WO2022166954A1 - Rna adeno-associated virus (raav) vector and uses thereof - Google Patents
Rna adeno-associated virus (raav) vector and uses thereof Download PDFInfo
- Publication number
- WO2022166954A1 WO2022166954A1 PCT/CN2022/075366 CN2022075366W WO2022166954A1 WO 2022166954 A1 WO2022166954 A1 WO 2022166954A1 CN 2022075366 W CN2022075366 W CN 2022075366W WO 2022166954 A1 WO2022166954 A1 WO 2022166954A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- rna
- aav
- transcribed
- dna virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14123—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
Definitions
- Adeno-associated virus is a small (about 20 nm in diameter) replication-defective, nonenveloped virus that infects human and other primate species. It belongs to the genus Dependoparvovirus within the family Parvoviridae. Wild type AAV can infect both dividing and non-dividing cells and may incorporate its genome into that of the host cell. Its life cycle is dependent on the presence of a helper virus, such as adenovirus (AdV) , hence its name and taxonomy classification.
- AdV adenovirus
- AAV is found in multiple vertebrate species, including human and non-human primates (NHPs) .
- the current consensus is that AAV does not cause any human diseases, and only causes a very mild immune response. It is composed of an icosahedral protein capsid of about 20 ⁇ 25 nm in diameter, and a single-stranded DNA (ssDNA) genome of about 4.7 kb that can either be the plus (sense) or minus (anti-sense) strand.
- the AAV capsid comprises three types of subunit, VP1, VP2 and VP3, totaling 60 copies in a ratio of 1: 1: 10 (VP1: VP2: VP3) .
- the genome is flanked by two T-shaped inverted terminal repeats (ITRs) at the ends that largely serve as the viral origins of replication and the packaging signal.
- the rep gene encodes four proteins required for viral replication.
- the Rep proteins are named after their molecular masses: Rep78, Rep68, Rep52 and Rep40.
- the cap gene encodes the translation from different start codons.
- a third gene which encodes assembly activating protein (AAP) , is encoded within the cap coding sequence in a different reading frame, and has been shown to promote virion assembly.
- AAP assembly activating protein
- AAV serotypes and numerous variants have been identified, they recognize distinct cell receptors, and thereby display different tissue-type and cell-type tropism profiles.
- the in vivo tissue tropisms of AAV1-13 have also been well studied in many animal models.
- the AAV ITR sequences comprise 145 nucleotides each.
- the ITR sequences can each form a hairpin for self-priming, which allows primase-independent synthesis of the second DNA strand.
- the ITRs were also shown to be required for both integration of the AAV DNA into the host cell genome (19th chromosome in humans) and rescue from it as well as for efficient encapsidation of the AAV DNA combined with generation of a fully assembled, DNase-resistant AAV particles.
- the AAV2 ITR serves as origin of replication and is composed of two arm palindromes (namely B-B’ and C-C’) embedded in a larger stem palindrome (A-A’) .
- the ITR can acquire two configurations (i.e., flip and flop) . See FIG. 1.
- the flip and flop configurations have the B-B’ and the C-C’ palindrome closest to the 3’ end, respectively.
- the 20-nucleotide D sequence or D region is present only once at each end of the AAV genome and thus remains single-stranded.
- the ITR also contains a ⁇ 22-bp sequence -Rep-binding element (RBE) -that binds the AAV Rep78 and Rep68 proteins in a specific orientation. If the ITR is in the palindromic (hairpinned) configuration, the Rep protein also contacts a 5-base sequence at the tip of one of the short palindromes (RBE’) , which activates the Rep DNA helicase and strand-specific endonuclease activities to help AAV replication and packaging (see FIG. 1) .
- RBE ⁇ 22-bp sequence -Rep-binding element
- the RBE comprises a tetranucleotide repeat (e.g., 4 repeats) with the consensus sequence of 5’-GNGC-3’.
- the ATP-dependent DNA helicase activities of Rep78 and Rep68 remodel the A-A’ region, generating a stem-loop that locates at the summit the terminal resolution site (trs or TRS) in a single-stranded form.
- trs or TRS terminal resolution site
- the strand-and site-specific endonuclease catalytic domain of Rep78 and Rep68 introduces a nick at the trs.
- the nucleotides at the apex of the T-shaped structure correspond to an additional RBE (RBE’) that stabilizes the association between the two largest Rep proteins and the ITR.
- the ITR of the incoming single-stranded genome snaps into a hairpin that provides a natural 3’-OH primer for the synthesis of the second strand.
- the large Rep proteins then bind RBE and RBE’ within the hairpin, and the activated endonuclease cleaves one strand at a specific site within a recognition sequence called the terminal resolution site (trs) .
- a molecule of Rep78 or Rep68 is covalently attached to the 5’-end phosphate via a tyrosine-phosphate linkage.
- the ITR is then reconfigured into a double hairpin to produce a 3’-OH primer that directs strand displacement synthesis down the length of the genome using the cellular complexes.
- This displaces a single strand, which is packaged, and reforms a duplex molecule that is covalently closed at one end, beginning a new cycle of nicking, repair, and strand displacement synthesis. Each time this cycle is repeated, a new single strand is generated for packaging. Because the two ends are identical, the process occurs equally well from both ends, generating both positive and negative strands for packaging.
- AAV is capable of transducing a wide range of species and tissues in vivo with no evidence of toxicity, and generates relatively mild innate and adaptive immune responses, it has been widely used in gene therapy.
- AAV vectors are composed of the same capsid sequence and structure as found in wild-type AAVs (wtAAVs) .
- AAV vectors encapsidate genomes that are devoid of all AAV protein-coding sequences and have transgene expression cassettes designed in their place.
- the only sequences of viral origin are the ITRs, which are needed to guide genome replication and packaging during vector production.
- the complete removal of viral coding sequences maximizes the packaging capacity of AAV vectors, and contributes to their low immunogenicity and cytotoxicity when delivered in vivo.
- AAV vectors optimally accommodate genomes that are under 4.7 kb, the payload must be carefully designed to consider not only the transgene sequence but also the inclusion of regulatory elements necessary for gene expression (for example, promoter, enhancer, intron and polyadenylation signal) .
- a popular AAV vector production method is triple transfection of HEK293T cells, which harbor constitutively expressed AdV E1a and E1b genes, with a packaging plasmid expressing rep and cap genes, a transgene plasmid to be packaged into AAV capsids, and a helper plasmid containing other AdV genes that serve helper function, such as the E2A, E4 and VA RNA genes that are essential for replication, message RNA (mRNA) processing and translation, respectively.
- the transgene expression cassette that is built with AAV2 ITRs can be packaged into any serotype capsids by merely exchanging the capsid-coding region in the packaging plasmid or helper virus.
- AAV vectors recognize and bind distinct cell receptors, and get into the cells by internalization. Intact AAV vector particles in endosomes undergo a series of pH-dependent structural changes necessary for transduction and traffic through the cytosol via the cytoskeletal network. After endosomal escape, AAV vector enters the nucleus through the nuclear pore complex, where it undergoes capsid uncoating to release the genome.
- the single-stranded AAV vectors genome that is released in the nucleus is not immediately ready for gene expression until it is converted to a double-stranded form -a requirement of transcription and a rate-limiting step for transduction.
- Second strand synthesis is initiated from the self-primed ITR at the 3′-end of the genome.
- double-stranded genomes can be achieved by strand annealing, whereby plus-stranded and minus-stranded genomes that are packaged into separate virions anneal by Watson–Crick base pairing once in the nucleus.
- the double-stranded genome then undergoes circularization via intra-molecular or inter-molecular genome recombination at the ITRs. This circularization and concatemerization process stabilizes the AAV vectors genome as episomal DNA, leading to gene expression that persists in post mitotic cells (FIG. 2) .
- CRISPR has brought new momentum to gene therapy.
- CRISPR is a powerful genome editing tool, and it has shown potential in curing genetic, acquired and infectious diseases.
- delivery of the cellular components for CRISPR is still a major hurdle for its clinical translation. So far, the most successful in vivo gene editing with CRISPR uses AAV as a delivery vector.
- RNA sequence of interest e.g., a RNA coding sequence for a gene of interest (GOI)
- a protein e.g., a therapeutic protein, an antigen protein, or a gene-editing protein such as a CRISPR/Cas effector enzyme ( “a Cas protein” for short) , a ZFN protein, a TALEN protein
- RNA sequence of interest RNA such as, a mRNA, or a non-coding, functional RNA (such as, a transfer RNA (tRNA) , a ribosomal RNA (rRNA) , a small interfering RNA (siRNA) , a short hairpin RNA (shRNA) , an antisense RNA, an antisense oligonucleotide, a micro RNA (mi)
- tRNA transfer RNA
- rRNA ribosomal RNA
- shRNA small interfering RNA
- shRNA short hairpin RNA
- the DNA virus viral particle is an AAV viral particle or an oncolytic viral particle.
- the RPS is located at or near the 5’ end of the RSI, at or near the 3’ end of the RSI, or internal to the RSI (e.g., inside an intron of an mRNA) .
- the RNA sequence comprises more than one (e.g., 1, 2, 3, or more) RPS that are identical or different.
- two or more (e.g., 3) of the more than one RPS are adjacent to each other, or are in tandem, via the same or different linkers.
- the RNA sequence comprises two or more RPS that are not adjacent to each other (e.g., one each located at or near one end of the RNA sequence of interest (RSI) ) .
- RPS RNA sequence of interest
- the RPS comprises a transcribed modified AAV inverted terminal repeat (ITR) , wherein the transcribed modified AAV ITR: (a) comprises a transcribed functional Rep-Binding Element (RBE) , optionally further comprising a transcribed functional RBE’; and, (b) lacks either a transcribed terminal resolution site (TRS) , or a transcribed reverse complement TRS (rcTRS) , or both; optionally, the transcribed modified AAV ITR further comprises a transcribed D region sequence (D sequence or D’ sequence) ; and/or optionally, the RPS-interacting molecule is Rep78, Rep68, Rep52, and/or Rep40.
- ITR transcribed modified AAV inverted terminal repeat
- the transcribed modified AAV ITR is within the 3’ end 1000 nucleotides, 800 nucleotides, 500 nucleotides, 300 nucleotides, or 200 nucleotides of the RNA; optionally, the transcribed modified AAV ITR is 5’ to a polyA sequence, a polyA signal sequence (e.g., AAUAAA) , or a sequence for RNA transcription termination (e.g., a histone downstream element) .
- a polyA sequence e.g., AAUAAA
- a sequence for RNA transcription termination e.g., a histone downstream element
- the transcribed modified AAV ITR is modified based on a transcribed wild-type flip or flop ITR; optionally, the wild-type flip or flop ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13 (optionally, the wild-type flop ITR has the nucleotide sequence of SEQ ID NO: 1) .
- the transcribed modified AAV ITR lacks both the transcribed TRS and the transcribed rcTRS.
- the transcribed modified AAV ITR comprises the transcribed D region sequence (optionally, the modified AAV ITR has the nucleotide sequence of SEQ ID NO: 3) .
- the transcribed modified AAV ITR lacks the transcribed D region sequence (optionally, the modified AAV ITR has the nucleotide sequence of SEQ ID NO: 2) .
- the RNA sequence further comprises a second transcribed modified AAV ITR having a second transcribed functional RBE sequence but lacking either a second transcribed TRS or a second transcribed rcTRS or both; optionally, the second transcribed modified AAV ITR further comprises a second transcribed D region sequence.
- the transcribed modified AAV ITR and the second transcribed modified AAV ITR are identical (or different) .
- the transcribed modified AAV ITR, and the second transcribed modified AAV ITR comprise a deletion from, a mutation in, or an insertion into a corresponding transcribed wild-type AAV ITR D region sequence or a corresponding transcribed wild-type TRS /rcTRS.
- the second transcribed modified AAV ITR is within 5’ end 1000 nucleotides, 800 nucleotides, 500 nucleotides, 250 nucleotides, or 150 nucleotides of the RNA sequence.
- the RPS comprises an MS2 sequence, an PP7 binding site, or a com binding site
- the RPS-interacting molecule comprises an RPS-interacting protein (RPSIP) capably of interacting, e.g., binding, directly or indirectly, to the RPS, such as a bacteriophage-derived MS2 coat protein (MCP) for an MS2 sequence, a PP7 bacteriophage coat protein (PCP) for an PP7 binding site, or a phage COM protein (COM) for a com binding site.
- MCP bacteriophage-derived MS2 coat protein
- PCP PP7 bacteriophage coat protein
- COM phage COM
- the RPSIP is associated directly or indirectly with (e.g., fused to) a protein component of the viral packaging system for the DNA virus viral particle (such as Rep78 and/or Rep68 of adeno-associated virus 2 (AAV2) , or assembly-activating protein (AAP) ) .
- a protein component of the viral packaging system for the DNA virus viral particle such as Rep78 and/or Rep68 of adeno-associated virus 2 (AAV2) , or assembly-activating protein (AAP)
- the RNA sequence comprises or preferably does not comprise a transcribed DNA packaging signal, for example, a transcribed wild-type AAV ITR sequence (e.g., the RNA sequence comprises a transcribed modified AAV ITR sequence having an addition, a deletion, and/or a substitution of a nucleotide of a corresponding transcribed wild-type AAV ITR sequence to reduce the DNA packaging capability of the DNA virus viral particle) .
- a transcribed wild-type AAV ITR sequence e.g., the RNA sequence comprises a transcribed modified AAV ITR sequence having an addition, a deletion, and/or a substitution of a nucleotide of a corresponding transcribed wild-type AAV ITR sequence to reduce the DNA packaging capability of the DNA virus viral particle.
- the RNA sequence further comprises: (1) a transcribed transcription enhancer; (2) a transcribed intron sequence or exon sequence (such as one for enhancing protein expression) ; (3) a 5’ UTR sequence; (4) a 3’ UTR sequence; (5) a polyA sequence, or a polyadenylation (polyA) signal sequence and optionally a GU-rich region downstream of the polyA signal sequence; (6) a posttranscriptional regulatory element or sequence, such as a transcribed Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) sequence; and/or, (7) a transcription termination sequence (such as a histone downstream element) , optionally, the RNA sequence comprises an RPS located 3’ to the posttranscriptional regulatory element or sequence, and 5’ to the polyA sequence or the polyA signal sequence.
- a transcription termination sequence such as a histone downstream element
- the RNA sequence comprises, in 5’ to 3’ orientation, the RSI, the optional transcribed WPRE sequence; the RPS (such as the transcribed modified AAV ITR, the MS2 sequence, the PP7 binding site, or the com binding site) ; and the polyA sequence or the polyA signal sequence.
- the GOI comprises a protein (e.g., a fluorescent protein, a therapeutic protein, an antigen protein, or a gene-editing protein such as a Cas protein, a ZFN protein, a TALEN protein) , an enzyme (such as a Cre protein, or a CRISPR/Cas effector enzyme, e.g., Cas9, Cas12, Cas13, or a variant thereof) , a structural protein, an mRNA, a non-coding RNA (ncRNA) , an siRNA, a piRNA, a short hairpin RNA or shRNA, a microRNA (miRNA) or a precursor thereof (including pre-miRNA and pri-miRNA) , a ribosomal RNA (rRNA) , an antisense sequence or oligonucleotide (ASO) , an RNA component of a CRISPR-Cas system, including a guide RNA (or a gRNA)
- the RNA sequence is a single-stranded RNA less than about 8,900 nucleotides in length, less than about 8,000 nucleotides in length, less than about 7,000 nucleotides in length, less than about 6,000 nucleotides in length, less than about 5,200 nucleotides in length, less than about 4,000 nucleotides in length, less than about 3,000 nucleotides in length, less than about 2,000 nucleotides in length, about 4,700-5,200 nucleotides in length, about 4,700-5,000 nucleotide in length, about 4,700-4,800 nucleotides in length, or about 4,700 nucleotides in length.
- polynucleotide comprising a cassette encoding the RNA sequence of the invention; optionally, the polynucleotide is a DNA sequence (e.g., a DNA plasmid) , optionally comprising a stuffer sequence in the backbone of the DNA plasmid, and/or optionally comprising no functional DNA packaging signal such as AAV ITR.
- a DNA sequence e.g., a DNA plasmid
- stuffer sequence in the backbone of the DNA plasmid optionally comprising no functional DNA packaging signal such as AAV ITR.
- the polynucleotide further comprises a promoter operably linked to and driving the transcription of the RNA sequence encoded by the cassette.
- the promoter is a ubiquitous promoter.
- the promoter is a tissue-specific promoter.
- the promoter is a constitutive promoter.
- the promoter is an inducible promoter.
- the polynucleotide further comprises an enhancer that enhances the transcription of the RNA sequence driven by the promoter.
- Another aspect of the invention provides a recombinant DNA virus viral particle comprising an RNA genome (such as the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention) packaged within the protein shell (such as capsid) of a DNA virus (such as an AAV virus, or an oncolytic virus) .
- an RNA genome such as the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention
- the protein shell such as capsid
- a DNA virus such as an AAV virus, or an oncolytic virus
- the DNA virus is AAV
- the recombinant DNA virus viral particle is a recombinant RNA adeno-associated virus (rRAAV) particle, comprising: (1) an AAV capsid; and, (2) the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention packaged within the AAV capsid.
- rRAAV RNA adeno-associated virus
- the AAV capsid comprises a capsid from an AAV of the serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP. eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.
- Another aspect of the invention provides a population of recombinant DNA virus viral particles (e.g., rRAAV particles) comprising a plurality of recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or more of the recombinant DNA virus viral particles (e.g., rRAAV particles) within the population have the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention packaged therein.
- recombinant DNA virus viral particles e.g., rRAAV particles
- Another aspect of the invention provides a host cell comprising the RNA sequence of the invention, the polynucleotide of the invention, the RNA sequence transcribed from the polynucleotide of the invention, the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, and/or the population of recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention.
- a host cell comprising the RNA sequence of the invention, the polynucleotide of the invention, the RNA sequence transcribed from the polynucleotide of the invention, the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, and/or the population of recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention.
- the host cell further comprises a viral packaging system that facilitates packaging of the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention into the DNA virus viral particle.
- the viral packaging system comprises: (1) an AAV rep gene (e.g., coding sequence for Rep78, Rep68, Rep52, and/or Rep40) and an AAV cap gene (e.g., coding sequence for VP1, VP2, VP3, AAP, and/or MAAP) , under the transcriptional control of one or more promoters that drive the transcription of the rep gene and cap gene, or the expression products thereof; (2) one or more coding sequences for one or more proteins required for AAV packaging, such as adenoviral E2A, E4, and VA genes, or the one or more proteins; and (3) the RPS-interacting molecule or a coding sequence thereof; optionally, the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the RNA sequence of the invention or on the polynucleotide of the invention,
- the host cell is a mammalian cell (such as HEK293 cells) or an insect cell (such as Sf9 or Sf21 cells) .
- Another aspect of the invention provides a method of generating the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention or the population of recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, the method comprising: a) culturing the host cell of the invention for a sufficient time, and b) harvesting the recombinant DNA virus viral particle or the population of recombinant DNA virus viral particles.
- the method further comprises isolating or purifying the recombinant DNA virus viral particle or the population of recombinant DNA virus viral particles.
- Another aspect of the invention provides a method of generating a recombinant DNA virus viral particle (e.g., rRAAV particle) or a population of recombinant DNA virus viral particles, the method comprising: a) contacting a viral packaging system (e.g., a AAV packaging system) with the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention for a period of time sufficient to produce the recombinant DNA virus viral particle or the population of recombinant DNA virus viral particles, and b) harvesting the recombinant DNA virus viral particle or the population of recombinant DNA virus viral particles; and, optionally, c) isolating or purifying the harvested recombinant DNA virus viral particle or population of recombinant DNA virus viral particles.
- a viral packaging system e.g., a AAV packaging system
- the viral packaging system (e.g., a AAV packaging system) comprises: (1) one or more proteins for assemblying the protein shell (e.g., VP1, VP2, and/or VP3 for assembling AAV capsid) of the DNA virus viral particle for packaging the RNA sequence, or one or more coding sequences thereof; (2) one or more proteins (e.g., Rep78, Rep68, Rep52, and/or Rep40 for AAV packaging) for facilitating the assemblying of the protein shell and/or the packaging of the RNA sequence into the protein shell of the DNA virus viral particle, or one or more coding sequences thereof (e.g., adenoviral E2a, E4, and VA genes) ; and (3) the RPS-interacting molecule or a coding sequence thereof; optionally, the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucle
- Another aspect of the invention provides a system of packaging the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention into a DNA virus viral particle, comprising: (1) one or more proteins for assemblying the protein shell (e.g., VP1, VP2, and/or VP3 for assembling AAV capsid) of the DNA virus viral particle for packaging the RNA sequence, or one or more coding sequences thereof; (2) one or more proteins (e.g., Rep78, Rep68, Rep52, and/or Rep40 for AAV packaging) for facilitating the assemblying of the protein shell and/or the packaging of the RNA sequence into the protein shell of the DNA virus viral particle, or one or more coding sequences thereof (e.g., adenoviral E2a, E4, and VA genes) ; and (3) the RPS-interacting molecule or a coding sequence thereof; optionally, the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example
- Another aspect of the invention provides a method of delivering a gene of interest (GOI) into a cell, a plant, or an animal, the method comprising contacting the cell, the plant, or the animal with the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, or the recombinant DNA virus viral particle (e.g., rRAAV particle) or the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) produced by the method of the invention, wherein the GOI is encoded by the RNA sequence of the invention.
- the recombinant DNA virus viral particle e.g., rRAAV particle
- Another aspect of the invention provides a method of delivering an RNA sequence of interest (RSI) into a cell, a plant, or an animal, the method comprising contacting the cell, the plant, or the animal with the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, or the recombinant DNA virus viral particle (e.g., rRAAV particle) or the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) produced by the method of the invention.
- the recombinant DNA virus viral particle e.g., rRAAV particle
- the population of the recombinant DNA virus viral particles e.g., rRAAV particles
- the recombinant DNA virus viral particle e.g., rRAAV particle
- the recombinant DNA virus viral particle e.g.,
- Another aspect of the invention provides a method of diagnosing, preventing, or treating a disease or disorder in a subject in need thereof, comprising administrating to the subject a therapeutically effective amount or dose of the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention or produced by the method of the invention.
- a therapeutically effective amount or dose of the population of the recombinant DNA virus viral particles e.g., rRAAV particles
- Another aspect of the invention provides a use of the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, or the recombinant DNA virus viral particle (e.g., rRAAV particle) or the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) produced by the method of the invention in the manufacture of a medicament for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof.
- the recombinant DNA virus viral particle e.g., rRAAV particle
- the population of the recombinant DNA virus viral particles e.g., rRAAV particles
- the recombinant DNA virus viral particle e.g., rRAAV particle
- the recombinant DNA virus viral particle e.g., rRAAV particle
- FIG. 1A shows the structure and sequence of the wild type ITR of AAV2, including the A: A’ stem region sequences, the B: B’ and C: C’ T region sequences, and the unpaired D region sequence, in both the flip and flop configuration of 3’ ITR.
- the RBE, RBE’ and the TRS are also shown.
- FIGs. 1B and 1C show multi-sequence alignments of 5’ (FIG. 1B) and 3’ (FIG. 1C) ITR sequences from AAV1-7.
- FIG. 2 shows the life cycle of an AAV vector /viral particle, and the subject RAAV vector /viral particle.
- FIG. 3 is a schematic diagram of transgene plasmids of RAAV-ITR vectors and control vectors, showing the relative position and orientation of the promoter (such as the CAG promoter or “C” ) , the GOI coding sequence (such as the coding sequence for the reporter gene tdTomato or “T” ) , the WPRE sequence (or “W” ) , the SV40 polyA signal sequence (or “S” ) , and the wild-type ITR, mutated /optimized ITR (dITR or dITR-D) .
- the promoter such as the CAG promoter or “C”
- the GOI coding sequence such as the coding sequence for the reporter gene tdTomato or “T”
- WPRE sequence or “W”
- S SV40 polyA signal sequence
- wild-type ITR mutated /optimized ITR
- FIG. 4 is a schematic diagram showing the generation of AAV vectors and RAAV-ITR vectors with the triple-plasmid system.
- three plasmids e.g., a transgene plasmid, a packaging plasmid, and a helper plasmid
- Green ITR indicates wild type ITR
- yellow ITR indicates optimized ITRs.
- pCAG-Transgene, pCAG-Transgene-ITR and pCAG-ITR-Transgene-ITR are transgene plasmids;
- pAAV-rep/cap is a packaging plasmid;
- pHelper is the helper plasmid.
- FIGs. 5A and 5B show representative viral vector titration process.
- FIG. 5A is a flowchart for RAAV titration.
- FIG. 5B shows primers and probes for Q-PCR.
- FIGs. 6A-6C show titration of RAAV-ITR vectors.
- FIG. 6A shows titration of CITWS group.
- FIG. 6B shows titration of CTWIS group.
- FIG. 6C shows titration of CITWIS group.
- FIGs. 7A and 7B show titration and infection of RAAV-dITR-D vectors.
- FIG. 7A shows titration of RAAV-dITR-D vectors.
- FIG. 7B shows in vitro infection of RAAV-dITR-D vectors. The same volume (5 ⁇ L) of purified RAAV-dITR-D vectors had been used to infect 2 ⁇ 10 5 HEK293T cells in vitro. Fluorescence photos were taken 3 and 5 days post infection.
- FIG. 8A is a schematic diagram (not to scale) showing the different plasmid constructs used to demonstrate efficient packaging of RNA into RAAV particles.
- FIG. 8B shows the results of specific DNA and RNA packaging of the AAV-tdTomato and RAAV-tdTomato constructs by detecting the WPRE sequence in the packaged DNA or RNA. Efficient RNA packaging occurred when both the heterologous RNA Packaging Signal (RPS) and its cognate RPS binding protein (RBP, e.g., MCP for MS2) are both present.
- RPS heterologous RNA Packaging Signal
- RPS RPS binding protein
- FIGs. 9A-9C show reduced DNA packaging using enlarged plasmid backbone.
- FIG. 9A is a schematic diagram (not to scale) of the various plasmids, including the plasmid with the longer backbone sequence due to the inserted stuffer region (L-CTWM3S) , used to generate the results in FIGs. 9B and 9C.
- FIG. 9B shows specific DNA packaging of AAV-tdTomato and RAAV-tdTomato by detecting the presence of CAG promoter sequence using CAG-specific primer pairs.
- FIG. 9C shows specific DNA and RNA packaging of AAV-tdTomato and RAAV-tdTomato by detecting the presence of WPRE sequence using WPRE-specific primer pairs. The results showed a surprising ⁇ 2-fold reduction of undesired DNA packaging by using enlarged /longer plasmid backbone sequence with stuffer sequences.
- FIGs. 10A and 10B show efficient packaging of the Cre transgene into RAAV using the MS2/MCP packaging system.
- FIG. 10A shows specific DNA packaging of AAV-Cre and RAAV-Cre by detecting the presence of CAG promoter sequence using CAG-specific primer pairs. Note that the CAG sequence is not present in the RAAV RNA sequence, and the detected RNA signal was background.
- FIG. 10B shows specific DNA and RNA packaging of AAV-Cre and RAAV-Cre by detecting the presence of WPRE sequence using WPRE-specific primer pairs.
- FIGs. 11A-11B show that RPS/RBP improved RNA packaging of conventional AAVs.
- FIG. 11A shows the results of AAV genome packaging in the presence of only DNA packaging signals (i.e., ITRs) .
- FIG. 11B shows the AAV genome packaging in presence of both DNA packaging signals (ITRs) and RNA packaging signals (MS2X3) .
- FIGs. 12A-12D show the results of optimizing the RAAV system and identification of the properties of optimized RAAVs.
- FIG. 12A represents the specific genome packaging of AAV-Cre and RAAV-Cre by detecting WPRE sequence.
- FIG. 12B represents the specific genome packaging of AAV-Cre and RAAV-Cre by detecting Cre sequence.
- FIG. 12C shows silver staining analysis of the composition of the AAV and RAAV particles.
- FIG. 12D shows the morphology analysis of the AAV and RAAV particles by TEM, scale bar 100 nm.
- FIGs. 13A and 13B show results of reducing DNA packaging of AAV and RAAV.
- FIG. 13A shows that engineered Rep reduced DNA packaging of the conventional AAV.
- FIG. 13B shows reduction of DNA packaging in RAAV by using various mutant MCP fusion proteins, including double mutant MCP fusion protein DJ-MCPX2.
- FIGs. 14A-14D show that the RAAV viral particles express functional transgene-encoded proteins. Samples are designated the same way in FIGs. 14A-14C.
- FIG. 14A shows a time course of Cre mRNA levels in infected cells.
- FIG. 14B shows fold change of Cre mRNA levels in infected cells from 20 hrs post infection.
- FIG. 14C shows a time course of Cre DNA levels in infected cells.
- FIGs. 15A-15D show results of DNA and mRNA analysis for the AAV or RAAV infected Ai9-MEF cells.
- FIG. 15A shows Ct value of the Cre mRNA.
- FIG. 15B shows Ct value of the Cre DNA.
- FIG. 15C shows Ct value of the GAPDH mRNA.
- FIG. 15D shows Ct value of the 36B4 DNA.
- FIG. 16 shows genotype identification of Ai9-MEF cells.
- FIGs. 17A-17B show transient transfer of RAAV particles.
- FIG. 17A shows Western blot analysis of the lifespan of Cre protein in infected cells after conventional AAV delivery.
- FIG. 17B shows Western blot analysis of the lifespan of Cre protein in infected cells after RAAV delivery.
- FIG. 18 shows additional functional RPS/RBP pairs –the PP7/PCP pair, and the com/COM pair -tested in the RAAV system.
- FIG. 19 shows that the RAAV system is applicable for various AAV serotypes, including AAV-DJ, AAV5, AAV8, and AAV9.
- FIGs. 20A and 20B shows that additional AAP and MCP fusion proteins increased RAAV yield.
- FIG. 20A represents the specific genome packaging of RAAV-Cre by detecting Cre sequence.
- FIG. 20B shows comparison of the RNA packaging efficiency of RAAVs with AAP N-or C-terminal fusions (AM or MA fusion constructs) .
- FIGs. 21A-21C show results of transient transfer of RAAV-Cre into the hippocampus of Ai9-Mice.
- FIG. 21A shows transfer of high dose of AAV-Cre into the hippocampus of Ai9-Mice.
- FIG. 21B shows transfer of low dose of AAV-Cre into the hippocampus of Ai9-Mice.
- FIG. 21C shows transfer of high dose of RAAV-Cre into the hippocampus of Ai9-Mice.
- FIG. 21D shows the results in a control mouse.
- Red signal tdTomato
- Green signal Cre
- Blue signal DAPI (nuclei statining) .
- the invention described herein provides a recombinant viral particle comprising a DNA virus protein shell, and a “vector genome” comprising RNA, such as single-stranded RNA (rather than DNA) .
- the “vector genome” may not be a typical viral RNA, in that it may have very little, if any, virus-originated sequences, other than the RNA Packaging Signal (RPS) described herein below. That is, the DNA virus normally or naturally encapsidates a DNA viral vector genome inside the protein shell, while the recombinant version of the DNA virus viral particle as described herein encapsidates instead an RNA.
- RPS RNA Packaging Signal
- RNA or “ribonucleic acid” it means a stretch of ribonucleotides each composed of a phosphate, a ribose, and a base (A (adenine) , U (uracil) , G (guanine) , or C (cytosine) ) , each of which ribonucleotides may be modified (for example, base-modified, glycosyl-modified, phosphate-modified, e.g., oxygen-modified, fluorine-modified, sulphur-modified, pseudo-modified (e.g., pseudo-uridine-modified) , methylated, capped (e.g., 5-capped) ) or unmodified, and, optionally, fused directly or indirectly with a stretch of deoxyribonucleotides each composed of a phosphate, a deoxyribose, and a base (A (adenine) , T (thymine) , G (
- a typical (non-limiting) example of such a recombinant DNA virus viral particle is adeno-associated virus (AAV) , which normally /naturally encapsidates a single-stranded DNA (ssDNA) vector genome.
- AAV adeno-associated virus
- ssDNA single-stranded DNA
- an oncolytic DNA virus such as an oncolytic herpes virus (e.g., herpes simplex virus or HSV) , an oncolytic adenovirus, a vaccinia virus (VACV) , vesicular stomatitis virus (VSV) , etc.
- the invention is partly based on the surprising discovery that, transcribed AAV ITR, in RNA form, can facilitate high efficiency direct packaging of transcribed RNA encompassing such transcribed AAV ITR into conventional AAV viral particles.
- RNA packaging Signals RPS
- RPSIPs RPS-Interacting Proteins
- the ITR sequences at the 5’ and 3’ ends of the DNA vector genome comprise sequence elements such as Rep-Binding Element (RBE) and RBE’ that can interact with the Rep proteins (such as Rep68 and Rep78) .
- the Rep proteins bind the ITR and facilitate the packaging of AAV ssDNA vector genome comprising such ITR sequence elements into the AAV viral particle.
- RNA sequence of interest RNA sequence of interest
- MCP MCP -the bacteriophage-derived MS2 coat protein
- the heterologous MS2-MCP pair constitutes an artificial system of RPS and RPSIP pair that can effectively replace the natural ITR-Rep DNA packaging system, with the former efficiently facilitates RNA packaging.
- RNA-containing DNA virus such as AAV
- R-DNA viral particle or RAAV in the case of AAV
- rRAAV recombinant R-DNA viral particle
- the R-DNA viral particle and RAAV viral particles of the invention can be used to deliver the RNA transcript of any transgene or gene of interest (GOI) of suitable length (e.g., within the packaging limit of the various DNA virus or AAVs) or any guide RNA to a host cell compatible with the tropism of the DNA viral protein shell or AAV viral capsid shell.
- GOI transgene or gene of interest
- the recombinant DNA viral particles such as recombinant AAV vectors, vector genomes, and recombinant AAV viral particles or recombinant AAV particles, are referred to herein as rRAAV vectors (recombinant RNA adeno-associated virus vectors) , vector genomes, and recombinant RAAV (rRAAV) viral particles or rRAAV particles, respectively (the “rRAAV vectors” and “rRAAV particles” are used exchangeably herein) .
- rRAAV vectors recombinant RNA adeno-associated virus vectors
- rRAAV recombinant RAAV
- the subject RAAV vectors can also be composed of any of the same capsid shells found in any wild-type AAVs carrying DNA as the viral genetic material.
- the subject RAAV vectors possess all the usual advantages derived from the AAV shell, such as specific/broad tropism and low immugenicity.
- RNAs e.g., mRNAs
- mRNAs RNAs
- the genome of the subject RAAV vectors are comprised of RNAs (e.g., mRNAs) , which have short lifespans, and thereby leading to a transient expression of any encoded gene product on such RNA genetic material.
- the RAAV vectors of the invention are advantageous for in vivo DNA gene editing, since time-restricted exposure to RAAV-encoded DNA gene editors (such as the mRNA coding sequence for a CRISPR/Cas system effector enzyme Cas9 and variants thereof fused to a base editor) may enable efficient gene editing.
- RAAV-encoded DNA gene editors such as the mRNA coding sequence for a CRISPR/Cas system effector enzyme Cas9 and variants thereof fused to a base editor
- Such transiently expressed DNA editors also improves the safety profile of the gene therapy, by reducing off-target gene targeting, and reducing immunogenicity compared to the persistent expression of the same DNA gene editors expressed from conventional DNA-based AAV vectors.
- the subject RAAV vectors can carry longer transgenes, because of the exclusion of at least the promoter (and also any non-transcribed enhancer sequences that may be) required for expression of the GOI encoded by a DNA-based AAV vector.
- the rRAAV viral particles have the same entry and intracellular-trafficking processes as the conventional DNA-based AAV vectors. However, they have quite different fates after entering into the host cell nucleus. After entering into the nucleus, the mRNA genome of the subject RAAV vector is released and subsequently transported to the cytoplasm, leading to translation. As is understood, mRNAs generally have short lifespans, ranging from several minutes to days, and are eventually degraded via many cellular mechanisms. However, the limited mRNA lifespan still enables the host cell to complete the protein synthesis, often without the delay due to the 2 nd strand cDNA synthesis in DNA-based AAV vectors, and allowing the encoded proteins to function rapidly.
- RPS/RPSIP pairs can be used for RNA packaging into DNA virus.
- the inventors have demonstrated at least two additional such pairs, including the PP7 sequence and the PP7 bacteriophage coat protein (PCP) , and the com sequence and the phage COM protein (COM) , that efficiently package RNA comprising the heterologous RPS (i.e., PP7 and com sequences, respectively) .
- the three pairs of RPS/RPSIP as demonstrated encompass at least two categories.
- com/COM is not a natural viral packaging system but known to be transcription regulators that play roles in the transcription initiation of the bacteriophage Mu mom gene.
- Numerous transcribed modified AAV ITR sequences can also be used as RPS of the invention.
- the invention described herein is also not limited to a specific serotype of DNA virus (e.g., a specific AAV serotype) .
- the inventors have demonstrated efficient packaging of RNA sequences with suitable RPS into representative AAV viruses including AAV5, AAV8, AAV9, and AAV-DJ, using in conjunction with compatible RPSIP in each case.
- the invention described herein is also based on the discovery that the efficiency of packaging undesired DNA into natural DNA virus viral particles can be decreased by several independent approaches.
- the undesired DNA packaging efficiency can be reduced by increasing the overall size of the DNA vector from which the RNA of interest is transcribed.
- the gene of interest GOI
- the required Rep and Cap proteins are encoded by the rep and cap genes on a second plasmid
- the other AAV packaging required components are provided by a third plasmid.
- the RNA sequence to be packaged into the DNA virus can be transcribed from the first plasmid, and the overall size of the first plasmid can be artificially increased by including a random stuffer sequence (e.g., an intron) , such as a stuffer sequence that is at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more in length, or a stuffer sequence that increases the overall size of the first plasmid by 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more, e.g., to about 6 kb, 7 kb, 8 kb, 9 kb, 10 kb or more, etc.
- a random stuffer sequence e.g., an intron
- the undesired DNA packaging efficiency can be reduced by inhibiting the function of a canonical element that facilitates DNA packaging.
- a canonical element for DNA packaging may include a DNA sequence (such as an element of the AAV ITR sequence that facilitates DNA packaging, including the trs sequence, the RBE or RBE’ sequence, or the entire ITR sequence of an AAV) ; and/or a protein element participating in the DNA packaging, such as, a protein that interacts with the DNA sequence (such as a mutant Rep68 or Rep 78 protein that lacks or has diminished trs-endonuclease activity) .
- RNA sequence capable of being packaged into a DNA virus viral particle, such as a DNA virus that naturally packages DNA
- RNA sequence comprises: (1) an RNA sequence of interest (RSI) ; and, (2) an RNA-packaging signal (RPS) capable of interacting, e.g., binding, directly or indirectly to an RPS-interacting molecule (e.g., an RPS-interacting protein or RPSIP) that facilitates packaging of the RNA sequence into the DNA virus viral particle.
- RPS RNA-packaging signal
- RNA sequence can comprise any RSI (RNA) , which may be encoded by “a gene of interest” or “GOI” (DNA) .
- a gene of interest includes any coding sequence for a protein or polypeptide, including intron and exon sequences, and/or coding sequence for any non-translated RNA or non-coding RNA (ncRNA, such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or precursors thereof including pre-miRNA and pri-miRNA, antisense sequence or oligonucleotide (ASO) , guide RNA or gRNA for CRISPR/Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc. ) .
- RSI includes, for example, a protein (e.g., a therapeutic protein, an antigen protein, or a gene-editing protein such as a CRISPR/Cas effector enzyme ( “a Cas protein” for short) , a ZFN protein, a TALEN protein) -encoding RNA, such as an mRNA, or a non-coding, functional RNA (such as a transfer RNA (tRNA) , a ribosomal RNA (rRNA) , a transfer-messenger RNA (tmRNA) , a small interfering RNA (siRNA) , a short hairpin RNA (shRNA) , an antisense RNA or oligonucleotide (ASO) , a micro RNA (miRNA) , an RNA aptamer, or an RNA component of a CRISPR-Cas (e.g., Cas9, Cas12, Cas13)
- the RNA sequence of the invention or GOI can comprise one coding sequence, or more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) coding sequences.
- the length of the coding sequence, or the combined length of all coding sequences may be no more than the maximum length of RNA that can be packaged into a particular or chosen DNA virus viral particle (e.g., AAV viral particle) , which can differ from one specific DNA virus (e.g., AAV) viral particle from another.
- AAV viral particle e.g., AAV viral particle
- a DNA sequence encoding or corresponding to the RNA sequence of the invention, or a reverse complement of the DNA sequence has reduced, diminished, or substantially no capacity of being packaged into the DNA virus viral particle.
- the DNA sequence may encode the RNA sequence of the invention (e.g., the DNA sequence has the reverse complement sequence of the RNA sequence of the invention) .
- the DNA sequence may also correspond to the RNA sequence of the invention, in that the DNA sequence has otherwise identical nucleotide sequence as the RNA sequence of the invention, except that the DNA sequence has T’s, instead of the U’s in the RNA sequence of the invention.
- the DNA sequence or the reverse complement thereof may lack a functional DNA packaging signal for packaging into the DNA virus viral particle, such as an AAV ITR for AAV packaging, such that the DNA sequence or the reverse complement thereof (DNA) has reduced, diminished, or substantially no capacity of being packaged into the DNA virus viral particle.
- a functional DNA packaging signal for packaging into the DNA virus viral particle such as an AAV ITR for AAV packaging, such that the DNA sequence or the reverse complement thereof (DNA) has reduced, diminished, or substantially no capacity of being packaged into the DNA virus viral particle.
- the RNA sequence of the invention is transcribed from a DNA construct, such as transcribed from a DNA plasmid encoding the RNA sequence, wherein the DNA construct /plasmid comprises a stuffer sequence (e.g., an intron sequence) in its backbone sequence to enhance packaging of the RNA sequence of the invention, and/or to reduce undesired packaging of DNA into the DNA virus viral particle.
- a stuffer sequence e.g., an intron sequence
- the RNA sequence of the invention can be transcribed from a DNA construct /plasmid, and the overall size of the DNA construct /plasmid can be artificially increased by including a random DNA stuffer sequence, such as a stuffer sequence that is at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more in length, or a stuffer sequence that increases the overall size of the DNA construct /plasmid by 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more, e.g., to about 6 kb, 7 kb, 8 kb, 9 kb, 10 kb or more, etc.
- a random DNA stuffer sequence such as a stuffer sequence that is at least about 1 kb, 2 kb, 3 kb, 4 kb, 5 kb or more in length, or a stuffer sequence that increases the overall size of the DNA construct /plasmid by 1 kb, 2
- the stuffer sequence can be located upstream (e.g., immediately upstream) of the transcription unit comprising the coding sequence for the RNA sequence of the invention (see FIG. 9A, in which a long stuffer sequence of >3 kb is inserted immediately upstream of a CAG promoter that drives the transcription of an exemplary RNA sequence of the invention) .
- the stuffer sequence is inserted immediately upstream of a promoter operably linked to the codon sequence for the RNA sequence of the invention.
- the coding sequence for the RNA sequence of the invention is devoid of a functional natural DNA packaging signals for the DNA virus viral particle, such as devoid of a functional ITR sequence that supports packaging into an AAV viral particle.
- the RNA sequence of the invention is capable of being packaged into a DNA virus viral particle that is an AAV viral particle.
- Any AAV virus can be used to package the RNA sequence of the invention, including, but not limited to, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAV 13, AAVrh10, AAVrh74, AAVhu32, AAVhu37, AAV-DJ, AAV PHP.
- eB Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.
- the RNA sequence of the invention is capable of being packaged into a DNA virus viral particle that is an oncolytic viral particle.
- exemplary (non-limiting) oncolytic viral particles include: oncolytic herpes virus (e.g., herpes simplex virus or HSV) , an oncolytic adenovirus, a vaccinia virus (VACV) , vesicular stomatitis virus (VSV) , etc.
- the location of the RPS in the RNA sequence of the invention can be flexible.
- the RPS is located at or near the 5’ end of the RNA sequence of the invention, at or near the 3’ end of the RNA sequence of the invention, or internal to the RNA sequence of the invention.
- the RPS is located at or near the 5’ end of the RNA sequence of interest (RSI) , at or near the 3’ end of the RNA sequence of interest (RSI) , or internal to the RNA sequence of interest (e.g., inside an intron of an mRNA) .
- the RNA sequence of the invention comprises more than one (e.g., 1, 2, 3, or more) RPS that are identical or substantially identical. In certain embodiments, the RNA sequence of the invention comprises more than one (e.g., 1, 2, 3, or more) RPS, and at least two of which are different from each other.
- the linker between any two adjacent RPS sequences may be the same or different.
- the linker sequence may be a randomized RNA sequence with no substantial secondary structure, no known functional sequences or elements, and/or may be less than 50%in GC content.
- the length of the linker may be any where between 1-1 kb, 1-500 bases, 1-200 bases, 1 to about 100 bases, 1 to about 60 bases, about 5 to about 55 bases, about 10 to about 30 bases, or about 15-25 bases.
- the RNA sequence of the invention comprises 3 RPS sequences adjacent to one another, separated by two linker sequences, each independently about 20 or about 50 bases.
- the first two of three identical RPS sequences may be separated by a linker of 20 bases, and/or the last two of the RPS sequences may be separated by a linker of 51 bases.
- the RNA sequence of the invention comprises more than one RPS (e.g., 1, 2, 3, 4, or 5 RPS) , wherein at least two of the more than one RPS are not adjacent to each other.
- RPS e.g., 1, 2, 3, 4, or 5 RPS
- one of the RPS may be located at the 5’ end of the RNA sequence of the invention, while another RPS may be located at the 3’ end of the RNA sequence of the invention, and an optional 3 rd RPS may be located inside an intron of an mRNA as the RSI within the RNA sequence of the invention.
- a 4 th and/or a 5 th RPS may be located close or adjacent to any one the first, second, or third RPS.
- the RNA sequence of the invention comprises at least two (e.g., two or more) RPS sequences that are not adjacent to each other, e.g., one each located at or near one end of the RNA sequence of interest (RSI) .
- RPS RNA sequence of interest
- the RPS comprises a transcribed modified AAV inverted terminal repeat (ITR) , wherein the transcribed modified AAV ITR (a) comprises a transcribed functional Rep-Binding Element (RBE) , optionally further comprising a transcribed functional RBE’; and, (b) lacks either a transcribed terminal resolution site (TRS) , or a transcribed reverse complement TRS (rcTRS) , or both.
- the transcribed modified AAV ITR further comprises a transcribed D region sequence (D sequence or D’ sequence) .
- the RPS-interacting molecule is Rep78, Rep68, Rep52, and/or Rep40.
- AAV viral particle includes viral particles comprising any wild-type capsids of adeno-associated virus (AAV) (belonging to the genus Dependoparvovirus, which in turn belongs to the family Parvoviridae) , as well as engineered or variants thereof having modified sequence and/or tissue or host tropism.
- AAV adeno-associated virus
- RNA sequence of the invention may comprise an intron sequence, such as an intron sequence from a heterologous gene ( “heterologous” with respect to the gene of interest or GOI, which is to be expressed as a transgene delivered to a host cell by the rRAAV viral particle of the invention) , in order to enhance the expression of the GOI.
- heterologous with respect to the gene of interest or GOI, which is to be expressed as a transgene delivered to a host cell by the rRAAV viral particle of the invention
- Such intron sequence in the RNA sequence of the invention may or may not be removed by splicing.
- such intron sequence may further comprise a transcribed enhancer or a part thereof, since certain enhancers can be located within an intron of a coding DNA.
- exon refers to a coding segment of a DNA or an RNA, which exon is to be translated into a protein sequence.
- an exon sequence within the RNA sequence of the invention may encode part of or the entirety of the GOI to be expressed as a transgene delivered to a host cell by the rRAAV viral particle of the invention.
- an exon sequence within the RNA sequence of the invention may belong to a heterologous gene (with respect to the GOI) , and the presence of such exon may enhance the expression of the GOI.
- coding sequence includes a polynucleotide sequence of a DNA or an RNA which encodes a product that can be (a) a protein or a polypeptide, or (2) other than a protein or a polypeptide (e.g., ncRNA, such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or precursors thereof including pre-miRNA and pri-miRNA, antisense sequence or oligonucleotide (ASO) , guide RNA or gRNA for CRISPR/Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc. ) .
- ncRNA such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or precursors thereof including pre-miRNA and pri-miRNA, antisense sequence or oligonucleotide (ASO)
- the ribonucleotide coding sequence for the gene of interest may be further processed inside the cell, once the RNA content of the RAAV viral particle is separated from the AAV capsid and released into the cell. Processing of the coding sequence can produce one or more RNA products, such as siRNA, miRNA, and/or mRNA, which may be further translated into protein product (s) , or be incorporated into other cellular machinery such as the RISC complex or a CRISPR/Cas effector enzyme (such as a Class 2, type II, V, or VI effector enzyme) .
- RNA ribonucleic acid
- the transcribed RNA molecule can corresponds to either a plus strand or a minus strand of an AAV ssDNA, wherein the transcribed plus strand RNA was transcribed from the minus strand of the DNA template and the transcribed minus strand RNA was transcribed from the plus strand of the DNA template.
- the transcribed RNA molecule can either be transcribed from the sense or antisense strand of a double stranded DNA template.
- a transcribed RNA using the dsDNA as template may have the same sequence as the sense strand or the antisense strand, as the case may be. That is, RNA transcribed from double-stranded DNA shown as SEQ ID NO: 1 may have the same sequence as SEQ ID NO: 1 or its reverse complement, except that the T’s in DNA are replaced by U’s in the transcribed RNA.
- the transcribed modified AAV inverted terminal repeat (ITR) sequence of the invention is an RNA sequence (as opposed to the single-stranded DNA sequence in the conventional AAV viral genome encapsidated within the AAV viral particle) .
- the transcribed modified AAV ITR sequence also supports binding of the RNA sequence of the invention to the AAV Rep protein, and is thus capable of supporting the direct packaging of the RNA sequence of the invention into the AAV viral particle.
- the transcribed modified ITR sequence comprises a transcribed Rep-binding element (RBE) (e.g., a transcribed functional RBE) , and optionally a transcribed RBE’ (e.g., a transcribed functional RBE’) , for Rep binding.
- RBE transcribed Rep-binding element
- the transcribed modified ITR sequence supports or facilitates packaging or encapsidation of the RNA sequence into an AAV viral particle.
- the modified ITR comprises a wild-type RBE.
- the modified ITR comprises a functional RBE that retains at least about 60%, 70%, 80%, 90%, 95%, 100%or more of the ability of wild-type RBE for supporting AAV packaging, such as Rep binding.
- the functional RBE comprises up to about 30%, 25%, 20%, 15%, 10%, or 5%of sequence variation compared to the wild-type RBE, due to, for example, insertion, deletion, substitution, and/or other mutation of one or more nucleotides of the RBE.
- the modified AAV ITR DNA template, from which the transcribed modified AAV ITR is transcribed is defective as an ITR, in that it lacks one or more functions of the corresponding wild-type AAV ITR, such as being able to be cleaved at the TRS (transcribed terminal resolution site, see below) . This can be due to, for example, the lack of a functional TRS.
- the wild-type TRS is completely deleted such that the modified ITR has no TRS.
- the wild-type TRS is mutated by deleting, inserting, substituting, and/or mutating one or more nucleotides such that it can no longer to recognized and cleaved by Rep during AAV replication.
- the modified AAV ITR DNA template retains the RBE or a functional variant thereof as described herein, and optionally the RBE’ or a functional variant thereof. In certain embodiments, the RBE and/or RBE’ is/are functional with respect to binding to AAV Rep78/68.
- the transcribed modified AAV inverted terminal repeat (ITR) of the invention further lacks either a transcribed terminal resolution site (TRS) , or a transcribed reverse complement TRS (rcTRS) , or both.
- TRS transcribed terminal resolution site
- rcTRS transcribed reverse complement TRS
- the TRS is at the 5’ end of the modified AAV ITR.
- the TRS is between the D region sequence and the RBE.
- the transcribed modified AAV ITR lacks both the transcribed TRS and the transcribed rcTRS.
- terminal resolution site refers to the single-stranded DNA sequence in the single-stranded AAV vector genome (plus or minus strand) that is recognized and nicked by the AAV Rep proteins during AAV replication.
- reverse complement TRS refers to the single-stranded DNA sequence in the single-stranded AAV vector genome (plus or minus strand) that is reverse complement sequence of the TRS. The rcTRS pairs with the TRS to form a double stranded DNA region at one end of the A region stem. See FIGs. 1A-1C.
- the TRS comprises the sequence of TTGGC, with the Rep cleavage site in between the two T’s; while the rcTRS comprises the sequence of GCCAA.
- One TRS is located at the juncture of the D and A region sequences, and is at the most 5’ end of the A region sequence (e.g., between the D region sequence and the RBE) . See FIGs. 1B and 1C for the TRS and rcTRS in 5’ and 3’ ITR multi-sequence alignment of representative AAV’s.
- a “transcribed TRS” is a single-stranded RNA sequence resulting from transcribing the TRS DNA template.
- the transcribed TRS comprises GCCAA.
- a “transcribed rcTRS” is a single-stranded RNA sequence resulting from transcribing the rcTRS DNA template.
- the transcribed rcTRS comprises UUGGC.
- a transcribed modified AAV ITR “lacks a transcribed AAV2 TRS, ” if it does not have the GCCAA sequence at the location the GCCAA sequence normally appears in a corresponding transcribed wild-type AAV2 ITR, e.g., due to complete deletion of the GCCAA sequence, or due to insertion, deletion, substitution, and/or other mutation of one or more nucleotides within the GCCAA sequence.
- TTGGC complete deletion of the TRS
- the RNA sequence of the invention or the transcribed modified AAV ITR lacks a transcribed functional TRS.
- a transcribed modified AAV ITR “lacks a transcribed AAV2 rcTRS, ” if it does not have the UUGGC sequence at the location the UUGGC sequence normally appears in a corresponding transcribed wild-type AAV2 ITR, e.g., due to complete deletion of the GCCAA sequence, or due to insertion, deletion, substitution, and/or other mutation of one or more nucleotides within the GCCAA sequence.
- This can result from transcribing a modified AAV ITR having a complete deletion of the rcTRS, or due to insertion, deletion, substitution, and/or other mutation of one or more nucleotides within the wild-type rcTRS.
- the transcribed modified AAV ITR further comprises a transcribed D region sequence (D or D’ sequence in a wild-type AAV ITR) or a mutant D region sequence (e.g., one with one or more nucleotide insertion, deletion, substitution, and/or other mutation) that substantially retains the function of a wild-type D region sequence.
- the transcribed modified AAV ITR does not comprises a transcribed D region sequence, or does not comprise a mutant D region sequence (e.g., one with one or more nucleotide insertion, deletion, substitution, and/or other mutation) that substantially retains the function of a wild-type D region sequence.
- the transcribed modified AAV ITR comprises the transcribed (functional) D region sequence.
- the modified AAV ITR DNA template has the nucleotide sequence of SEQ ID NO: 3.
- the transcribed modified AAV ITR comprises an RNA equivalent of SEQ ID NO: 3 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of SEQ ID NO: 3) .
- the transcribed modified AAV ITR comprises an RNA equivalent of the reverse complement of SEQ ID NO: 3 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of the reverse complement of SEQ ID NO: 3) .
- the transcribed modified AAV ITR lacks the transcribed (functional) D region sequence.
- the modified AAV ITR DNA template has the nucleotide sequence of SEQ ID NO: 2.
- the transcribed modified AAV ITR comprises an RNA equivalent of SEQ ID NO: 2 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of SEQ ID NO: 2) .
- the transcribed modified AAV ITR comprises an RNA equivalent of the reverse complement of SEQ ID NO: 2 (i.e., the RNA equivalent has the same base sequence as the DNA sequence of the reverse complement of SEQ ID NO: 2) .
- D region sequence refers to either the D sequence or its reverse complement D’ sequence. Location of the D region sequence depends on whether the ITR takes the “flip” or the “flop” configuration. See FIGs. 1A-1C. For example, in wild-type AAV2 ITR (see FIG. 2 of Srivastava et al., J. Viol.
- the plus strand ssDNA sequence comprises, from 5’ to 3’, palindromic sequence segments named A, B, B’, C, C’, A’, D, ..., D’, A, C, C, B, B’, and A’, in which A: A’, B: B’, C: C’ and D: D’ are reverse complement sequences of each other and can form base-paired stem sequences (though the D and D’ sequences may not actually base-pair with each other in the ssDNA AAV vector genome) .
- the 5’ ITR of the plus strand has the B: B’ stem closer to one end (5’ end) of the sequence than the C: C’ stem, and is known as the flip ITR.
- the 3’ ITR of the plus strand has the C: C’ stem closer to one end (3’ end) of the sequence than the B: B’ stem, and is known as the flop ITR.
- the transcribed modified AAV ITR sequence of the invention may lack a functional transcribed D region sequence (D or D’ sequence) by, for example, deletion, insertion, substitution, and/or other mutation of one or more nucleotides of the transcribed wild-type D region sequence.
- D or D a functional transcribed D region sequence
- the RNA or transcribed modified AAV ITR sequence of the invention comprises a mutated transcribed D region sequence and/or a mutated transcribed TRS sequence. In certain embodiments, the RNA or transcribed modified AAV ITR sequence of the invention comprises no transcribed D region sequence and/or no transcribed TRS /rcTRS sequence.
- the transcribed modified AAV ITR is modified based on a transcribed wild-type flip ITR or a wild-type flop ITR.
- the wild-type flip ITR or the wild-type flop ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAV 13, AAVrh10, AAVrh74, AAVhu32, AAVhu37, AAV PHP. eB, Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.
- the wild-type flop ITR has the nucleotide sequence of SEQ ID NO: 1.
- the transcribed D region sequence is present, and is not within the 3’ end 50 nucleotides (e.g., 40 nt, 30 nt, 25 nt, or 20 nt) of the RNA.
- the transcribed D region sequence is present, and is within the 3’ end 50 nucleotides (e.g., 40 nt, 30 nt, 25 nt, or 20 nt) of the RNA.
- the transcribed modified AAV ITR is within the 3’ end 1000 nucleotides of the RNA. In certain embodiments, the transcribed modified AAV ITR is within the 3’ end 800 nucleotides of the RNA. In certain embodiments, the transcribed modified AAV ITR is within the 3’ end 500 nucleotides of the RNA. In certain embodiments, the transcribed modified AAV ITR is within the 3’ end 300 nucleotides of the RNA. In certain embodiments, the transcribed modified AAV ITR is within the 3’ end 200 nucleotides of the RNA.
- the transcribed modified AAV ITR is 5’ to a polyA sequence, a polyA signal sequence (e.g., AAUAAA) , or a sequence for RNA transcription termination (e.g., a histone downstream element) .
- polyA sequence or “polyA tail” refers to a string of adenine ribonucleotides or adenosine monophosphates (e.g., a string of RNA with each base therewithin an adenine) .
- a polyA tail is important for the nuclear export, translation and stability of mRNA.
- the length of the polyA sequence can vary in different mRNA or the RNA sequence of the invention, and can be about 250 nucleotides of polyA, about 230 nucleotides of polyA, about 200 nucleotides of polyA, about 180 nucleotides of polyA, about 160 nucleotides of polyA, about 140 nucleotides of polyA, about 120 nucleotides of polyA, about 100 nucleotides of polyA, or less.
- polyA signal sequence refers to an RNA sequence (such as AAUAAA) that is located downstream of the most 3’ exon, and is recognized by an RNA cleavage complex that cleaves off the 3’ terminal sequence of a newly transcribed RNA by RNA polymerase (such as Pol II) such that polyadenylation can occur.
- RNA polymerase such as Pol II
- Polyadenylate polymerase then adds and extends the poly (A) tail by adding adenosine monophosphate units from ATP to the nascent cleaved 3’ end of the RNA.
- the initial RNA cleavage is typically catalyzed by the enzyme CPSF (cleavage /polyadenylation specificity factor) , and occurs about 10-30 nucleotides downstream of its binding site -the polyA signal sequence, which is often AAUAAA on the transcribed RNA.
- the sequence at/or immediately 5’ to the site of RNA cleavage is frequently (but not always) CA.
- the polyA signal sequence recognized by the RNA cleavage complex varies between different groups of eukaryotes, with most human polyadenylation sites containing the AAUAAA sequence, though this sequence is less common in plants and fungi mRNA. In addition, other variants that bind more weakly to CPSF exist. All such sequence motifs recognized by the RNA cleavage complex to enable RNA cleavage and the subsequent polyadenylation are within the scope of the polyA signal sequence.
- a transcribed GU-rich region downstream of the polyA site refers to a sequence that may be used by other proteins (such as the cleavage stimulation factor or CstF) to enhance binding specificity of CPSF to the polyA signal sequence (e.g., AAUAAA) .
- CstF cleavage stimulation factor
- the RNA sequence of the invention further comprises a recognition sequence for CFI (cleavage factor I) , such as a set of UGUAA sequences in mammals, that can recruit CPSF even if the AAUAAA polyA signal sequence is missing.
- CFI cleavage factor I
- a sequence for RNA transcription termination includes an RNA sequence motif present at or near the 3’ end of a transcribed RNA (such as a transcribed RNA without a polyA tail) that terminates transcription.
- a transcribed RNA such as a transcribed RNA without a polyA tail
- Almost all eukaryotic mRNAs are polyadenylated, with the exception of metazoan replication-dependent histone mRNAs, in which mRNA processing occurs at a site of highly conserved stem-loop structure and a purine rich region around 20 nucleotides downstream.
- HDE histone downstream element
- the RNA sequence of the invention further comprises a second transcribed modified AAV ITR of the invention.
- the second transcribed modified AAV ITR has a transcribed functional RBE sequence but lacks either a second transcribed TRS or a second transcribed rcTRS or both; optionally, the second transcribed modified AAV ITR further comprises or lacks a second transcribed D region sequence.
- the second transcribed modified AAV ITR comprises a second transcribed mutated D region sequence and/or a second transcribed mutated TRS sequence.
- the transcribed modified AAV ITR and the second transcribed modified AAV ITR are identical.
- the transcribed modified AAV ITR and the second transcribed modified AAV ITR are different.
- the transcribed modified AAV ITR, the second transcribed modified AAV ITR comprise a deletion from, a mutation in, or an insertion into a corresponding transcribed wild-type AAV ITR D region sequence or a corresponding transcribed wild-type TRS /rcTRS.
- the second transcribed modified AAV ITR is within 5’ end 1000 nucleotides, 800 nucleotides, 500 nucleotides, 250 nucleotides, or 150 nucleotides of the RNA sequence.
- the RPS comprises an MS2 sequence, an PP7 binding site, or a com binding site
- the RPS-interacting molecule comprises an RPS-interacting protein (RPSIP) capably of interacting, e.g., recognizing and binding, directly or indirectly, to the RPS, such as a bacteriophage-derived MS2 coat protein (MCP) for an MS2 sequence, a PP7 bacteriophage coat protein (PCP) for an PP7 binding site, or a phage COM protein (COM) for a com binding site.
- MCP bacteriophage-derived MS2 coat protein
- PCP PP7 bacteriophage coat protein
- COM phage COM
- any of the one or more RPS sequences described herein above, including any of the transcribed modified ITR sequences, and any of the MS2 sequence, PP7 binding site, and/or com binding site, alone or in combination, can facilitate the packaging of the RNA sequence of the invention into the DNA virus viral particle, in the presence of a suitable /compatible cognate RPSIP.
- the RPSIP is, or is associated directly or indirectly with, a protein component of the viral packaging system for the DNA virus viral particle.
- the RPSIP is a protein component of the viral packaging system for the DNA virus, such as, Rep78, Rep68, Rep52, and/or Rep40 for AAV.
- the RPSIP may be directly fused to a protein component of the viral packaging system for the DNA virus.
- Exemplary protein components of the viral packaging system for AAV include any of the Rep proteins (such as Rep78 and/or Rep68 of adeno-associated virus 2 (AAV2) ) , and/or any of the assembly-activating protein (AAP) .
- the fusion is an N-terminal fusion wherein the RPSIP (such as MCP, PCP, or COM) is fused N-terminal to a Rep68/78 protein, and/or to an AAP.
- RPSIP such as MCP, PCP, or COM
- the fusion is an N-terminal fusion wherein the RPSIP (such as MCP, PCP, or COM) is fused C-terminal to a Rep68/78 protein, and/or to an AAP.
- RPSIP such as MCP, PCP, or COM
- the fusion is a direct fusion with no linker sequences in-between.
- the fusion is through one or more linker sequence, such as a flexible peptide linker that may include a Gly and Ser rich linker or GS linker.
- Representative GS linkers include 1, 2, 3, 4, 5 or more repeats of Gly or Ser, such as GS, GSS, GSSS, GSSSS, and repeats thereof (e.g., (GS p ) n , wherein p is an integer between 1-5, and n is an integer between 1-20.
- One typical such GS linker is GS 3 linker or GS 4 linker.
- p is 3 or 4, and n is 1.
- the RNA sequence of the invention can comprise, but preferably does not comprise, a transcribed DNA packaging signal, for example, a transcribed wild-type AAV ITR sequence.
- the RNA sequence of the invention may comprise a transcribed modified AAV ITR sequence having an addition, a deletion, and/or a substitution of a nucleotide of a corresponding transcribed wild-type AAV ITR sequence to reduce the DNA packaging capability of the DNA virus viral particle.
- the RNA sequence of the invention further comprises one or more of: (1) a coding sequence for a protein (such as an mRNA encoding a therapeutic protein or a CRISPR/Cas effector enzyme including any of the Cas effectors described herein below, e.g., Cas9, or a variant thereof, optionally fused to a base editor) , a non-coding RNA (ncRNA) , or a functional RNA (such as a tRNA, a ribosomal RNA (rRNA) , an RNAi reagent or precursor thereof, siRNA, shRNA, miRNA or precursors thereof including pre-miRNA and pri-miRNA, antisense RNA (ASO) , piRNA, an RNA component of CRISPR-Cas system such as a guide RNA (or gRNA) , a single guide RNA (or sgRNA, chimeric RNA, RNA chimera) , a CRISPR RNA
- a transcribed transcription enhancer (2) a transcribed transcription enhancer; (3) a transcribed intron sequence or exon sequence (such as one for enhancing protein expression) ; (4) a 5’ UTR sequence; (5) a 3’ UTR sequence; (6) a polyA sequence, or a (transcribed) polyadenylation (polyA) signal sequence, and optionally a transcribed polyA site and a transcribed GU-rich region downstream of the polyA site; (7) a posttranscriptional regulatory element or sequence, such as a transcribed Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) sequence; and/or, (8) a transcription termination sequence (such as a histone downstream element) .
- WTP Woodchuck Hepatitis Virus
- WPRE Posttranscriptional Regulatory Element
- the RNA sequence of the invention comprises an RPS located 3’ to the posttranscriptional regulatory element or sequence, and 5’ to the polyA sequence or the polyA signal sequence.
- the RNA sequence of the invention comprises, in 5’ to 3’ orientation, the RSI; the optional transcribed WPRE sequence (that may or may not be present) ; the RPS (such as the transcribed modified AAV ITR, the MS2 sequence, the PP7 binding site, or the com binding site) ; and the polyA sequence or the polyA signal sequence.
- the RNA sequence of the invention encodes, or the GOI comprises, a protein (e.g., a fluorescent protein, a therapeutic protein, an antigen protein, or a gene-editing protein such as a Cas protein, a ZFN protein, a TALEN protein) , an enzyme (such as a Cre protein, or a CRISPR/Cas effector enzyme, e.g., Cas9, Cas12, Cas13, or a variant thereof) , a structural protein, an mRNA, a non-coding RNA (ncRNA) , an siRNA, a piRNA, a short hairpin RNA or shRNA, a microRNA (miRNA) or a precursor thereof (including pre-miRNA and pri-miRNA) , a ribosomal RNA (rRNA) , an antisense sequence or oligonucleotide (ASO) , an RNA component of a CRISPR-Cas system, including
- the overall length of the RNA sequence of the invention depends on the packaging capacity of the AAV viral particle. Most AAV viral particles have a packaging capacity of about 4,700-5,200 nucleotides, but certain AAV viral particles such as AAV5 particles can package up to 8,900 nucleotides.
- the RNA sequence of the invention to be packaged into an AAV viral particle is a single-stranded RNA (ssRNA) less than about 8,900 nucleotides in length.
- ssRNA single-stranded RNA
- the RNA sequence is a ssRNA less than about 8,000 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA less than about 7,000 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA less than about 6,000 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA less than about 5,200 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA less than about 4,000 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA less than about 3,000 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA less than about 2,000 nucleotides in length.
- the RNA sequence is a ssRNA about 4,700-5,200 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA about 4,700-5,000 nucleotide in length. In certain embodiments, the RNA sequence is a ssRNA about 4,700-4,800 nucleotides in length. In certain embodiments, the RNA sequence is a ssRNA about 4,700 nucleotides in length.
- polynucleotide comprising a (transcription) cassette encoding the RNA sequence of the invention; optionally, the polynucleotide is a DNA sequence (e.g., a DNA plasmid) , optionally comprising a stuffer sequence in the backbone of the DNA plasmid, and/or optionally comprising no functional DNA packaging signal such as AAV ITR.
- a DNA sequence e.g., a DNA plasmid
- stuffer sequence in the backbone of the DNA plasmid optionally comprising no functional DNA packaging signal such as AAV ITR.
- the polynucleotide comprising the cassette is a DNA vector encoding the RNA sequence of the invention.
- DNA vector and/or the cassette thereof can be used to transcribe and produce the RNA sequence of the invention for further packaging into, e.g., an AAV viral particle.
- the polynucleotide further comprises a promoter operably linked to and driving the transcription of the RNA sequence of the invention encoded by the cassette to produce the RNA sequence of the invention.
- the promoter is a ubiquitous promoter.
- the promoter is a tissue-specific promoter.
- the promoter is a constitutive promoter.
- the promoter is an inducible promoter.
- the polynucleotide further comprises an enhancer that enhances the transcription of the RNA sequence driven by the promoter.
- Another aspect of the invention provides a recombinant DNA virus viral particle comprising an RNA genome (such as the RNA sequence of the invention, or the RNA sequence transcribed from the polynucleotide of the invention) packaged within the protein shell (such as capsid) of a DNA virus (such as an AAV virus, or an oncolytic virus) .
- an RNA genome such as the RNA sequence of the invention, or the RNA sequence transcribed from the polynucleotide of the invention
- the protein shell such as capsid
- a DNA virus such as an AAV virus, or an oncolytic virus
- the DNA virus is AAV
- the recombinant DNA virus viral particle is a recombinant RNA adeno-associated virus (rRAAV) particle, comprising: (1) an AAV capsid; and, (2) the RNA sequence of the invention, or the RNA sequence transcribed from the polynucleotide of the invention, packaged within the AAV capsid.
- rRAAV RNA adeno-associated virus
- the AAV capsid comprises a capsid from an AAV of the serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP. eB, Anc80L65, Anc80L65AAP, or 7m8.
- a related aspect of the invention provides a population of recombinant DNA virus viral particles (e.g., rRAAV particles) comprising a plurality of recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or more of the recombinant DNA virus viral particles (e.g., rRAAV particles) within the population have encapsidated RNA sequence of the invention, or the RNA sequence transcribed from the polynucleotide of the invention packaged therein.
- rRAAV particles e.g., rRAAV particles
- the population of recombinant viral particles comprises at least 1 ⁇ 10 4 viral particles, at least 2 ⁇ 10 4 viral particles, at least 5 ⁇ 10 4 viral particles, at least 1 ⁇ 10 5 viral particles, at least 2 ⁇ 10 5 viral particles, at least 5 ⁇ 10 5 viral particles, at least 1 ⁇ 10 6 viral particles, at least 2 ⁇ 10 6 viral particles, at least 5 ⁇ 10 6 viral particles, at least 1 ⁇ 10 7 viral particles, at least 2 ⁇ 10 7 viral particles, at least 5 ⁇ 10 7 viral particles, at least 1 ⁇ 10 8 viral particles, at least 2 ⁇ 10 8 viral particles, at least 5 ⁇ 10 8 viral particles, at least 1 ⁇ 10 9 viral particles, at least 2 ⁇ 10 9 viral particles, at least 5 ⁇ 10 9 viral particles, at least 1 ⁇ 10 10 viral particles, at least 2 ⁇ 10 10 viral particles, at least 5 ⁇ 10 9 viral particles, at least 1 ⁇ 10 10 viral particles, at least 2 ⁇ 10 10 viral particles, at least 5 ⁇ 10 9 viral particles, at least 1
- non-RNA e.g., DNA
- Another aspect of the invention provides a host cell comprising the RNA sequence of the invention, the polynucleotide of the invention, the RNA sequence transcribed from the polynucleotide of the invention, the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, and/or the population of recombinant DNA virus viral particle (e.g., rAAV particle) of the invention.
- a host cell comprising the RNA sequence of the invention, the polynucleotide of the invention, the RNA sequence transcribed from the polynucleotide of the invention, the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, and/or the population of recombinant DNA virus viral particle (e.g., rAAV particle) of the invention.
- the host cell further comprises a viral packaging system that facilitates packaging of the RNA sequence of the invention, or the RNA sequence transcribed from the polynucleotide of the invention into the DNA virus viral particle.
- the viral packaging system comprises: (1) an AAV rep gene (e.g., coding sequence for Rep78, Rep68, Rep52, and/or Rep40) and an AAV cap gene (e.g., coding sequence for VP1, VP2, and/or VP3, AAP, and/or MAAP) , under the transcriptional control of one or more promoters that drive the transcription of the rep gene and cap gene, or the expression products thereof; (2) one or more coding sequences for one or more proteins required for AAV packaging, such as adenoviral E2A, E4, and VA genes, or the one or more proteins; and (3) the RPS-interacting molecule or a coding sequence thereof.
- AAV rep gene e.g., coding sequence for Rep78, Rep68, Rep52, and/or Rep40
- AAV cap gene e.g., coding sequence for VP1, VP2, and/or VP3, AAP, and/or MAAP
- the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the RNA sequence of the invention or on the polynucleotide of the invention, (2) modifying, e.g., mutating, the AAV rep gene, the AAV cap gene, and/or the one or more coding sequences for one or more proteins required for AAV packaging to reduce, diminish, or substantially eliminate the capacity of the respective translated protein in order to facilitate the packaging of the DNA sequence into the DNA virus viral particle (e.g., a Y156F mutation in the common sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu) ; and/or (3) enlarging the size of the polynucleotide encoding the RNA sequence of the invention or the polynucleotide of the invention.
- the DNA packaging signals such as A
- enlarging the size of the polynucleotide encoding the RNA sequence of the invention or the polynucleotide of the invention is made by inserting a stuffer sequence (e.g., an intron) into (e.g., the backbone of) the polynucleotide (e.g., a DNA plasmid) .
- a stuffer sequence e.g., an intron
- the polynucleotide e.g., a DNA plasmid
- the AAV rep gene, the AAV cap gene, and/or the proteins required for AAV packaging comprises a mutation that diminishes or reduces capacity to facilitate packaging of DNA into the DNA virus viral particle.
- the Rep68 /Rep 78 protein required for DNA packaging comprises a mutation that compromises or diminishes its trs-endonuclease activity.
- the trs-endonuclease activity is believed to be required to resolve AAV replication (DNA) intermediates at the trs sequence or site, such that individual units of AAV ssDNA can be resolved before packaging into the AAV capsid.
- the trs-endonuclease mutation comprise a Y156F mutation in the common sequence of Rep78 and Rep68 proteins.
- the Rep78 /Rep68 proteins comprise a KDE-mu mutation (see sequence below in the sequence section) .
- Rep78 /Rep68 proteins comprise a EKE-mu mutation (see sequence below in the sequence section) .
- Rep78 /Rep68 proteins comprise two or more mutations selected form the Y156F mutation, the KDE-mu mutation, and the EKE-mu mutation.
- the Rep68/Rep78 are from any one of the AAVs with serotype of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.
- eB Anc80L65, Anc80L65AAP, AAVrh74, or 7m8, and has a corresponding trs-endonuclease mutation of the Y156F mutation, the KDE-mu mutation, and/or the EKE-mu mutation.
- the host cell further comprises: (1) a coding sequence for an AAV rep gene and an AAV cap gene, under the transcriptional control of one or more promoters that drive the transcription of the rep gene and cap gene; and, (2) coding sequences for proteins required for AAV packaging, such as adenoviral E2A, E4, and VA genes.
- the host cell is a mammalian cell, such as a HEK293 cell or a variant thereof (e.g., HEK293T cell) , or an insect cell, such as Sf9 or Sf21 cells.
- a mammalian cell such as a HEK293 cell or a variant thereof (e.g., HEK293T cell)
- an insect cell such as Sf9 or Sf21 cells.
- Another aspect of the invention provides a method of generating the recombinant DNA virus viral particle (e.g., rRAAV particle) or the population of recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, the method comprising: a) culturing the host cell of the invention for a sufficient time, and b) harvesting the recombinant DNA virus viral particle or the population of recombinant DNA virus viral particles.
- the method further comprises isolating or purifying the recombinant DNA virus viral particle or the population of recombinant DNA virus viral particles.
- Another aspect of the invention provides a method of generating a recombinant DNA virus viral particle (e.g., rRAAV particle) or a population of recombinant DNA virus viral particles, the method comprising: a) contacting a viral packaging system (e.g., an AAV packaging system) with the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention, for a period of time sufficient to produce the recombinant DNA virus viral particle of the invention, or the population of recombinant DNA virus viral particles of the invention, and b) harvesting the recombinant DNA virus viral particle of the invention, or the population of recombinant DNA virus viral particles of the invention; and , optionally, c) isolating or purifying the harvested recombinant DNA virus viral particle of the invention, or the population of recombinant DNA virus viral particles of the invention.
- a viral packaging system e.g., an AAV packaging system
- the viral packaging system (e.g., a AAV packaging system) comprises: (1) one or more proteins for assemblying the protein shell (e.g., VP1, VP2, and/or VP3 for assembling AAV capsid) of the DNA virus viral particle for packaging the RNA sequence, or one or more coding sequences thereof; (2) one or more proteins (e.g., Rep78, Rep68, Rep52, and/or Rep40 for AAV packaging) for facilitating the assemblying of the protein shell and/or the packaging of the RNA sequence into the protein shell of the DNA virus viral particle, or one or more coding sequences thereof (e.g., adenoviral E2a, E4, and VA genes) ; and (3) the RPS-interacting molecule or a coding sequence thereof.
- the protein shell e.g., VP1, VP2, and/or VP3 for assembling AAV capsid
- the viral packaging system comprises: (1) one or more proteins for assemblying the protein shell (e.g., VP1, VP2, and/
- the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the RNA sequence of the invention, or on the polynucleotide of the invention, (2) modifying, e.g., mutating, the AAV rep gene, the AAV cap gene, and/or the one or more coding sequences for one or more proteins required for AAV packaging to reduce, diminish, or substantially eliminate the capacity of the respective translated protein to facilitate the packaging of the DNA sequence into the DNA virus viral particle (e.g., a Y156F mutation in the common sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu) ; and/or (3) enlarging the size of the polynucleotide encoding the RNA sequence of the invention or the polynucleotide of the invention.
- the DNA packaging signals such as AAV
- Another aspect of the invention provides a system of packaging the RNA sequence of the invention or the RNA sequence transcribed from the polynucleotide of the invention into a DNA virus viral particle, the system comprising: (1) one or more proteins for assemblying the protein shell (e.g., VP1, VP2, and/or VP3 for assembling AAV capsid) of the DNA virus viral particle for packaging the RNA sequence, or one or more coding sequences thereof; (2) one or more proteins (e.g., Rep78, Rep68, Rep52, and/or Rep40 for AAV packaging) for facilitating the assemblying of the protein shell and/or the packaging of the RNA sequence of the invention into the protein shell of the DNA virus viral particle, or one or more coding sequences thereof (e.g., adenoviral E2a, E4, and VA genes) ; and (3) the RPS-interacting molecule or a coding sequence thereof.
- the protein shell e.g., VP1, VP2, and/or VP3 for assembling AAV caps
- the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the RNA sequence of the invention or on the polynucleotide of the invention, (2) modifying, e.g., mutating, the AAV rep gene, the AAV cap gene, and/or the one or more coding sequences for one or more proteins required for AAV packaging to reduce, diminish, or substantially eliminate the capacity of the respective translated protein to facilitate the packaging of the DNA sequence into the DNA virus viral particle (e.g., a Y156F mutation in the common sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu) ; and/or (3) enlarging the size of the polynucleotide encoding the RNA sequence of the invention or the polynucleotide of the invention.
- the DNA packaging signals such as AAV I
- Another aspect of the invention provides a method of delivering an RNA sequence of interest (RSI) into a cell, a plant, or an animal, the method comprising contacting the cell, the plant, or the animal with the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, the population of recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, or the recombinant DNA virus viral particle (e.g., rRAAV particle) or the population of recombinant DNA virus viral particles (e.g., rRAAV particles) produced by the method of the invention, wherein the GOI is optionally encoded by the RNA sequence of the invention.
- rRAAV particle the recombinant DNA virus viral particle
- the population of recombinant DNA virus viral particles e.g., rRAAV particles
- the recombinant DNA virus viral particle e.g., rRAAV particle
- Another aspect of the invention provides a method of diagnosing, preventing, or treating a disease or disorder in a subject in need thereof, comprising administrating to the subject a therapeutically effective amount or dose of the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, or produced by the method of the invention.
- a therapeutically effective amount or dose of the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention or produced by the method of the invention.
- Another aspect of the invention provides a use of the recombinant DNA virus viral particle (e.g., rRAAV particle) of the invention, the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) of the invention, or the recombinant DNA virus viral particle (e.g., rRAAV particle) or the population of the recombinant DNA virus viral particles (e.g., rRAAV particles) produced by the method of the invention, in the manufacture of a medicament for diagnosing, preventing, or treating a disease or disorder in a subject in need thereof.
- the recombinant DNA virus viral particle e.g., rRAAV particle
- the population of the recombinant DNA virus viral particles e.g., rRAAV particles
- the recombinant DNA virus viral particle e.g., rRAAV particle
- the recombinant DNA virus viral particle e.g., rRAAV particle
- Another aspect of the invention provides a fusion protein or a conjugate, comprising an RPSIP of the invention fused or conjugated to a protein component of the viral packaging system for the DNA virus, wherein the RPSIP interacts with /binds to an RPS on the RNA sequence of the invention to facilitate the packaging of the RNA sequence into the DNA virus.
- the RPS is MS2, and the RPSIP is MCP.
- the RPS is PP7 binding site
- the RPSIP is PCP
- the RPS is com
- the RPSIP is phage COM protein
- the fusion or conjugate comprises more than one RPSIP, each independently binds to one or more RPS on the RNA sequence of the invention. In certain embodiments, at least two of the more than one RPSIP are identical. In certain embodiments, at least two of the more than one RPSIP are different.
- the fusion or conjugate comprises two MCP in tandem.
- the protein component of the viral packaging system for the DNA virus comprises a Rep protein of an AAV, such as a Rep68 or a Rep78 of the AAV.
- the Rep protein comprises one or more mutations that compromises or diminishes trs-endonuclease activity.
- the mutations comprise the Y156F mutation, the KDE-mu mutation, and/or the EKE-mu mutation.
- the protein component of the viral packaging system for the DNA virus comprises an assembly-activating protein (AAP) .
- AAP assembly-activating protein
- the RPSIP is fused to the protein component of the viral packaging system for the DNA virus (e.g., a Rep protien or an AAP) directly.
- the DNA virus e.g., a Rep protien or an AAP
- the RPSIP is fused to the protein component of the viral packaging system for the DNA virus (e.g., a Rep protien or an AAP) through a peptide linker.
- the DNA virus e.g., a Rep protien or an AAP
- the peptide linker is a flexible linker, such as a Gly and Ser containing linker.
- the Gly and Ser containing linker comprises 1-20 repeats (e.g., 1-5 or 1-3 repeats) of GS n , wherein n is 1, 2, 3, 4, or 5.
- the GS n linker is GS 2 , GS 3 , or GS 4 , with 1-4 (e.g., 2) repeats.
- the linker is GSSGSS.
- the fusion protein comprises MCP and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and/or a EKE-mu mutation.
- MCP is fused N-terminal to Rep (MCP-Rep) .
- the Rep fused to MCP comprises a Y156F mutation, a KDE-mu mutation, and/or a EKE-mu mutation.
- the MCP-Rep fusion is linked by a GS n linker, such as GSSGSS.
- the MCP-Rep comprises two MCP in tandem (e.g., without any linker between the two MCP moieties) .
- the MCP is C-terminal to another GS n linker, such as GSSGSS.
- the fusion protein comprises PCP and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and/or a EKE-mu mutation.
- PCP is fused N-terminal to Rep (PCP-Rep) .
- the Rep fused to PCP comprises a Y156F mutation, a KDE-mu mutation, and/or a EKE-mu mutation.
- the PCP-Rep fusion is linked by a GS n linker, such as GSSGSS.
- the PCP-Rep comprises two PCP in tandem (e.g., without any linker between the two PCP moieties) .
- the PCP is C-terminal to another GS n linker, such as GSSGSS.
- the fusion protein comprises COM and Rep, wherein the Rep optionally comprises a Y156F mutation, a KDE-mu mutation, and/or a EKE-mu mutation.
- COM is fused N-terminal to Rep (COM-Rep) .
- the Rep fused to COM comprises a Y156F mutation, a KDE-mu mutation, and/or a EKE-mu mutation.
- the COM-Rep fusion is linked by a GS n linker, such as GSSGSS.
- the COM-Rep comprises two COM in tandem (e.g., without any linker between the two COM moieties) .
- the COM is C-terminal to another GS n linker, such as GSSGSS.
- the fusion protein comprises MCP and AAP.
- MCP is fused N-terminal to AAP (MCP-AAP, or MA) .
- MCP is fused C-terminal to AAP (AAP-MCP, or AM) .
- the MCP-AAP or AAP-MCP fusion is linked by a GS n linker, such as GSSGSS.
- the MCP-AAP fusion is C-terminal to another GS n linker, such as GSSGSS.
- the AAP-MCP fusion is N-terminal to another GS n linker, such as GSSGSS.
- Another aspect of the invention provides a polynucleotide encoding any one of the fusions between the RPSIP of the invention and the protein component of the viral packaging system for the DNA virus (e.g., AAP or a Rep protein) .
- the DNA virus e.g., AAP or a Rep protein
- AAV particles packaging ribopolynucleotides of the invention may comprise or be derived from any natural or recombinant AAV serotypes.
- the AAV particles may utilize or be based on a serotype selected from any of the following serotypes, and variants thereof, including but not limited to: AAV1, AAV10, AAV106.1/hu. 37, AAV11, AAV114.3/hu. 40, AAV 12, AAV127.2/hu. 41, AAV127.5/hu. 42, AAV128.1/hu. 43, AAV128.3/hu. 44, AAV130.4/hu. 48, AAV145.1/hu. 53, AAV145.5/hu. 54, AAV145.6/hu. 55, AAV16.12/hu. l 1, AAV16.3, AAV16.8/hu.
- AAV5 AAV52.1/hu. 20, AAV52/hu. 19, AAV5-22/rh. 58, AAV5-3/rh. 57, AAV54.1/hu. 21, AAV54.2/hu. 22, AAV54.4R/hu. 27, AAV54.5/hu. 23, AAV54.7 /hu. 24, AAV58.2/hu. 25, AAV6, AAV6.1, AAV6.1.2, AAV6.2, AAV7, AAV7.2, AAV7.3/hu.
- AAV8 AAV-8b, AAV-8h, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV A3.3, AAV A3.4, AAV A3.5, AAV A3.7, AAV-b, AAVC1, AAVC2, AAVC5, AAVCh. 5, AAVCh. 5R1, AAVcy. 2, AAVcy. 3, AAVcy. 4, AAVcy. 5, AAVCy. 5Rl, AAVCy. 5R2, AAVCy. 5R3, AAVCy. 5R4, AAVcy.
- AAVhu. l AAVhu. 12, AAVhu. 13, AAVhu. 14/9, AAVhu. 15, AAVhu. 16, AAVhu. 17, AAVhu. 18, AAVhu. 19, AAVhu. 2, AAVhu. 20, AAVhu. 21, AAVhu. 22, AAVhu. 23.2, AAVhu. 24, AAVhu. 25, AAVhu. 27, AAVhu. 28, AAVhu. 29, AAVhu. 29R, AAVhu. 3, AAVhu. 31, AAVhu. 32, AAVhu. 34, AAVhu. 35, AAVhu. 37, AAVhu. 39, AAVhu. 4, AAVhu.
- AAVLG-9/hu. 39 AAVLG-9/hu.
- AAVrh. 64R2 AAVrh. 65, AAVrh. 67, AAVrh. 68, AAVrh. 69, AAVrh. 70, AAVrh. 72, AAVrh. 73, AAVrh. 74, AAVrh. 8, AAVrh.
- AAVrh8R AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, bovine AAV, caprine AAV, Japanese AAV 10, true type AAV (ttAAV) , UPENN AAV 10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and/or AAV SM 10-8.
- the AAV serotype may comprise a mutation in the AAV9 sequence, such as the sequence described by Pulichla et al. (Molecular Therapy 19 (6) : 1070-1078, 2011) , such as AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.
- the AAV serotype may comprise a sequence described in US 6,156,303, such as AAV3B (SEQ ID NOs: 1 and 10 of US 6,156,303) , AAV6 (SEQ ID NOs: 2, 7 and 11 of US 6,156,303) , AAV2 (SEQ ID NOs: 3 and 8 of US 6,156,303) , AAV3A (SEQ ID NOs: 4 and 9, of US 6,156,303) , or derivatives thereof.
- AAV3B SEQ ID NOs: 1 and 10 of US 6,156,303
- AAV6 SEQ ID NOs: 2, 7 and 11 of US 6,156,303
- AAV2 SEQ ID NOs: 3 and 8 of US 6,156,303
- AAV3A SEQ ID NOs: 4 and 9, of US 6,156,303
- the serotype may be AAV-DJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8) , as described by Grimm et al. (Journal of Virology 82 (12) : 5887-5911, 2008) .
- the amino acid sequence of AAV-DJ8 may comprise two or more mutations in order to remove the heparin binding domain (HBD) .
- the AAV-DJ sequence described as SEQ ID NO: 1 in US 7, 588, 772 may comprise two mutations: (1) R587Q (Arg at amino acid 587 is changed to glutamine Gln) , and (2) R590T.
- the AAV-DJ sequence may comprise three mutations: (1) K406R, (2) R587Q, and (3) R590T.
- the AAV serotype may comprise a sequence as described in WO2015/121501, such as true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015/121501) , the so-called UPenn AAV10 (SEQ ID NO: 8 of WO2015/121501) , or the so-called Japanese AAV10 (SEQ ID NO: 9 of WO2015/121501) , or variants thereof.
- true type AAV ttAAV
- UPenn AAV10 SEQ ID NO: 8 of WO2015/121501
- Japanese AAV10 SEQ ID NO: 9 of WO2015/121501
- AAV capsid serotype selection or use may be from a variety of species.
- the AAV may be an avian AAV (aAAV) .
- the aAAV serotype may comprise a sequence described in US 9,238,800, such as aAAV (SEQ ID NOs: 1, 2, 4, 6, 8, 10, 12, and 14 of US 9,238,800) , or variants thereof.
- the AAV may be a bovine AAV (bAAV) .
- the bAAV serotype may comprise a sequence described in US 9,193,769, such as bAAV (SEQ ID NOs: 1 and 6 of US 9,193,769) , or variants thereof.
- the bAAV serotype may comprise a sequence as described in US 7,427,396, such as bAAV (SEQ ID NOs: 5 and 6 of US 7,427,396) , or variants thereof.
- the AAV may be a caprine AAV.
- the caprine AAV serotype may comprise a sequence described in US 7,427,396, such as caprine AAV (SEQ ID NO: 3 of US 7,427,396) , or variants thereof.
- the AAV may be engineered as a hybrid AAV from two or more parental serotypes.
- the AAV may be AAV2G9, which comprises sequences from AAV2 and AAV9.
- the AAV2G9 AAV serotype may comprise a sequence described in US 2016-0017005 A1. (incorporated herein by reference) .
- the AAV may be a serotype generated by the AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering) as described by Puajila et al. (Molecular Therapy 19 (6) : 1070-1078, 2011, incorporated herein by reference) .
- the serotype and corresponding nucleotide and amino acid substitutions may be, but is not limited to: AAV9.1 (G1594C; D532H) , AAV6.2 (T1418A and T1436X; V473D and I479K) , AAV9.3 (T1238A; F413Y) , AAV9.4 (T1250C and A1617T; F417S) , AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V) , AAV9.6 (T1231A; F411I) , AAV9.9 (G1203A, G1785T, W595C) , AAV9.10 (A1500G, T1676C; M559T) , AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L) , AAV9.13 (A1369C, A17
- the AAV may be a serotype comprising at least one AAV capsid CD8 + T-cell epitope.
- the serotype may be AAV1, AAV2 or AAV 8.
- the AAV may be a variant, such as PHP. A or PHP. B as described in Deverman (Nature Biotechnology. 34 (2) : 204-209, 2016, incorporated herein by reference) .
- the AAV may be a serotype generated by Cre-recombination-based AAV targeted evolution (CREATE) described by Deverman et al., (Nature Biotechnology 34 (2) : 204-209, 2016, incorporated herein by reference) .
- CREATE Cre-recombination-based AAV targeted evolution
- the AAV serotypes generated in this manner have improved CNS transduction and/or neuronal and astrocytic tropism, as compared to other AAV serotypes.
- the AAV serotypes may be an AAV9 derivative with a 7-amino acid insertion between amino acids 588-589.
- Non-limiting examples of these 7-amino acid insertions include PHP. A, PHP. B, PHP. B2, PHP. B3, PHP. N, PHP. S, G2A12, G2A15, G2A3, G2B4, and G2B5.
- the AAV may be a serotype selected from any of those found in SEQ ID NOs: 4, 734-5, 302 and in Table 2 of WO2018/002719A1 (incorporated herein by reference) .
- the AAV may be encoded by a sequence, fragment or variant as described in SEQ ID NOs: 4,734-5,302 of WO2018/002719A1 (incorporated herein by reference) .
- the AAV VP1 capsid sequence is one of the following: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP. eB, Anc80L65, Anc80L65AAP, or 7m8.
- Protein sequences of the above representative VP1 capsids are provided below.
- RNA transcribed AAV ITR sequences
- Any transcribed AAV ITR sequences can be modified according to the disclosure herein, by engineering the encoding modified AAV ITR DNA template to, e.g., eliminate or inactivate the TRS or equivalent thereof, and/or to eliminate the D region sequence thereof.
- the transcribed modified AAV ITR, resulting from transcribing such modified AAV ITR DNA template retains the ability to facilitate the packaging of the RNA sequence of the invention into an AAV viral particle.
- the ITRs are nicked by the virus-encoded Rep proteins at the terminal resolution site (TRS) .
- This origin function requires three DNA sequence elements, namely the Rep binding element (RBE) , a small palindrome that comprises a single tip of an internal hairpin within the terminal repeat (RBE’) , and the TRS.
- Rep is tethered to the RBE (DNA) in a specific orientation during TRS nicking. This orientation appears to align Rep on the AAV ITR, allowing specific nucleotide contacts with the RBE’ and directing nicking to the TRS. Alterations in the polarity or position of the RBE relative to the TRS greatly inhibit Rep nicking.
- RNA transcribed modified ITR sequence
- the transcribed modified ITR sequence of the invention is preferably located closer to the 3’ end of the RNA sequence of the invention.
- the RNA sequence of the invention comprises two transcribed modified ITR sequences.
- the two transcribed modified ITR sequences may be derived from the same AAV serotype.
- the two transcribed modified ITR sequences may be derived from two different AAVs of different serotypes.
- the transcribed modified ITR sequence (s) include (s) an insertion, deletion, and/or a mutation.
- the rRAAV RNA sequence of the invention comprises one transcribed modified /mutated ITR sequence and one transcribed wild-type ITR sequence.
- the transcribed modified ITR sequence (s) is/are based on a wild-type ITR in either the flip orientation or the flop orientation.
- the subject transcribed modified ITR sequences, or their coding DNA sequences can be readily prepared based on wild-type ITR sequences known in the art.
- Wild-type ITR sequences including at least the following sequences listed in Table 1.
- a multi-sequence alignment for the 5’ ITR sequences, and a multi-sequence alignment for the 3’ ITR sequences of AAV1-AAV7 are shown in FIGs. 1B and 1C, respectively, including the consensus sequences, the TRS, the RBE, and the D region sequences.
- RBE sequence refers to the AAV ITR sequences within the A: A’ palindromic stem sequences that, when base-paired, form a stem (usually a double stranded region of about 21-23, or about 22 bp) and facilitate ITR binding to AAV Rep proteins (Rep78 and Rep68) .
- a representative RBE sequence is shown in FIG. 1A, in both the flip and flop configurations of the wild-type AAV2 ITR.
- Wild-type ITR sequences of the numerous AAV serotypes known in the art are readily available, each can be aligned with the other AAV ITRs as in FIGs. 1B and 1C. The results of the alignment can be used to identify the RBE sequences for any AAV ITR.
- a “transcribed (functional) RBE” refers to a transcribed RNA corresponding to the RBE DNA template, which is either wild-type RBE, or a functional variant thereof with one or more nucleotide insertions, deletions, substitutions, and/or other mutations, so long as the functional variant RBE substantially retains the ability to bind to Rep (e.g., retains at least about 60%, 70%, 80%, 90%, 95%, or enhanced binding to Rep of the same serotype) .
- the RBE DNA template or the transcribed RBE RNA differs from the wild-type sequence by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 nucleotide (s) .
- the functional RBE comprises up to about 30%, 25%, 20%, 15%, 10%, or 5%of sequence variation compared to the wild-type RBE, due to, for example, insertion, deletion, substitution, and/or other mutation of one or more nucleotides of the RBE.
- the nucleotide sequence difference does not result in loss of paired base pair (e.g., a GC pair in the wild-type RBE can be changed to CG, AT/AU or TA/UA in the variant RBE without losing the original paired base pair) .
- the transcribed modified ITR sequence retains a transcribed Rep-binding element (transcribed RBE) or a functional variant thereof, to facilitate Rep-mediated packaging.
- RNA transcribed modified ITR sequence
- RBE transcribed Rep-binding element
- the RBE DNA sequence for wild-type AAV2 ITR is SEQ ID NO: 5.
- the transcribed modified ITR sequence (RNA) further retains a transcribed Rep-binding element’ (transcribed RBE’) sequence.
- RNA transcribed modified ITR sequence
- RBE transcribed Rep-binding element
- the transcribed modified ITR sequence lacks a transcribed TRS, and/or a transcribed rcTRS, or both.
- the RNA sequence of the invention lacks a transcribed (functional) TRS sequence, due to the fact that its corresponding DNA sequence lacks certain sequence elements of the wild-type TRS, such that wild-type TRS function is lost in the DNA (e.g., the sequence or internal strand normally occupied by the wild-type TRS sequence between the A: A’ segment and D region sequence, which is normally recognized and cleaved by endonuclease during AAV replication, is not cleaved if present in the ssDNA vector genome of AAV ITR) .
- the reverse complement of the TRS may be deleted or mutated, as in the dITR and dITR-D sequence used in the examples.
- the TRS normally between the A: A’ segment and D region sequence may lack one or more nucleotides, or have one or more nucleotide substitutions or mutations (such as lacking or substituting /mutating 4 nucleotides in the dITR sequence used in the examples) .
- the entire or nearly the entire TRS /rcTRS in the wild-type sequence is deleted such that the resulting RNA transcript lacks a functional TRS sequence.
- a part of the wild-type TRS /rcTRS sequence is altered /mutated by, for example, having an insertion, deletion, substitution, and/or other mutation in the wild-type sequence, such that the mutated TRS /rcTRS produces a corresponding RNA transcript that lacks a transcribed functional TRS.
- 1 2, 3, 4, or 5 consecutive or non-consecutive TRS nucleotides and/or rcTRS nucleotides can be deleted or substituted in a mutated sequence.
- the transcribed modified ITR sequence is transcribed from a modified ITR lacking a D region sequence, or at least a functional D region sequence (D sequence or D’ sequence, depending on the flip or flop configuration) .
- the entire D region sequence is deleted such that the resulting RNA transcript lacks a transcribed functional D region sequence.
- at least a portion of the D region sequence is mutated (e.g., having deletion, insertion, substitution, and/or other mutation) such that the resulting RNA transcript lacks a transcribed functional D region sequence.
- the mutated D region sequence has no more than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of the wild-type sequence.
- the modified ITR sequence (DNA template) lacks 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 most 5’ end nucleotides of the wild-type ITR sequence.
- the dITR sequence (SEQ ID NO: 2) and the dITR-D sequence (SEQ ID NO: 3) both lack the most 5’ end 8 nucleotides compared to the wild-type ITR sequence (SEQ ID NO: 1) .
- RNA sequences encoding any of the above described transcribed RNA coding sequence (DNA coding sequence for the GOI) , transcribed modified AAV ITR (modified AAV ITR) , transcribed functional RBE (functional RBE) , transcribed functional D region sequence (functional D region sequence) , and transcribed functional TRS sequence (functional TRS sequence) are expressly contemplated as within the scope of the invention.
- RNA sequence of the invention to be encapsidated in the rRAAV viral particles of the invention may further comprise additional optional sequence elements (such as expression control elements) that may enhance or regulate the expression of the GOI.
- RNA sequence of the invention facilitate proper heterologous polynucleotide (e.g., GOI) transcription and/or translation, including, e.g., splicing signal for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA and, stop codons etc.
- heterologous polynucleotide e.g., GOI
- expression control elements are nucleic acid sequence (s) , such as promoters and enhancers that influence expression of an operably linked heterologous polynucleotide (e.g., GOI) .
- s nucleic acid sequence
- Such elements typically act in cis but may also act in trans.
- Expression control can be effected at the level of transcription, translation, splicing, message stability, etc.
- an expression control element that modulates transcription is juxtaposed near the 5' end (i.e., “upstream” ) of the transcribed polynucleotide.
- Expression control elements can also be located at the 3' end (i.e., “downstream” ) of the transcribed sequence or within the transcript (e.g., in an intron) . Expression control elements can be located at a distance away from the transcribed gene of interest sequence (e.g., 100 to 500, 500 to 1000, 2,000 to 5,000, or more nucleotides from the gene of interest polynucleotide) . Nevertheless, owing to the polynucleotide length limitations for viral vectors, such as AAV vectors, such expression control elements will typically be within 1-1,000, 1-500, 1-250, or 1-100 nucleotides from the transcribed gene of interest sequence.
- RNA sequence of the invention or DNA encoding the RNA sequence of the invention, are described in further details herein below.
- Introns are known to possess a posttranscriptional regulatory element that efficiently induces transport of mRNA out of the nucleus and enhances mRNA stability.
- the rRAAV can include one or more introns or a fragment thereof.
- the one or more introns are fragments of the gene of interest.
- the one or more introns are heterologous to the gene of interest.
- Introns have been reported to affect the levels of gene expression. This effect is known as Intron Mediated Enhancement (IME) of gene expression (Lu et al., Mol Genet Genomics 279: 563-572,2008) .
- the levels of gene expression are increases by about 1.5-fold, about 2-fold, about 2.5-fold, about 3-fold, about 3.5 fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold, about 7.5-fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, or about 10-fold when compared to gene expression from a sequence without the one or more introns.
- Non-limiting introns include SV40 intron, beta globin intron, and short chimeric intron (CIB) .
- Other introns include the ColE2-RNA-OUT, OIPR, and R6K-RNA-OUT introns described in Lu et al., Hum Gene Ther. 2017; 28 (1) : 125-134 (incorporated by reference) ; the human hemoglobin subunit beta (HBB2) synthetic intron (Snyder et al., Hum Gene Ther, 8 (1997) , pp. 1891-1900, incorporated by reference) .
- HBB2 human hemoglobin subunit beta
- the one or more introns may be less than 25 nucleotides, less than 50 nucleotides, less than 100 nucleotides, less than 150 nucleotides, less than 200 nucleotides, less than 250 nucleotides, less than 300 nucleotides, less than 350 nucleotides, less than 400 nucleotides, less than 450 nucleotides, or less than 500 nucleotides.
- the one or more introns may be more than 25 nucleotides, more than 50 nucleotides, more than 100 nucleotides, more than 150 nucleotides, more than 200 nucleotides, more than 250 nucleotides, more than 300 nucleotides, more than 350 nucleotides, more than 400 nucleotides, more than 450 nucleotides, or more than 500 nucleotides.
- the one or more introns may be about 50 to about 100 nucleotides, about 50 to about 200 nucleotides, about 50 to about 300 nucleotides, about 50 to about 400 nucleotides, about 50 to about 500 nucleotides, about 100 to about 200 nucleotides, about 100 to about 300 nucleotides, about 100 to about 400 nucleotides, about 100 to about 500 nucleotides, about 200 to about 300 nucleotides, about 200 to about 400 nucleotides, about 200 to about 500 nucleotides, about 300 to about 400 nucleotides, about 300 to about 500 nucleotides, or about 400 to about 500 nucleotides.
- Enhancer can refer to a sequence that is located adjacent to the gene of interest. Enhancer elements are typically located upstream of a promoter element in the DNA encoding the RNA sequence of the invention, but can also be located downstream of or within an intron sequence (e.g., a gene of interest) and remain functional. Thus the enhancer or part thereof may be present in the transcribed RNA sequence of the invention.
- Non-limiting examples of suitable enhancers include a CMV enhancer.
- an enhancer element can be located 100 base pairs,200 base pairs, or 300 or more base pairs upstream or downstream of a gene of interest (e.g., in the RNA sequence of the invention or a DNA coding sequence therefor) .
- Enhancer elements typically increase expressed of a gene of interest above increased expression afforded by a promoter element.
- UTRs refer to RNA that are not translated after transcription.
- the 5’ UTR is upstream of the start code of the gene of interest and the 3’ UTR is downstream of the stop codon of the gene of interest.
- the 5’ and/or 3’ UTRs may have an insertion, deletion, or modification to enhance stability of the transcribed gene of interest.
- the 5′UTR may comprise a translation initiation sequence such as, but not limited to, a Kozak sequence and an internal ribosome entry site (IRES) .
- Kozak sequences have the consensus CCR (A/G) CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG) , which is followed by another ‘G’ .
- 3′UTRs are known to have stretches of Adenosines and Uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995) : Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA (U/A) (U/A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined.
- the 5’ UTR and/or 3’ UTR may comprise heterologous sequence to the gene of interest. In some embodiments, the 5’ UTR and/or 3’ UTR are native to the gene of interest.
- a 5’ UTR and/or a 3’ UTR from an mRNA normally expressed in a specific tissue or organ such as lung, liver, pancreas, endothelial cells, CNS, neurons, astrocytes, skeletal muscle, cardiac muscle, smooth muscle, blood, hematopoietic cells may be used in the RNA sequence of the invention comprising a GOI targeted to one or more of these tissues.
- the RNA sequence of the invention comprise a transcribed modified AAV ITR that is 5’ to a polyA sequence, a polyA signal sequence (e.g., AAUAAA) , or a sequence for RNA transcription termination (e.g., a histone downstream element) .
- polyA sequence ” “polyA tail, ” “polyA signal sequence, ” and “a sequence for RNA transcription termination” are defined herein above.
- the RNA sequence of the invention comprises a polyA tail.
- RNA sequence can be packaged into the rRAAV viral particles of the invention and be delivered directly into a target cell, and the GOI encoded by the RNA sequence of the invention can be directly translated.
- the RNA sequence of the invention comprises a polyA signal sequence and optionally a transcribed GU-rich region downstream of the polyA site.
- RNA sequence can be packaged into the rRAAV viral particles of the invention and be delivered directly into a target cell.
- the polyA signal sequence may be recognized and further processed by the cytosolic polyA addition enzymes to produce a polyA tail, before the GOI encoded by the RNA sequence of the invention is translated.
- Representative polyA signal sequence and surrounding sequences include human growth hormone (hGH) polyA sequence (see Liu et al., Gene Ther 20: 308–317, 2013, incorporated by reference) , bovine growth hormone polyadenylation signal (bGHpA) (Goodwin and Rottman, J Biol Chem. 1992 Aug 15; 267 (23) : 16330-4, incorporated by reference) , SV40 early or late polyadenylation signal, and the synthetic polyA signal used in Choi et al. (Mol Brain. 2014; 7: 17, incorporated herein by reference) .
- hGH human growth hormone
- bGHpA bovine growth hormone polyadenylation signal
- SV40 early or late polyadenylation signal SV40 early or late polyadenylation signal
- synthetic polyA signal used in Choi et al. (Mol Brain. 2014; 7: 17, incorporated herein by reference) .
- a “transcription enhancer” refer to cis-acting nucleotide sequences that can increase the transcription of the gene of interest.
- the transcription enhancer can be located in the intron or partially in an exon region of the transcribed RAAV RNA sequence of the invention.
- the RNA sequence of the invention comprises a transcribed WPRE sequence, encoded by the WPRE sequence on the encoding DNA.
- Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is a 600-bp or so DNA sequence that, when transcribed, creates a tertiary structure enhancing expression.
- WPRE is commonly used in molecular biology to increase expression of genes delivered by viral vectors. It is a tripartite regulatory element with gamma, alpha, and beta components.
- the alpha component is 80 bp long: GCCACGGCGGAACTCATCGCCGCC TGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGG T (SEQ ID NO: 39) .
- the alpha component is only 9%as active as the full tripartite WPRE sequence, which is 100%identical to base pairs 1093-1684 of the Woodchuck hepatitis B virus (WHV8) genome.
- the transcribed WPRE sequence or part thereof (such as the gamma, alpha, and beta elements, preferably in the given order) is present in a 3’ UTR region of a GOI on the subject RNA sequence encapsidated in the rRAAV viral particle of the invention, to substantially increase stability and protein yield of the RNA sequence of the invention.
- the WPRE sequence is a shorted WPRE (WPRE2) containing a minimal gamma element and a partial alpha-beta element (see Kalev-Zylinska, J Neurosci. 2007, 27: 10456-10467, incorporated by reference) .
- the WPRE sequence is a shorted WPRE (WPRE3) containing minimal gamma and alpha elements (see Choi et al., Mol Brain 7, 17 (2014) , incorporated by reference) .
- the RNA sequence of the invention comprises a WPRE sequence and a GOI lacking introns.
- promoter as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
- RNA sequence of the invention does not comprise a promoter.
- a DNA encoding the RNA sequence of the invention (such as an expression cassette or expression vector encoding the RNA sequence of the invention) comprises a promoter for transcribing the RNA sequence of the invention.
- promoter/regulatory sequence means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence. In other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
- the promoter /regulatory sequence may, for example, be one which expresses the gene product (e.g., the RNA sequence of the invention) in a tissue or cell type specific manner.
- operable linkage or “operably linked” refers to a physical or functional juxtaposition of the components so described as to permit them to function in their intended manner.
- the relationship is such that the control element modulates expression of the heterologous polynucleotide.
- two DNA sequences operably linked means that the two DNAs are arranged (cis or trans) in such a relationship that at least one of the DNA sequences is able to exert a physiological effect upon the other sequence.
- the promoter is a constitutive promoter.
- a “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
- a promoter that can be used to constitutively drive the expression of the RNA sequence of the invention from a DNA encoding the same can include: a ⁇ glucuronidase (GUSB) promoter, a cytomegalovirus (CMV) immediate-early (Ie) enhancer and/or promoter, a chicken ⁇ -actin (CBA) promoter or derivative thereof such as a CAG promoter, CB promoter, a (human) elongation factor 1 ⁇ -subunit (EF1 ⁇ ) promoter, and a ubiquitin C (UBC) promoter.
- GUSB ⁇ glucuronidase
- CMV cytomegalovirus
- Ie immediate-early
- CBA chicken ⁇ -actin
- CAG promoter CAG promoter
- CB promoter a (human) elongation factor 1 ⁇ -subunit (EF1 ⁇ ) promoter
- UBC ubiquitin C
- the promoter is an inducible promoter.
- an “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
- the promoter is a tissue-specific promoter, a species specific promoter, or a cell cycle-specific promoter. See Parr et al., Nat. Med. 3: 1145-9, 1997 (entire contents incorporated herein by reference) .
- tissue-or cell-type-specific promoter is a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a specific cell type or a specific tissue preferentially, due to, for example, the cell /tissue is a cell type or tissue type in which the promoter is normally active.
- Tissue-or cell type-specific promoters may include neuronal tissue specific promoter; CNS-or PNS-specific promoter such as astrocyte, oligodendrocyte, or neuronal promotor; hematopietic lineage specific promoter such as B cell promoter, T cell promoter, NK cell promoter, monocyte promoter, leukocyte promoter, macrophage promoter; endothelial cell promoter; pancreatic promoter; liver /hepatic cell promoter; lung tissue promoter, etc.
- CNS-or PNS-specific promoter such as astrocyte, oligodendrocyte, or neuronal promotor
- hematopietic lineage specific promoter such as B cell promoter, T cell promoter, NK cell promoter, monocyte promoter, leukocyte promoter, macrophage promoter
- endothelial cell promoter pancreatic promoter
- liver /hepatic cell promoter lung tissue promoter, etc.
- tissue-specific promoters include prion promoter, neuron-specific enolase (NSE) , neurofilament light (NFL) promoter, neurofilament heavy (NFH) promoter, platelet-derived growth factor (PDGF) , platelet-derived growth factor B-chain (PDGF- ⁇ ) , synapsin (Syn) , synapsin 1 (Syn1) , methyl-CpG binding protein 2 (MeCP2) , Ca2+/calmodulin-dependent protein kinase II (CaMKII) , metabotropic glutamate receptor 2 (mGluR2) , neurofilament light (NFL) or heavy (NFH) , ⁇ -globin minigene n ⁇ 2, preproenkephalin (PPE) , enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2) promoters.
- NSE neuron-specific enolase
- NSE neurofilament light
- Astrocyte-specific promoters include glial fibrillary acidic protein (GFAP) and EAAT2 promoters.
- Oligodendrocyte-specific promoters include the myelin basic protein (MBP) promoter.
- MBP myelin basic protein
- the promoter is heterologous to the gene of interest. In some embodiments, the promoter is the natural promoter of the gene of interest. In some embodiments, the heterologous promoter includes an insertion, deletion, substitution, and/or other mutation. In some embodiments, the natural promoter includes an insertion, deletion, substitution, and/or other mutation.
- the promoter is a Pol II promoter. In certain embodiments, the promoter is a Pol III promoter, such as U6 promoter.
- a “vector” generally refers to a composition of matter which comprises an isolated nucleic acid (DNA or RNA) and which can be used to deliver the isolated nucleic acid to the interior of a cell.
- “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
- An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
- Expression vectors include all those known in the art, such as cosmids, plasmids, bacmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
- An rRAAV RNA sequence of the invention comprising a GOI is a vector for delivering the GOI into a target /host cell through a rRAAV viral particle encapsidating the vector.
- the rRAAV RNA sequence of the invention is encoded by a DNA expression vector, such as a plasmid or bacmid (e.g., one that can be maintained or replicated like a baculovirus inside an insect cell) .
- a DNA expression vector can transcribe the RNA sequence of the invention within a suitable host cell, such as a mammalian packaging cell (e.g., HEK293T cells) or an insect packaging cell (e.g., Sf9 cells) , such that the subject rRAAV viral particles can be produced in the presence of other elements necessary for rRAAV packaging (such as rep and cap coding sequences) .
- vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
- vector includes an autonomously replicating plasmid or a virus.
- the term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
- viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
- the RAAV is transcribed from a plasmid or bacmid.
- the plasmid or bacmid can include the gene of interest sequence.
- the promoter is operably linked to the gene of interest and is located upstream of the gene of interest. In some embodiments, promoter is not in the transcribed RAAV.
- the invention provides an isolated rRAAV viral particle comprising any one of the RNA sequence of the invention encapsidated within any one of the AAV capsid or viral particle described herein.
- the AAV capsid or viral particle is of a serotype or a combination of one or more serotypes described herein.
- RNA may be either a single stranded (ss) nucleic acid or a double stranded (ds) , self-complementary (sc) nucleic acid.
- a related aspect of the invention provides a population of recombinant viral particles (e.g., rRAAV particles) comprising a plurality of recombinant viral particle (e.g., rRAAV particle) of the invention, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or more of the recombinant viral particles (e.g., rRAAV particles) within the population have encapsidated RNA sequence of the invention.
- recombinant viral particles e.g., rRAAV particles
- the population of rRAAV particles contain a plurality of rRAAV viral particle of the invention, wherein about 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or more of the rRAAV particles within the population have encapsidated RNA sequence of the invention.
- the population of recombinant viral particles comprises at least 1 ⁇ 10 4 viral particles, at least 2 ⁇ 10 4 viral particles, at least 5 ⁇ 10 4 viral particles, at least 1 ⁇ 10 5 viral particles, at least 2 ⁇ 10 5 viral particles, at least 5 ⁇ 10 5 viral particles, at least 1 ⁇ 10 6 viral particles, at least 2 ⁇ 10 6 viral particles, at least 5 ⁇ 10 6 viral particles, at least 1 ⁇ 10 7 viral particles, at least 2 ⁇ 10 7 viral particles, at least 5 ⁇ 10 7 viral particles, at least 1 ⁇ 10 8 viral particles, at least 2 ⁇ 10 8 viral particles, at least 5 ⁇ 10 8 viral particles, at least 1 ⁇ 10 9 viral particles, at least 2 ⁇ 10 9 viral particles, at least 5 ⁇ 10 9 viral particles, at least 1 ⁇ 10 10 viral particles, at least 2 ⁇ 10 10 viral particles, at least 5 ⁇ 10 9 viral particles, at least 1 ⁇ 10 10 viral particles, at least 2 ⁇ 10 10 viral particles, at least 5 ⁇ 10 9 viral particles, at least 1
- non-RNA e.g., DNA
- AAV vector serotypes can be matched to target cell types.
- Table 2 of WO2018002719A1 lists exemplary cell types that can be transduced by the indicated AAV serotypes (incorporated herein by reference) .
- Packaging cells are used to form virus particles that are capable of infecting a host cell.
- Such cells include HEK293 and Sf9 cells, which can be used to package AAV and adenovirus.
- Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle.
- the vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable) , other viral sequences being replaced by an expression cassette encoding the protein to be expressed.
- the missing viral functions can be supplied in trans by the packaging cell line, usually as a result of expression of these viral functions /proteins (such as the rep and cap genes for AAV) either as transgenes integrated into the packaging cell, or as transgenes on a second viral vector or expression vector introduced into the packaging cell.
- AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome.
- Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
- the cell line is also infected with adenovirus as a helper.
- the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
- the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
- recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650) .
- the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a gene of interest) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector.
- An AAV helper function vector encodes the “AAV helper function” sequences (e.g., rep and cap) , which function in trans for productive AAV replication and encapsidation.
- the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes) .
- the accessory function vector encodes nucleotide sequences for non-AAV derived viral and/or cellular functions upon which AAV is dependent for replication (e.g., “accessory functions” ) .
- the accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly.
- Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1) , and vaccinia virus.
- the subject rRAAV is produced using a baculovirus expression system packaged in insect cells such as Sf9 cells.
- insect cells such as Sf9 cells.
- a baculovirus expression system packaged in insect cells such as Sf9 cells. See, for example, WO2007046703, WO2007148971, WO2009014445, WO2009104964, WO2013036118, WO2011112089, WO2016083560, WO2015137802, and WO2019016349, all incorporated herein by reference.
- the vector titers are usually expressed as viral genomes per ml (vg/ml) .
- viral titers is above 1x10 9 , above 5x10 10 , above 1x10 11 , above 5x10 11 , above 1x10 12 , above 5x10 12 , or above 1x10 13 vg/ml.
- the rRAAV viral particles of the invention can be used to deliver any gene of interest (GOI) or RNA sequence of Interest (RSI) to a host cell, for any purpose, so long as the GOI is an RNA within the packaging limit of the chosen AAV viral capsid or AAV viral particle shell, such as about 4,700 nucleotides overall length for most AAV viral particles, up to about 8,900 nucleotides for certain large capacity AAV viral particles such as AAV5.
- GOI gene of interest
- RSI RNA sequence of Interest
- representative (non-limiting) RNA sequence of interest includes, for example, a protein-encoding RNA, an mRNA, a non-coding RNA (ncRNA) , a tRNA, a ribosomal RNA (rRNA) , a transfer-messenger RNA (tmRNA) , an antisense oligonucleotide (ASO) , an RNA aptamer, an RNA component of CRISPR-Cas system such as a single guide RNA (or sgRNA, chimeric RNA, RNA chimera) , CRISPR RNA (crRNA) , tracr RNA, or an RNA component of a RISC complex or RNAi pathway (such as shRNA, miRNA, or siRNA) , a regulatory RNA, Piwi-interacting RNAs (piRNAs) , small nucleolar RNAs (snoRNAs) , a long non-coding RNA (riRNAs) ,
- the RNA sequence of the invention comprises a coding sequence for a protein or polypeptide.
- protein or polypeptide is a wild-type protein or functional equivalent or variant thereof (such as an enzyme or a structural protein) that can be used to replace a defective protein in a target cell, tissue, or organism.
- protein or polypeptide is a wild-type protein or functional equivalent or variant thereof (such as an enzyme or a structural protein) that can be used to antagonize the detrimental effect of a compound (small molecule compound, or macromolecules such as lipids, fatty acids, protein, nucleic acid, etc) in a target cell, tissue, or organism.
- a compound small molecule compound, or macromolecules such as lipids, fatty acids, protein, nucleic acid, etc
- the RNA sequence of the invention comprises a coding sequence for an effector enzyme of CRISPR/Cas system.
- the CRISPR-Cas system is a Class 1 system
- the effector enzyme is a type I, III, or IV effector enzyme.
- the CRISPR-Cas system is a Class 2 system
- the effector enzyme is a type II, V, or VI effector enzyme.
- the effector enzyme is a Class 2, type II enzyme such as Cas9, including Streptococcus pyogenes (SpCas9) or SaCas9 (see WO 2014/093622 (PCT/US2013/074667) , incorporated by reference) .
- Cas9 including Streptococcus pyogenes (SpCas9) or SaCas9 (see WO 2014/093622 (PCT/US2013/074667) , incorporated by reference) .
- the Cas effector enzyme is a Class 2, type V Cas protein, including Cas12a (formerly known as Cpf1, such as Francisella novicida Cas12a) , C2c1, and C2c3.
- the Cas effector enzyme is a Class 2, type VI Cas protein, including Cas13a (also known as C2c2) , Cas13b, Cas13c, Cas13d, Cas13e, and Cas13f. These Cas proteins use their crRNA to recognize target RNA sequences, rather than target DNA sequences in Cas9 and Cas12a.
- the Cas effector enzyme is any one of the Cas effector enzymes described in WO2020/028555 (entire content incorporated herein by reference) , including any of Cas9, Cas12 (e.g., Cas12a, Cas12b, Cas12c, Cas12d, etc. ) , Cas13 (e.g., Cas13a, Cas13b (such as Cas13b-t1, Cas13b-t2, Cas13b-t3) , Cas13c, Cas13d, etc. ) , Cas14, CasX, and CasY.
- Cas9 Cas9
- Cas12 e.g., Cas12a, Cas12b, Cas12c, Cas12d, etc.
- Cas13 e.g., Cas13a, Cas13b (such as Cas13b-t1, Cas13b-t2, Cas13b-t3)
- Cas13c Cas13d, etc.
- the Cas effector enzyme is fused to a DNA and/or RNA base editor, such as Cytosine or Adenine base editors (CBEs or ABEs) .
- the base editor preferantially edits DNA bases and optionally have reduced or substantially no off-target RNA base editing capability.
- the base editor preferantially edits RNA bases and optionally have reduced or substantially no off-target DNA base editing capability.
- the base editor edits both DNA and RNA bases.
- the base editor is a first, second (BE2) , third (BE3) , or fourth generation (BE4) base editor. In certain embodiments, the base editor is a dual base editor.
- the base editor is an RNA adenosine deaminase (ADAR) , such as ADAR1, ADAR2, or ADARDD including ADAR2DD (E488Q) .
- ADAR RNA adenosine deaminase
- the RNA sequence of the invention can further comprise a guide RNA sequence designed to be loaded into the encoded CRISPR/Cas effector enzyme for binding to a target polynucleotide sequence complementary to the guide RNA.
- a guide RNA sequence designed to be loaded into the encoded CRISPR/Cas effector enzyme for binding to a target polynucleotide sequence complementary to the guide RNA.
- Such gRNA sequence can be processed by cellular nucleases and be released /separated from the RNA sequence of the invention after the RNA sequence of the invention has been delivered by the rRAAV viral particles of the invention to a target host cell.
- the gRNA can be present in an unpaired 5’ or 3’ flanking region sequence of a pri-miRNA hairpin structure that is part of the RNA sequence of the invention, and, upon processing of the pri-miRNA by cellular enzymes such as Drosha, is released /separated from the primary pri-miRNA transcript.
- the RNA sequence of the invention comprises a coding sequence for an effector enzyme of CRISPR/Cas system, and further comprising a coding sequence for the DNA or RNA base-editing enzyme or domain, such that a fusion of a Cas effector enzyme and the DNA/RNA base-editing enzyme /domain is encoded by the RNA sequence.
- the Cas effector enzyme is defective in nuclease activity, such that it is able to bind to a target polynucleotide sequence through the guide RNA it binds, but is unable to cleave the DNA/RNA target polynucleotide.
- the RNA sequence of the invention comprises a coding sequence for a variant or derivative of the effector enzyme of CRISPR/Cas system, wherein the variant comprises deletions (such as N and/or C terminal deletions, e.g., N-terminal deletion of no more than 210 residues, and/or a C-terminal deletion of no more than 180 residues for Cas13e or Cas13f) , insertions, or substitutions of a wild-type CRISPR/Cas system effector enzyme but substantially retains the ability of the wild-type effector enzyme to bind to the gRNA, and/or to cleave the target polynucleotide.
- the variant lacks activity to cleave a target polynucleotide.
- the RNA base-editing domain encoded by the RNA sequence of the invention is an adenosine deaminase, such as a double-stranded RNA-specific adenosine deaminase (e.g., ADAR1 or ADAR2) ; apolipoprotein B mRNA editing enzyme; catalytic polypeptide-like (APOBEC) ; or activation-induced cytidine deaminase (AID) .
- adenosine deaminase such as a double-stranded RNA-specific adenosine deaminase (e.g., ADAR1 or ADAR2) ; apolipoprotein B mRNA editing enzyme; catalytic polypeptide-like (APOBEC) ; or activation-induced cytidine deaminase (AID) .
- adenosine deaminase such as a double-stranded RNA-specific a
- the RNA base-editing domain encoded by the RNA sequence of the invention comprises an adenosine deaminase and/or a cytidine deaminase, such as a cytidine deaminase acting on RNA (CDAR) , such as a double-stranded RNA-specific adenosine deaminase (ADAR) (e.g., ADAR1 or ADAR2) , apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC, such as APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4) , activation-induced cytidine deaminase (AID) , a cytidine deamin
- CDAR
- the ADAR has E488Q/T375G double mutation or is ADAR2DD.
- the base-editing domain is further fused to an RNA-binding domain, such as MS2.
- the variant or derivative of the encoded CRISPR/Cas effector enzyme further comprises an RNA methyltransferase, a RNA demethylase, an RNA splicing modifier, a localization factor, or a translation modification factor.
- the Cas effector enzyme, the variant /derivative, or a functional fragment thereof comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES) .
- NLS nuclear localization signal
- NES nuclear export signal
- the Cas effector enzyme, the variant /derivative thereof, or the functional fragment thereof is fused to a heterologous functional domain.
- the heterologous functional domain comprises: a nuclear localization signal (NLS) , a reporter protein or a detection label (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP) , a localization signal, a protein targeting moiety, a DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD) , an epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc) , a transcription activation domain (e.g., VP64 or VPR) , a transcription inhibition domain (e.g., KRAB moiety or SID moiety) , a nuclease (e.g., FokI) , a dea nuclear localization signal (NLS)
- the RNA sequence of the invention comprises a coding sequence for a CasPR (CRISPR-associated Protein for Class 1 pre-crRNA processing) fusion protein, comprising a CasPR (or a homolog, an ortholog, a paralog, a variant, a derivative, or a functional fragment thereof) fused to a heterologous functional domain; or a functional variant thereof.
- CasPR CRISPR-associated Protein for Class 1 pre-crRNA processing
- the CasPR is Cas5d, Cas6, or Csf5.
- the CasPR is MtCas6 (I-A) (Sequence 1) , MmCas6 (I-B) (Sequence 2) , SpCas5d (I-C1) (Sequence 3) , BhCas5d (I-C2) (Sequence 4) , SaCas6 (I-D) (Sequence 5) , EcCas6e (I-E) (Sequence 6) , PaCas6f (I-F) (Sequence 7) , MtCas6 (III-A) (Sequence 8) , PfCas6 (III-B) (Sequence 9) , PaCsf5 (IV-A1) (Sequence 10) , or MtCsf5 (IV-A2) (Sequence 11) . All sequences incorporated herein by reference.
- the heterologous functional domain fused to the CasPR comprises: a nuclear localization signal (NLS) , a reporter protein or a detection label (e.g., GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP) , a localization signal, a protein targeting moiety, a DNA binding domain (e.g., MBP, Lex A DBD, Gal4 DBD) , an epitope tag (e.g., His, myc, V5, FLAG, HA, VSV-G, Trx, etc) , a transcription activation domain (e.g., VP64 or VPR) , a transcription inhibition domain (e.g., KRAB moiety or SID moiety) , a nuclease (e.g., FokI) , a deamination domain (e.g., ADAR1, ADAR2, APOBEC, AID, or TAD) , a methyl NLS a
- the heterologous functional domain comprises an RNA base editor.
- the RNA base editor edits A ⁇ G single base change.
- the RNA base editor edits C ⁇ U single base change.
- the RNA base editor comprises ADAR2DD or a derivative thereof.
- the ADAR2DD derivative comprises the E488Q/T375A double mutations.
- the fusion protein has the amino acid sequence of any one of Sequences 45-55.
- the heterologous functional domain is fused N-terminally, C-terminally, or internally in the fusion protein.
- the functional variant of the CasPR fusion comprises a protein having the amino acid sequence of: (1) any one of Sequences 1-11, except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, additions, or deletions, wherein the protein maintains the ability of one of Sequences 1-11 for binding to a direct repeat sequence of a Class 1, type I, III, or IV CRISPR system (e.g., any one of Sequences 12-33) ; or, (2) at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%or more sequence identity with any one of Sequences 1-11, wherein the protein maintains the ability of one of the CasPRs of Sequences 1-11 for binding to a direct repeat sequence of a Class 1, type I, III, or IV CRISPR system (e.g., any one of Sequences 12-33) ; optionally, with the proviso that the protein is not any one of Sequences 1-11
- the RNA sequence of the invention further encodes a CasPR guide RNA comprising a guide sequence capable of hybridizing to a target RNA, and a direct repeat (DR) sequence 3’ (or 5’) to the guide sequence.
- the DR sequence has substantially the same secondary structure as the secondary structure of any one of Sequences 12-33.
- the DR sequence is encoded by any one of Sequences 12-33, or a functional portion thereof that binds to a cognate wild-type CasPR.
- the target RNA is encoded by a eukaryotic DNA.
- the eukaryotic DNA is a non-human mammalian DNA, a non-human primate DNA, a human DNA, a plant DNA, an insect DNA, a bird DNA, a reptile DNA, a rodent DNA, a fish DNA, a worm /nematode DNA, a yeast DNA.
- the target RNA is an mRNA.
- the CasPR guide sequence is between 15-120 nucleotides, between 20-100 nucleotides, between 25-80 nucleotides, between 15-55 nucleotides, between 25-35 nucleotides, or about 30 nucleotides.
- the CasPR guide sequence is 90-100%complementary to the target RNA.
- the CasPR guide RNA results from processing of a pre-crRNA transcript by the CasPR, and wherein the pre-crRNA comprises two or more guide RNAs having different guide sequences for different target RNAs.
- the variant or derivative of the CasPR fusion comprises conserved amino acid substitutions of one or more residues of any one of Sequences 1-11; optionally, the variant or derivative of the CasPR fusion comprises only conserved amino acid substitutions.
- the derivative of the CasPR fusion is capable of binding to the CasPR guide sequence hybridized to the target RNA, but has no RNase catalytic activity due to a mutation in the RNase catalytic site of the CasPR.
- the derivative of the CasPR fusion has an N-terminal deletion of no more than 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 residues, and/or a C-terminal deletion of no more than 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 residues.
- the CasPR is a Cas5d, a Cas6, or a Csf5, such as MtCas6 (I-A) , MmCas6 (I-B) , SpCas5d (I-C1) , BhCas5d (I-C2) , SaCas6 (I-D) , EcCas6e (I-E) , PaCas6f (I-F) , MtCas6 (III-A) , PfCas6 (III-B) , PaCsf5 (IV-A1) , or MtCsf5 (IV-A2) .
- MtCas6 I-A
- MmCas6 I-B
- SpCas5d I-C1
- BhCas5d I-C2
- SaCas6 I-D
- EcCas6e I-E
- PaCas6f I-F
- MtCas6
- the heterologous functional domain of the CasPR fusion comprises an RNA base-editing domain.
- the RNA base-editing domain comprises an adenosine deaminase and/or a cytidine deaminase, such as a cytidine deaminase acting on RNA (CDAR) , such as a double-stranded RNA-specific adenosine deaminase (ADAR) (e.g., ADAR1 or ADAR2) , apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC, such as APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4) , activation-induced cytidine deamin
- CDAR aden
- the derivative of the CasPR fusion further comprises an RNA methyltransferase, a RNA demethylase, an RNA splicing modifier, a localization factor, or a translation modification factor.
- the CasPR, the homolog, the ortholog, the paralog, the variant, the derivative, or the functional fragment comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES) .
- NLS nuclear localization signal
- NES nuclear export signal
- targeting of the target RNA results in a modification of the target RNA.
- the modification of the target RNA is a cleavage of the target RNA.
- the modification of the target RNA is deamination of an adenosine (A) to an inosine (I) , and/or deamination of a cytidine (C) to a uracil (U) .
- the RNA sequence of the invention encodes a codon-optimized polynucleotide encoding a wild-type CasPR (e.g., Cas5d, Cas6, or Csf5) , a homolog thereof, an ortholog thereof, a paralog thereof, a variant or derivative thereof, or a functional fragment thereof, wherein the polynucleotide is codon-optimized for mammalian (e.g., human) expression, optionally, the wild-type CasPR has the amino acid sequence of any one of Sequences 1-11.
- the codon-optimized polynucleotide has the amino acid sequence of any one of Sequences 34-44.
- the codon-optimized polynucleotide further comprises sequence encoding a heterologous functional domain.
- the heterologous functional domain comprises an RNA base editor.
- the RNA sequence of the invention encodes a non-naturally occurring polynucleotide comprising a derivative of any one of Sequences 12-33, wherein the derivative (i) has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) nucleotides additions, deletions, substitutions, and/or other mutations compared to any one of Sequences 12-33; (ii) has at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 97%sequence identity to any one of Sequences 12-33; (iii) hybridize under stringent conditions with any one of Sequences 12-33, or any of (i) and (ii) ; or (iv) is a complement of any of (i) - (iii) , provided that the derivative is not any one of Sequences 12-33, and that the derivative encodes an RNA (or is an RNA) that has maintained substantially the same secondary structure (e.g., stems,
- the derivative
- the RNA sequence of the invention comprises a coding sequence for an engineered Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) -Cas13 effector enzyme, wherein the engineered Cas13: (1) comprises a mutation in a region spacially close to an endonuclease catalytic domain of the corresponding wild-type Cas13 effector enzyme; (2) substantially preserves guide sequence-specific endonuclease cleavage activity of the wild-type Cas13 towards a target RNA complementary to the guide sequence; and, (3) substantially lacks guide sequence-independent collateral endonuclease cleavage activity of the wild-type Cas13 towards a non-target RNA that does not bind to the guide sequence.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeat
- the Cas13 is a Cas13a, a Cas13b, a Cas13c, a Cas13d (including CasRx) , a Cas13e, or a Cas13f.
- the Cas13e has the amino acid sequence of SEQ ID NO: 4 of PCT/CN2020/119559 (incorporated herein by reference) .
- the region includes residues within 120, 110, 100, 90, or 80 amino acids from any residues of the endonuclease catalytic domain (e.g., an RXXXXH domain) in the primary sequence of the Cas13.
- an endonuclease catalytic domain e.g., an RXXXXH domain
- the region includes residues more than 100, 110, 120, or 130 residues away from any residues of the endonuclease catalytic domain in the primary sequence of the Cas13, but are spacially within 1-10 or 5 of a residue of the endonuclease catalytic domain.
- the endonuclease catalytic domain is a HEPN domain, optionally a HEPN domain comprising an RXXXXH motif.
- the RXXXXH motif comprises a R ⁇ N/H/K ⁇ X1X2X3H sequence.
- X1 is R, S, D, E, Q, N, G, or Y;
- X2 is I, S, T, V, or L;
- X3 is L, F, N, Y, V, I, S, D, E, or A.
- the RXXXXH motif is an N-terminal RXXXH motif comprising an RNXXXH sequence, such as an RN ⁇ Y/F ⁇ ⁇ F/Y ⁇ SH sequence.
- the N-terminal RXXXXH motif has a RNYFSH sequence.
- the N-terminal RXXXXH motif has a RNFYSH sequence.
- the RXXXXH motif is a C-terminal RXXXXH motif comprising an R ⁇ N/A/R ⁇ ⁇ A/K/S/F ⁇ ⁇ A/L/F ⁇ ⁇ F/H/L ⁇ H sequence.
- the C-terminal RXXXXH motif has a RN (A/K) ALH sequence.
- the C-terminal RXXXXH motif has a RAFFHH or RRAFFH sequence.
- the region comprises, consists essentially of, or consists of residues corresponding to residues between residues 2-187, 227-242, or 634-755 of SEQ ID NO: 4 of PCT/CN2020/119559 (incorporated by reference) . In certain embodiments, the region comprises, consists essentially of, or consists of residues corresponding to residues between residues 35-51, 52-67, 156-171, 666-682, or 712-727 of SEQ ID NO: 4 of PCT/CN2020/119559 (incorporated by reference) .
- the mutation comprises, consists essentially of, or consists of substitutions, within a stretch of 15-20 consecutive amino acids within the region, one or more charged or polar residues to a charge-neutal short chain aliphatic residue (such as A) .
- the stretch is about 16 or 17 residues.
- substantially all, except for up to 1, 2, or 3, charged and polar residues within the stretch are substituted.
- a total of about 7, 8, 9, or 10 charged and polar residues within the stretch are substituted.
- the N-and C-terminal 2 residues of the stretch are substituted to amino acids the coding sequences of which contain a restriction enzyme recognition sequence.
- the N-terminal two residues are VF, and the C-terminal 2 residues are ED, and the restriction enzyme is BpiI.
- the one or more charged or polar residues comprise N, Q, R, K, H, D, E, Y, S, and T residues.
- the one or more charged or polar residues comprise R, K, H, N, Y, and/or Q residues.
- one or more Y residue (s) within the stretch is substituted.
- the one or more Y residues (s) correspond to Y672, Y676, and/or Y751 of wild-type Cas13e.
- the stretch is residues 35-51, 52-67, 156-171, 666-682, or 712-727 of SEQ ID NO: 4 of PCT/CN2020/119559 (incorporated by reference) .
- the mutation comprises Ala substitution (s) corresponding to any one or more of SEQ ID NOs: 37-39, 45, and 48 of PCT/CN2020/119559 (incorporated by reference) .
- the charge-neutal short chain aliphatic residue is Ala (A) .
- the mutation comprises, consists essentially of, or consists of substitutions within 2, 3, 4, or 5 the stretches of 15-20 consecutive amino acids within the region.
- the engineered Cas13 preserves at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%of the guide sequence-specific endonuclease cleavage activity of the wild-type Cas13 towards the target RNA.
- the engineered Cas13 lacks at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%of the guide sequence-independent colleteral endonuclease cleavage activity of the wild-type Cas13 towards the non-target RNA.
- the engineered Cas13 preserves at least about 80-90%of the guide sequence-specific endonuclease cleavage activity of the wild-type Cas13 towards the target RNA, and lacks at least about 95-100%of the guide sequence-independent colleteral endonuclease cleavage activity of the wild-type Cas13 towards the non-target RNA.
- the engineered Cas13 of the invention has an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.86%identical to any one of SEQ ID NOs: 6-10 of PCT/CN2020/119559 (incorporated by reference) , excluding any one or more of the regions defined by SEQ ID NOs: 16, 20, 24, 28, and 32 of PCT/CN2020/119559 (incorporated by reference) .
- the amino acid sequence contains up to 1, 2, 3, 4, or 5 differences in each of one or more regions defined by SEQ ID NO: 16, 20, 24, 28, and 32 of PCT/CN2020/119559 (incorporated by reference) , as compared to SEQ ID NOs: 17, 21, 25, 29, and 33 of PCT/CN2020/119559 (incorporated by reference) , respectively.
- he engineered Cas13 of the invention has the amino acid sequence of any one of SEQ ID NOs: 6-10 of PCT/CN2020/119559 (incorporated by reference) . In certain embodiments, the engineered Cas13 of the invention has the amino acid sequence of SEQ ID NO: 9 or 10 of PCT/CN2020/119559 (incorporated by reference) .
- the engineered Cas13 of the invention further comprises a nuclear localization signal (NLS) sequence or a nuclear export signal (NES) .
- the engineered Cas13 comprises an N-and/or a C-terminal NLS.
- the RNA sequence of the invention encoding the engineered CRISPR/Cas13 effector enzyme of the invention is codon-optimized for expression in a eukaryote, a mammal, such as a human or a non-human mammal, a plant, an insect, a bird, a reptile, a rodent (e.g., mouse, rat) , a fish, a worm /nematode, or a yeast.
- a mammal such as a human or a non-human mammal
- a plant an insect, a bird, a reptile, a rodent (e.g., mouse, rat) , a fish, a worm /nematode, or a yeast.
- rodent e.g., mouse, rat
- the RNA sequence of the invention comprises a coding sequence for the engineered Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) -Cas13 effector enzyme, the coding sequence having (i) one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) nucleotides additions, deletions, substitutions, and/or other mutations compared to the wild-type sequence; (ii) at least 50%, 60%, 70%, 80%, 90%, 95%, or 97%sequence identity to the wild-type sequence; (iii) hybridize under stringent conditions with the wild-type sequence, or any of (i) and (ii) ; or (iv) is a complement of any of (i) - (iii) .
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeat
- the RNA sequence of the invention comprises a coding sequence for a non-coding RNA (ncRNA) , such as siRNA, piRNA, short hairpin RNA or shRNA, microRNA or miRNA or precursors thereof including pre-miRNA and pri-miRNA, antisense sequence or oligonucleotide (ASO) , guide RNA or gRNA for CRISPR/Cas, rRNA, tRNA, snoRNA, snRNA, exRNA, scaRNA, lncRNA, Xist, and HOTAIR, etc.
- ncRNA non-coding RNA
- the rRAAV viral particles and RNA sequences of the invention can be used to deliver any GOI /RSI to any suitable target cell, tissue, or organism for any use for gene therapy.
- the rRAAV viral particles and RNA sequences of the invention can be used in a method of treatment, in which a defective or loss of function disease gene can be replaced by a functional version of the gene to restore the lost function.
- a wild-type coding sequence, or a variant coding sequence encoding a variant protein of the wild-type protein and having preserved at least one desired functions of the wild-type protein can be delivered to the target cell /tissue /organ, to express the encoded wild-type of variant thereof, in order to compensate for the loss of function of the disease gene.
- the rRAAV viral particles and RNA sequences of the invention can be used in a method of treatment, in which a defective or gain of function disease gene can be knocked out, knocked down, or otherwise down-regulated by a gene targeting agent to alleviate the detrimental effect of the disease gene.
- the gene targeting agent can be a CRISPR/Cas effector enzyme (such as an engineered Cas9 or Cas13 effector enzyme as described herein) , optionally with a guide RNA that is provided simultaneously (or separately) , that together target the disease gene.
- the gene targeting agent can be a Cas effector enzyme linked to a DNA or RNA base editor for DNA-RNA base editing.
- the gene targeting agent is an siRNA, shRNA, microRNA, or antisense RNA.
- the invention provides a method of modifying a target RNA in a target cell, the method comprising contacting the target cell with an rRAAV viral particle or RNA sequence of the invention encoding a CasPR or engineered CRISPR/Cas effector enzyme described herein (or ortholog, paralog, variant, derivative, or functional fragment thereof) , wherein a guide sequence for the CasPR /Cas effector enzyme is complementary to at least 15 nucleotides of the target RNA, and wherein the CasPR /engineered Cas effector enzyme associates with the guide sequence to form a complex that binds to and modified the target RNA.
- the invention provides a method of treating a condition or disease in a subject in need thereof, the method comprising administering to the subject a composition comprising the an rRAAV viral particle or RNA sequence of the invention encoding a CasPR or engineered CRISPR/Cas effector enzyme described herein (or ortholog, paralog, variant, derivative, or functional fragment thereof) , wherein a guide sequence for the CasPR /Cas effector enzyme is complementary to at least 15 nucleotides of the target RNA, and wherein the CasPR /engineered Cas effector enzyme associates with the guide sequence to form a complex that binds to and modified the target RNA, thereby treating the condition or disease in the subject.
- a composition comprising the an rRAAV viral particle or RNA sequence of the invention encoding a CasPR or engineered CRISPR/Cas effector enzyme described herein (or ortholog, paralog, variant, derivative, or functional fragment thereof) , wherein a guide sequence for the Cas
- the target RNA is modified by cleavage by the CasPR or engineered Cas effector enzyme complex. In certain embodiments, the target RNA is modified by deamination by a derivative comprising a double-stranded RNA-specific adenosine and/or cytidine deaminase. In certain embodiments, the target RNA is an mRNA, a tRNA, an rRNA, a non-coding RNA, an lncRNA, or a nuclear RNA. In certain embodiments, the target RNA is within a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is infected with an infectious agent.
- the infectious agent is a virus, a prion, a protozoan, a fungus, or a parasite.
- the cell is a neuronal cell (e.g., astrocyte, glial cell (e.g., Muller glia cell, oligodendrocyte, ependymal cell, Schwan cell, NG2 cell, or satellite cell) ) .
- the condition or disease is a cancer or an infectious disease.
- the cancer is Wilms’ tumor, Ewing sarcoma, a neuroendocrine tumor, a glioblastoma, a neuroblastoma, a melanoma, skin cancer, breast cancer, colon cancer, rectal cancer, prostate cancer, liver cancer, renal cancer, pancreatic cancer, lung cancer, biliary cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, medullary thyroid carcinoma, ovarian cancer, glioma, lymphoma, leukemia, myeloma, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, or urinary bladder cancer.
- the method is an in vitro method, an in vivo method, or an ex vivo method.
- the engineered Cas13 upon binding of the complex to the target RNA, does not exhibit substantial (or detectable) collateral RNase activity.
- the condition or disease is a neurological condition such as glaucoma, age-related RGC loss, optic nerve injury, retinal ischemia, Leber’s hereditary optic neuropathy, a neurological condition associated with degeneration of RGC neurons, a neurological condition associated with degeneration of functional neurons in the striatum of a subject in need thereof, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, Schizophrenia, depression, drug addiction, movement disorder such as chorea, choreoathetosis, and dyskinesias, bipolar disorder, Autism spectrum disorder (ASD) , or dysfunction.
- a neurological condition such as glaucoma, age-related RGC loss, optic nerve injury, retinal ischemia, Leber’s hereditary optic neuropathy, a neurological condition associated with degeneration of RGC neurons, a neurological condition associated with degeneration of functional neurons in the striatum of a subject in need thereof, Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, Schizophrenia, depression, drug
- the method of the invention causes one or more of: (i) in vitro or in vivo induction of cellular senescence; (ii) in vitro or in vivo cell cycle arrest; (iii) in vitro or in vivo cell growth inhibition and/or cell growth inhibition; (iv) in vitro or in vitro induction of anergy; (v) in vitro or in vitro induction of apoptosis; and (vi) in vitro or in vitro induction of necrosis.
- a polynucleotide sequence including, but not limited to, ribonucleic acids (RNAs) , deoxyribonucleic acids (DNAs) , threose nucleic acids (TNAs) , glycol nucleic acids (GNAs) , peptide nucleic acids (PNAs) , locked nucleic acids (LNAs, including LNA having a ⁇ -D-ribo configuration, ⁇ -LNA having an ⁇ -L-ribo configuration (a diastereomer of LNA) , 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- ⁇ -LNA having a 2'-amino functionalization) or hybrids thereof, capable of being packaged into a DNA virus viral particle, said polynucleotide sequence comprises:
- a polynucleotide sequence of interest e.g., a RNA coding sequence for a gene of interest (GOI)
- a protein e.g., a therapeutic protein, an antigen protein, or a gene-editing protein such as a CRISPR/Cas effector enzyme ( “a Cas protein” for short) , a ZFN protein, a TALEN protein) -encoding RNA, such as, a mRNA, or a non-coding, functional RNA (such as, a transfer RNA (tRNA) , a ribosomal RNA (rRNA) , a small interfering RNA (siRNA) , a short hairpin RNA (shRNA) , an antisense RNA, an antisense oligonucleotide, a micro RNA (miRNA) , or an RNA component of a CRISPR-Cas (e.g., Cas9, Cas12
- PPS polynucleotide-packaging signal
- a DNA sequence encoding or corresponding to said polynucleotide sequence, or a reverse complement of said DNA sequence has reduced, diminished, or substantially no capacity of being packaged into the DNA virus viral particle (e.g., the DNA sequence or the reverse complement thereof lacks a DNA packaging signal such as a functional AAV ITR for AAV packaging) .
- DNA virus viral particle is an AAV viral particle or an oncolytic viral particle.
- polynucleotide sequence of any preceding embodiment comprising more than one (e.g., 1, 2, 3, or more) PPS that are identical or different.
- polynucleotide sequence of any preceding embodiment comprising two or more PPS that are not adjacent to each other (e.g., one each located at or near one end of the polynucleotide sequence of interest (PSI) ) .
- the PPS comprises a transcribed modified AAV inverted terminal repeat (ITR) , wherein said transcribed modified AAV ITR:
- (a) comprises a transcribed functional Rep-Binding Element (RBE) , optionally further comprising a transcribed functional RBE’ ;
- TRS terminal resolution site
- rcTRS transcribed reverse complement TRS
- said transcribed modified AAV ITR further comprises a transcribed D region sequence (D sequence or D’ sequence) ; and/or optionally, the PPS-interacting molecule is Rep78, Rep68, Rep52, and/or Rep40.
- RNA sequence of any preceding embodiment wherein the transcribed modified AAV ITR is within the 3’ end 1000 nucleotides, 800 nucleotides, 500 nucleotides, 300 nucleotides, or 200 nucleotides of the RNA; optionally, the transcribed modified AAV ITR is 5’ to a polyA sequence, a polyA signal sequence (e.g., AAUAAA) , or a sequence for RNA transcription termination (e.g., a histone downstream element) .
- a polyA signal sequence e.g., AAUAAA
- a sequence for RNA transcription termination e.g., a histone downstream element
- transcribed modified AAV ITR is modified based on a transcribed wild-type flip or flop ITR; optionally, said wild-type flip or flop ITR is from AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAVrh74, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13 (optionally, said wild-type flop ITR has the nucleotide sequence of SEQ ID NO: 1) .
- transcribed modified AAV ITR comprises the transcribed D region sequence (optionally, said modified AAV ITR has the nucleotide sequence of SEQ ID NO: 3) .
- polynucleotide sequence of any preceding embodiment further comprising a second transcribed modified AAV ITR having a second transcribed functional RBE sequence but lacking either a second transcribed TRS or a second transcribed rcTRS or both; optionally, said second transcribed modified AAV ITR further comprises a second transcribed D region sequence.
- transcribed modified AAV ITR and the second transcribed modified AAV ITR (if present) , comprise a deletion from, a mutation in, or an insertion into a corresponding transcribed wild-type AAV ITR D region sequence or a corresponding transcribed wild-type TRS /rcTRS.
- the PPS comprises an MS2 sequence, an PP7 binding site, or a com binding site
- the PPS-interacting molecule comprises an PPS-interacting protein (PPSIP) capably of interacting, e.g., binding, directly or indirectly, to the PPS, such as a bacteriophage-derived MS2 coat protein (MCP) for an MS2 sequence, a PP7 bacteriophage coat protein (PCP) for an PP7 binding site, or a phage COM protein (COM) for a com binding site.
- MCP bacteriophage-derived MS2 coat protein
- PCP PP7 bacteriophage coat protein
- COM phage COM
- PPSIP is associated directly or indirectly with (e.g., fused to) a protein component of the viral packaging system for the DNA virus viral particle (such as Rep78 and/or Rep68 of adeno-associated virus 2 (AAV2) , or assembly-activating protein (AAP) ) .
- a protein component of the viral packaging system for the DNA virus viral particle such as Rep78 and/or Rep68 of adeno-associated virus 2 (AAV2) , or assembly-activating protein (AAP)
- polynucleotide sequence of any preceding embodiment wherein the polynucleotide sequence comprises or preferably does not comprise a transcribed DNA packaging signal, for example, a transcribed wild-type AAV ITR sequence (e.g., the polynucleotide sequence comprises a transcribed modified AAV ITR sequence having an addition, a deletion, and/or a substitution of a nucleotide of a corresponding transcribed wild-type AAV ITR sequence to reduce the DNA packaging capability of the DNA virus viral particle) .
- a transcribed wild-type AAV ITR sequence e.g., the polynucleotide sequence comprises a transcribed modified AAV ITR sequence having an addition, a deletion, and/or a substitution of a nucleotide of a corresponding transcribed wild-type AAV ITR sequence to reduce the DNA packaging capability of the DNA virus viral particle
- a transcribed intron sequence or exon sequence (such as one for enhancing protein expression) ;
- polyA polyadenylation
- a posttranscriptional regulatory element or sequence such as a transcribed Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) sequence; and/or,
- the polynucleotide sequence comprises an PPS located 3’ to the posttranscriptional regulatory element or sequence, and 5’ to the polyA sequence or the polyA signal sequence.
- polynucleotide sequence of any preceding embodiment comprising, in 5’ to 3’ orientation, the PSI, the optional transcribed WPRE sequence; the PPS (such as the transcribed modified AAV ITR, the MS2 sequence, the PP7 binding site, or the com binding site) ; and the polyA sequence or the polyA signal sequence.
- the GOI comprises a protein (e.g., a fluorescent protein, a therapeutic protein, an antigen protein, or a gene-editing protein such as a Cas protein, a ZFN protein, a TALEN protein) , an enzyme (such as a Cre protein, or a CRISPR/Cas effector enzyme, e.g., Cas9, Cas12, Cas13, or a variant thereof) , a structural protein, an mRNA, a non-coding RNA (ncRNA) , an siRNA, a piRNA, a short hairpin RNA or shRNA, a microRNA (miRNA) or a precursor thereof (including pre-miRNA and pri-miRNA) , a ribosomal RNA (rRNA) , an antisense sequence or oligonucleotide (ASO) , an RNA component of a CRISPR-Cas system,
- a protein e.g., a fluorescent protein, a
- any preceding embodiment which is a single-stranded RNA less than about 8,900 nucleotides in length, less than about 8,000 nucleotides in length, less than about 7,000 nucleotides in length, less than about 6,000 nucleotides in length, less than about 5,200 nucleotides in length, less than about 4,000 nucleotides in length, less than about 3,000 nucleotides in length, less than about 2,000 nucleotides in length, about 4,700-5,200 nucleotides in length, about 4,700-5,000 nucleotide in length, about 4,700-4,800 nucleotides in length, or about 4,700 nucleotides in length.
- a polynucleotide comprising a cassette encoding the polynucleotide sequence of any preceding embodiment; optionally, the polynucleotide is a DNA sequence (e.g., a DNA plasmid) , optionally comprising a stuffer sequence in the backbone of the DNA plasmid, and/or optionally comprising no functional DNA packaging signal such as AAV ITR.
- a DNA sequence e.g., a DNA plasmid
- a stuffer sequence in the backbone of the DNA plasmid optionally comprising no functional DNA packaging signal such as AAV ITR.
- polynucleotide of any preceding embodiment further comprising a promoter operably linked to and driving the transcription of the polynucleotide sequence encoded by the cassette.
- polynucleotide of any preceding embodiment further comprising an enhancer that enhances the transcription of the polynucleotide sequence driven by the promoter.
- a recombinant DNA virus viral particle comprising an polynucleotide genome (such as the polynucleotide sequence of any preceding embodiment or the polynucleotide sequence transcribed from the polynucleotide of any preceding embodiment) packaged within the protein shell (such as capsid) of a DNA virus (such as an AAV virus, or an oncolytic virus) .
- an polynucleotide genome such as the polynucleotide sequence of any preceding embodiment or the polynucleotide sequence transcribed from the polynucleotide of any preceding embodiment
- a DNA virus such as an AAV virus, or an oncolytic virus
- rPAAV polynucleotide adeno-associated virus
- AAV capsid comprises a capsid from an AAV of the serotype AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV PHP.
- eB Anc80L65, Anc80L65AAP, AAVrh74, or 7m8.
- a population of recombinant DNA virus viral particles comprising a plurality of recombinant DNA virus viral particle (e.g., rPAAV particle) of any preceding embodiment, wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or more of the recombinant DNA virus viral particles (e.g., rPAAV particles) within said population have the polynucleotide sequence of any preceding embodiment or the polynucleotide sequence transcribed from the polynucleotide of any preceding embodiment packaged therein.
- a host cell comprising the polynucleotide sequence of any preceding embodiment, the polynucleotide of any preceding embodiment, the polynucleotide sequence transcribed from the polynucleotide of any preceding embodiment, the recombinant DNA virus viral particle (e.g., rPAAV particle) of any preceding embodiment, and/or the population of recombinant DNA virus viral particles (e.g., rPAAV particles) of any preceding embodiment.
- the recombinant DNA virus viral particle e.g., rPAAV particle
- the population of recombinant DNA virus viral particles e.g., rPAAV particles
- the host cell of any preceding embodiment further comprising a viral packaging system that facilitates packaging of the polynucleotide sequence of any preceding embodiment or the polynucleotide sequence transcribed from the polynucleotide of any preceding embodiment into the DNA virus viral particle.
- an AAV rep gene e.g., coding sequence for Rep78, Rep68, Rep52, and/or Rep40
- an AAV cap gene e.g., coding sequence for VP1, VP2, VP3, AAP, and/or MAAP
- one or more coding sequences for one or more proteins required for AAV packaging such as adenoviral E2A, E4, and VA genes, or said one or more proteins
- the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the polynucleotide sequence of any preceding embodiment or on the polynucleotide of any preceding embodiment, (2) modifying, e.g., mutating, said AAV rep gene, said AAV cap gene, and/or said one or more coding sequences for one or more proteins required for AAV packaging to reduce, diminish, or substantially eliminate the capacity of the respective translated protein to facilitate the packaging of the DNA sequence into the DNA virus viral particle (e.g., a Y156F mutation in the common sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu) ; and/or (3) enlarging the size of the polynucleotide encoding the polynu
- the host cell of any preceding embodiment which is a mammalian cell (such as HEK293 cells) or an insect cell (such as Sf9 or Sf21 cells) .
- a viral packaging system e.g., a AAV packaging system
- a viral packaging system e.g., a AAV packaging system
- the viral packaging system (e.g., a AAV packaging system) comprises:
- one or more proteins for assemblying the protein shell e.g., VP1, VP2, and/or VP3 for assembling AAV capsid
- the DNA virus viral particle for packaging the polynucleotide sequence, or one or more coding sequences thereof;
- one or more proteins e.g., Rep78, Rep68, Rep52, and/or Rep40 for AAV packaging
- one or more proteins for facilitating the assemblying of the protein shell and/or the packaging of the polynucleotide sequence into the protein shell of the DNA virus viral particle, or one or more coding sequences thereof (e.g., adenoviral E2a, E4, and VA genes)
- adenoviral E2a, E4, and VA genes e.g., adenoviral E2a, E4, and VA genes
- the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the polynucleotide sequence of any preceding embodiment or on the polynucleotide of any preceding embodiment, (2) modifying, e.g., mutating, said AAV rep gene, said AAV cap gene, and/or said one or more coding sequences for one or more proteins required for AAV packaging to reduce, diminish, or substantially eliminate the capacity of the respective translated protein to facilitate the packaging of the DNA sequence into the DNA virus viral particle (e.g., a Y156F mutation in the common sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu) ; and/or (3) enlarging the size of the polynucleotide encoding the polynucleotide sequence of any preceding embodiment or the polynucle
- one or more proteins for assemblying the protein shell e.g., VP1, VP2, and/or VP3 for assembling AAV capsid
- the DNA virus viral particle for packaging the polynucleotide sequence, or one or more coding sequences thereof;
- one or more proteins e.g., Rep78, Rep68, Rep52, and/or Rep40 for AAV packaging
- one or more proteins for facilitating the assemblying of the protein shell and/or the packaging of the polynucleotide sequence into the protein shell of the DNA virus viral particle, or one or more coding sequences thereof (e.g., adenoviral E2a, E4, and VA genes)
- adenoviral E2a, E4, and VA genes e.g., adenoviral E2a, E4, and VA genes
- the capacity of the viral packaging system of packaging a DNA sequence into the DNA virus viral particle is reduced, diminished, or substantially eliminated by, for example, (1) removing a part or all of the DNA packaging signals such as AAV ITR on the polynucleotide encoding the polynucleotide sequence of any preceding embodiment or on the polynucleotide of any preceding embodiment, (2) modifying, e.g., mutating, said AAV rep gene, said AAV cap gene, and/or said one or more coding sequences for one or more proteins required for AAV packaging to reduce, diminish, or substantially eliminate the capacity of the respective translated protein to facilitate the packaging of the DNA sequence into the DNA virus viral particle (e.g., a Y156F mutation in the common sequence of Rep78 and Rep68 proteins, KDE-mu, or EKE-mu) ; and/or (3) enlarging the size of the polynucleotide encoding the polynucleotide sequence of any preceding embodiment or the polynucle
- a method of delivering a gene of interest (GOI) into a cell, a plant, or an animal comprising contacting the cell, the plant, or the animal with the recombinant DNA virus viral particle (e.g., rPAAV particle) of any preceding embodiment, the population of the recombinant DNA virus viral particles (e.g., rPAAV particles) of any preceding embodiment, or the recombinant DNA virus viral particle (e.g., rPAAV particle) or the population of the recombinant DNA virus viral particles (e.g., rPAAV particles) produced by the method of any preceding embodiment, wherein said GOI is encoded by said polynucleotide sequence (of any preceding embodiment) .
- a method of delivering an polynucleotide sequence of interest (PSI) into a cell, a plant, or an animal comprising contacting the cell, the plant, or the animal with the recombinant DNA virus viral particle (e.g., rPAAV particle) of any preceding embodiment, the population of the recombinant DNA virus viral particles (e.g., rPAAV particles) of any preceding embodiment, or the recombinant DNA virus viral particle (e.g., rPAAV particle) or the population of the recombinant DNA virus viral particles (e.g., rPAAV particles) produced by the method of any preceding embodiment.
- PSI polynucleotide sequence of interest
- a method of diagnosing, preventing, or treating a disease or disorder in a subject in need thereof comprising administrating to the subject a therapeutically effective amount or dose of the population of the recombinant DNA virus viral particles (e.g., rPAAV particles) of any preceding embodiment or produced by the method of any preceding embodiment.
- rPAAV particles recombinant DNA virus viral particles
- recombinant DNA virus viral particle e.g., rPAAV particle
- the population of the recombinant DNA virus viral particles e.g., rPAAV particles
- the recombinant DNA virus viral particle e.g., rPAAV particle
- the population of the recombinant DNA virus viral particles e.g., rPAAV particles
- the recombinant DNA virus viral particle e.g., rPAAV particle
- the population of the recombinant DNA virus viral particles e.g., rPAAV particles
- the recombinant DNA virus viral particle e.g., rPAAV particle
- the population of the recombinant DNA virus viral particles e.g., rPAAV particles
- the recombinant DNA virus viral particle e.g., rPAAV particle
- the population of the recombinant DNA virus viral particles e.g., rPAAV particles
- the recombinant DNA virus viral particle
- RNA vector genome can be efficiently packaged into AAV viral capsids, especially with the modified /recombinant RNA designed for direct packaging into AAV capsids.
- the AAV packaging signal-ITR DNA
- RNA sequence of the invention e.g., the rRAAV vector genome RNA
- the RNA sequence of the invention e.g., the rRAAV vector genome RNA
- wild-type and modified AAV ITR sequences (DNA) from the ends of the AAV vector genome were moved into their respective transgene expression cassettes, to ensure that all the transgene transcripts (RNA’s) contain a candidate packaging signal.
- optimized ITRs (dITR and dITR-D) were used instead of wild type ITR (Table 2) .
- the TRS ( “TTGGC” ) is at the 5’ end of the ITR, and its reverse complement sequence GCCAA is double underlined.
- This sequence can be cloned into the coding plasmid in either direction (i.e., either the sequence shown as SEQ ID NO: 1, or its reverse complement sequence, can be used as template to transcribe the RNA sequence of the invention) .
- the wild-type AAV2 ITR sequence was cloned in an orientation such that the transcribed RNA had the same sequence as SEQ ID NO: 1 (or SEQ ID NO: 2 or 3 below) except that T’s were replaced by U’s in the transcribed RNA. Regardless, upon transcription of either this sequence or its reverse transcript, the resulting transcribed RNA of the wild-type ITR2 comprises the palindromic transcribed RBE (shaded in grey) . In the experiment herein, the transcribed RNA comprises a transcribed wild-type AAV2 ITR that is equivalent to SEQ ID NO: 1, except that all T’s were replaced by U’s.
- the transcribed RNA would comprise a transcribed TRS (UUGGC) encoded by GCCAA.
- UUGGC transcribed TRS
- the transcribed TRS is located between the transcribed RBE and the transcribed D sequence.
- the modified ITR sequence is “delta ITR” (or “dITR” for short) , which is defective because the dITR lacks both the D region sequence (bold italic) , the TRS at the 5’ end, and the reverse complement TRS sequence ( “GCCAA” ) except for the first G.
- the transcribed RNA of the dITR also comprises the palindromic transcribed RBE (shaded in grey) , and a transcribed defective ITR that lacks a transcribed TRS (UUGGC) encoded by GCCAA.
- the reverse complement sequence of SEQ ID NO: 2 served as the DNA template, such that the transcribed RNA comprises a transcribed modified AAV2 ITR (transcribed dITR) having the same sequence as SEQ ID NO: 2, except that all T’s were replaced by U’s.
- transcribed dITR transcribed modified AAV2 ITR
- modified ITR sequence is “dITR-D, ” which is also defective because it retains its D sequence ( “CTCCATCACTAGGGGTTCCT, ” SEQ ID NO: 4) but lacks the 5’ end TRS (TTGGC) .
- TTGGC 5’ end TRS
- GCCAA reverse complement TRS
- the reverse complement sequence of SEQ ID NO: 3 served as the DNA template, such that the transcribed RNA comprises a transcribed modified AAV2 ITR (transcribed dITR-D) having the same sequence as SEQ ID NO: 3, except that all T’s were replaced by U’s.
- both the dITR and dITR-D sequences retain the shaded palindromic RBE sequence SEQ ID NO: 5 (CTGCGCGCTCGCTCGCTCACTG ... CAGTGAGCGAGCGAGCGCGCAG) , and their respective transcribed modified ITR’s also have the RBE sequence.
- Such optimized ITR coding sequences were inserted into two positions of the tdTomato expression cassette -one located in-between the promoter and the tdTomato coding sequence, and the other located in-between the Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) and the SV40 polyA signal.
- WP Woodchuck Hepatitis Virus
- WPRE Posttranscriptional Regulatory Element
- a conventional AAV vector with a ssDNA vector genome and no ITR sequences at either end ( “CTWS, ” which stands for the sequence elements CAG promoter, tdTomato transgene, WPRE sequence, and SV40 polyA signal sequence) were used as a control.
- CWS CMV promoter
- tdTomato transgene tdTomato transgene
- WPRE sequence WPRE sequence
- SV40 polyA signal sequence SV40 polyA signal sequence
- AAV serotype DJ was chosen because of its excellent transduction efficiency in cultured cells used.
- AAV-DJ is a synthetic serotype with a chimeric capsid of AAV-2, 8, and 9. It contains a heparin-binding domain in its capsid, which may efficiently transduce a broad range of cell types and escape from immune neutralization (Grimm et al., J. Virol. 82: 5887-5911, 2008) .
- Both the various RAAV-ITR viral particles and the control viral particles were generated by using the triple-plasmid transfection system (FIG. 4) .
- the RAAV vectors were generated by co-transfecting tansgene plasmid, packaging plasmid and helper plasmid (weight ratio was 1: 1: 2) into HEK293T cells.
- the HEK293T cells were cultured in competent DMEM medium, and the cells were plated 24 hrs before transfection. Before transfection, the culture medium was replaced with fresh DMEM containing 2%FBS. PEI-MAX was used as the transfection reagent. The supernatant was then collected at Day 2 and Day 5 post transfection, and transfected cells were harvested on Day 5.
- RAAV vectors were purified by using iodixanol density gradient ultracentrifugation.
- Viral titers were determined by Q-PCR and Reverse transcription-PCR (RT-PCT) , respectively, using the procedure in FIG. 5A.
- the harvested and purified RAAV viral particles were first subjected to DNase I and RNase I treatment at 37°C for 2 hours to remove all nucleic acids outside the protein shells of the viral particles.
- the nucleases were denatured at 100°C for about 30 min, before the RAAV viral particles were denatured and ruptured to release the RAAV nucleic acid contents for further analysis.
- Q-PCR was used to analyze the nuclease-resistant products, in order to titrate the DNA vector genome encapsidated within the RAAV viral particles, Specifically, a primer pair specific for the promoter sequence was used in one set of Q-PCR to detect /quantitate any functional DNA, and a primer pair specific for the WPRE sequence was used in another set of Q-PCR to detect /quantitate any DNA vector genome encapsidated in the RAAV viral particles. See FIG. 5B.
- any RAAV-encapsidated DNA was first removed by DNA removal through Dnase I digestion, before the remaining RNA was subjected to reverse-transcription, and the resulting cDNA was used as Q-PCR templates for detection /quantitation of WPRE sequences transcribed into RNA.
- a sample after the DNA removal step was directly amplified using Q-PCR to detect any WPRE (DNA) sequences that might be present in that sample. See FIG. 5A.
- RNA vector genome was also packaged into viral particles (see the bar labelled as “RNA” which is about 2 orders of magnitude lower than the bar labelled as “DNA” and “Functional DNA” ) . Residual DNA is one order of magnitude less than the packaged RNA vector genome.
- FIG. 6B in which the CTWIS constructs were tested. Specifically, essentially the same results were obtained regarding packaging the pssDNA constructs (compared FIGs. 6A and 6B) –most packaged viral particles contained DNA (99%or more) and negligible amount (1%or less) of RNA.
- dITR ITR sequence
- ITR and dITR-D impaired the replication of the conventional AAV vectors, thereby leading to a reduction of DNA packaging into the RAAV viral particle.
- RAAV vectors with the dITR-D optimized ITR seem to have a better ability to encapsidate the transcribed mRNAs directly into RAAV particles, especially when the dITR-D ITR is located downstream of the mRNA coding sequence and WPRE sequence (for example, just 5’ to the polyA signal) . See FIGs. 6A-6C.
- a dITR-D sequence located upstream of the mRNA coding sequence e.g., right after the promoter sequence in the expression construct
- a dITR-D sequence located upstream of the mRNA coding sequence e.g., right after the promoter sequence in the expression construct
- CITWIS-D which harbors dITR-D signals at both ends of its mRNA genome, has the best ability to encapsidate specific mRNAs, despite the fact that its yield (mRNA-harbouring particles) is 20-fold lower than the yield of conventional AAV vectors with ssDNA vector genomes (pssAAV group) .
- RAAV vector CITWIS-D have an impaired DNA packaging, with its DNA-carrying particles only taking up about 20%or less of the RAAV vector stock, and the percentage of the particles harbouring functional DNAs is even lower (e.g., less than 10%) (FIGs. 6A-6C) .
- the undesired RAAV DNA packaging could be reduced by enlarging the size of the transgene plasmids, and functional DNA packaging could be further reduced by increasing the length of the transgene cassette, for example, by inserting cis-acting elements (such as, enhancer, intron, etc. ) or non-functional stuffer sequence into the cassette.
- cis-acting elements such as, enhancer, intron, etc.
- RAAV-dITR-D vectors are infectious and can be used as gene delivery vectors.
- CITWIS-D purified RAAV-dITR-D
- HEK293T cells were plated into 24-well plates about 24 hrs before infection. RAAV vectors were then mixed completely with 1 mL of DMEM (containing 2%FBS) . The culture medium of the cells was then removed, and the cells were incubated with mixed RAAV vectors overnight. Fluorescence photos were taken 3 and 5 days post infection.
- CTWS construct without any ITR sequences were apparently packaged to some degree, though the precise mechanism underlying this packaging remains unclear. At least two possibilities can explain the packaging of mRNA vector genome when the CTWS vectors were used: overexpressed cellular mRNAs could be packaged into the RAAV vectors non-specifically, or CTWS mRNA might have some RNA structures that interact with Rep2 or Cap-DJ. Meanwhile, CTWS DNA packaging may be due to the small size of the plasmid CTWS, and DNA packaging may be reduced by increasing the size of the CTWS plasmid.
- RNA genomes can be efficiently packaged into AAV capsids, especially with the modified /recombinant RNA constructs designed herein for direct packaging into AAV capsids to produce RAAV particles.
- the inventors have designed a strategy to utilize the strong interaction between bacteriophage-derived MS2 coat protein (MCP) and its recognizing stem loop MS2 as a novel packaging signal for packaging heterologous RNA into DNA virus viral particles.
- MCP bacteriophage-derived MS2 coat protein
- RNA packaging signals RPS
- MS2 stem loop or “MS2” for short, its RNA sequence is set forth in the sequence tables below
- WPRE Woodchuck Hepatitis Virus
- SV40 polyA signal in order to ensure that all the transcribed mRNAs would have the RPS, so as to be recognized by the binding protein, bacteriophage-derived MS2 coat protein (or “MCP” for short, its amino acid sequence is set forth in the sequence tables below) , corresponding to the MS2 (FIG. 8A) .
- AAV Rep proteins are non-structural proteins, and they conventionally serve as bridges between the ITRs of the ssDNA genomes and the AAV capsids during AAV packaging
- MCP was fused to the N-terminus of Rep78 protein and Rep68 protein from AAV2 (Rep 68 is a C-terminal truncation of Rep 78, the amino acid sequences of the two fusions are set forth in the sequence tables below) .
- Rep 68 is a C-terminal truncation of Rep 78, the amino acid sequences of the two fusions are set forth in the sequence tables below
- AAV serotype DJ ( “AAV-DJ” or “DJ” ) was selected for use because of its excellent transduction efficiency in the cultured cells, HEK293T cells, used in this Example.
- AAV-DJ is a synthetic serotype with a chimeric capsid of AAV-2, 8, and 9.
- Both the RAAV and control AAV particles herein were produced by using conventional triple-plasmid transfection system mutatis mutandis, by co-transfecting the respective transgene plasmids, packaging plasmids, and helper plasmids in a weight ratio of 1: 1: 2 into HEK293T cells.
- the HEK293T cells were cultured in competent DMEM medium, and the cells were plated 24 hrs before transfection. Shortly before transfection, the culture medium was replaced with fresh DMEM containing 2%FBS. PEI-MAX was used as the transfection reagent. Transcription of the RPS-harboring transgene plasmids to generate the RNA genomes to be packaged occurred after the transfection into the infected cells. The supernatant was then collected at Day 2 and Day 5 post transfection, and the transfected cells were harvested on Day 5. The RAAV and control AAV particles were purified by using iodixanol density gradient ultracentrifugation.
- the purified RAAV and control AAV particles were first subjected to nuclease treatment, including DNase I and RNase I treatment, at 37°C for 2 hours, in order to remove possibly existed nucleic acids outside the viral particles.
- nucleases and the RAAV or control AAV particles were denatured by proteinase K/SDS digestion at 65°C for about 3 hrs to rupture the viral particles in order to release the genomes packaged therein.
- the nuclease-resistant polynucleotides containing the released viral genomes were then extracted and purified by phenol/chloroform extraction.
- Q-PCR was used to analyze the nuclease-resistant polynucleotides directly.
- a pair of WPRE primers (as set forth in the sequence tables below) specific for the WPRE sequence on the viral genomes was used in the Q-PCR to detect and quantitate any DNA genomes encapsidated in the control AAV or RAAV particles.
- any control AAV-or RAAV-encapsidated DNA genomes was removed by DNA removal through Dnase I digestion, before the encapsidated RNA genomes were subjected to reverse-transcription, and the resulting cDNA was used as Q-PCR templates for the detection and quantitation of WPRE sequences with the same pair of WPRE primers aforementioned.
- a sample after the DNA removal step was directly amplified (without reverse-transcription) using Q-PCR to detect the WPRE (DNA) sequence with the same pair of WPRE primers aforementioned, which was also used for all the other PCR reactions specific for WPRE sequence.
- RNA genomes were also packaged into the particles (see the bar labelled as “RNA, ” which was about 5 orders of magnitude lower than the bar labelled as “DNA” ) .
- the presence of residual DNA is comparable to that of RNA, which may be due to the inefficient digestion of packaged DNA genomes with DNase I before reverse-transcription.
- DJ-MCP MCP fused to the N-terminus of Rep78 and 68 proteins
- the CTWS construct (ITR-free) produced about 4 orders of magnitude less of packaged DNA, and even less packaged RNA, no matter which packaging plasmid (DJ or DJ-MCP) was used.
- the RAAV transgene plasmids, CTWMS and CTWM3S respectively were obtained.
- the CTWMS and CTWM3S constructs could barely be encapsidated as DNA or RNA genomes, just like the genome distribution pattern of CTWS.
- the use of DJ-MCP as the packaging plasmid instead of DJ significantly reversed the packaging efficiency difference between DNA and RNA genomes, and the vast majority of the packaged genomes were RNA.
- the numbers of the packaged RNA genomes of CTWMS /DJ-MCP and CTWM3S /DJ-MCP were about 100-and 400-fold higher, respectively, whereas no significant difference was observed in the DNA-packaged number of the three.
- This result suggested that the MCP-Rep78/68 fusions could recognize the RPS, MS2, embedded in the RNA transcripts of the CTWMS and CTWM3S plasmids specifically and facilitate their RNA packaging into RAAV particles, and three copies of RPS in the CTWM3S construct provided an even better RNA packaging efficiency than one copy (FIG. 8B) .
- the introduction of the MS2/MCP pair into conventional AAV packaging system enabled the packaging of MS2-harboring RNA genomes into AAV particles in the presence of the MCP-Rep78/68 fusions, leading to the generation of RAAV particles.
- the undesired DNA packaging only constituted about 10%of the whole viral particle population produced by using CTWM3S /DJ-MCP.
- RPS native RNA virus packaging signal pair
- This example demonstrates that increasing the backbone size of the AAV transgene plasmid by inserting a stuffer sequence into the backbone of the plasmid could reduce undesired DNA packaging into RAAV particles.
- CTWMS and CTWM3S constructs for RAAV particles in Example 3 did not have ITRs and no reverse packaging existed in the RAAV production, it was speculated that the relative small size (5 ⁇ 6 kb) of the RAAV transgene plasmids might still lead to undesired DNA packaging.
- a 3266 bp non-coding sequence (stuffer sequence; see the sequence tables below) was inserted upstream of the tdTomato expression cassette of CTWM3S in order to increase the backbone length of the CTWM3S transgene plasmid, and the resulting construct was named L-CTWM3S.
- the schematic diagram of the plasmid is shown in FIG. 9A.
- RAAV particles were produced by co-transfecting CTWM3S or L-CTWM3S transgene plasmid together with the packaging plasmid DJ-MCP and the helper plasmid into HEK293T cells, and the resulting RAAV particles were purified and the viral genomes were quantified.
- the same pair of WPRE primers were used to detect and quantitate any DNA and RNA genomes encapsidated in the AAV and RAAV particles, and an additional pair of CAG primers specific for the CAG promoter sequence in the viral genomes were used in Q-PCR to detect and quantitate any functional DNA (meaning DNA containing the CAG promoter sequence and able to express functional transgene proteins) .
- RNA columns on the drawings with CAG primers represented background RNA signals (see FIG. 9B) .
- the DNA genome titer of the L-CTWM3S group was about 2 times lower than that of the CTWM3S group, no matter which pair of primers was used in Q-PCR (see FIGs. 9B and 9C) .
- the RNA genome titers of the CTWM3S and L-CTWM3S groups were substantially equivalent (see FIG. 9C) . Since there is no CAG promoter sequence in the transcribed RNA from the CTWM3S and L-CTWM3S transgene plasmids, the packaged RNA genomes could only be detected with the pair of WPRE primers (FIG. 9C) .
- the Cre transgene plasmids were co-transfected with the packing plasmid DJ or DJ-MCP, and together with the helper plasmid in HEK293T cells, respectively, to produce AAV and RAAV particles.
- the resulting viral particles were purified, and the viral genomes were quantified as described in Example 3.
- DJ-MCP fusion Since the DJ-MCP fusion not only assisted the RNA packaging but also retained the DNA packaging ability, its performance was also assessed in a construct containing both DNA packaging signals (ITRs) and RNA packaging signals (3 copies of MS2) designated as pssAAV-Cre-MS2X3, which was constructed by inserting 3 copies of MS2 in-between WPRE and SV40 polyA of the pssAAV-Cre construct.
- ITRs DNA packaging signals
- pssAAV-Cre-MS2X3 RNA packaging signals
- RNA packaging was remarkably improved when DJ-MCP was used instead of DJ as the packaging plasmid in combination with the RNA binding signals, and surprisingly, the increased RNA packaging did not significantly interfere with the DNA packaging of the pssAAV-Cre-MS2X3 construct (FIG. 11B) .
- the introduction of the MS2/MCP pair could significantly increase RNA packaging even without removing the DNA packaging signal-ITRs, indicating that the deconstruction of the DNA packaging system and the establishment of the RNA packaging system in AAV particles are two separate lines and the removal of ITRs is not the essential basis for the increased RNA packaging by the introduction of RPS/RBP pair.
- the subject RAAV-MS2/MCP system can be applied to any transgenes in general, such as the Cre recombinase as demonstrated above.
- the RAAV-Cre construct produced a better yield than that of the RAAV-tdTomato construct. While not wishing to be bound by any particular theory, this may be due to the simpler secondary structure of the Cre mRNA comparing to the tdTomato mRNA, based on online RNA secondary structure prediction such as that found at rna. tbi. univie. ac. at/cgi-bin/RNAWebSuite/RNAfold. cgi.
- Rep68/78 The endonuclease activity of the Rep68 and Rep78 proteins (Rep68/78) is essential for the DNA genome replication during the conventional DNA packaging of AAV particles. Without the functional trs-endonuclease, the newly-synthesized viral ssDNA cannot be released for packaging. It was investigated in this Example whether the undesired DNA packaging of RAAV particles could be further reduced by disrupting the activity of the trs-endonuclease.
- DJ-MCP Y156F, wherein the Y156F mutation was in the common sequence of Rep68 and Rep78 proteins, i.e., Rep68-Y156F and Rep78-Y156F
- DJ-MCP KDE-mu
- DJ-MCP EKE-mu
- DJ-MCP The DNA and RNA packaging efficiencies for DJ-MCP (Y156F) were firstly assessed with the transgene plasmid, pssAAV-Cre-MS2X3 containing both the DNA and RNA packaging signals, as described in Example 5. DJ and DJ-MCP were set as packaging plasmid controls. Viral particles were produced, purified, and titrated as described in Example 3.
- L-CCWM3S in Example 5 was used as a RAAV transgene plasmid to provide viral genomes in place of pssAAV-Cre-MS2X3.
- the DJ-MCP which was trs-endonuclease positive, was used as a control against DJ-MCP (Y156F) .
- Viral particles were produced, purified, and titrated as described in Example 3. Two pairs of primers were used here to titrate viral genomes, one pair for targeting WPRE sequence as above and one pair (see sequence tables below) for targeting the 5’ terminus of the Cre coding sequence.
- DJ-MCP Two other trs-endonuclease mutants, DJ-MCP (KDE-mu) and DJ-MCP (EKE-mu) , were also tested, and were demonstrated to have the same ability to reduce undesired DNA packaging as DJ-MCP (Y156F) , but only DJ-MCP (Y156F) showed improved RNA packaging (FIG. 13B) .
- compositions of the AAV and RAAV particles were analyzed by silver-stained SDS-PAGE, and the RAAV capsids were also composed of three VP proteins (VP1, VP2 and VP3) with a similar VP1/2/3 ratio to conventional AAV particles (FIG. 12C) .
- the RAAV particles were morphologically similar to the conventional AAV vectors, where full viral particles encapsidating genomes were viewed as 25-nm solid spheres, and empty viral particles without genomes encapsidated were 25-nm donut-like structures (FIG. 12D) .
- the mutation of functional proteins including Rep proteins participating in the DNA packaging process of AAV production to weaken or eliminate their DNA- packaging-associated functions in combination with the removal of DNA packaging signals, ITRs is an optimized strategy to reduce or inhibit undesired DNA packaging of RAAV particles.
- the produced RAAV particles have similar compositions and morphology to the conventional AAV particles.
- Cre-loxP system a highly sensitive system, was used for investigating the infectivity of the inventive RAAV vectors.
- Mouse embryonic fibroblast (MEF) cells isolated from homo-Ai9 (bearing loxP-tdTomato-reporter system) mice were incubated with the purified AAV (pssAAV-Cre /DJ) or RAAV (L-CCWM3S /DJ-MCP (Y156F) ) vectors in Example 5 overnight, and Multiplicity of Infections (MOIs) (the number of virions added per cell during infection) were set, including 7 MOIs for conventional AAV vectors and 3 MOIs for RAAV vectors.
- MOIs Multiplicity of Infections
- the dominant genome titer quantified by detecting Cre coding sequence with the 5’-terminus Cre primers aforementioned was used as the infection titer.
- the DNA genome titer was used for the conventional AAV vectors
- the RNA genome titer was used for the RAAV vectors.
- Ai9-MEF cells were plated into 48-well plates in about 5 ⁇ 10 4 cells per well about 24 hrs before infection.
- AAV vectors or RAAV vectors were mixed completely with 0.5 mL of DMEM containing 2%FBS.
- the culture medium of the plated cells was removed, and then the cells were incubated with mixed AAV or RAAV vectors overnight at 37°C.
- the infected cells were collected at different time points and subjected to RNA and DNA analysis.
- a pair of primers targeting the 5’-terminus of Cre-coding sequence as aforementioned was used for detecting the specific Cre-coding DNA and mRNA derived from the vectors. Fluorescence photos were taken daily post infection (p.i) , and the fluorescence-positive cells were quantified by flow cytometry 5 days p.i.
- the mRNA analysis results showed that the specific mRNA was detected in the RAAV-infected cells as early as 2 hrs p.i, peaked at 6 hrs p.i, and then decreased.
- the cells infected with the conventional AAV vectors no apparent transcription was detected at 2 hrs p.i, but a rapid increase of transcribed mRNA was observed from 6 hrs to 20 hrs p.i, reaching a plateau at 30 hrs.
- the mRNA level in the cells infected with the conventional AAV vectors did not decrease after reaching the plateau.
- the copy numbers of the Cre mRNAs were positively correlated with MOIs in all the samples (FIGs. 14A-14B and FIG. 15A) .
- mGAPDH mRNA was tested as a reference transcript (housekeeping gene) , and as expected, there was no difference in mGAPDH mRNA levels among all the samples (FIG. 15C) .
- the DNA results were quite different from the mRNA results.
- Conventional AAV and RAAV vectors had substantially the same DNA copy number pattern, the majority of DNA genomes was detected in the infected cells as early as 2 hrs post infection, and then a slight increase followed from 2 hrs to 20 hrs p.i, which was very similar to the trend of the mRNA levels in the RAAV-infected cells. After that, the DNA level reached a plateau or descended slowly.
- the DNA level of another housekeeping gene 36B4 was quantified as a reference gene, and as expected, no obvious difference in the DNA levels was observed among all the samples (FIG. 15D) .
- the lower fluorescent intensity of tdTomato in the RAAV-infected cells was possibly due to the short lifetime of the Cre mRNAs delivered thereinto and the inability of the limited amount of the translated Cre recombinase to rescue both of the two copies of tdTomato expression cassettes in the homo-Ai9-MEF cells (FIG. 16) .
- inventive RAAV vector could deliver functional Cre mRNAs into cells and express functional Cre recombinase.
- Cre expression increased during the first 4 days, but then decreased.
- a small amount of Cre was detected at as early as about 24 hrs after RAAV-CCWM3S transfer and disappeared after Day 2.
- This quick expression and degradation phenomenon may be due to the instant appearance and short lifetime of the delivered functional Cre mRNA (FIGs. 17A and 17B) .
- RAAV particles can be used as a tool for in vivo gene delivery and to express the functional Cre recombinase transiently.
- mice Six weeks after AAV or RAAV injection, mice were anesthetized and transcardially perfused with PBS at room temperature at pH 7.4 and then with freshly prepared, ice-cold 4%paraformaldehyde (PFA) in phosphate buffers (PB) .
- PFA paraffin wax
- PB phosphate buffers
- the brains were post-fixed in 4%PFA overnight.
- the fixed brains were embedded with OCT for frozen section after dehydration. Brains were sectioned in 20 ⁇ m thickness using a freezing microtome (Leica CM1950) , and the sections were mounted to slides directly. The slides were baked at 60°C for 1-2 hours followed by blocking with 5%BSA serum in PBS for 1 h.
- the slides were incubated with the primary antibody against Cre (10536; Cell Signaling Technology; 1: 800 dilution) in 5%BSA in PBS (0.1%Triton-X) overnight at room temperature. After five washes with PBS, the slides were incubated in 1%BSA in PBS containing secondary antibody against the primary antibody and DAPI (D3571, Invitrogen) .
- the secondary antibody used was Alexa Fluor 488 donkey anti-rabbit IgG (711-545-152, Jackson ImmunoResearch) (at 1: 1000 dilution) . Images were acquired with Nikon C2si+ Confocal Microscope.
- the acquired images showing fluorescence from tdTomato expression system demonstrated that RAAV-Cre infected the cells in Ai9-mice hippocampus and rescued the expression of tdTomato.
- the number of the infected cells in the RAAV-Cre group was less than that of the AAV-Cre group at the same dose.
- the RAAV-Cre infection generated much more tdTomato positive cells relative to the low-dose group (30-fold lower dose) of AAV-Cre infection.
- Cre expression was easily detected in both the high-dose and low-dose groups of AAV-Cre infection, but no significant Cre expression was detected in the RAAV-Cre infected cells despite of the detected tdTomato fluorescence proving the once existence of Cre.
- the RAAV-Cre had an inferior transduction efficiency compared to the conventional AAV-Cre as shown by the fluorescent photos (positive cell counts) for the two at the same high dose of 1E9 vg/mouse (FIG. 21A vs. FIG. 21C) , since multiple mRNAs for protein translation can be transcribed from one successfully transduced AAV DNA genome.
- the transduction efficiency of the AAV-Cre was normalized to that of the RAAV-Cre by reducing the high dose of AAV-Cre of 1E9 vg/mouse to a low dose of 3E6 vg/mouse (FIG.
- RNA packaging signal /RNA binding protein “RPS/RBP” herein
- Com binding site /phage COM protein “com/COM, ” or “COM” for short, or “C” in L-CCW C 3S”
- com/COM is not a natural viral packaging system but known to be transcription regulators that play roles in the transcription initiation of the bacteriophage Mu mom gene.
- RAAV-MS2/MCP and RAAV-com/COM system worked well in all the four serotypes, suggesting the general applicability of the RAAV packaging systems to different AAV serotypes (i.e., not limited to AAV-DJ) .
- Cre RNA genomes containing the corresponding RPS were efficiently encapsidated into the respective RAAV particles.
- the yields of the RNA-packaged RAAV particles varied from serotype to serotype, all of the RAAV5, RAAV8 and RAAV9 particles had a higher productivity than RAAV-DJ (FIG. 19) .
- AAV encodes a unique assembly-activating protein (AAP) within their natural viral genomes that is essential for capsid assembly. Specifically, AAP was found to be essential for capsid protein stabilization and generation of functional AAV particles.
- AAP assembly-activating protein
- AAP-MCP (with MCP fused to the C-terminus of AAP) or MCP-AAP (with MCP fused to the N-terminus of AAP) fusion protein expression cassette was inserted inversely into the backbone of the packaging plasmid DJ-MCP (Y156F) used in Examples 6-10, and the resulting constructs were named DJ-MCP (Y156F) -AM and DJ-MCP (Y156F) -MA, respectively.
- Such constructs then expressed both MCP-Rep78/68 (Y156F) fusion and AAP-MCP or MCP-AAP fusion, increasing the amount of RNA binding proteins (RBPs) assisting in RNA packaging compared with MCP-Rep78/68 fusion alone.
- Viral particles were produced, purified, and titrated as described in Example 3.
- RNA-packaged RAAV particles were increased by about 65%in DJ-MCP (Y156F) -MA and about 35%in DJ-MCP (Y156F) -AM compared with MCP-Rep78/68 fusion alone (FIGs. 20A and 20B) , suggesting that RBPs could be additionally fused to or associated with any other proteins which play roles in the packaging or assembly of AAV particles in order to enhance the RNA packaging of RAAV particles.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112023015769A BR112023015769A2 (pt) | 2021-02-07 | 2022-02-07 | Vetor de vírus adenoassociado de rna (raav) e usos do mesmo |
| CN202280002654.0A CN115209924A (zh) | 2021-02-07 | 2022-02-07 | Rna腺相关病毒(raav)载体及其用途 |
| KR1020237030365A KR20230142776A (ko) | 2021-02-07 | 2022-02-07 | Rna 아데노 관련 바이러스(raav) 벡터 및 그 용도 |
| CA3207601A CA3207601A1 (en) | 2021-02-07 | 2022-02-07 | Rna adeno-associated virus (raav) vector and uses thereof |
| IL305002A IL305002A (en) | 2021-02-07 | 2022-02-07 | Adeno-related virus vector (raav) and its uses |
| AU2022217349A AU2022217349A1 (en) | 2021-02-07 | 2022-02-07 | Rna adeno-associated virus (raav) vector and uses thereof |
| EP22749233.7A EP4288112A4 (en) | 2021-02-07 | 2022-02-07 | RNA ADENO-ASSOCIATED VIRUS (ARAV) VECTOR AND USES THEREOF |
| JP2023548288A JP2024508696A (ja) | 2021-02-07 | 2022-02-07 | Rnaアデノ随伴ウイルス(raav)ベクター及びその用途 |
| US17/836,222 US12031148B2 (en) | 2021-02-07 | 2022-06-09 | RNA adeno-associated virus (RAAV) vector and uses thereof |
| US18/664,495 US20240368629A1 (en) | 2021-02-07 | 2024-05-15 | Rna adeno-associated virus (raav) vector and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNPCT/CN2021/075874 | 2021-02-07 | ||
| CN2021075874 | 2021-02-07 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/836,222 Continuation US12031148B2 (en) | 2021-02-07 | 2022-06-09 | RNA adeno-associated virus (RAAV) vector and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022166954A1 true WO2022166954A1 (en) | 2022-08-11 |
Family
ID=74946911
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CN2022/075366 Ceased WO2022166954A1 (en) | 2021-02-07 | 2022-02-07 | Rna adeno-associated virus (raav) vector and uses thereof |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US12031148B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4288112A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024508696A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20230142776A (cg-RX-API-DMAC7.html) |
| CN (1) | CN115209924A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2022217349A1 (cg-RX-API-DMAC7.html) |
| BR (1) | BR112023015769A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3207601A1 (cg-RX-API-DMAC7.html) |
| IL (1) | IL305002A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022166954A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025124549A1 (en) * | 2023-12-13 | 2025-06-19 | Huidagene Therapeutics (Singapore) Pte. Ltd. | Improved system and method for producing recombinant dna-packaged aav particles |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116218904B (zh) * | 2022-11-03 | 2025-04-15 | 国药中生生物技术研究院有限公司 | 一种可提高工程化细胞外泌体中特定核酸分子载量的方法及其应用 |
| CN120659629A (zh) * | 2022-12-08 | 2025-09-16 | 辉大基因治疗(新加坡)私人有限公司 | 用于产生rna包装的aav颗粒的改善的系统 |
| CN117778431B (zh) * | 2023-12-04 | 2024-10-25 | 广州派真生物技术有限公司 | 一种用于重组腺相关病毒包装的质粒系统及其应用 |
| CN117701638B (zh) * | 2023-12-18 | 2024-10-18 | 苏州新芽基因生物技术有限公司 | 一种抑制残留aav载体质粒和质粒骨架转录活性的方法 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018131551A1 (ja) * | 2017-01-13 | 2018-07-19 | 学校法人自治医科大学 | 肝臓ゲノム上の凝固関連因子遺伝子を破壊するためのaavベクター |
| CN110114461A (zh) * | 2016-08-17 | 2019-08-09 | 博德研究所 | 新型crispr酶和系统 |
| CN110312799A (zh) * | 2016-08-17 | 2019-10-08 | 博德研究所 | 新型crispr酶和系统 |
| CN111349148A (zh) * | 2020-03-13 | 2020-06-30 | 辉大(上海)生物科技有限公司 | 一种腺相关病毒载体及其用途 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6346415B1 (en) * | 1997-10-21 | 2002-02-12 | Targeted Genetics Corporation | Transcriptionally-activated AAV inverted terminal repeats (ITRS) for use with recombinant AAV vectors |
| US9790490B2 (en) * | 2015-06-18 | 2017-10-17 | The Broad Institute Inc. | CRISPR enzymes and systems |
| JP7044373B2 (ja) * | 2015-07-15 | 2022-03-30 | ラトガース,ザ ステート ユニバーシティ オブ ニュージャージー | ヌクレアーゼ非依存的な標的化遺伝子編集プラットフォームおよびその用途 |
| EP3565608A4 (en) * | 2017-01-05 | 2020-12-16 | Rutgers, The State University of New Jersey | TARGETED GENE EDITING PLATFORM INDEPENDENT OF BICATENARY DNA BREAKAGE AND ITS USES |
| BR112019028146A2 (pt) * | 2017-07-31 | 2020-07-07 | Sigma-Aldrich Co. Llc | rna guia sintético para sistemas ativadores de crispr/cas |
| CN109055375B (zh) * | 2018-07-26 | 2021-11-12 | 东南大学 | 一种crispr辅助反式增强子激活基因表达的方法及其应用 |
| JP2023537296A (ja) * | 2020-07-29 | 2023-08-31 | ザ・キャソリック・ユニバーシティ・オブ・アメリカ | ヒトゲノムリモデリングのためのバクテリオファージベースの人工ウイルスの設計 |
-
2022
- 2022-02-07 CN CN202280002654.0A patent/CN115209924A/zh active Pending
- 2022-02-07 CA CA3207601A patent/CA3207601A1/en active Pending
- 2022-02-07 AU AU2022217349A patent/AU2022217349A1/en active Pending
- 2022-02-07 KR KR1020237030365A patent/KR20230142776A/ko active Pending
- 2022-02-07 IL IL305002A patent/IL305002A/en unknown
- 2022-02-07 EP EP22749233.7A patent/EP4288112A4/en active Pending
- 2022-02-07 JP JP2023548288A patent/JP2024508696A/ja active Pending
- 2022-02-07 BR BR112023015769A patent/BR112023015769A2/pt not_active Application Discontinuation
- 2022-02-07 WO PCT/CN2022/075366 patent/WO2022166954A1/en not_active Ceased
- 2022-06-09 US US17/836,222 patent/US12031148B2/en active Active
-
2024
- 2024-05-15 US US18/664,495 patent/US20240368629A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110114461A (zh) * | 2016-08-17 | 2019-08-09 | 博德研究所 | 新型crispr酶和系统 |
| CN110312799A (zh) * | 2016-08-17 | 2019-10-08 | 博德研究所 | 新型crispr酶和系统 |
| WO2018131551A1 (ja) * | 2017-01-13 | 2018-07-19 | 学校法人自治医科大学 | 肝臓ゲノム上の凝固関連因子遺伝子を破壊するためのaavベクター |
| CN111349148A (zh) * | 2020-03-13 | 2020-06-30 | 辉大(上海)生物科技有限公司 | 一种腺相关病毒载体及其用途 |
Non-Patent Citations (3)
| Title |
|---|
| GEE, P ET AL.: "Extracellular nanovesicles for packaging of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping", NATURE COMMUNICATIONS, vol. 11, no. 1, 13 March 2020 (2020-03-13), XP055745253, ISSN: 2041-1723, DOI: 10.1038/s41467-020-14957-y * |
| See also references of EP4288112A4 * |
| TRAN NGOC TAM, HEINER CHERYL, WEBER KRISTINA, WEIAND MICHAEL, WILMOT DANIELLA, XIE JUN, WANG DAN, BROWN ALEXANDER, MANOKARAN SANGE: "AAV-Genome Population Sequencing of Vectors Packaging CRISPR Components Reveals Design-Influenced Heterogeneity", MOLECULAR THERAPY- METHODS & CLINICAL DEVELOPMENT, NATURE PUBLISHING GROUP, GB, vol. 18, 1 September 2020 (2020-09-01), GB , pages 639 - 651, XP093083949, ISSN: 2329-0501, DOI: 10.1016/j.omtm.2020.07.007 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025124549A1 (en) * | 2023-12-13 | 2025-06-19 | Huidagene Therapeutics (Singapore) Pte. Ltd. | Improved system and method for producing recombinant dna-packaged aav particles |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20230142776A (ko) | 2023-10-11 |
| US12031148B2 (en) | 2024-07-09 |
| CA3207601A1 (en) | 2022-08-11 |
| EP4288112A4 (en) | 2025-08-06 |
| BR112023015769A2 (pt) | 2023-12-12 |
| JP2024508696A (ja) | 2024-02-28 |
| CN115209924A (zh) | 2022-10-18 |
| US20230062529A1 (en) | 2023-03-02 |
| US20240368629A1 (en) | 2024-11-07 |
| IL305002A (en) | 2023-10-01 |
| AU2022217349A1 (en) | 2023-08-31 |
| EP4288112A1 (en) | 2023-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12031148B2 (en) | RNA adeno-associated virus (RAAV) vector and uses thereof | |
| JP2022121364A (ja) | 無カプシドaavベクター、組成物ならびにベクター製造および遺伝子運搬のための方法 | |
| AU2019226527A1 (en) | Closed-ended DNA (ceDNA) vectors for insertion of transgenes at genomic safe harbors (GSH) in humans and murine genomes | |
| CN110869498A (zh) | 经由核递送crispr/cas9导向编辑细胞rna | |
| WO2019152816A1 (en) | Campaign-ready series of recombinant adeno-associated virus (raav) complementing plasmids | |
| WO2024120528A1 (en) | Improved system for producing rna-packaged aav particles | |
| US20240100185A1 (en) | Compositions and methods for the targeting of ptbp1 | |
| CN119213013A (zh) | 具有增加的心脏富集的腺相关病毒组合物 | |
| KR20240055835A (ko) | 치료용 단백질의 발현을 위한 간 특이적 발현 카세트, 벡터 및 이들의 용도 | |
| JP2025536927A (ja) | RNA編集のためのプログラム可能なsnRNAを含む組成物及び方法 | |
| EP4603585A1 (en) | Snrna nucleic acid molecule and application thereof | |
| HK40082840A (en) | Rna adeno-associated virus (raav) vector and uses thereof | |
| CA3219287C (en) | Dual helper plasmid | |
| US20260125704A1 (en) | rAAV capsids | |
| US20250381303A1 (en) | Crispr interference therapeutics for c9orf72 repeat expansion disease | |
| JP2025516715A (ja) | 脳微小血管系を標的とするアデノ随伴ウイルスベクター | |
| WO2025059540A1 (en) | Systems and methods of gene-editing to treat spinal muscular atrophy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22749233 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3207601 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023548288 Country of ref document: JP Ref document number: 305002 Country of ref document: IL |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023015769 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022217349 Country of ref document: AU Date of ref document: 20220207 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20237030365 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020237030365 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022749233 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202305929X Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 2022749233 Country of ref document: EP Effective date: 20230907 |
|
| ENP | Entry into the national phase |
Ref document number: 112023015769 Country of ref document: BR Kind code of ref document: A2 Effective date: 20230804 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2023121263 Country of ref document: RU |