WO2022158922A2 - 프로피오니박테리움 프레우덴레키 mj2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물 - Google Patents

프로피오니박테리움 프레우덴레키 mj2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물 Download PDF

Info

Publication number
WO2022158922A2
WO2022158922A2 PCT/KR2022/001189 KR2022001189W WO2022158922A2 WO 2022158922 A2 WO2022158922 A2 WO 2022158922A2 KR 2022001189 W KR2022001189 W KR 2022001189W WO 2022158922 A2 WO2022158922 A2 WO 2022158922A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
composition
rheumatoid arthritis
present
freudenreichii
Prior art date
Application number
PCT/KR2022/001189
Other languages
English (en)
French (fr)
Other versions
WO2022158922A3 (ko
Inventor
임영희
염지아
마성호
임동준
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Publication of WO2022158922A2 publication Critical patent/WO2022158922A2/ko
Publication of WO2022158922A3 publication Critical patent/WO2022158922A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/306—Foods, ingredients or supplements having a functional effect on health having an effect on bone mass, e.g. osteoporosis prevention
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2400/00—Lactic or propionic acid bacteria
    • A23V2400/61—Propionibacterium
    • A23V2400/617—Freudenreichii

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating rheumatoid arthritis comprising a Propionibacterium freudenreichii MJ2 strain as an active ingredient, and a food composition for preventing or improving arthritis comprising the strain as an active ingredient will be.
  • Rheumatoid arthritis is a chronic systemic inflammatory autoimmune disease that is accompanied by swelling and pain due to the continuous inflammatory reaction of the joint synovial membrane, and destruction of articular cartilage and bone damage.
  • Typical early symptoms include swelling and pain in the joints of the hands and feet, and stiff joints in the morning, making it difficult to move.
  • symptoms such as osteoporosis, vasculitis, and organ involvement in addition to the joints.
  • nonsteroidal anti-inflammatory drugs have an effect of relieving pain, they cannot prevent the course of the disease and can cause gastrointestinal disturbances when taken for a long period of time.
  • lactic acid bacteria are effective in suppressing rheumatoid arthritis.
  • ingestion of Lactobacillus helveticus was effective in suppressing arthritis.
  • L. reuteri , L. casei , and L. rhamnosus were also effective in alleviating arthritis.
  • research to discover a treatment for rheumatoid arthritis using microorganisms is continuing.
  • Non-Patent Document 1 Food & Function, 2020;11(4), 3681-3694
  • Non-Patent Document 2 Journal of functional foods, 2015;13, 350-362
  • An object of the present invention is to provide a composition capable of preventing, improving, or treating rheumatoid arthritis.
  • the present invention is Propionibacterium freudenreichii ( Propionibacterium freudenreichii ) MJ2 (KCCM12272P), its culture medium, live cells, dead cells, or prevention of rheumatoid arthritis containing a mixture thereof as an active ingredient, or A therapeutic pharmaceutical composition is provided.
  • the present invention provides a food composition for preventing or improving rheumatoid arthritis containing Propionibacterium preudenreki MJ2, its culture medium, live cells, dead cells, or a mixture thereof as an active ingredient.
  • the live cells may be obtained by culturing the MJ2 strain activated in a culture medium under anaerobic conditions at 30 to 37° C. for 45 to 50 hours, and centrifuging the culture broth.
  • the dead cells may be obtained after culturing the MJ2 strain activated in a culture medium for 45 to 50 hours under anaerobic conditions of 35 to 39° C., and heat treatment.
  • the composition may increase the expression of IL-10 to suppress the inflammatory response.
  • the composition may inhibit the differentiation of osteoclasts.
  • the composition may reduce the production of IgG, IgG1, and IgG2a.
  • the composition may inhibit apoptosis and restore autophagy to a normal level.
  • the composition is at a concentration of 1 ⁇ 10 6 to 1 ⁇ 10 10 CFU/mL, preferably at a concentration of 1 ⁇ 10 7 to 1 ⁇ 10 9 CFU/mL, more preferably at a concentration of 1 ⁇ 10 It may contain MJ2 live cells at a concentration of 8 CFU/mL.
  • the composition comprises 1 ⁇ 10 6 to 1 ⁇ 10 10 cells/mL concentration, preferably 1 ⁇ 10 7 to 1 ⁇ 10 9 cells/mL concentration, more preferably It may contain MJ2 dead cells at a concentration of 1 ⁇ 10 8 cells/mL.
  • the composition may be a mixture of MJ2 live cells and dead cells.
  • the composition may be administered once a day, and may be for oral administration.
  • the present invention provides a method for improving, preventing, or treating rheumatoid arthritis, comprising administering Propionibacterium preudenrechi MJ2, its culture medium, live cells, dead cells, or a mixture thereof to an individual,
  • the administration may be oral administration, and the method may further include the step of confirming the degree of swelling of the joint after the administration step.
  • the method may be to administer MJ2 live cells and/or dead cells to an individual, and the MJ2 live cells and/or dead cells are 10 6 to 10 10 cells/day, preferably 10 7 to 10 9 cells/day, more preferably, 10 8 cells/day may be administered.
  • the present invention provides the use of Propionibacterium preudenlechi MJ2, a culture solution thereof, live cells, dead cells, or a mixture thereof for the preparation of a medicament for the prevention or treatment of rheumatoid arthritis.
  • composition of the present invention is safe even for long-term administration, restores osteoclast differentiation, inflammatory response, apoptosis and autophagy to normal levels, and inhibits antibody production for the prevention, treatment, and improvement of rheumatoid arthritis, an autoimmune disease It is expected to be used in various fields such as medicine, non-drug use, and functional food.
  • 1 is a result showing the inhibition of inflammatory cytokine expression of the strain of the present invention.
  • Figure 4 is a result showing the increase in the anti-inflammatory cytokine expression of the strain of the present invention.
  • FIG. 6 is a micro-CT image ( FIG. 6a ) and a result showing an index in a mouse model orally administered with the strain of the present invention ( FIG. 6b ).
  • 11 is a result of measuring the expression level of autophagy protein in a mouse model orally administered with the strain of the present invention.
  • Propionibacterium freudenreichii was first identified in cheese fermentation studies and is mainly found in milk and dairy products. Recently, it has been found that P. freudenreichii is effective in the treatment of colitis by regulating cytokine release by attaching to the surface of the colon.
  • the P. freudenreichii used by the present inventors is a P. freudenreichii MJ2 strain (KCCM12272P) deposited at the Korea Microorganism Conservation Center.
  • the present inventors confirmed that the P. freudenreichii MJ2 strain has an effect of increasing the expression of the anti-inflammatory cytokine IL-10 in vitro and inhibiting osteoclast differentiation at the same time, and the MJ2 strain in a collagen-induced animal model.
  • the present invention was completed by confirming that rheumatoid arthritis can be prevented.
  • the present inventors induced inflammation by treating Raw 264.7 macrophages with LPS.
  • P. freudenreichii MJ2 dead cells at various concentrations with LPS and checking the expression levels of inflammatory cytokines (IL-6, TNF- ⁇ , IL-1 ⁇ , and MMP9), 1 ⁇ 10 7 cells/mL of dead MJ2 cells It was confirmed that a significant decrease in cytokine expression in the group treated with (Example 2).
  • the present inventors treated Raw 264.7 macrophages with RANKL (Receptor activator of nuclear factor kappa- ⁇ ligand) to induce differentiation into osteoclasts, and treated P. freudenreichii MJ2 dead cells with RANKL at various concentrations to induce osteoclasts.
  • RANKL Receptor activator of nuclear factor kappa- ⁇ ligand
  • P. freudenreichii MJ2 dead cells treated at various concentrations to induce osteoclasts.
  • the osteoclast differentiation markers were reduced when MJ2 dead cells were treated at concentrations of 1 ⁇ 10 6 cells/mL and 1 ⁇ 10 7 cells/mL. It was confirmed that the expression was reduced.
  • MJ2 dead cells increase the expression of IL-10, an anti-inflammatory cytokine that suppresses the inflammatory response together with the inhibition of osteoclast differentiation (Example 4).
  • MJ2 dead cells which have been confirmed to inhibit osteoclast differentiation and anti-inflammatory activity in vitro, can be included in an orally administered drug or food to prevent rheumatoid arthritis.
  • low or high concentrations of MJ2 live and dead cells were orally administered to mice for 3 weeks, and arthritis was induced with collagen. It was confirmed that this was mild (Examples 5-1 and 5-2).
  • the present inventors measured the amount of each IgG in plasma to confirm the serological level of rheumatoid arthritis, an autoimmune disease.
  • the concentration of collagen antigen-specific total IgG antibody and IgG2a antibody in the MJ2 administration group was higher than in the non-administered group. It was confirmed that it was remarkably low (Example 5-3). From the above results, it can be seen that live and/or dead MJ2 cells can prevent rheumatoid arthritis.
  • live and dead MJ2 cells can inhibit osteoclast differentiation even in vivo , reduce apoptosis of cells around the synovial membrane, and restore autophagy to a normal level (Example) 5-5 to Examples 5-7). From the above results, it can be seen that live and/or dead MJ2 cells can suppress the progression of rheumatoid arthritis by increasing the survival rate of cells around the synovial membrane in which the inflammatory response is induced.
  • the present invention provides a pharmaceutical composition for preventing or treating rheumatoid arthritis containing Propionibacterium preudenreki MJ2, its culture medium, live cells, dead cells, or a mixture thereof as an active ingredient.
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier in addition to the active ingredient.
  • pharmaceutically acceptable carriers are those commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose. , polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.
  • a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. may be additionally included in addition to the above components.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically) according to a desired method, and the dosage may vary depending on the condition and weight of the patient, and the disease. Although it varies depending on the degree, drug form, administration route and time, it may be appropriately selected by those skilled in the art.
  • prevention refers to any action that suppresses or delays the onset of rheumatoid arthritis by administration of the pharmaceutical composition according to the present invention.
  • treatment refers to any action in which symptoms for rheumatoid arthritis are improved or beneficially changed by administration of the pharmaceutical composition according to the present invention.
  • “improvement” refers to any action of reducing a parameter related to rheumatoid arthritis, for example, the severity of symptoms by administering the composition according to the present invention.
  • the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient into the body, inactivation rate and excretion rate, disease type, and drugs used in combination, in general 0.001 to 150 mg, preferably 0.01 to 100 mg per 1 kg of body weight, may be administered daily or every other day, or divided into 1 to 3 times a day.
  • the dosage may be increased or decreased depending on the route of administration, the severity of rheumatoid arthritis, sex, weight, age, etc., and thus the dosage is not intended to limit the scope of the present invention in any way.
  • the present invention provides a method for preventing, controlling or treating rheumatoid arthritis, comprising administering the pharmaceutical composition to an individual.
  • “individual” means a subject in need of a method for preventing, controlling or treating a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat. , refers to mammals such as horses and cattle.
  • the present invention provides a health functional food composition for improving rheumatoid arthritis, comprising P. freudenreichii MJ2, its culture medium, live cells, dead cells, or a mixture thereof as an active ingredient.
  • the composition of the present invention may be added to a health functional food for the purpose of preventing or improving rheumatoid arthritis. They can be used together, and they can be used appropriately according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the compound of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw material.
  • the above amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.
  • Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and it includes all health functional foods in the ordinary sense.
  • the health beverage composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage.
  • the above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol.
  • sweetener natural sweeteners such as taumatine and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used.
  • the proportion of the natural carbohydrate is generally about 0.01 to 0.20 g, preferably about 0.04 to 0.10 g per 100 ml of the composition of the present invention.
  • the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, It may contain a carbonation agent used in carbonated beverages, and the like.
  • the composition of the present invention may contain fruit for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01 to 0.20 parts by weight per 100 parts by weight of the composition of the present invention.
  • Example 1 Propionibacterium freudenreichii Production of live and dead cells of MJ2
  • P. freudenreichii MJ2 is a strain in which a single colony was purified three times from raw milk procured from a ranch in Gimpo, Gyeonggi-do, a candidate strain was selected, and the identified strain was deposited using 16s rDNA sequencing.
  • Example 2 P. freudenreichii Measurement of inhibition of inflammatory cytokine expression in dead MJ2 bacteria
  • Raw 264.7 cell line a macrophage cell line
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS Fetal bovine serum
  • penicillin 100 units/mL
  • streptomycin 100 ⁇ g/mL
  • CO 2 -95% air composition.
  • the cells were removed using a scraper, adjusted to 2.5 ⁇ 10 8 cells/mL, and inoculated 2 mL each in 6 wells. After stabilization in an incubator at 37°C for one day, it was treated with 100 ng/mL LPS (Lipopolysaccharides) and dead P. freudenreichii MJ2 cells (1 ⁇ 10 5 , 1 ⁇ 10 6 , 1 ⁇ 10 7 cells/mL) and cultured for 24 hours. did.
  • LPS Lipopolysaccharides
  • Example 2-1 the macrophage culture supernatant cultured by treating LPS and MJ2 dead cells was removed, and RNA was isolated using Trizol. After converting the isolated RNA into cDNA using Revert Aid First Strand cDNA kit (Fermentas, EU), DyNamo HS SYBR Green qPCR kit (FINNZYMES, Finland) reagent was used in Applied Biosystems 7500 (AppliedBiosystems, FosterCity, CA, USA) machine After pre-heating at 95°C for 10 minutes using The sequences of the primers used are shown in Table 1 below.
  • Example 3 P. freudenreichii Measurement of inhibition of differentiation of osteoclasts of dead MJ2 cells
  • Macrophage cell line Raw 264.7 cell line was treated with 50 ng/mL Receptor activator of nuclear factor kappa- ⁇ ligand (RANKL) for 4 days to induce differentiation into osteoclasts. 10% FBS, 100 units/mL penicillin, and 100 ⁇ g/mL streptomycin were added to Minimum Essential Medium Eagle-Alpha Modification ( ⁇ -MEM) medium, and incubated at 37°C in an incubator with 5% CO 2 -95% air. When the cells grew to 80% confluent, the cells were removed using a scraper, adjusted to 1 ⁇ 10 4 cells/mL, and inoculated 1 mL each in 12 wells. After stabilization in an incubator at 37° C. for one day, RANKL and dead P. freudenreichii MJ2 cells (1 ⁇ 10 5 , 1 ⁇ 10 6 , 1 ⁇ 10 7 cells/mL) were treated and cultured for 4 days.
  • ⁇ -MEM Minimum Essential Medium Eagle-Alpha Modification
  • Example 3-1 the macrophage culture supernatant cultured by treating dead cells with RANKL and MJ2 was removed, and RNA was isolated using Trizol. After the isolated RNA was converted to cDNA using Revert Aid First Strand cDNA kit, real-time PCR was performed using an Applied Biosystems 7500 machine with DyNamo HS SYBR Green qPCR kit reagent. The sequences of the primers used are shown in Table 2 below.
  • TRAP is an enzyme expressed during differentiation into osteoclasts, and the degree of differentiation of osteoclasts can be confirmed through TRAP staining. Accordingly, the macrophage culture supernatant cultured by treating dead cells with RANKL and MJ2 in Example 3-1 was removed, and the cells were washed with PBS and then fixed. After adding sodium tartrate to the premixed substrate NABP/FRVLB, the TRAP of osteoclasts was stained with the solution at 37°C for 30 minutes. After removing the supernatant and washing the cells with distilled water, osteoclasts having three or more nuclei were observed through an optical microscope. To measure TRAP activity, fixed cells were cultured in citrate buffer containing sodium tartarte and para-Nitrophenylphosphate (pNPP), the reaction mixture was stopped through NaOH and absorbance was measured at 405 nm. Corrected.
  • pNPP para-Nitrophenylphosphate
  • Example 4 P. freudenreichii Interleukin-10 (IL-10) expression increase in MJ2 dead cells
  • IL-10 as a representative anti-inflammatory cytokine, is known not only to suppress the inflammatory response but also to inhibit the differentiation of osteoclasts by inhibiting the expression of nuclear factor of activated T-cells c1 (NFATc1), a major factor in osteoclast differentiation. After taking the supernatant to measure the IL-10 expression level by P. freudenreichii MJ2 dead cells, an ELISA method was performed.
  • the IL-10 expression level was significantly increased in the group treated with 1 ⁇ 10 6 cells/mL and 1 ⁇ 10 7 cells/mL of P. freudenreichii MJ2 dead cells compared to the group treated with only RANKL. .
  • Example 5 P. freudenreichii Evaluation of the efficacy of MJ2 dead cells in preventing rheumatoid arthritis
  • P. freudenreichii MJ2 was directly injected into DBA/1 mice through oral administration for 3 weeks before arthritis induction, and arthritis was induced with collagen.
  • the groups were the group that did not induce arthritis after feeding with PBS (Control), the group that induced arthritis after feeding with PBS (Vehicle), and the group that induced arthritis after feeding the high concentration of 1 ⁇ 10 8 CFU/mL of P. freudenheimii MJ2 live cells. (High-dose Live; HDL), P. freudenheimii MJ2 live cells at a low concentration of 1 ⁇ 10 7 CFU/mL and then arthritis induced group (Low-dose Live; LDL), P.
  • freudenreichii MJ2 dead cells with a high concentration of 1 ⁇ 10 8 cells After feeding /mL, the group induced arthritis (High-dose Dead; HDD) and P. freudenreichii MJ2 dead cells low concentration 1 ⁇ 10 7 cells/mL was fed and then divided into the arthritis-induced group (Low-dose Dead; LDD). .
  • 1st immunization was performed by injecting type 2 bovine collagen into complete Freund's Adjuvant (CFA) at a 1:1 ratio, then intradermal injection of the tail, and 3 weeks later, type 2 bovine collagen was injected into incomplete Freund's.
  • CFA complete Freund's Adjuvant
  • the knee joint and foot area of the mouse were taken with micro-CT, converted into a 3D image, and observed.
  • HRP Horseradish peroxidase
  • the spleen index was obtained by dividing by the weight of the subject.
  • the spleen index value was significantly higher when arthritis was induced, and the spleen index value was significantly lower in the P. freudenreichii MJ2 live cell low concentration and dead cell low concentration group.
  • the plasma was separated by collecting the blood of the mouse, and the amounts of IL-6 and TNF- ⁇ , which are representative inflammatory cytokines in plasma, were measured through the ELISA method, and the spleen of the mouse was crushed to produce IL-10, a representative anti-inflammatory cytokine. The amount was determined by ELISA method.
  • the amount of IL-6 and TNF- ⁇ was significantly increased in the rheumatoid arthritis-induced group compared to the non-rheumatoid arthritis group, and in the case of IL-6, P. freudenreichii MJ2 dead cells Anti-inflammatory effect was shown in the group administered with TNF- ⁇ , and anti-inflammatory effect was shown in the group administered with live and dead P. freudenheimii MJ2 cells. In the case of IL-10, all groups except for the low concentration of dead P. freudenheimii MJ2 showed a tendency to increase.
  • the osteoclast differentiation-related genes NFATc1, Cathepsin K (Ctsk), Calcitonin receptor (Calcr), Matrix metallopeptidase 9 (MMP9) in the group inducing rheumatoid arthritis compared to the group not inducing rheumatoid arthritis as shown in FIG. ) was significantly increased, and the expression levels of these genes were significantly decreased in the group administered with P. freudenheimii MJ2.
  • the expression ratio of Osteoprotegrin (OPG)/RANKL which inhibits osteoclast differentiation and promotes osteoblast differentiation, was significantly increased in the group administered with P. freudenreichii MJ2.
  • the amount of protein was quantified by the Bradford method by crushing the synovial tissue near the hind leg of the mouse, and denaturation at 100° C. followed by western blot.
  • the Bax/Bcl2 ratio, Caspase-3 and Cytochrome c expression levels were significantly higher in the rheumatoid arthritis-induced group compared to the non-rheumatoid arthritis group, and P. freudenreichii MJ2 was administered. Expression levels of these proteins were significantly reduced in one group.
  • the amount of protein was quantified using the Bradford method by crushing the synovial tissue near the hind leg of the mouse, and denaturation at 100 ° C.
  • the rheumatoid arthritis-induced group had a decreased LC3B expression level compared to the non-rheumatoid arthritis group, and the LC3B expression level was significantly increased in the P. freudenreichii MJ2 administered group.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Nutrition Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Rheumatology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 프로피오니박테리움 프레우덴레키(Propionibacterium freudenreichii) MJ2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 개선 또는 치료용 조성물에 관한 것으로서, 본 발명의 조성물은 장기간 투여에도 안전하고, 파골세포 분화, 염증반응, 세포사멸, 항체 생성을 억제하면서 오토파지를 정상수준으로 회복시켜 자가면역질환인 류마티스 관절염의 예방, 치료, 및 개선을 위한 의약용, 의약부외용, 기능성 식품용 등 다양한 방면으로 이용될 것으로 기대된다.

Description

프로피오니박테리움 프레우덴레키 MJ2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물
본 발명은 프로피오니박테리움 프레우덴레키(Propionibacterium freudenreichii) MJ2 균주를 유효성분으로 포함하는 류마티스 관절염 예방 또는 치료용 약학적 조성물 및 상기 균주를 유효성분으로 포함하는 관절염의 예방 또는 개선용 식품 조성물에 관한 것이다.
류마티스 관절염은 관절 활막의 지속적인 염증반응으로 인해 부종과 통증이 수반되며, 관절 연골의 파괴 및 뼈 손상이 일어나는 만성 전신성 염증성 자가면역질환이다. 대표적인 초기 증상으로 손, 발의 관절이 붓고 통증이 느껴지는 것이 있으며 아침에 관절이 뻣뻣해져 움직임이 힘들어지는 것이 있다. 또한, 관절 이외에 골다공증, 혈관염 및 장기 침범 등의 증상을 동반한다고 알려져 있다.
현재까지 류마티스 관절염 완치제는 개발되지 않았지만, 류마티스 관절염 치료약제로써 비스테로이드성 항염제, 면역억제제, 항류마티스제 등이 쓰이고 있다. 하지만 비스테로이드성 항염제는 통증을 완화시키는 효과를 보이지만 질병의 경과를 막지는 못하고 장기간 복용 시 위장 장애를 일으킬 수 있으며, TNF-α 억제제와 같은 면역억제제는 잠복 결핵과 같은 부작용이 나타날 수 있다.
따라서 상기 약물들을 대체할 수 있는, 류마티스 관절염 증상을 억제하면서 부작용이 적은 신규 치료제 개발이 필요한 실정이다.
최근 들어 유산균의 다양한 효과와 더불어, 유산균이 류마티스 관절염을 억제하는데 효과가 있다고 밝혀지고 있다. 콜라겐으로 관절염을 유도한 모델에서 Lactobacillus helveticus의 섭취가 관절염을 억제하는데 효과가 있었으며, 이 밖에 L. reuteri, L. casei, L. rhamnosus 또한 관절염을 완화시키는 효과를 보였다. 관련하여 미생물을 이용한 류마티스 관절염 치료제를 발굴하고자 하는 연구가 계속되고 있다.
[선행기술문헌]
비특허문헌 1: Food & Function, 2020;11(4), 3681-3694
비특허문헌 2: Journal of functional foods, 2015;13, 350-362
본 발명이 이루고자 하는 기술적 과제는 류마티스관절염을 예방, 개선, 또는 치료할 수 있는 조성물을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 프로피오니박테리움 프레우덴레키 (Propionibacterium freudenreichii) MJ2 (KCCM12272P), 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 유효성분으로 함유하는 류마티스 관절염의 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 프로피오니박테리움 프레우덴레키 MJ2, 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 유효성분으로 함유하는 류마티스 관절염의 예방 또는 개선용 식품 조성물을 제공한다.
본 발명의 일 구현예로서, 상기 생균체는 배양배지에서 활성화시킨 MJ2 균주를 30~37℃의 혐기 조건에서 45~50 시간 동안 배양하고, 배양 균액을 원심분리하여 수득되는 것 일 수 있다.
본 발명의 다른 구현예로서, 상기 사균체는 배양배지에서 활성화시킨 MJ2 균주를 35~39℃의 혐기 조건에서 45~50 시간 동안 배양하고, 열처리 후 수득되는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 IL-10의 발현을 증가시켜 염증반응을 억제하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 파골세포의 분화를 억제하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 IgG, IgG1, 및 IgG2a의 생성을 감소시키는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 세포사멸(apoptosis)을 억제하고 오토파지(autophagy)를 정상수준으로 회복하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 1 Х 106 내지 1 Х 1010 CFU/mL농도, 바람직하게는 1 Х 107 내지 1 Х 109 CFU/mL농도, 더욱 바람직하게는 1 Х 108 CFU/mL 농도로 MJ2 생균체를 포함하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 상기 조성물은 1 Х 106 내지 1 Х 1010 cells/mL농도, 바람직하게는 1 Х 107 내지 1 Х 109 cells/mL농도, 더욱 바람직하게는 1 Х 108 cells/mL 농도로 MJ2 사균체를 포함하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 MJ2 생균체 및 사균체의 혼합일 수 있다.
본 발명의 또 다른 구현예로서, 상기 조성물은 1일 1회 투여되는 것일 수 있으며, 구강 투여용일 수 있다.
또한, 본 발명은 프로피오니박테리움 프레우덴레키 MJ2, 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 개체에 투여하는 단계를 포함하는 류마티스 관절염의 개선, 예방, 또는 치료 방법을 제공하며, 상기 투여는 구강 투여일 수 있으며, 상기 방법은 투여 단계 이후에 관절의 붓기 정도를 확인하는 단계를 추가로 포함하는 것일 수 있다.
본 발명의 일 구현예로서, 상기 방법은 MJ2 생균체 및/또는 사균체를 개체에 투여하는 것일 수 있고, 상기 MJ2 생균체 및/또는 사균체는 106 ~1010 cells/day, 바람직하게는 107 ~109 cells/day, 더욱 바람직하게는 108 cells/day 투여하는 것일 수 있다.
또한, 본 발명은 류마티스 관절염 예방 또는 치료용 약제의 제조를 위한 프로피오니박테리움 프레우덴레키 MJ2, 이의 배양액, 생균체, 사균체, 또는 이들의 혼합의 용도를 제공한다.
본 발명의 조성물은 장기간 투여에도 안전하고, 파골세포 분화, 염증반응, 세포사멸 및 오토파지를 정상수준으로 회복하고, 항체 생성을 억제하여 자가면역질환인 류마티스 관절염의 예방, 치료, 및 개선을 위한 의약용, 의약부외용, 기능성 식품용 등 다양한 방면으로 이용될 것으로 기대된다.
도 1은 본 발명 균주의 염증성 사이토카인 발현 억제를 나타낸 결과이다.
도 2는 본 발명 균주의 파골세포 분화 인자 발현 억제를 나타낸 결과이다.
도 3은 본 발명 균주의 파골세포 내 TRAP 활성 억제를 나타낸 결과이다.
도 4는 본 발명 균주의 항염증성 사이토카인 발현 증가를 나타낸 결과이다.
도 5는 본 발명 균주를 경구 투여한 마우스 모델에서의 관절염 질환지수를 나타낸 결과이다.
도 6은 본 발명 균주를 경구 투여한 마우스 모델에서의 micro-CT 이미지(도 6a) 및 지표를 나타낸 결과(도 6b)이다.
도 7은 본 발명 균주를 경구 투여한 마우스 모델에서의 콜라겐 항원 특이적 IgG, IgG1, IgG2a 항체를 측정한 결과이다.
도 8은 본 발명 균주를 경구 투여한 마우스 모델에서의 염증성 사이토카인 발현량을 측정한 결과이다.
도 9는 본 발명 균주를 경구 투여한 마우스 모델에서의 파골세포 분화 유전자 발현량을 측정한 결과이다.
도 10은 본 발명 균주를 경구 투여한 마우스 모델에서의 세포사멸 단백질 발현량을 측정한 결과이다.
도 11은 본 발명 균주를 경구 투여한 마우스 모델에서의 오토파지 단백질 발현량을 측정한 결과이다.
프로피오니박테리움 프레우덴레키 (Propionibacterium freudenreichii)는 치즈의 발효 연구에서 최초로 동정되어 주로 우유 및 유제품에서 확인할 수 있다. 최근 P. freudenreichii이 대장 표면에 부착하여 사이토카인 방출을 조절하여 대장염의 치료에 효과가 있음이 밝혀진바 있다.
본 발명자들이 이용한 P. freudenreichii는 한국미생물보존센터에 기탁된 P. freudenreichii MJ2 strain(KCCM12272P)이다.
본 발명자들은 P. freudenreichii MJ2 strain이 생체 외(in vitro)에서 항염증성 사이토카인 IL-10의 발현을 증가 효과와 동시에 파골세포 분화를 억제하는 효과가 있음을 확인하고, 콜라겐 유도 동물모델에서 MJ2 균주가 류마티스 관절염을 예방할 수 있음을 확인하여 본 발명을 완성하였다.
구체적으로, 본 발명자들은 Raw 264.7 대식세포에 LPS를 처리하여 염증을 유도하였다. LPS와 함께 P. freudenreichii MJ2 사균을 다양한 농도로 처리하고 염증성 사이토카인(IL-6, TNF-α, IL-1β, 및 MMP9)의 발현 수준을 확인한 결과, 1 Х 107cells/mL의 MJ2 사균을 처리한 그룹에서 유의한 사이토카인 발현 감소를 확인할 수 있었다(실시예 2).
또한, 본 발명자들은 Raw 264.7 대식세포에 RANKL(Receptor activator of nuclear factor kappa-Β ligand)을 처리하여 파골세포로의 분화를 유도하였고, RANKL과 함께 P. freudenreichii MJ2 사균을 다양한 농도로 처리하여 파골세포 분화 마커(MMP9, RANK, c-fos, NFATc1, Calcr, Ctsk)의 발현 수준을 확인한 결과, 1 Х 106 cells/mL 및 1 Х 107 cells/mL 농도의 MJ2 사균 처리시 파골세포 분화 마커의 발현이 감소됨을 확인할 수 있었다. 상기 결과로부터 MJ2 사균에서 파골세포 분화 억제 활성이 있음을 알 수 있었으며, 본 발명자들은 Tartrate-Resistant Acid Phosphate (TRAP) 염색법을 이용하여 MJ2 사균의 파골세포 분화 억제 활성을 재확인하였다(실시예 3).
또한, 본 발명자들은 MJ2 사균이 파골세포 분화 억제와 함께 염증반응을 억제하는 항염증성 사이토카인인 IL-10의 발현을 증가시킴을 확인하였다(실시예 4).
이어서, 본 발명자들은 In vitro 에서 파골세포의 분화 억제 및 항염증 활성이 확인된 MJ2 사균이 경구투여 약물 또는 식품에 포함되어 류마티스 관절염을 예방할 수 있는지 확인하고자 하였다. 구체적으로 MJ2 생균과 사균을 저농도 또는 고농도로 3주간 마우스에 구강투여하고 콜라겐으로 관절염을 유도하고, 무릎 관절과 발에서의 관절염 증상을 관찰하고 CT 촬영 이미지 분석으로부터 MJ2 생균 및/또는 사균에서 관절염 증상이 경미함을 확인하였다(실시예 5-1 및 5-2).
또한, 본 발명자들은 혈청학적으로 자가면역질환인 류마티스 관절염 증상 정도를 확인하기 위하여 혈장 내의 각 IgG의 양을 측정한 결과, MJ2 투여군에서 콜라겐 항원 특이적 total IgG 항체 및 IgG2a 항체의 농도가 비투여군보다 현저하게 낮음을 확인할 수 있었다(실시예 5-3). 상기 결과로부터 MJ2 생균 및/또는 사균이 류마티스 관절염을 예방할 수 있음을 알 수 있다.
또한, 저농도의 MJ2 생균 또는 사균의 투여군에서 유의한 비장지수(spleen index) 감소를 확인할 수 있었으며, MJ2 사균 투여군에서 유의한 IL-6 발현 감소를 확인할 수 있었고, 생균 또는 사균 MJ2 투여군은 모든 농도에서 유의한 TNF-α 감소와 IL-10 증가를 확인할 수 있었으며, 특히 고농도 MJ2 사균 처리군에서 현저한 TNF-α 감소를 확인할 수 있었고, 저농도 MJ2 생균 처리군에서 현저한 IL-10 증가를 확인할 수 있었다(실시예 5-4). 상기 결과로부터, MJ2 생균 및/또는 사균이 염증반응을 억제하여 류마티스 관절염을 개선 및 치료할 수 있음을 알 수 있다.
또한, MJ2 생균 및 사균은 in vivo에서도 파골세포 분화를 억제할 수 있으며, 활막 주변의 세포의 세포사멸(apoptosis)을 감소시키고 오토파지(autophagy)를 정상수준으로 회복시킴을 알 수 있다(실시예 5-5 내지 실시예 5-7). 상기 결과로부터 MJ2 생균 및/또는 사균이 염증반응이 유도되는 활막 주변의 세포의 생존율을 증가시켜 류마티스 관절염의 진행을 억제할 수 있음을 알 수 있다.
이에, 본 발명은 프로피오니박테리움 프레우덴레키 MJ2, 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 유효성분으로 함유하는 류마티스관절염의 예방 또는 치료용 약학 조성물을 제공한다.
본 발명에 따른 약학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함할 수 있다. 이때, 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아고무, 인산칼슘, 알기네이트, 젤라틴, 규산칼슘, 미세결정성 셀룰로스, 폴리비닐피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 상기성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있으며, 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 시간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
본 발명에서 “예방”이란 본 발명에 따른 약학적 조성물의 투여에 의해 류마티스 관절염을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서 “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 류마티스 관절염에 대한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서 “개선”이란 본 발명에 따른 조성물의 투여에 의해 류마티스 관절염과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서 “약학적으로 유효한 양”은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명에 다른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
구체적으로 본 발명의 약학적 조성물의 유효량은 환자의 연령, 성별, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성률 및 배설속도, 질병종류, 병용되는 약물에 따라 달라질 수 있으며, 일반적으로는 체중 1 ㎏ 당 0.001 내지 150 ㎎, 바람직하게는 0.01 내지 100 ㎎을 매일 또는 격일 투여하거나, 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 류마티스 관절염의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
본 발명의 또 다른 양태로서, 본 발명은 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는 류마티스 관절염의 예방, 조절 또는 치료 방법을 제공한다.
본 발명에서 "개체"란 질병의 예방, 조절 또는 치료방법을 필요로 하는 대상을 의미하고, 보다 구체적으로는, 인간 또는 비-인간인 영장류, 생쥐(mouse), 쥐(rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.
또한, 본 발명은 P. freudenreichii MJ2, 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 유효성분으로 포함하는, 류마티스 관절염 개선용 건강기능식품 조성물을 제공한다. 보다 구체적으로, 본 발명의 조성물은 류마티스 관절염의 예방 또는 개선을 목적으로 건강기능식품에 첨가될 수 있으며, 본 발명의 조성물을 식품 첨가물로 사용할 경우, 상기 조성물을 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합양은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조 시 본 발명의 화합물은 원료에 대하여 15 중량% 이하, 바람직하게는 10 중량% 이하의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강기능식품을 모두 포함한다.
본 발명의 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당 및 과당과 같은 모노사카라이드, 말토오스 및 수크로오스와 같은 디사카라이드, 덱스트린 및 시클로덱스트린과 같은 폴리사카라이드, 및 자일리톨, 소르비톨 및 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖당 일반적으로 약 0.01 내지 0.20 g, 바람직하게는 약 0.04 내지 0.10 g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01 내지 0.20 중량부의 범위에서 선택되는 것이 일반적이다.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 이하 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
[실시예]
실시예 1: Propionibacterium freudenreichii MJ2의 생균 및 사균 제조
본 발명에서 사용한 Propionibacterium freudenreichii MJ2 (KCCM12272P)는 한국미생물보존센터에 기탁한 균을 사용하였다. P. freudenreichii MJ2는 경기도 김포 목장으로부터 조달한 raw milk에서 single colony를 3회 purification 하는 과정을 통해 후보균주를 선정한 뒤, 16s rDNA sequencing을 이용해 동정한 균을 기탁한 균주이다.
Propionibacterium freudenreichii MJ2의 생균 및 사균을 제조하기 위하여, 배지 RCM(Reinforced Clostridial Medium)에 3차례 이상 활성화시킨 균을 접종 후, GasPak (Franklin lakes, NJ, USA)을 이용해 혐기 환경을 조성하고 30℃에서 48시간 배양하였다. 배양된 균액을 3,000 rpm에서 원심분리시켜 생균을 모으고, 생리식염수(PBS, Phosphate-buffered saline)에 109 CFU/mL가 되도록 희석하여, 가열처리를 통해 사균을 제조하였다.
실시예 2: P. freudenreichii MJ2 사균의 염증성 사이토카인 발현 억제능 측정
2-1. 대식세포(Macrophage) 배양 및 P. freudenreichii MJ2 사균의 처리
대식세포(Macrophage) 세포주인 Raw 264.7 cell line을 Dulbecco's Modified Eagle Medium (DMEM) 배지에 10% FBS (Fetal bovine serum), 100 units/mL penicillin과 100 μg/mL streptomycin을 첨가하여 37℃ incubator에 5% CO2-95% 공기 조성으로 배양하였다. 세포가 약 80% confluent 하게 자라면 scraper를 이용하여 세포를 떼어내고, 2.5 Х 108cells/mL로 맞춘 후, 6 well에 2 mL씩 접종하였다. 37℃ incubator에서 하루 동안 안정화시킨 후, 100 ng/mL LPS (Lipopolysaccharides)와 P. freudenreichii MJ2 사균 (1 Х 105, 1 Х 106, 1 Х 107cells/mL)을 처리하여 24시간 동안 배양하였다.
2-2. P. freudenreichii MJ2 사균의 염증성 사이토카인 발현 억제능 측정
상기 실시예 2-1에서 LPS와 MJ2 사균을 처리하여 배양한 대식세포 배양 상등액을 제거하고 Trizol을 이용하여 RNA를 분리하였다. 분리된 RNA를 Revert Aid First Strand cDNA kit(Fermentas, EU)를 이용하여 cDNA로 전환시킨 후, DyNamo HS SYBR Green qPCR kit(FINNZYMES, Finland) 시약으로 Applied Biosystems 7500(AppliedBiosystems, FosterCity, CA, USA) 기계를 사용하여 95℃에서 10분간 pre-heating한 후, 95℃에서 15초간, 60℃에서 15초간, 72℃에서 30초간 40회 사이클링 과정으로 Real-Time PCR을 진행하였다. 사용된 primers의 sequences는 하기 표 1과 같다.
유전자 Forward (5′-3′) Reverse (5′-3′)
GAPDH ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC
IL-6 TTTCTCCACGCAGGAGACTT TCCACGATTTCCCAGAGAAC
TNF-α AAGATGGAGGAAGGGCAGTT GATCCTGGAGGGGAAGAGAC
IL-1β CAGGCAGGCAGTATCACTCA AGCTCATATGGGTCCGACAG
MMP9 GAAGGCAAACCCTGTGTGTT AGAGTACTGCTTGCCCAGGA
그 결과, 도 1에 나타낸 바와 같이 one-way ANOVA를 통해 분석한 결과, P. freudenreichii MJ2 사균 1 Х 107 cells/mL를 처리한 그룹이 LPS만 처리한 그룹에 비해 염증성 사이토카인(IL-6, TNF-α, IL-1β, 및 MMP9) 유전자들의 발현이 유의하게 감소됨을 확인할 수 있었다.
실시예 3: P. freudenreichii MJ2 사균의 파골세포(Osteoclast) 분화 억제능 측정
3-1. 파골세포 배양 및 P. freudenreichii MJ2 사균의 처리
대식세포 세포주인 Raw 264.7 cell line에 50 ng/mL Receptor activator of nuclear factor kappa-β ligand (RANKL)을 4일간 처리하여 파골세포로의 분화를 유도하였다. Minimum Essential Medium Eagle-Alpha Modification(α-MEM) 배지에 10% FBS, 100 units/mL penicillin과 100 μg/mL streptomycin을 첨가하여 37℃ incubator에 5% CO2-95% 공기 조성으로 배양하였다. 세포가 80% confluent하게 자라면 scraper를 이용하여 세포를 떼어내고, 1 Х 104 cells/mL로 맞춘 후, 12 well에 1 mL씩 접종하였다. 37℃ incubator에서 하루 동안 안정화시킨 후, RANKL과 P. freudenreichii MJ2 사균 (1 Х 105, 1 Х 106, 1 Х 107 cells/mL)을 처리하여 4일 동안 배양하였다.
3-2. P. freudenreichii MJ2 사균의 파골세포 분화 인자 발현 억제능 측정
상기 실시예 3-1에서 RANKL과 MJ2 사균을 처리하여 배양한 대식세포 배양 상등액을 제거하고 Trizol을 이용하여 RNA를 분리하였다. 분리된 RNA를 Revert Aid First Strand cDNA kit를 이용하여 cDNA로 conversion한 후, DyNamo HS SYBR Green qPCR kit 시약으로 Applied Biosystems 7500 기계를 사용하여 Real-Time PCR을 진행하였다. 사용된 primers의 sequences는 하기 표 2과 같다.
유전자 Forward (5′-3′) Reverse (5′-3′)
MMP9 GAAGGCAAACCCTGTGTGTT AGAGTACTGCTTGCCCAGGA
RANK TGCAGCTCAACAAGGATACG GAGCTGCAGACCACATCTGA
c-fos CCAGTCAAGAGCATCAGCAA AAGTAGTGCAGCCCGGAGTA
NFATc1 GGTGCTGTCTGGCCATAACT GCGGAAAGGTGGTATCTCAA
Calcr CGGACTTTGACACAGCAGAA GTCACCCTCTGGCAGCTAAG
Ctsk CAGCTTCCCCAAGATGTGAT AGCACCAACGAGAGGAGAAA
OPG CTGCCTGGGAAGAAGATCAG TTGTGAAGCTGTGCAGGAAC
RANKL AGCCGAGACTACGGCAAGTA GCGCTCGAAAGTACAGGAAC
그 결과, 도 2에 나타낸 바와 같이 P. freudenreichii MJ2 사균 1 Х 106 cells/mL와 1 Х 107 cells/mL를 처리한 그룹이 RANKL만 처리한 그룹에 비해 파골세포 분화 관련 유전자들의 발현량이 유의하게 감소하였다. 3-3. P. freudenreichii MJ2 사균의 파골세포 내 Tartrate-resistant acid phosphatase(TRAP) 활성 억제능 측정
TRAP는 파골세포로 분화 중 발현되는 효소로 TRAP 염색을 통해 파골세포의 분화 정도를 확인할 수 있다. 이에, 상기 실시예 3-1에서 RANKL과 MJ2 사균을 처리하여 배양한 대식세포 배양 상등액을 제거하고 세포를 PBS로 세척한 후 고정하였다. Premix된 기질인 NABP/FRVLB에 sodium tartrate를 넣어준 뒤, 해당 용액으로 파골세포의 TRAP을 37℃에서 30분간 염색하였다. 상등액을 제거하고 세포를 증류수로 세척한 후, 광학현미경을 통해 핵이 3개 이상인 파골세포를 관찰하였다. TRAP 활성을 측정하기 위해 고정된 세포를 sodium tartarte와 para-Nitrophenylphosphate (pNPP)가 포함된 citrate buffer에 배양한 후, reaction mixture를 NaOH를 통해 반응을 정지시키고 405 nm에서 흡광도를 측정하였으며 단백질 정량을 통해 보정하였다.
그 결과, 도 3에 나타낸 바와 같이 P. freudenreichii MJ2 사균을 처리한 그룹이 RANKL만 처리한 그룹에 비해 TRAP이 활성화된 파골세포의 수 및 TRAP 활성이 유의하게 감소하였다. 상기 결과로부터 P. freudenreichii MJ2 사균의 처리에 따라 파골세포 분화가 억제됨을 알 수 있다.
실시예 4: P. freudenreichii MJ2 사균의 Interleukin-10(IL-10) 발현 증가능 측정
IL-10은 대표적인 항염증성 사이토카인으로서 염증반응을 억제할뿐만 아니라 파골세포 분화의 주요인자인 Nuclear factor of activated T-cells c1(NFATc1)의 발현을 억제하여 파골세포의 분화를 막는다고 알려져있다. P. freudenreichii MJ2 사균에 의한 IL-10 발현량을 측정하기 위해 상등액을 취한 후, ELISA 방법을 실시하였다.
그 결과, 도 4에 나타낸 바와 같이 P. freudenreichii MJ2 사균 1 Х 106 cells/mL과 1 Х 107 cells/mL을 처리한 그룹이 RANKL만 처리한 그룹에 비해 IL-10 발현량이 유의하게 증가하였다.
실시예 5: P. freudenreichii MJ2 사균의 류마티스 관절염 예방 효능 평가
5-1. 콜라겐 유도 관절염 마우스 모델에서의 질환지수 평가
P. freudenreichii MJ2를 관절염 유도 전, 3주간 구강투여를 통해 DBA/1 마우스에 직접 주입하고 콜라겐으로 관절염을 유도하였다. 그룹은 PBS를 먹인 후 관절염을 유도하지 않은 그룹(Control), PBS를 먹인 후 관절염을 유도한 그룹(Vehicle), P. freudenreichii MJ2 생균 고농도 1 Х 108 CFU/mL를 먹인 후 관절염을 유도한 그룹(High-dose Live; HDL), P. freudenreichii MJ2 생균 저농도 1 Х 107 CFU/mL를 먹인 후 관절염을 유도한 그룹(Low-dose Live; LDL), P. freudenreichii MJ2 사균 고농도 1 Х 108 cells/mL를 먹인 후 관절염을 유도한 그룹(High-dose Dead; HDD), P. freudenreichii MJ2 사균 저농도 1 Х 107 cells/mL를 먹인 후 관절염을 유도한 그룹(Low-dose Dead; LDD)으로 나누었다. 관절염 유도는 제2형 Bovine collagen을 complete Freund's Adjuvant(CFA)와 1:1로 emulsion한 후, 꼬리 피내에 주사하여 첫 번째 면역(1st immunization)을 진행하고 3주 후 제2형 Bovine collagen을 incomplete Freund's Adjuvant(IFA)와 1:1로 emulsion한 후 꼬리 피내에 주사하여 두 번째 면역(2nd boost)을 유도하였다. 관절염을 유도한 후, 부어오르는 증상 및 염증이 심한 정도를 관절염 질환지수(Arthritic score) 기준에 따라 육안적으로 평가하여 점수를 나타내었다.
그 결과, 도 5에 나타낸 바와 같이 PBS를 투여하며 관절염을 유도한 그룹에서 가장 심한 관절염 증상이 나타났으며, P. freudenreichii MJ2 생균 및 사균을 투여하며 관절염을 유도한 그룹은 육안적으로 유의하게 관절염 증상 완화 효과를 보였다.
5-2. 콜라겐 유도 관절염 마우스 모델에서의 micro-CT 이미지 분석
육안적 평가 외에 마우스의 무릎 관절과 발 부위를 micro-CT로 촬영하여 3D 이미지로 변환하고 관찰하였다.
그 결과, 도 6에 나타낸 바와 같이 발 부위에서는 그룹간 뚜렷한 차이가 보이지 않았으나, 무릎 부위에서는 PBS를 투여하며 관절염을 유도한 그룹이 뼈가 얇아지고 관절의 변형 및 파괴가 크게 일어났으며 상대적으로 P. freudenreichii MJ2 생균 및 사균을 투여하며 관절염을 유도한 그룹은 관절염 증상 완화 효과를 보였다. micro-CT 이미지를 통해 얻은 지표들을 살펴보면 유의성이 상이하였으나, P. freudenreichii MJ2 사균 고농도 그룹은 모든 지표에서 유의한 결과를 나타냈다.
5-3. 콜라겐 유도 관절염 마우스 모델에서의 콜라겐 항원 특이적 IgG, IgG1, IgG2a 항체 농도 측정
마우스의 혈액을 채취하여 혈장을 분리하고 콜라겐 항원 특이적 IgG, IgG1, IgG2a 항체 농도를 ELISA 방법을 통해 측정하였다. Immunoplate에 mouse type II collagen을 4℃에서 코팅한 후, 상온에서 blocking 과정을 거치고 샘플과 Horseradish peroxidase(HRP)-conjugated anti-mouse IgG antibody, anti-IgG1 antibody, anti-IgG2a antibody를 넣어 3시간 가량 반응시켰다. 3시간 후, 기질을 넣고 2N H2SO4를 통해 반응을 정지시켜 혈장 내의 각 IgG 항체 양을 측정하였다.
그 결과, 도 7에 나타낸 바와 같이 관절염 유발 시 혈액 내 콜라겐 항원 특이적 IgG 항체들의 생성이 촉진되는 것을 확인할 수 있었으며, P. freudenreichii MJ2 생균 및 사균 투여 그룹에서는 콜라겐 항원 특이적 total IgG 항체 및 IgG2a 항체의 농도가 감소하는 것을 확인할 수 있었다.
5-4. 콜라겐 유도 관절염 마우스 모델에서 P. freudenreichii MJ2의 항염증 효과 측정
마우스의 비장을 분리하여 무게를 측정한 후, 해당 개체의 몸무게로 나누어 spleen index를 구하였다.
그 결과, 도 8에 나타낸 바와 같이 관절염 유발 시 spleen index 수치가 유의하게 높았으며, P. freudenreichii MJ2 생균 저농도 및 사균 저농도 그룹에서 spleen index 수치가 유의하게 낮았다.
마우스의 혈액을 채취하여 혈장을 분리하고 혈장 내 대표적 염증성 사이토카인인 IL-6와 TNF-α의 양을 ELISA 방법을 통해 측정하고, 마우스의 비장을 분쇄하여 대표적 항염증성 사이토카인인 IL-10의 양을 ELISA 방법을 통해 측정하였다.
그 결과, 도 8에 나타낸 바와 같이 류마티스 관절염을 유도한 그룹이 류마티스 관절염을 유도하지 않은 그룹에 비해 IL-6, TNF-α의 양이 유의하게 증가하였으며, IL-6의 경우 P. freudenreichii MJ2 사균을 투여한 그룹에서 항염증성 효과를 보였고, TNF-α의 경우 P. freudenreichii MJ2 생균 및 사균을 투여한 그룹에서 항염증성 효과를 보였다. IL-10의 경우, P. freudenreichii MJ2 사균 저농도를 제외한 그룹에서 모두 증가하는 경향을 보였다.
5-5. 콜라겐 유도 관절염 마우스 모델에서 P. freudenreichii MJ2의 파골세포 분화 인자 발현 억제능 측정
마우스 뒷다리 부근의 활막 조직을 분쇄하여 Trizol을 이용하여 RNA를 분리하고 cDNA로 conversion한 후, real-time PCR을 실시하였다.
그 결과, 도 9에 나타낸 바와 같이 류마티스 관절염을 유도한 그룹이 류마티스 관절염을 유도하지 않은 그룹에 비해 파골세포 분화 관련 유전자인 NFATc1, Cathepsin K(Ctsk), Calcitonin receptor(Calcr), Matrix metallopeptidase 9(MMP9)의 발현량이 유의하게 증가했고, P. freudenreichii MJ2을 투여한 그룹들에서 이와 같은 유전자들의 발현량이 유의하게 감소하였다. 또한 파골세포의 분화를 억제하고 조골세포(Osteoblast)의 분화를 촉진하는 Osteoprotegrin(OPG)/RANKL 발현량 비율은 P. freudenreichii MJ2을 투여한 그룹들에서 유의하게 증가하였다.
5-6. 콜라겐 유도 관절염 마우스 모델에서 P. freudenreichii MJ2의 세포사멸(Apoptosis) 억제능 측정
마우스 뒷다리 부근의 활막 조직을 분쇄하여 Bradford 방법을 통해 단백질 양을 정량하고 100℃에서 denaturation시켜 western blot을 실시하였다.
그 결과, 도 10에 나타낸 바와 같이 류마티스 관절염을 유도한 그룹이 류마티스 관절염을 유도하지 않은 그룹에 비해 Bax/Bcl2 ratio, Caspase-3 및 Cytochrome c의 발현량이 유의하게 높았으며, P. freudenreichii MJ2을 투여한 그룹들에서 이와 같은 단백질들의 발현량이 유의하게 감소하였다.
5-7. 콜라겐 유도 관절염 마우스 모델에서 P. freudenreichii MJ2의 오토파지(Autophagy) 발현 측정
마우스 뒷다리 부근의 활막 조직을 분쇄하여 Bradford 방법을 통해 단백질 양을 정량하고 100℃에서 denaturation시켜 오토파지 발현을 나타내는 대표적 인자인 LC3B의 발현량을 western blot을 통해 측정하였다.
그 결과, 도 11에 나타낸 바와 같이 류마티스 관절염을 유도한 그룹은 류마티스 관절염을 유도하지 않은 그룹에 비해 LC3B 발현량이 감소하였으며, P. freudenreichii MJ2을 투여한 그룹들에서 LC3B 발현량이 유의하게 증가하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.

Claims (11)

  1. 프로피오니박테리움 프레우덴레키 (Propionibacterium freudenreichii) MJ2 (KCCM12272P), 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 유효성분으로 함유하는 류마티스관절염의 예방 또는 치료용 약학 조성물.
  2. 제1항에 있어서,
    상기 생균체는 배양배지에서 활성화시킨 MJ2 균주를 30~37℃의 혐기 조건에서 45~50 시간 동안 배양하고, 배양 균액을 원심분리하여 수득된 것을 특징으로 하는, 약학 조성물.
  3. 제1항에 있어서,
    상기 사균체는 배양배지에서 활성화시킨 MJ2 균주를 30~37℃의 혐기 조건에서 45~50 시간 동안 배양하고, 열처리 후 수득되는 것을 특징으로 하는, 약학 조성물.
  4. 제1항에 있어서,
    상기 조성물은 구강 투여용인 것을 특징으로 하는, 약학 조성물.
  5. 제1항에 있어서,
    상기 조성물은 IL-10의 발현을 증가시켜 염증반응을 억제하는 것을 특징으로 하는, 약학 조성물.
  6. 제1항에 있어서,
    상기 조성물은 파골세포의 분화를 억제하는 것을 특징으로 하는, 약학 조성물.
  7. 제1항에 있어서,
    상기 조성물은 IgG, IgG1, 및 IgG2a의 생성을 감소시키는 것을 특징으로 하는, 약학 조성물.
  8. 제1항에 있어서,
    상기 조성물은 세포사멸(apoptosis)을 억제하고 오토파지(autophagy)를 정상수준으로 회복하는 것을 특징으로 하는, 약학 조성물.
  9. 제1항에 있어서,
    상기 조성물은 생균을 1 Х 106 내지 1 Х 1010 CFU/mL 농도로 포함하고, 사균을 1 Х 106 내지 1 Х 1010cells/mL 농도로 포함하는 것을 특징으로 하는, 약학 조성물.
  10. 프로피오니박테리움 프레우덴레키 (Propionibacterium freudenreichii) MJ2 (KCCM12272P), 이의 배양액, 생균체, 사균체, 또는 이들의 혼합을 유효성분으로 함유하는 류마티스관절염의 예방 또는 개선용 식품 조성물.
  11. 제1항에 있어서,
    상기 식품은 기능성 식품이고,
    상기 조성물은 생균을 1 Х 106 내지 1 Х 1010 CFU/mL 농도로 포함하고, 사균을 1 Х 106 내지 1 Х 1010cells/mL 농도로 포함하는 것을 특징으로 하는, 식품 조성물.
PCT/KR2022/001189 2021-01-25 2022-01-24 프로피오니박테리움 프레우덴레키 mj2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물 WO2022158922A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210010296A KR102482433B1 (ko) 2021-01-25 2021-01-25 프로피오니박테리움 프레우덴레키 mj2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물
KR10-2021-0010296 2021-01-25

Publications (2)

Publication Number Publication Date
WO2022158922A2 true WO2022158922A2 (ko) 2022-07-28
WO2022158922A3 WO2022158922A3 (ko) 2022-09-15

Family

ID=82549933

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/001189 WO2022158922A2 (ko) 2021-01-25 2022-01-24 프로피오니박테리움 프레우덴레키 mj2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물

Country Status (2)

Country Link
KR (1) KR102482433B1 (ko)
WO (1) WO2022158922A2 (ko)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200000956A (ko) * 2018-06-26 2020-01-06 고려대학교 산학협력단 프로피오니바크테리움 후레우덴레이키, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 장질환의 예방 또는 치료용 조성물
KR102127108B1 (ko) * 2018-06-26 2020-06-26 고려대학교산학협력단 프로피오니바크테리움 후레우덴레이키, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 골질환의 예방 또는 치료용 조성물
CN111944725B (zh) * 2020-08-24 2021-12-07 汤臣倍健股份有限公司 一种副干酪乳杆菌207-27及其应用

Also Published As

Publication number Publication date
WO2022158922A3 (ko) 2022-09-15
KR102482433B1 (ko) 2022-12-27
KR20220107541A (ko) 2022-08-02

Similar Documents

Publication Publication Date Title
US7785581B2 (en) Composition and method for reducing feces toxins and treating digestive disorders
WO2019199094A1 (ko) 비만의 예방 또는 치료 효과를 가지는 신규 비피도박테리움 롱검 균주 또는 락토바실러스 람노서스 균주 및 이의 용도
CN113302279B (zh) 新乳酸菌及其用途
KR101807328B1 (ko) 경구용 ｄｎａ 손상 수복 촉진제 및 엘라스타아제 활성 억제제
WO2018062914A1 (ko) 신규한 락토바실러스 사케이 및 이를 포함하는 조성물
WO2018117659A1 (ko) 청대 추출물 또는 이의 분획물을 유효성분으로 포함하는 염증성 장질환의 예방 또는 치료용 약학적 조성물
EP2110133A1 (en) Prophylactic and/or therapeutic agent for functional dyspepsia
KR102084973B1 (ko) 엔테로코커스 패칼리스를 유효성분으로 포함하는 대장염 예방 또는 치료용 조성물
WO2020076004A1 (ko) 테트라제노코커스 할로필러스를 포함하는 베체트병 또는 헤르페스 바이러스 감염증의 예방 또는 치료용 조성물
WO2021246610A1 (ko) 락토바실러스 사케이 cvl-001 균주를 포함하는 염증성 질환 예방 또는 치료용 조성물
WO2019117654A1 (ko) 신장질환 진행 억제 및 예방용 프로바이오틱스 및 이를 포함하는 신장질환 진행 억제 및 예방용 조성물
WO2021261929A1 (ko) 신규 락토바실러스 루테리 균주 및 이의 용도
WO2014196775A1 (ko) 락토바실러스 브레비스 g-101 및 이의 용도
WO2022158922A2 (ko) 프로피오니박테리움 프레우덴레키 mj2 균주를 유효성분으로 포함하는 류마티스 관절염 예방, 치료, 또는 개선용 조성물
KR101238836B1 (ko) 혼합 유산균을 포함하는 비만 또는 비만 관련 질환 치료 또는 예방용 약제학적 조성물 또는 식품 조성물
US20220135935A1 (en) Composition comprising lactobacillus sakei cvl-001 or culture liquid thereof for alleviating, preventing, or treating bone diseases or metabolic diseases
WO2020045972A1 (ko) 항비만 활성을 갖는 인체 유래 락토바실러스 퍼멘툼 엠지4231 또는 락토바실러스 퍼멘툼 엠지4244 균주 및 이를 포함하는 조성물
KR102507532B1 (ko) 락토바실러스 플란타룸 hac03 균주 및 플라보노이드를 포함하는 염증성 장질환 예방 또는 치료용 조성물
WO2022045513A1 (ko) 락토바실러스 퍼멘텀을 포함하는 갱년기 예방 또는 치료용 조성물
WO2023058801A1 (ko) 락토바실러스 애시도필러스 kbl402 또는 kbl409 균주를 포함하는 장 질환 개선, 예방 또는 치료용 조성물
WO2022039514A1 (ko) 락토바실러스 사케이 또는 이로부터 유래된 세포밖 소포체를 유효성분으로 포함하는 뇌질환의 치료용 조성물
WO2018030650A1 (ko) 국화잎 추출물을 유효성분으로 포함하는 항비만 조성물
KR20220168575A (ko) 대사성 질환의 예방 및 치료를 위한 락토바실러스 퍼멘텀 균주 및 조절 t 세포의 병용 투여 용도
US20240374658A1 (en) Composition for preventing, treating or alleviating rheumatoid arthritis comprising propionibacterium freudenreichii mj2 strain as an active ingredient
WO2023229263A1 (ko) 락토바실러스 플란타룸 nchbl-004 균주 또는 이의 배양액을 포함하는 대사성 질환 예방, 치료 또는 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22742898

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22742898

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 18701173

Country of ref document: US