WO2022176859A1 - Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1 - Google Patents

Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1 Download PDF

Info

Publication number
WO2022176859A1
WO2022176859A1 PCT/JP2022/005993 JP2022005993W WO2022176859A1 WO 2022176859 A1 WO2022176859 A1 WO 2022176859A1 JP 2022005993 W JP2022005993 W JP 2022005993W WO 2022176859 A1 WO2022176859 A1 WO 2022176859A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
polynucleotide
vector
guide rna
base sequence
Prior art date
Application number
PCT/JP2022/005993
Other languages
English (en)
Inventor
Tetsuya Yamagata
Yuanbo QIN
Original Assignee
Modalis Therapeutics Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Modalis Therapeutics Corporation filed Critical Modalis Therapeutics Corporation
Publication of WO2022176859A1 publication Critical patent/WO2022176859A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to a method for treating muscular dystrophy, particularly Merosin-Deficient Congenital Muscular Dystrophy (MDC1A), by targeting a Laminin- ⁇ 1 chain (LAMA1) gene and the like. More particularly, the present invention relates to a method for treating or preventing muscular dystrophy, the method including complementing LAMA2 or its function deleted by mutation by upregulating the expression of human LAMA1 gene, which is not inherently expressed in muscle tissues, by the use of guide RNA targeting a specific sequence of human LAMA1 gene, and a fusion protein of a transcription activator and a CRISPR effector protein, and an agent for treating or preventing muscular dystrophy and the like.
  • MDC1A Merosin-Deficient Congenital Muscular Dystrophy
  • LAMA1A Laminin- ⁇ 1 chain
  • Muscular dystrophy is a generic term for a hereditary disease with progressive muscular atrophy and loss of muscle strength. At present, there is no effective fundamental therapeutic drug for muscular dystrophy, and only symptomatic treatment is given. As one type of muscular dystrophy, the autosomal recessive disease Merosin-Deficient Congenital Muscular Dystrophy (MDC1A) is known.
  • MDC1A Merosin-Deficient Congenital Muscular Dystrophy
  • MDC1A is a congenital muscular dystrophy of the western type lacking mental retardation, and is caused by a deficiency of merosin in the skeletal muscle basement membrane component.
  • Merosin is a heterotrimer composed of laminin chains and is bound to ⁇ -dystroglycan via a sugar chain structure. When it is deleted, the connection between the cytoskeleton and the extracellular matrix via the dystrophin glycoprotein complex is broken. It is the most frequent congenital muscular dystrophy in Europe and the United States (about 50%). It is caused by a mutation in the laminin ⁇ 2 chain gene (LAMA2 gene) at 6q22.33.
  • LAMA2 gene laminin ⁇ 2 chain gene
  • LAMA1 gene could be a disease modifying gene for MDC1A.
  • LAMA1 gene encodes a laminin ⁇ 1 chain protein that is structurally similar to laminin ⁇ 2 chain.
  • experiments using mice have shown the possibility that the CRISPR/Cas9 system of S. aureus may be used to upregulate expression of LAMA1 and compensate for the lack of laminin ⁇ 2 chain (NPL 2, NPL 3).
  • NPL 1 Kemaladewi, D. U., Maino, E., Hyatt, E., Hou, H., Ding, M., Place, K. M., Zhu, X., Bassi, P., Baghestani, Z., Deshwar, A. G., Merico, D., Xiong, H. Y., Frey, B. J., Wilson, M. D., Ivakine, E. A., Cohn, R. D. Nat Medicine. 23:8. 2017.
  • Prabhpreet Singh Bassi A thesis submitted in conformity with the requirements for the degree of Master of Science, Department of Molecular Genetics, University of Toronto.
  • the present invention aims to provide a novel therapeutic approach to human muscular dystrophy (particularly MDC1A).
  • the present inventors have conducted intensive studies of the above-mentioned problem and found that the expression of human LAMA1 gene can be upregulated with myocytes by using guide RNA targeting a specific sequence of human LAMA1 gene (Gene ID: 284217), and a fusion protein of a transcription activator and a CRISPR effector protein lacking nuclease activity.
  • the present inventors have completed the present invention based on these findings.
  • the present invention may include the following invention.
  • a polynucleotide comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene.
  • the polynucleotide of the above-mentioned [1], wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, or said base sequence in which 1 to 3 nucleotides are deleted, substituted, inserted, and/or added.
  • the polynucleotide of the above-mentioned [1], wherein the base sequence encoding the guide RNA comprises (i) the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 or (ii) said base sequence in which one nucleotide or 2 to 5 continuous nucleotides are deleted from the 5’-terminal thereof.
  • the polynucleotide of the above-mentioned [1], wherein the base sequence encoding the guide RNA comprises (i) the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 or (ii) said base sequence in which one nucleotide or 2 to 5 continuous nucleotides corresponding to the upstream target sequence are added to the 5’-terminal thereof.
  • [3] The polynucleotide of the above-mentioned [1] or [2], wherein the transcription activator is selected from the group consisting of VP64, VP160, VPH, VPR, VP64-miniRTA (miniVR), and microVR, a variant thereof having transcription activation ability.
  • [5] The polynucleotide of any of the above-mentioned [1] to [4], wherein the nuclease-deficient CRISPR effector protein is dCas9.
  • a vector comprising a polynucleotide of any of the above-mentioned [1] to [12].
  • the vector of the above-mentioned [13], wherein the vector is a plasmid vector or a viral vector.
  • the vector of the above-mentioned [14], wherein the viral vector is selected from the group consisting of adeno-associated virus (AAV) vector, adenovirus vector, and lentivirus vector.
  • AAV adeno-associated virus
  • AAV8 AAV9
  • An agent for treating or preventing MDC1A comprising a polynucleotide of any of the above-mentioned [1] to [12] or a vector of any of the above-mentioned [13] to [16].
  • a method for treating or preventing MDC1A comprising administering a polynucleotide of any of the above-mentioned [1] to [12] or a vector of any of the above-mentioned [13] to [16] to a subject in need thereof.
  • a method for upregulating expression of human LAMA1 gene in a cell comprising expressing (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene, in the aforementioned cell.
  • a ribonucleoprotein comprising the following: (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene.
  • a kit comprising the following for upregulation of the expression of the human LAMA1 gene: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
  • a method for treating or preventing MDC1A comprising administering the following (e) and (f) to a subject in need thereof: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
  • the expression of human LAMA1 gene can be upregulated, as a result of which the present invention is expected to be able to treat MDC1A.
  • FIG. 1 shows the location of the targeted genomic region in the human LAMA1 gene.
  • FIG. 2 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary skeletal muscle myoblasts (HSMM cells) derived from donor #3 by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NOs: 1 to 53 and mini-VR (Batch 1).
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence
  • the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • FIG. 3 Fig.
  • FIG. 3 shows the evaluation results of an expression enhancing effect on human LAMA1 gene in primary HSMM cells derived from donor #3 by using sgRNA containing crRNA encoded by the targeting sequences shown in SEQ ID NOs: 54 to 100 and mini-VR (Batch 2).
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • Fig. 4 Fig.
  • FIG. 4 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary HSMM cells derived from donor #3 by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NOs: 101-164 and 173-175 and mini-VR (Batch 3).
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence
  • the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • Fig. 5 Fig.
  • FIG. 5 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary HSMM cells derived from donor #3 by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NOs: 165-172 and 176-245 and mini-VR (Batch 4).
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence
  • the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • Fig. 6 Fig.
  • FIG. 6 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary HSMM cells (derived from donor #3) by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 and mini-VR.
  • the horizontal axis shows sgRNA containing crRNA encoded by each targeting sequence
  • the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • Fig. 7 Fig.
  • FIG. 7 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary HSMM cells (derived from donor #617) by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 and mini-VR.
  • the horizontal axis shows each condition, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • Fig. 8 Fig.
  • FIG. 8 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary HSMM cells (derived from donor #121) by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 and mini-VR.
  • the horizontal axis shows each condition, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown. [Fig. 9] Fig.
  • FIG. 9 shows the evaluation results of an expression enhancing action on human LAMA1 gene in primary HSMM cells (derived from donor #368) by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 and mini-VR.
  • the horizontal axis shows each condition, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown. [Fig. 10] Fig.
  • FIG. 10 shows the evaluation results of an expression enhancing action on human LAMA1 gene in Cynomolgus Monkey skeletal muscle cells by using sgRNA containing crRNA encoded by the targeting sequence shown in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 and mini-VR.
  • the horizontal axis shows each condition, and the vertical axis shows the ratio of the expression level of LAMA1 gene when using each sgRNA to that when using control sgRNA as 1. Experiments were repeated three times and the average and SD were shown.
  • polynucleotide comprising the following base sequences (hereinafter sometimes to be also referred to as “the polynucleotide of the present invention”): (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (b) a base sequence encoding a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene.
  • the polynucleotide of the present invention is introduced into a desired cell and transcribed to produce a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and a guide RNA targeting a particular region of the putative promoter region of the human LAMA1 gene.
  • These fusion protein and guide RNA form a complex (hereinafter the complex is sometimes referred to as “ribonucleoprotein; RNP”) and cooperatively act on the aforementioned particular region, thus activating transcription of the human LAMA1 gene.
  • the putative promoter region of human Laminin- ⁇ 1 chain (LAMA1) gene means any region in which the expression of human LAMA1 gene can be activated by binding RNP to that region.
  • the putative promoter region when the putative promoter region is shown by the particular sequence, the putative promoter region includes both the sense strand sequence and the antisense strand sequence conceptually.
  • a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator is recruited by a guide RNA into a particular region in the putative promoter region of the human LAMA1 gene.
  • the “guide RNA targeting ...” means a “guide RNA recruiting a fusion protein into ...”.
  • the “guide RNA (to be also referred to as ‘gRNA’)” is an RNA comprising a genome specific CRISPR-RNA (to be referred to as “crRNA”).
  • crRNA is an RNA that binds to a complementary sequence of a targeting sequence (described later).
  • the “guide RNA” refers to an RNA comprising an RNA consisting of crRNA and a specific sequence attached to its 5’-terminal (for example, an RNA sequence set forth in SEQ ID NO: 247 in the case of FnCpf 1).
  • the “guide RNA” refers to chimera RNA (to be referred to as “single guide RNA(sgRNA)”) comprising crRNA and trans-activating crRNA attached to its 3’-terminal (to be referred to as “tracrRNA”) (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
  • a sequence complementary to the sequence to which crRNA is bound in the putative promoter region of the human LAMA1 gene is referred to as a “targeting sequence”. That is, in the present specification, the “targeting sequence” is a DNA sequence present in the putative promoter region of the human LAMA1 gene and adjacent to PAM (protospacer adjacent motif). PAM is adjacent to the 5’-side of the targeting sequence when Cpf1 is used as the CRISPR effector protein. PAM is adjacent to the 3’-side of the targeting sequence when Cas9 is used as the CRISPR effector protein.
  • the targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the putative promoter region of the human LAMA1 gene (see, for example, the aforementioned Zhang F. et al., Hum Mol Genet. 2014 Sep 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
  • CRISPR effector protein using a nuclease-deficient CRISPR effector protein, a transcriptional activator fused thereto is recruited to the putative promoter region of the human LAMA1 gene.
  • the nuclease-deficient CRISPR effector protein (hereinafter to be simply referred to as “CRISPR effector protein”) to be used in the present invention is not particularly limited as long as it forms a complex with gRNA and is recruited to the putative promoter region of the human LAMA1 gene.
  • nuclease-deficient Cas9 (hereinafter sometimes to be also referred to as “dCas9”) or nuclease-deficient Cpf1 (hereinafter sometimes to be also referred to as “dCpf1”) can be included.
  • dCas9 nuclease-deficient Cas9
  • dCpf1 nuclease-deficient Cpf1
  • dCas9 examples include, but are not limited to, a nuclease-deficient variant of Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence: NGG (N is A, G, T or C. Hereinafter the same)), Streptococcus thermophilus-derived Cas9 (StCas9; PAM sequence: NNAGAAW (W is A or T.
  • Neisseria meningitidis-derived Cas9 Neisseria meningitidis-derived Cas9 (NmCas9; PAM sequence: NNNNGATT), or Staphylococcus aureus-derived Cas9 (SaCas9; PAM sequence: NNGRRT (R is A or G. hereinafter the same)
  • NmCas9 Neisseria meningitidis-derived Cas9
  • SaCas9 Staphylococcus aureus-derived Cas9
  • NNGRRT R is A or G. hereinafter the same
  • dSaCas9 a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO:248), or a double mutant in which the 10th Asp residue is converted to Ala residue and the 557th His residue is converted to Ala residue (SEQ ID NO: 249) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9”) can be used (see, for example, the aforementioned Friedland AE et al., Genome Biol. 2015, which is incorporated herein by reference in its entirety).
  • dCas9 a variant obtained by modifying a part of the amino acid of the aforementioned dCas9, which forms a complex with gRNA and is recruited to the putative promoter region of the human LAMA1 gene, may also be used.
  • examples of such variant include a truncated variant with a partly deleted amino acid sequence or a variant obtained by modification (deletion, addition and/or substitution) of a part of the amino acid of the aforementioned dCas9.
  • dCas9 variants disclosed in WO2019049913A1, WO2019235627A1, and WO2020085441A1, which are incorporated herein by reference in there entireties, can be used.
  • dSaCas9 obtained by deleting the 721st to 745th amino acids from dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue (SEQ ID NO: 250), or dSaCas9 in which the deleted part is substituted by a peptide linker (e.g., one in which the deleted part is substituted by GGSGGS linker (SEQ ID NO: 251) is set forth in SEQ ID NO: 252), or dSaCas9 obtained by deleting the 482nd - 648th amino acids of dSaCas9 that is the aforementioned double mutant (SEQ ID NO: 253)
  • dSaCas9 obtained by amino acid substitution (E782K_L800R_T927K_K929N_N968R_N985A_R991A_A1021S_I1017F) of dSaCas9 that is a double mutant in which the 10th Asp residue is converted to Ala residue and the 580th Asn residue is converted to Ala residue.
  • the alphabet displayed on the left side of the number indicating the number of amino acid residues up to the substitution site indicates a single letter code of the amino acid before substitution of the amino acid sequence of SaCas9
  • the alphabet displayed on the right side indicates a single letter code of the amino acid after substitution.
  • dCpf1 examples include, but are not limited to, a nuclease-deficient variant of Francisella novicida-derived Cpf1 (FnCpf1; PAM sequence: NTT), Acidaminococcus sp.-derived Cpf1 (AsCpf1; PAM sequence: NTTT), or Lachnospiraceae bacterium-derived Cpf1 (LbCpf1; PAM sequence: NTTT) and the like (see, for example, Zetsche B. et al., Cell. 2015 Oct 22; 163(3):759-71, Yamano T et al., Cell.
  • FnCpf1 Francisella novicida-derived Cpf1
  • AsCpf1 Acidaminococcus sp.-derived Cpf1
  • LbCpf1 Lachnospiraceae bacterium-derived Cpf1
  • dCpf1 a variant obtained by modifying a part of the amino acid of the aforementioned dCpf1, which forms a complex with gRNA and is recruited to the putative promoter region of the human LAMA1 gene, may also be used.
  • dCas9 is used as the CRISPR effector protein and, in a particular embodiment, dSaCas9 is used.
  • a polynucleotide comprising a base sequence encoding a CRISPR effector protein can be cloned by, for example, synthesizing an oligoDNA primer covering a region encoding a desired part of the protein based on the cDNA sequence information thereof, and amplifying the polynucleotide by PCR method using total RNA or mRNA fraction prepared from the cells producing the protein as a template.
  • a polynucleotide comprising a base sequence encoding a CRISPR effector protein can be obtained by introducing a mutation into a nucleotide sequence encoding a cloned CRISPR effector protein by a known site-directed mutagenesis method to convert the amino acid residues (e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpf1, and the like can be included, but are not limited to these) at a site important for DNA cleavage activity to other amino acids.
  • amino acid residues e.g., 10th Asp residue, 557th His residue, and 580th Asn residue in the case of SaCas9; 917th Asp residue and 1006th Glu residue in the case of FnCpf1, and the like can be included, but are not limited to these
  • a polynucleotide comprising a base sequence encoding CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method, based on the cDNA sequence information thereof, and can also be further constructed as a base sequence that underwent codon optimization to give codons suitable for expression in human.
  • transcription activator means a protein having ability to activate gene transcription of human LAMA1 gene or a peptide fragment retaining the function thereof.
  • the transcription activator to be used in the present invention is not particularly limited as long as it can activate expression of human LAMA1 gene.
  • it includes VP64, VP160, VPH, VPR, miniVR, and microVR, a variant thereof having transcription activation ability and the like.
  • VP64 is exemplified by a peptide consisting of 50 amino acids set forth in SEQ ID NO: 255.
  • VP160 is exemplified by a peptide consisting of 131 amino acids set forth in SEQ ID NO: 256.
  • VPH is a fusion protein of VP64, p65 and HSF1, specifically, exemplified by a peptide consisting of 376 amino acids set forth in SEQ ID NO: 257.
  • VPR is a fusion protein of VP64, p65, and a replication and transcription activator of Epstein-Barr virus (RTA), specifically, exemplified by a peptide consisting of 523 amino acids set forth in SEQ ID NO: 258.
  • RTA Epstein-Barr virus
  • MiniVR and microVR are peptides comprising VP64 and a transcription activation domain of RTA.
  • the transcription activation domain of RTA is known and disclosed in, for example, J Virol. 1992 Sep;66(9):5500-8, which is incorporated herein by reference in its entirety and the like.
  • miniVR is exemplified by a peptide consisting of 167 amino acids set forth in SEQ ID NO: 259
  • microVR is exemplified by a peptide consisting of 140 amino acids set forth in SEQ ID NO: 260.
  • the amino acid sequence set forth in SEQ ID NO: 259 is composed of an amino acid sequence in which the 493rd - 605th amino acid residues of RTA and VP64 are linked with a G-S-G-S linker (SEQ ID NO: 261).
  • the amino acid sequence set forth in SEQ ID NO: 260 is composed of an amino acid sequence in which the 520th - 605th amino acid residues of RTA and VP64 are linked with a G-S-G-S linker.
  • miniVR and microVR is described in WO2020/032057A1, which is incorporated herein by reference in its entirety. Any of the aforementioned transcriptional activators may be subjected to any modification and/or alteration as long as it maintains its transcription activation ability.
  • a polynucleotide comprising a base sequence encoding a transcription activator can be constructed by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method. Furthermore, a polynucleotide comprising a base sequence encoding a transcription activator can also be constructed as a codon-optimized DNA sequence to be codons suitable for expression in human.
  • a polynucleotide comprising a base sequence encoding a fusion protein of a transcription activator and a CRISPR effector protein can be prepared by ligating a base sequence encoding a CRISPR effector protein to a base sequence encoding a transcription activator directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal) and/or a tag.
  • the transcription activator may be fused with either N-terminal or C-terminal.
  • linker a linker with an amino acid number of about 2 to 50 can be used, and specific examples thereof include, but are not limited to, a G-S-G-S linker in which glycine (G) and serine (S) are alternately linked and the like.
  • a fusion protein of CRISPR effector protein and transcription activator can be recruited to the putative promoter region of the human LAMA1 gene by guide RNA.
  • guide RNA comprises crRNA, and the crRNA binds to a complementary sequence of the targeting sequence.
  • crRNA may not be completely complementary to the complementary sequence of the targeting sequence as long as the guide RNA can recruit the fusion protein to the target region, and may be a sequence in which at least 1 to 3 nucleotides are deleted, substituted, inserted and/or added.
  • one nucleotide or several continuous nucleotides may be deleted from the 5’-terminal of the gRNA.
  • one nucleotide or several continuous nucleotides complementary to the complementary sequence of the targeting sequence e.g., 2, 3, 4, or 5 nucleotides
  • the deletion or addition has little effect on the activity of the gRNA.
  • the targeting sequence can be determined using a published gRNA design web site (CRISPR Design Tool, CRISPR direct etc.).
  • CRISPR Design Tool CRISPR direct etc.
  • candidate targeting sequences of about 20 nucleotides in length for which PAM (e.g., NNGRRT in the case of SaCas9) is adjacent to the 3’-side thereof are listed, and one having a small number of off-target sites in human genome from among these candidate targeting sequences can be used as the targeting sequence.
  • the base length of the targeting sequence is 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length.
  • bioinformatic tools such as Benchling (https://benchling.com), and COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (Available on https://crispr.bme.gatech.edu on the internet). Using these, the similarity to the base sequence targeted by gRNA can be summarized.
  • the off-target site can be searched for by subjecting the target genome to Blast search with respect to 8 to 12 nucleotides on the 3’-side of the candidate targeting sequence (seed sequence with high discrimination ability of targeted nucleotide sequence).
  • the targeting sequence can be 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in at least one region of the following region existing in the GRCh38.p13 position of human chromosome 18 (Chr 18): 7,115,000-7,118,000.
  • the targeting sequence can be the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236.
  • SEQ ID NO: 32 ATGCTTGAATGAATGAGATGG
  • crRNA transcribed from the sequence is AUGCUUGAAUGAAUGAGAUGG (SEQ ID NO: 262) and is bound to CCATCTCATTCATTCAAGCAT(SEQ ID NO: 263), which is a sequence complementary to the base sequence set forth in SEQ ID NO: 32 and is present in the putative promoter region of the human LAMA1 gene.
  • a base sequence which is a targeting sequence in which at least 1 to 3 nucleotides are deleted, substituted, inserted and/or added can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region. Therefore, in one embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, or such sequence in which 1 to 3 nucleotides are deleted, substituted, inserted and/or added can be used.
  • a base sequence encoding gRNA can be designed as a DNA sequence encoding crRNA with particular RNA attached to the 5’-terminal.
  • RNA attached to the 5’-terminal of crRNA and a DNA sequence encoding said RNA can be appropriately selected by those of ordinary skill in the art according to the dCpf1 to be used.
  • a base sequence in which SEQ ID NO: 264; AATT TCTAC TGTT GTAGA T is attached to the 5’-side of the targeting sequence can be used as a base sequence encoding gRNA (when transcribed to RNA, the sequences of the underlined parts form a base pairs to form a stem-loop structure).
  • the sequence to be added to the 5’-terminal may be a sequence generally used for various Cpf1 proteins in which at least 1 to 6 nucleotides are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the putative promoter region after transcription.
  • a base sequence encoding gRNA can be designed as a DNA sequence in which a DNA sequence encoding known tracrRNA is linked to the 3’-terminal of a DNA sequence encoding crRNA.
  • tracrRNA and a DNA sequence encoding the tracrRNA can be appropriately selected by those of ordinary skill in the art according to the dCas9 to be used.
  • the base sequence set forth in SEQ ID NO: 265 is used as the DNA sequence encoding tracrRNA.
  • the DNA sequence encoding tracrRNA may be a base sequence encoding tracrRNA generally used for various Cas9 proteins in which at least 1 to 6 nucleotides are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the putative promoter region after transcription.
  • the base sequence of gRNA comprises a DNA sequence encoding crRNA set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236 and a DNA sequence encoding tracrRNA, or such base sequence in which 1 to 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides are deleted, substituted, inserted and/or added can be used.
  • the deleted, substituted, inserted and/or added nucleotides may or may not be continuous.
  • the deletion or addition of continuous nucleotides is found at the 5’-terminal of the base sequence.
  • the base sequence encoding the gRNA comprises the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, or said base sequence in which 1 to 3 nucleotides are deleted, substituted, inserted and/or added.
  • the base sequence encoding the gRNA comprises the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, or said base sequence in which one nucleotide or 2 to 5 continuous nucleotides are deleted from the 5’-terminal of the base sequence.
  • the base sequence encoding the gRNA comprises the base sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, or said base sequence in which one nucleotide or 2 to 5 continuous nucleotides corresponding to the target sequence are added to the 5’-terminal of the base sequence.
  • a polynucleotide comprising a base sequence encoding gRNA designed in this way can be chemically synthesized using a known DNA synthesis method.
  • the polynucleotide of the present invention may comprise two or more kinds of gRNA with different crRNA.
  • a promoter sequence may be operably linked to the upstream of each of a base sequence encoding fusion protein of CRISPR effector protein and transcription activator and/or a base sequence encoding gRNA.
  • the promoter to be possibly linked is not particularly limited as long as it shows a promoter activity in the target cell.
  • Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding the fusion protein include, but are not limited to, EFS promoter, CMV (cytomegalovirus) promoter, CK8 promoter, MHC promoter, MYOD promoter, hTERT promoter, SR ⁇ promoter, SV40 promoter, LTR promoter, CAG promoter, RSV (Rous sarcoma virus) promoter and the like.
  • Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding gRNA include, but are not limited to, U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, H1 promoter, and tRNA promoter, which are pol III promoters, and the like.
  • a muscle specific promoter can be used as the promoter sequence linked to the upstream of a base sequence encoding the aforementioned fusion protein.
  • muscle specific promoter examples include, but are not limited to, CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac muscle troponin C promoter, ⁇ actin promoter, myosin heavy chain kinase (MHCK) promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase promoter, dMCK promoter, tMCK promoter, enh348 MCK promoter, synthetic C5-12(Syn) promoter, unc45b promoter, Myf5 promoter, MLC1/3f promoter, MYOD promoter, Myog promoter, Pax7 promoter and the like (for the detail of the muscle specific promoter, see, for example, US2011/0212529A, McCarthy JJ et al., Skeletal Muscle. 2012 May; 2(1):8, Wang B. et al., Gene Ther. 2008 Nov; 15(22):1489-99,
  • the polynucleotide of the present invention may further comprise known sequences such as Polyadenylation signal, Kozak consensus sequence and the like besides those mentioned above for the purpose of improving the translation efficiency of mRNA produced by transcription of a base sequence encoding a fusion protein of CRISPR effector protein and transcription activator.
  • the polynucleotide of the present invention may comprise a base sequence encoding a linker sequence, a base sequence encoding NLS and/or a base sequence encoding a tag.
  • the present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as “the vector of the present invention”).
  • the vector of the present invention may be a plasmid vector or a viral vector.
  • the plasmid vector to be used is not particularly limited and may be any plasmid vector such as cloning plasmid vector and expression plasmid vector.
  • the plasmid vector is prepared by inserting the polynucleotide of the present invention into a plasmid vector by a known method.
  • the viral vector to be used is not particularly limited and examples thereof include, but are not limited to, adenovirus vector, adeno-associated virus (AAV) vector, lentivirus vector, retrovirus vector, Sendaivirus vector and the like.
  • AAV vector adeno-associated virus
  • lentivirus vector lentivirus vector
  • retrovirus vector Sendaivirus vector
  • Sendaivirus vector Sendaivirus vector
  • the “virus vector” or “viral vector” also includes derivatives thereof.
  • AAV vector is preferably used for the reasons such that it can express transgene for a long time, and it is derived from a non-pathogenic virus and has high safety.
  • a viral vector comprising the polynucleotide of the present invention can be prepared by a known method.
  • a plasmid vector for virus expression into which the polynucleotide of the present invention has been inserted is prepared, the vector is transfected into an appropriate host cell to allow for transient production of a viral vector comprising the polynucleotide of the present invention, and the viral vector is collected.
  • the serotype of the AAV vector is not particularly limited as long as expression of the human LAMA1 gene in the target can be activated, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and variant thereof, and the like may be used (for the various serotypes of AAV, see, for example, WO 2005/033321, which is incorporated herein by reference in its entirety).
  • the variants of AAV include, but are not limited to, new serotype with a modified capsid (e.g., WO 2012/057363, which is incorporated herein by reference in its entirety) and the like.
  • a vector plasmid comprising inverted terminal repeat (ITR) at both ends of wild-type AAV genomic sequence and the polynucleotide of the present invention inserted in place of the DNA encoding Rep protein and capsid protein is prepared.
  • ITR inverted terminal repeat
  • the DNA encoding Rep protein and capsid protein necessary for forming virus particles is inserted into other plasmid.
  • a plasmid comprising genes (E1A, E1B, E2A, VA and E4orf6) responsible for the helper action of adenovirus necessary for proliferation of AAV is prepared as an adenovirus helper plasmid.
  • AAV vector recombinant AAV
  • a cell capable of supplying a part of the gene products (proteins) of the genes responsible for the aforementioned helper action e.g., 293 cell etc.
  • the produced AAV vector is present in the nucleus.
  • a desired AAV vector is prepared by destroying the host cell with freeze-thawing, collecting the virus and then subjecting the virus fraction to separation and purification by density gradient ultracentrifugation method using cesium chloride, column method or the like.
  • AAV vector has great advantages in terms of safety, gene transduction efficiency and the like, and is used for gene therapy.
  • the size of polynucleotide that can be packaged is limited. For example, the entire length including the base length of a polynucleotide comprising a base sequence encoding a fusion protein of dSaCas9 and miniVR or microVR, a base sequence encoding gRNA targeting the putative promoter region of the human LAMA1 gene, and EFS promoter sequence and U6 promoter sequence as the promoter sequences, which is one embodiment of the present invention, and ITR parts is about 4.85 kb, and they can be packaged in a single AAV vector.
  • Treating or preventing agent for MDC1A also provides a treating or preventing agent for MDC1A comprising the polynucleotide of the present invention or the vector of the present invention (hereinafter sometimes referred to as “the agent of the present invention”).
  • the agent of the present invention comprises the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, generally, a pharmaceutically acceptable carrier.
  • the agent of the present invention is administered parenterally, and may be administered topically or systemically.
  • the agent of the present invention can be administered by, but are not limited to, for example, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, or intramuscular administration.
  • the dose of the agent of the present invention to a subject is not particularly limited as long as it is an effective amount for the treatment and/or prevention. It may be appropriately optimized according to the active ingredient, dosage form, age and body weight of the subject, administration schedule, administration method and the like.
  • the agent of the present invention can be not only administered to the subject affected with MDC1A but also prophylactically administered to subjects who may develop MDC1A in the future based on the genetic background analysis and the like.
  • treatment in the present specification also includes remission of disease, in addition to cure of diseases.
  • prevention may also include delaying onset of disease, in addition to prophylaxis of onset of disease.
  • the agent of the present invention can also be referred to as “the pharmaceutical composition of the present invention” or the like.
  • the present invention also provides a method for treating or preventing MDC1A, comprising administering the polynucleotide of the present invention or the vector of the present invention to a subject in need thereof (hereinafter sometimes referred to as “the method of the present invention”).
  • the present invention includes the polynucleotide of the present invention or the vector of the present invention for use in the treatment or prevention of MDC1A.
  • the present invention includes use of the polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical composition for the treatment or prevention of MDC1A.
  • the method of the present invention can be practiced by administering the aforementioned agent of the present invention to a subject affected with MDC1A, and the dose, administration route, subject and the like are the same as those mentioned above.
  • Measurement of the symptoms may be performed before the start of the treatment using the method of the present invention and at any timing after the treatment to determine the response of the subject to the treatment.
  • the method of the present invention can improve the functions of the skeletal muscle and/or cardiac muscle of the subject.
  • Muscles to be improved in the function thereof are not particularly limited, and any muscles and muscle groups are exemplified.
  • Ribonucleoprotein comprising the following (hereinafter sometimes referred to as “RNP of the present invention”): (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene.
  • RNP of the present invention a ribonucleoprotein comprising the following (hereinafter sometimes referred to as “RNP of the present invention”): (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, and (d) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene.
  • the CRISPR effector protein, transcription activator, and guide RNA comprised in the RNP of the present invention the CRISPR effector protein, transcription activator, and guide RNA explained in detail in the above-mentioned section of “1.
  • Polynucleotide can be used.
  • the fusion protein of CRISPR effector protein and transcription activator to be comprised in the RNP of the present invention can be produced by, for example, introducing a polynucleotide encoding the fusion protein into the cell, bacterium, or other organism to allow for expression, or an in vitro translation system by using the polynucleotide.
  • guide RNA comprised in the RNP of the present invention can be produced by, for example, chemical synthesis or an in vitro transcription system by using a polynucleotide encoding the guide RNA.
  • the thus-prepared CRISPR effector protein and guide RNA are mixed to prepare the RNP of the present invention.
  • other substances such as gold particles may be mixed.
  • the RNP may be encapsulated in a lipid nanoparticle (LNP) by a known method.
  • LNP lipid nanoparticle
  • the RNP of the present invention can be introduced into the target cell, tissue and the like by a known method.
  • Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, WO 2016/153012 which are incorporated herein by reference in their entireties, and the like can be referred to for encapsulation in LNP and introduction method.
  • the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 20 to 23 nucleotides in length, more preferably 21 to 23 nucleotides in length, in at least one region of the following region existing in the GRCh38.p13 position of human chromosome 18 (Chr 18): 7,115,000-7,118,000.
  • the guide RNA targets a region comprising all or a part of the sequence set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236.
  • one nucleotide or several continuous nucleotides e.g., 2, 3, 4, or 5 nucleotides
  • one nucleotide or several continuous nucleotides complementary to the complementary sequence of the targeting sequence e.g., 2, 3, 4, or 5 nucleotides
  • the present invention also provides a composition or kit comprising the following for activation of the expression of the human LAMA1 gene: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
  • the present invention also provides a method for treating or preventing MDC1A, comprising administering the following (e) and (f) to a subject in need thereof: (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcription activator, or a polynucleotide encoding the fusion protein, and (f) a guide RNA targeting a continuous region set forth in SEQ ID NO: 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 or 236, in the putative promoter region of human LAMA1 gene, or a polynucleotide encoding the guide RNA.
  • CRISPR effector protein transcription activator, guide RNA, as well as polynucleotides encoding them and vectors in which they are carried in these inventions, those explained in detail in the above-mentioned sections of “1. Polynucleotide”, “2. Vector” and “5. Ribonucleoprotein” can be used.
  • the dose, administration route, subject, formulation and the like of the above-mentioned (e) and (f) are the same as those explained in the section of “3. Treating or preventing agent for MDC1A”.
  • Targeting sequences were specified by the 21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNG (5’-21nt targeting sequence-NNG-3’) (Table 1-1 to Table 1-9).
  • PAM protospacer adjacent motif
  • Table 1 (Table 1-1 to Table 1-9) Targeting sequences used to screen putative promoter region of LAMA1 gene.
  • pLentiCRISPR v2 Construction of Lentiviral transfer plasmid (pED176-v51) pLentiCRISPR v2 was purchased from Genscript (https://www.genscript.com) and the following modifications were made: the SpCas9 gRNA scaffold sequence was replaced by SaCas9 gRNA scaffold sequence; SpCas9-FLAG was replaced with dSaCas9-PFv51 fused to codon optimized VP64-miniRTA (also referred to as mini-VR). VP64-miniRTA transcriptional activation domains can activate gene expression when localized to promoters by activating transcription.
  • VP64-miniRTA was tethered to the C-terminus of dSaCas9-PF v51 (D10A and N580A mutant), which is referred to as dSaCas9-PFv51-VR hereinafter, and targeted to human LAMA1 gene regulatory regions as directed by targeting sequences (Table 1).
  • the generated backbone plasmid was named pED176-v51.
  • gRNA cloning Control non-targeting targeting sequences and targeting sequences were cloned into pED176-v51.
  • Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format: Forward; 5’ CACC(G)-21 basepair targeting sequence - 3’, and Reverse: 5’ AAAC - 19-21 basepair reverse complement targeting sequence - (C) - 3’, where bases in parenthesis were added if the target did not begin with a G.
  • Oligos were resuspended in Tris-EDTA buffer (pH 8.0) at 100 ⁇ M. 1 ⁇ l of each complementary oligo were combined in a 10 ⁇ l reaction in NE Buffer 3.1 (New England Biolabs).
  • the reaction was heated to 95°C and allowed to cool to 25°C in a thermocycler, thus annealing oligos with sticky end overhangs compatible with cloning to pED176-v51.
  • Annealed oligos were combined with lentiviral transfer plasmid pED176-v51 which had been digested with BsmBI and gel purified, and ligated with T4 DNA ligase (NEB catalog number: M0202S) according to manufacturer’s protocol.
  • 2 ⁇ l of the ligation reaction was transformed into 10 ⁇ l of NEB Stable Competent cells (NEB catalog number: C3040I) according to the manufacturer’s protocol.
  • the resulting construct drives expression of sgRNAs comprising crRNA encoded by individual targeting sequences fused with tracrRNA (gttttagtactctggaaacagaatctactaaaacaaggcaaaatgccgtgtttatctcgtcaacttgttggcgagatttttt; SEQ ID NO:266) by a U6 promoter.
  • Lentivirus Generation HEK293TA cells were seeded at 0.75*10 ⁇ 6 cells/well in 6 well cell culture dishes (VWR catalog number: 10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids) and incubated at 37°C/5% CO 2 for 24 hours.
  • VWR catalog number: 10062-89293TA cells 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and non-essential amino acids) and incubated at 37°C/5% CO 2 for 24 hours.
  • HSMM Primary skeletal muscle myoblast cells
  • Lonza Inc Donor #3, #121, #368, #617).
  • the cells were cultured in primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (CC-3244 & CC-3246)] from Lonza.
  • primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (CC-3244 & CC-3246)] from Lonza.
  • VWR catalog number: 10062-894 12 well cell culture dishes
  • cynomolgus monkey skeletal muscle cells Primary cynomolgus monkey skeletal muscle cells were obtained from BioIVT LLC. The cells were cultured in primary skeletal muscle cell growth medium [SkGM-2 Skeletal Muscle Growth BulletKit medium (CC-3244 & CC-3246)] from Lonza. For transduction, cells were seeded at 12 well cell culture dishes (VWR catalog number: 10062-894) containing growth medium and incubated at 37°C/5% CO 2 for 24 hours.
  • cDNA was generated from ⁇ 0.5-0.8 ⁇ g of total RNA according to High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; ThermoFisher catalog number: 4368813) protocol in a 10 ⁇ l volume. cDNA was diluted 10-fold and analyzed using Taqman Fast Advanced Master Mix according to manufacturer’s protocol.
  • Taqman probes (human LAMA1: Assay Id Hs01074489_m1 FAM; human HPRT: Assay Id Hs99999909_m1 VIC_PL; cynomolgus monkey LAMA1: Assay Id Mf02858010_m1 FAM; cynomolgus monkey ARL1: Assay Id Mf02795431_m1 VIC) were obtained from Life Technologies.
  • Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol.
  • deltaCt values were calculated by subtracting the average Ct values from 3 technical replicates of the LAMA1 probe from the housekeeping gene probe (HPRT for human samples, and ARL1 for cynomolgus monkey samples) (Average Ct LAMA1 - Average Ct housekeeping gene). Expression values were determined for each sample using the formula 2 ⁇ -(deltaCt). Sample expression values were then normalized to the average of 3 control expression values for each experiment to determine the relative LAMA1 expression for each sample.
  • Lentivirus was produced that deliver expression cassettes for dSaCas9-PF v51-VR and sgRNAs for each targeting sequence to primary HSMM cells. Transduced cells were selected for resistance to puromycin, and LAMA1 expression was quantitated using the Taqman Assay. Expression values from each sample were normalized to an average of LAMA1 expression in cells transduced with control sgRNAs.
  • the expression of LAMA1 gene in muscle cell derived from a MDC1A patient can be upregulated.
  • the present invention is expected to be extremely useful for the treatment and/or prevention of MDC1A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention vise à fournir une nouvelle approche thérapeutique pour la dystrophie musculaire humaine (en particulier pour la MDC1A). La présente invention concerne un polynucléotide comprenant les séquences de bases suivantes : (a) une séquence de bases codant pour une protéine de fusion d'une protéine effectrice CRISPR déficiente en nucléase et un répresseur de transcription ; et (b) une séquence de bases codant pour un ARN guide ciblant une région continue représentée par les SEQ ID NO : 8, 10, 15, 20, 24, 31, 32, 48, 77, 87, 164 ou 236, dans la région promotrice putative du gène LAMA1 humain.
PCT/JP2022/005993 2021-02-16 2022-02-15 Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1 WO2022176859A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163149769P 2021-02-16 2021-02-16
US63/149,769 2021-02-16

Publications (1)

Publication Number Publication Date
WO2022176859A1 true WO2022176859A1 (fr) 2022-08-25

Family

ID=82931722

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2022/005993 WO2022176859A1 (fr) 2021-02-16 2022-02-15 Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1

Country Status (1)

Country Link
WO (1) WO2022176859A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021033635A1 (fr) * 2019-08-16 2021-02-25 Modalis Therapeutics Corporation Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021033635A1 (fr) * 2019-08-16 2021-02-25 Modalis Therapeutics Corporation Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ARNAUD PERRIN, ROUSSEAU JOëL, TREMBLAY JACQUES P.: "Increased Expression of Laminin Subunit Alpha 1 Chain by dCas9-VP160", MOLECULAR THERAPY-NUCLEIC ACIDS, CELL PRESS, US, vol. 6, 17 March 2017 (2017-03-17), US , pages 68 - 79, XP055742450, ISSN: 2162-2531, DOI: 10.1016/j.omtn.2016.11.004 *
KEMALADEWI DWI U., COHN RONALD D.: "Development of therapeutic genome engineering in laminin-α2-deficient congenital muscular dystrophy", EMERGING TOPICS IN LIFE SCIENCES, vol. 3, no. 1, 14 March 2019 (2019-03-14), pages 11 - 18, XP055809033, ISSN: 2397-8554, DOI: 10.1042/ETLS20180059 *
KEMALADEWI DWI U.; BASSI PRABHPREET S.; ERWOOD STEVEN; AL-BASHA DHEKRA; GAWLIK KINGA I.; LINDSAY KYLE; HYATT ELZBIETA; KEMBER REBE: "A mutation-independent approach for muscular dystrophy via upregulation of a modifier gene", NATURE, NATURE PUBLISHING GROUP UK, LONDON, vol. 572, no. 7767, 24 July 2019 (2019-07-24), London, pages 125 - 130, XP036848585, ISSN: 0028-0836, DOI: 10.1038/s41586-019-1430-x *

Similar Documents

Publication Publication Date Title
JP7069426B2 (ja) ユートロフィン遺伝子を標的とした筋ジストロフィーの治療方法
JP4063319B2 (ja) 組換えウイルスベクター系
US20220233721A1 (en) Method for treating muscular dystrophy by targeting dmpk gene
WO2021033635A1 (fr) Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1
WO2021230385A1 (fr) Procédé de traitement de la dystrophie musculaire par ciblage d'un gène utrophine
KR20240025507A (ko) 미성숙 종결 코돈-매개 장애를 치료하기 위한 방법 및 조성물
WO2022045366A1 (fr) Procédé de traitement de la dystrophie musculaire faceoscapulohumerale (dfmh) par le ciblage du gène dux4
WO2022176859A1 (fr) Méthode de traitement de la dystrophie musculaire par ciblage du gène lama1
WO2023190935A1 (fr) Procédé de traitement de myopathies par ciblage du gène titin
WO2022145495A1 (fr) Procédé de traitement d'ataxies spinocérébelleuses (sca) par ciblage du gène atxn7
WO2022009987A1 (fr) Méthode de traitement de la maladie d'alzheimer par ciblage du gène mapt
WO2022114243A1 (fr) Méthode de traitement de la dystrophie musculaire par ciblage du gène dmpk
WO2024137767A1 (fr) Compositions et procédés de modification de dux4
WO2023133525A1 (fr) Polynucléotides optimisés pour l'expression de protéines
WO2023147558A2 (fr) Méthodes crispr pour corriger des mutations du gène bag3 in vivo
CN117062912A (zh) 用于基于crispr的转录抑制的融合蛋白

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22756177

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22756177

Country of ref document: EP

Kind code of ref document: A1