutes, about 75 minutes, about 81 minutes, about 87 minutes, about 90 minutes, about 95 minutes minutes, or the range (including the endpoints) between any two of these values, or any value therein.
  • administration of the anti-PD-1 antibody or antigen-binding fragment (or formulation) occurs after administration of the anti-TIGIT antibody or antigen-binding fragment (or formulation). In some embodiments, administration of the anti-PD-1 antibody or antigen-binding fragment (or formulation) occurs about 15-60 minutes (eg, about 30 minutes) after administration of the anti-TIGIT antibody or antigen-binding fragment (or formulation).
  • Figure 1 shows that the antibody inhibits the growth of tumor body; the abscissa represents the days of administration, and the ordinate represents the tumor volume.
  • Figure 2 shows the effect of antibody on the body weight of mice; the abscissa represents the days of administration, and the ordinate represents the weight of mice.
  • an entity refers to one or more of such entities, eg "an antibody” should be understood to mean one or more antibodies, thus the term “an” (or “an” ), “one or more” and “at least one” are used interchangeably herein.
  • compositions, methods and the like include the recited elements, such as components or steps, but do not exclude others.
  • Consisting essentially of means that the compositions and methods exclude other elements that have an essential effect on the characteristics of the combination, but do not exclude elements that have no essential effect on the compositions or methods.
  • Consisting of means excluding elements not specifically recited.
  • polypeptide is intended to encompass the singular “polypeptide” as well as the plural “polypeptide”, and refers to a molecule composed of amino acid monomers linked linearly by amide bonds (also known as peptide bonds).
  • polypeptide refers to any single chain or chains of two or more amino acids, and does not refer to a particular length of the product.
  • the definition of “polypeptide” includes a peptide, dipeptide, tripeptide, oligopeptide, "protein”, “amino acid chain” or any other term used to refer to two or more amino acid chains, and the term “polypeptide” may Used in place of, or used interchangeably with, any of the above terms.
  • polypeptide is also intended to refer to the product of post-expression modifications of the polypeptide, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage or non-native Amino acid modifications that occur.
  • a polypeptide may be derived from a natural biological source or produced by recombinant techniques, but it need not be translated from a given nucleic acid sequence, and it may be produced by any means including chemical synthesis.
  • Amino acid refers to an organic compound containing both an amino group and a carboxyl group, such as an alpha-amino acid, which can be encoded by a nucleic acid directly or in a precursor form.
  • a single amino acid is encoded by a nucleic acid consisting of three nucleotides, so-called codons or base triplets. Each amino acid is encoded by at least one codon. The same amino acid is encoded by different codons called “degeneracy of the genetic code”.
  • Amino acids include natural amino acids and unnatural amino acids.
  • Natural amino acids include alanine (three-letter code: ala, one-letter code: A), arginine (arg, R), asparagine (asn, N), aspartic acid (asp, D), cysteine Amino acid (cys, C), glutamine (gln, Q), glutamic acid (glu, E), glycine (gly, G), histidine (his, H), isoleucine (ile, I) ), leucine (leu, L), lysine (lys, K), methionine (met, M), phenylalanine (phe, F), proline (pro, P), serine (ser, S), threonine (thr, T), tryptophan (trp, W), tyrosine (tyr, Y) and valine (val, V).
  • alanine three-letter code: ala, one-letter code: A
  • arginine arg, R
  • asparagine asparag
  • Constant amino acid substitution refers to the replacement of one amino acid residue by another amino acid residue containing a side chain (R group) of similar chemical properties (eg, charge or hydrophobicity). In general, conservative amino acid substitutions will not substantially alter the functional properties of the protein.
  • amino acid classes containing chemically similar side chains include: 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic hydroxyl side chains: serine and threonine 3) Amide-containing side chains: asparagine and glutamine; 4) Aromatic side chains: phenylalanine, tyrosine and tryptophan; 5) Basic side chains: lysine, Arginine and histidine; 6) Acidic side chains: aspartic acid and glutamic acid.
  • the number of amino acids for "conservative amino acid substitutions of VL and VH" can be about 1, about 2, about 3, about 4, about 5, about 6, about 8, about 9, about 10, About 11, about 13, about 14, about 15 conservative amino acid substitutions, or a range (including endpoints) between any two of these values, or any value therein.
  • the number of amino acids for a "conservative amino acid substitution of a heavy or light chain” can be about 1, about 2, about 3, about 4, about 5, about 6, about 8, about 9, about 10 about 11, about 13, about 14, about 15, about 18, about 19, about 22, about 24, about 25, about 29, about 31, about 35, About 38, about 41, about 45 conservative amino acid substitutions, or a range (including endpoints) between any two of these values, or any value therein.
  • encoding when applied to a polynucleotide refers to a polynucleotide referred to as “encoding” a polypeptide, transcribed and/or in its native state or when manipulated by methods well known to those skilled in the art Or translation can yield the polypeptide and/or fragments thereof.
  • Antibodies, antigen-binding fragments or derivatives disclosed herein include, but are not limited to, polyclonal, monoclonal, multispecific, fully human, humanized, primatized, chimeric antibodies, single chain antibodies, epitope binding Fragments (eg, Fab-like, Fab'-like, and F(ab') 2 ), single-chain-like Fvs (scFv).
  • recombinant refers to a polypeptide or polynucleotide and means a form of the polypeptide or polynucleotide that does not occur in nature, non-limiting examples may be combined to produce polynucleotides that do not normally exist or peptide.
  • Homology refers to the sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing the positions within each sequence that can be aligned. A molecule is homologous when a position in the sequences being compared is occupied by the same base or amino acid. The degree of homology between sequences is a function of the number of matches or homologous positions shared by the sequences.
  • At least 80% identity is about 80% identity, about 81% identity, about 82% identity, about 83% identity, about 85% identity, about 86% identity, about 87% identity, about 88% identity, about 90% identity, about 91% identity, about 92% identity, about 94% identity, about 95% identity, about 98% identity, about 99% identity, or these A range (including endpoints) between any two values in a numerical value or any value therein.
  • a polynucleotide or polynucleotide sequence has a certain percentage (eg, 90%, 95%, 98% or 99%) "identity" or “sequence identity” to another sequence "Sex” means that when the sequences are aligned, the percentage of bases (or amino acids) in the two sequences being compared are identical.
  • the percent alignment or sequence identity can be determined using visual inspection or software programs known in the art, such as those described by Ausubel et al. eds. (2007) in Current Protocols in Molecular Biology. The default parameters are preferably used for alignment.
  • Biologically equivalent polynucleotides are polynucleotides that have the above-specified percentages of identity and encode polypeptides having the same or similar biological activity.
  • Antibody refers to a polypeptide or polypeptide complex that specifically recognizes and binds an antigen.
  • Antibodies can be whole antibodies and any antigen-binding fragments thereof or single chains thereof.
  • the term “antibody” thus includes any protein or peptide in the molecule that contains at least a portion of an immunoglobulin molecule that has the biological activity of binding to an antigen.
  • Antibodies and antigen-binding fragments include, but are not limited to, the complementarity determining regions (CDRs), heavy chain variable regions (VH), light chain variable regions (VL), heavy chain constant regions of heavy or light chains or ligand binding portions thereof (CH), a light chain constant region (CL), a framework region (FR), or any portion thereof, or at least a portion of a binding protein.
  • the CDR regions include the CDR regions of the light chain (LCDR1-3) and the CDR regions of the heavy chain (HCDR1-3).
  • antibody includes a wide variety of biochemically distinguishable polypeptides. Those of skill in the art will appreciate that classes of heavy chains include gamma, mu, alpha, delta, or epsilon (gamma, mu, alpha, delta, epsilon), with some subclasses (eg, gamma1-gamma4). The nature of this chain determines the "class” of the antibody as IgG, IgM, IgA, IgG or IgE, respectively. Immunoglobulin subclasses (isotypes), eg, IgGl, IgG2, IgG3, IgG4, IgG5, etc., are well characterized and the functional specificities conferred are known. All immunoglobulin species are within the scope of the present disclosure. In some embodiments, the immunoglobulin molecule is of the IgG class.
  • Light chains can be classified as kappa ( ⁇ ) or lambda ( ⁇ ). Each heavy chain can bind to a kappa or lambda light chain.
  • ⁇ kappa
  • ⁇ lambda
  • Each heavy chain can bind to a kappa or lambda light chain.
  • immunoglobulins are produced by hybridomas, B cells or genetically engineered host cells, their light and heavy chains are joined by covalent bonds, and the "tail" portion of the two heavy chains is joined by a covalent disulfide bond or non-covalent bond.
  • the amino acid sequence extends from the N-terminus of the forked terminus in the Y configuration to the C-terminus at the bottom of each chain.
  • the variable region of immunoglobulin kappa light chain is V ⁇ ; the variable region of immunoglobulin lambda light chain is V ⁇ .
  • Both light and heavy chains are divided into regions of structural and functional homology.
  • the terms "constant” and “variable” are used according to function.
  • the light chain variable region (VL) and heavy chain variable region (VH) determine antigen recognition and specificity.
  • the light chain constant region (CL) and heavy chain constant region (CH) confer important biological properties such as secretion, transplacental movement, Fc receptor binding, complement fixation, and the like. By convention, the numbering of constant regions increases as they become further from the antigen binding site or amino terminus of the antibody.
  • the N-terminal portion is the variable region and the C-terminal portion is the constant region; the CH3 and CL domains actually comprise the carboxy-terminus of the heavy and light chains, respectively.
  • CDR complementarity determining region
  • CDRs as defined by Kabat and Chothia include overlaps or subsets of amino acid residues when compared to each other. Nonetheless, it is within the scope of the invention to apply either definition to refer to the CDRs of an antibody or variant thereof.
  • the exact residue numbers encompassing a particular CDR will vary depending on the sequence and size of the CDR. Those skilled in the art can usually determine which specific residues the CDRs contain based on the amino acid sequence of the variable region of the antibody.
  • Kabat et al. also define a numbering system applicable to variable region sequences of any antibody.
  • One of ordinary skill in the art can apply this "Kabat numbering" system to any variable region sequence independent of experimental data other than the sequence itself.
  • Kabat Numbering means the numbering system proposed by Kabat et al., U.S. Dept. of Health and Human Services in "Sequence of Proteins of Immunological Interest” (1983).
  • Antibodies may also use the EU or Chothia numbering system.
  • antibody drug conjugate refers to an antibody or antigen-binding fragment thereof chemically linked to one or more chemical agents, which may optionally be therapeutic or cytotoxic agents.
  • the ADC includes an antibody, cytotoxic or therapeutic drug, and a linker that enables the drug to be attached or conjugated to the antibody.
  • ADCs typically have 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 number of drugs conjugated to the antibody.
  • Drugs that can be included in ADCs are, but are not limited to: mitotic inhibitors, antitumor antibiotics, immunomodulators, vectors for gene therapy, alkylating agents, antiangiogenic agents, antimetabolites, boron-containing agents, chemoprotective agents, Hormones, antihormones, corticosteroids, photoactive therapeutics, oligonucleotides, radionuclide agents, topoisomerase inhibitors, tyrosine kinase inhibitors and radiosensitizers.
  • the drug included in the ADC can be a maytansinoid drug.
  • the drug included in the ADC can be a compound of Formula I as described herein, or a pharmaceutically acceptable salt thereof.
  • the antibody in the ADC, is conjugated to the drug through self-cysteine or sulfylated amino acids, such as sulfylated lysine, to form a disulfide bond.
  • Treatment means therapeutic treatment and prophylactic or prophylactic measures, the purpose of which is to prevent, slow, ameliorate and stop adverse physiological changes or disorders, such as the progression of disease, including but not limited to the following whether detectable or undetectable As a result, alleviation of symptoms, reduction of disease severity, stabilization of disease state (ie, no worsening), delay or slowdown of disease progression, improvement or alleviation of disease state, alleviation or disappearance (whether in part or in whole), prolongation and Expected duration of survival when not receiving treatment, etc.
  • a patient in need of treatment includes a patient already suffering from a condition or disorder, a patient susceptible to a condition or disorder, or a patient in need of prevention of such a condition or disorder, may or may be expected from administration of the antibodies or compositions disclosed herein for detection, Patients who benefit from the diagnostic process and/or treatment.
  • Patient refers to any mammal in need of diagnosis, prognosis, or treatment, including humans, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and the like. In some embodiments, the patient is a human.
  • Effective amount refers to the amount of active compound or agent that elicits a biological or medical response in a tissue, system, animal, individual, or human; an effective amount is sought by a researcher, veterinarian, physician, or other clinician.
  • the phrase "in need” means that a patient has been identified as in need of a particular method or treatment. In some embodiments, identification can be made by any diagnostic means. In any of the methods and treatments described herein, the patient may need.
  • Combination drugs include two or more drugs, which can each form an independent administration unit or together form a combined administration unit.
  • the combination drug comprises a separate anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent.
  • the combination drug comprises a combination of an anti-TIGIT antibody or antigen-binding fragment and another therapeutic agent.
  • the different drugs may be administered simultaneously or separately when administering a combination of drugs.
  • Antibody-encoding DNA can be designed and synthesized according to the antibody amino acid sequences described herein by conventional methods, inserted into an expression vector, and then transfected into host cells, and the transfected host cells are cultured in culture to produce monoclonal antibodies.
  • an antibody expression vector includes at least one promoter element, an antibody coding sequence, a transcription termination signal, and a polyA tail.
  • Other elements include enhancers, Kozak sequences, and donor and acceptor sites for RNA splicing flanking the inserted sequence.
  • Efficient transcription can be obtained by the early and late promoters of SV40, long terminal repeats from retroviruses such as RSV, HTLV1, HIVI, and the early promoter of cytomegalovirus, and other cellular promoters such as muscle can be used.
  • Suitable expression vectors may include pIRES1neo, pRetro-Off, pRetro-On, PLXSN, or pLNCX, pcDNA3.1(+/-), pcDNA/Zeo(+/-), pcDNA3.1/Hygro(+/-), PSVL, PMSG, pRSVcat, pSV2dhfr, pBC12MI and pCS2 etc.
  • Commonly used mammalian cells include HEK293 cells, Cos1 cells, Cos7 cells, CV1 cells, mouse L cells and CHO cells.
  • IC50 means the 50% inhibitory concentration, that is, the concentration of drug or inhibitor required to inhibit half the indicated biological process.
  • the DNA sequences of the heavy and light chains were constructed according to the amino acid sequences of the heavy and light chains of the antibody, the 5' ends of the DNA sequences were modified with PCR primers, and the kozak sequence and the signal peptide DNA were added to the 5' ends of the light and heavy chain DNA sequences sequence.
  • the constructed sequence was then cloned into the existing expression vector, and the correct construction of the recombinant plasmid was verified by sequencing analysis.
  • the above recombinant plasmid was transfected into expression cells for expression, and the supernatant was collected and purified to obtain antibody protein samples, which were used in the following various examples.
  • the expression vector used is pCDNA3.1 TM (+) (Invitrogen company, the product number is V79020), and the expression cells are CHO cells; 2) in the preparation process of the antibody h10D8OFKF, the expression vector used It is pCDNA3.1 TM (+), the expression cells are CHO cells with ⁇ -(1,6)-fucosyltransferase gene knockout, and the fucosylation level is about 0 after testing; 3) Anti-CTLA- 4 In the process of antibody preparation, the expression vector used was pCDNA3.1 TM (+), and the expression cells were ⁇ -(1,6)-fucosyltransferase gene knockout CHO cells, which were tested for fucosylation The level is about 0; 4) During the preparation of the anti-PD-1 antibody, the expression vector used was pCDNA3.1 TM (+), and the expression cells were CHO cells; 5) During the preparation of the reference antibody Tiragolum
  • amino acid sequences of the above antibodies are shown in Tables 1-4; wherein, the amino acid sequences of the antibodies h10D8OF and h10D8OFKF are the same.
  • the DNA sequences of the antibodies are shown in Table 5; wherein, the DNA sequences of the antibodies h10D8OF and h10D8OFKF are the same.
  • the DNA sequences added to the 5' ends of the light chain DNA sequences of antibody h10D8OF, antibody h10D8OFKF, anti-CTLA-4 antibody and anti-PD-1 antibody are all gccgccaccatgg actttcaggtgcagatcatctccttcctgctgatcagcgcctccgtgatcatgtccaggggc, as shown in SEQ ID NO: 35, and the kozak sequence is underlined , the signal peptide is shown in italics;
  • the DNA sequences added to the 5' ends of the heavy chain DNA sequences of antibody h10D8OF, antibody h10D8OFKF, anti-CTLA-4 antibody and anti-PD-1 antibody are all gccgccaccatgg gctggagcctgatcctgctgttcctggtggccgtggccaccagagtgctgtccc, as shown in SEQ
  • the DNA sequence added to the 5' end of the light chain DNA sequence of the reference antibody Tiragolumab is gccg ccaccatgg acatgagggtgctggcccagctgctgggactgctgctgctgtgcttcccaggcgccagatgc, as shown in SEQ ID NO: 37, the kozak sequence is underlined, and the signal peptide is shown in italics;
  • the DNA sequence added at the ' end is gccgccaccatgg agtttgggctgagctgggtttttccttgttgctatattaaaaggtgtccagt, as shown in SEQ ID NO: 38, the kozak sequence is underlined, and the signal peptide is shown in italics.
  • TIGIT-Jurkat cells The binding of free PVR-Fc to TIGIT on the surface of TIGIT-Jurkat cells was detected by flow cytometry.
  • the test steps are as follows: take TIGIT-Jurkat cells with good viability (cell viability greater than 90%), resuspend them with PBS to a density of 10 million/ml after centrifugation, and add 50 ⁇ l per well to a 96-well tip bottom plate, which is the number of cells per well.
  • PVR-Fc-bio biotinylated PVR-Fc
  • PBS phosphate buffered saline
  • PVR-Fc-bio dilution a final concentration of 12.5nM
  • Appropriate amount of anti-TIGIT antibody or reference antibody Tiragolumab was diluted with PVR-Fc-bio diluent.
  • the initial concentration of the antibody was 200nM, 2-fold gradient dilution, a total of 10 concentration gradients, and 3 duplicate wells were set for each concentration point; 2- Incubate at 8°C for 1 hour, then wash twice with PBS, add 1:1000 diluted fluorescent secondary antibody Streptavidin-PE (eBioscience, CAT#12-4317-87) dilution, 100 ⁇ l per well, 2-8°C Incubate for 30 min; then wash with PBS twice, and use a flow analyzer to detect the fluorescence intensity (Mean PE-A).
  • the preparation method of PVR-Fc-bio is as follows: the nucleic acid sequence of the extracellular region of human PVR is added with enzyme cleavage sites (HindIII and EcoRI), and is fused with the nucleic acid sequence of the constant region of the human IgG1 heavy chain through a linker; It was inserted into the pCDNA3.1(+) vector, and then transiently transfected into HEK293F cells; the cultured cell supernatant was purified by ProteinA affinity chromatography, and the purified fusion protein was named PVR-Fc; take an appropriate amount of PVR-Fc protein, Biotin labeling kit from Thermo scientific company ( HSulfo-NHS-LC-BiotinylationKit, product number: 21435), biotinylated PVR-Fc according to the operation steps in the manual, and the labeled protein was named PVR-Fc-bio.
  • amino sequence of the extracellular region of human PVR is shown in SEQ ID NO: 13
  • the gene sequence of the linker is shown in SEQ ID NO: 14
  • the amino acid sequence of the linker is shown in SEQ ID NO: 39
  • the human IgG1 heavy The amino acid sequence of the chain constant region is shown in SEQ ID NO: 15, and the amino acid sequence of PVR-Fc is shown in SEQ ID NO: 40 (see Table 6).
  • the preparation method of TIGIT-Jurkat cells is as follows: replace the target gene on pCMV2-CFD-Flag (Yiqiao Shenzhou, item number: HG10160-MF) with the human full-length TIGIT gene to obtain a recombinant plasmid, and use the restriction endonuclease ClaI (Bsu15I) to The recombinant plasmid was linearized and transfected into Jurkat cell line (ATCC, Clone E6-1, TIB-152 TM ) by electroporation.
  • the screening pressure is hygromycin, and the positive cell line is obtained and then subcloned to obtain a cell line that can stably express human TIGIT, namely: TIGIT-Jurkat cells.
  • TIGIT-Jurkat cells a cell line that can stably express human TIGIT, namely: TIGIT-Jurkat cells.
  • sequence of the human full-length TIGIT gene is shown in SEQ ID NO: 16 (see Table 6).
  • both the antibody h10D8OF and the antibody Tiragolumab can effectively block the binding of TIGIT to PVR-Fc, and their IC 50 values are 0.4409nM and 2.820nM respectively; the blocking ability of the antibody h10D8OF is better than that of the antibody Tiragolumab.
  • both the antibody h10D8OFKF and the antibody Tiragolumab can effectively block the binding of TIGIT to PVR-Fc, and their IC 50 values are 0.742nM and 2.820nM respectively; the blocking ability of the antibody h10D8OFKF is better than that of the antibody Tiragolumab.
  • mice BALB/c-hPD1/hTIGIT (Jiangsu JiCui Yaokang Biotechnology Co., Ltd.) were subcutaneously inoculated with CT26 colon cancer tumor cells; after inoculation with tumor cells, when the average tumor volume of the mice was 79.65 mm3 , the Group, 10 in each group.
  • the day of grouping was defined as D0 day, and was administered by intraperitoneal injection (IP) on D0 day, D4 day, D7 day, D11 day, D14 day, and D18 day, and the dose was 10 mg/kg or 30 mg/kg.
  • IP intraperitoneal injection
  • TGItw inhibition rate of tumor weight
  • TGItw (1-(mean TW administration group )/(mean TW control group )) ⁇ 100%;
  • Mean TW administration group mean tumor weight of mice in administration group at the end point treatment,
  • Mean TW control group control The mean value of tumor weight at the end point treatment of mice in the group.
  • Both antibody h10D8OF and antibody Tiragolumab can inhibit the growth of CT26 colon cancer, and the effect of antibody h10D8OF in inhibiting tumor growth is better than that of antibody Tiragolumab; at the dose of 30 mg/kg, the relative tumor inhibition rate TGitw (%) at the end of the trial (D20 day) h10D8OF was 92.89% and Tiragolumab was 71.07%.
  • Both antibody h10D8OFKF and antibody Tiragolumab can inhibit the growth of CT26 colon cancer, and the effect of antibody h10D8OFKF in inhibiting tumor growth is better than that of antibody Tiragolumab.
  • Example 4 Co-administration of antibody h10D8OFKF and anti-PD-1 antibody inhibits the proliferation of cancer cells
  • Mouse colon cancer cells were recovered, cells in logarithmic growth phase were collected, the culture medium was removed, and the cells were washed twice with PBS and then inoculated with an inoculation volume of 5 ⁇ 10 6 /100 ⁇ L per mouse.
  • the inoculation site was the right hind limb of the mouse.
  • mice When the tumor volume reached 89.19 mm 3 , 40 mice were randomly divided into 4 groups according to the tumor volume, with 10 mice in each group.
  • the day of grouping is defined as D0 day, and administration starts on D0 day; the grouping administration schedule is shown in Table 8, and the administration dates are: D0 day, D4 day, D7 day, D11 day, D14 day, D18 day, D21 day (G3 day)
  • the group was administered on D22, and the G4 group was administered on both D21 and D22) and D25.
  • mice Following cell inoculation, tumor effects on the animals' normal behavior were routinely monitored weekly. Specific indicators include mouse activity, food and water intake, weight gain or loss, eyes, coat and other abnormalities.
  • mice The experimental results such as tumor volume, mouse body weight, and tumor weight of mice in each group are expressed as mean ⁇ standard error (mean ⁇ SEM).
  • the independent sample T test was used to compare whether there were significant differences between the different administration groups and the control group. Data were analyzed using SPSS. P ⁇ 0.05 means there is a significant difference.
  • TGItv inhibition rate relative to tumor volume
  • RTVn Vnt / Vn0 ; Vnt : tumor volume of mouse number n on day t, Vn0 : tumor volume of mouse number n on day 0, RTVn: mouse number n Relative tumor volume in mice on day t
  • TGItv (1-(mean RTV administration group )/(mean RTV control group )) ⁇ 100%; mean RTV administration group : average RTV of administration group, mean RTV control group : average RTV of control group.
  • single-drug antibody h10D8OFKF and single-drug anti-PD-1 antibody can inhibit tumor growth, and the combined administration group of antibody h10D8OFKF and anti-PD-1 antibody has significant anti-tumor efficacy, and The anti-tumor effect was better than the anti-tumor effect of single-drug antibody h10D8OFKF and anti-PD-1 antibody (no tumor completely regressed in G1 and G2 groups, 2 mice in G3 group had complete tumor regression, and 1 mouse in G4 group had a small tumor.
  • the tumor inhibition rate (TGItv) of the G4 group was significantly improved, and the combination of the antibody h10D8OFKF and the anti-PD-1 antibody had a synergistic anti-tumor effect.
  • TGItv tumor inhibition rate
  • This study is a multicenter, open-label study to evaluate the safety, tolerability, pharmacokinetics, and preliminary clinical efficacy of antibody h10D8OFKF injection alone or in combination with tislelizumab in patients with advanced malignant solid tumors. Phase I clinical study.
  • Part I Single-agent dose escalation studies. The safety, tolerability and pharmacokinetics of the antibody h10D8OFKF were explored using accelerated titration and a "3+3" dose escalation rule.
  • a total of 8 dose groups were set, including 1mg (initial dose) group, 3mg group, 10mg group, 30mg group, 100mg group, 300mg group, 600mg group and 900mg group.
  • the whole is divided into two stages.
  • the first stage 1mg group, 3mg group and 10mg group adopt the accelerated titration method for dose escalation.
  • the second stage 30mg group, 100mg group, 300mg group, 600mg group and 900mg group will conduct a dose escalation study according to the standard "3+3" rule.
  • Antibody h10D8OFKF dosing regimen intravenous infusion, the recommended infusion time is ⁇ 60 minutes, and the study drug is tentatively scheduled to be administered once every 3 weeks (Q3W). If the patient has an infusion-related reaction and can continue treatment, the investigator may consider the use of diphenhydramine or acetaminophen for prophylaxis based on past experience and clinical reality. If no infusion-related reaction is observed, the subsequent infusion time can be adjusted by the investigator to 30 minutes to 2 hours to complete the infusion according to the actual clinical situation.
  • Tislelizumab dosing regimen The antibody h10D8OFKF is administered intravenously 30 minutes after the completion of the infusion. The recommended infusion time is 30-60 minutes, and it is administered once every 3 weeks (Q3W). For the detailed dosing schedule, refer to the instructions for Tislelizumab injection.
  • DLT dose-limiting toxicity
  • Grade 3 endocrine toxicity can be effectively controlled by hormone replacement therapy
  • MTD was defined as the highest dose level of DLT explored in ⁇ 1/6 subjects in a dose cohort observed during the DLT evaluation period.
  • DLT dose-limiting toxicity
  • Safety evaluation indicators vital signs and physical examination, laboratory tests (blood routine, blood biochemistry, thyroid function, coagulation routine, urine routine, stool routine, pregnancy test), ECOG score, electrocardiogram, adverse events (including immune-related adverse events) )Wait.
  • Subjects in all dose groups were required to collect blood samples at prescribed time points during the treatment period (first 6 treatment cycles) and monitor plasma concentrations (C trough ) within 2 hours prior to dosing.
  • a 3.5 mL blood sample is planned to be taken at each time point to detect the concentration level of the serum drug and study the pharmacokinetic (PK) characteristics.
  • PK parameters were calculated from actual doses administered, actual sampling times, and non-compartmental models:
  • the receptor occupancy study of antibody h10D8OFKF injection was achieved by detecting TIGIT receptor binding on the surface of T cells in peripheral blood.
  • Pharmacodynamic receptor occupancy studies were conducted only in dose-escalation subjects who had blood samples collected at specific time points during treatment. A 2 mL blood sample was planned to be collected at each time point, and intensive sampling was performed before administration, at the end of administration, 168h, 336h, and 504h in cycles 1 and 3, and before administration in cycles 2, 4, 5, and 6.
  • ORR Objective response rate
  • DOR duration of response
  • DCR disease control rate
  • PFS progression-free survival
  • OS overall survival

Abstract

La présente invention concerne une association médicamenteuse, comprenant un anticorps anti-TIGIT ou un fragment de liaison à l'antigène et un autre agent thérapeutique. La présente invention concerne en outre l'utilisation de l'anticorps anti-TIGIT ou du fragment de liaison à l'antigène et d'un autre agent thérapeutique dans la préparation de l'association médicamenteuse pour le traitement de tumeurs ou de cancers.
PCT/CN2022/078682 2021-03-02 2022-03-01 Application d'anticorps anti-tigit dans une combinaison de médicaments WO2022184067A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CNPCT/CN2021/078725 2021-03-02
CN2021078725 2021-03-02

Publications (1)

Publication Number Publication Date
WO2022184067A1 true WO2022184067A1 (fr) 2022-09-09

Family

ID=83023436

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/078682 WO2022184067A1 (fr) 2021-03-02 2022-03-01 Application d'anticorps anti-tigit dans une combinaison de médicaments

Country Status (2)

Country Link
CN (1) CN114984227A (fr)
WO (1) WO2022184067A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024046389A1 (fr) * 2022-08-31 2024-03-07 百奥泰生物制药股份有限公司 Utilisation combinée d'un anticorps anti-tigit et d'un anticorps anti-ctla-4 dans le traitement d'une tumeur

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107148430A (zh) * 2014-08-19 2017-09-08 默沙东公司 抗tigit抗体
CN109734806A (zh) * 2019-03-15 2019-05-10 安徽安科生物工程（集团）股份有限公司 一种全人源抗huTIGIT单克隆抗体及其应用
CN112154155A (zh) * 2018-02-28 2020-12-29 株式会社柳韩洋行 抗tigit抗体及其用途
US20200407445A1 (en) * 2017-07-27 2020-12-31 Iteos Therapeutics Sa Anti-tigit antibodies
CN112274637A (zh) * 2016-08-17 2021-01-29 康姆普根有限公司 抗tigit抗体、抗pvrig抗体及其组合

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107148430A (zh) * 2014-08-19 2017-09-08 默沙东公司 抗tigit抗体
CN112274637A (zh) * 2016-08-17 2021-01-29 康姆普根有限公司 抗tigit抗体、抗pvrig抗体及其组合
US20200407445A1 (en) * 2017-07-27 2020-12-31 Iteos Therapeutics Sa Anti-tigit antibodies
CN112154155A (zh) * 2018-02-28 2020-12-29 株式会社柳韩洋行 抗tigit抗体及其用途
CN109734806A (zh) * 2019-03-15 2019-05-10 安徽安科生物工程（集团）股份有限公司 一种全人源抗huTIGIT单克隆抗体及其应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN 23 July 2016 (2016-07-23), ANONYMOUS : "immunoglobulin heavy chain variable region 68-5N, partial [Mus musculus]", XP055962986, retrieved from NCBI Database accession no. AAK71606 *
HARJUNPÄÄ, H. ET AL.: "TIGIT as an emerging immune checkpoint.", CLINICAL AND EXPERIMENTAL IMMUNOLOGY., vol. 200, no. 2, 25 December 2019 (2019-12-25), XP071089726, DOI: 10.1111/cei.13407 *

Also Published As

Publication number Publication date
CN114984227A (zh) 2022-09-02

Similar Documents

Publication Publication Date Title
US20240018257A1 (en) Antibodies specific to human poliovirus receptor (pvr)
RU2733315C2 (ru) Комбинированная терапия для лечения злокачественной опухоли
KR20160077155A (ko) 인간 암을 치료하기 위한 특이적 항-ｃｄ38 항체
KR20220164787A (ko) 암 및 감염의 치료를 위한 NKp46에 대한 항체 및 이의 작제물
US20200095330A1 (en) System and method for the development of cd30 bispecific antibodies for immunotherapy of cd30+ malignancies
WO2022184067A1 (fr) Application d'anticorps anti-tigit dans une combinaison de médicaments
IL293118A (en) Methods for treating cancer by anti-oxo40 antibody in combination with anti-tigit antibody
JP7036471B2 (ja) デスレセプター４及びデスレセプター５に結合する非常に強力な抗体
WO2021129775A1 (fr) Anticorps monoclonal anti-ctla-4, son procédé de préparation et son application
WO2023001118A1 (fr) Application d'anticorps anti-ox40 dans un médicament combiné
WO2022073515A1 (fr) Utilisation d'anticorps anti-pd-1 dans une médication combinée
WO2022184068A9 (fr) Application d'anticorps anti-tigit dans le traitement de tumeurs ou de cancers
WO2022105839A1 (fr) Utilisation d'anticorps anti-ox40 pour le traitement de tumeurs ou de cancers
WO2022242757A1 (fr) Application d'anticorps anti-pd-1
CN114641500B (zh) 使用抗ox40抗体与抗tim3抗体的组合治疗癌症的方法
WO2021098749A1 (fr) Méthodes de traitement du cancer associant un anticorps anti-ox40 et la radiothérapie
CN116262790A (zh) 嵌合的抗cd27抗体组合物及其应用
CN116262135A (zh) 抗cd27抗体组合物及其用途
WO2023242351A1 (fr) Polythérapie d'anticorps bispécifiques dirigés contre ceacam5 et cd47 et anticorps bispécifiques dirigés contre ceacam5 et cd3
WO2022172267A1 (fr) Anticorps dirigés contre cd112r et leurs utilisations
CN116262788A (zh) 抗cd27抗体分子
CN117255804A (zh) 针对人4-1bb的抗体及其变体
CN116262789A (zh) 嵌合的抗cd27抗体

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22762531

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22762531

Country of ref document: EP

Kind code of ref document: A1