WO2022144836A1 - Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123 - Google Patents

Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123 Download PDF

Info

Publication number
WO2022144836A1
WO2022144836A1 PCT/IB2021/062494 IB2021062494W WO2022144836A1 WO 2022144836 A1 WO2022144836 A1 WO 2022144836A1 IB 2021062494 W IB2021062494 W IB 2021062494W WO 2022144836 A1 WO2022144836 A1 WO 2022144836A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
cdr
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2021/062494
Other languages
English (en)
French (fr)
Inventor
Laurent M. GAUTHIER
Ariane THIELENS
Benjamin Rossi
Céline AMARA
Céline NICOLAZZI
Marielle Blondel CHIRON
Francis DUFFIEUX
Angela VIRONE-ODDOS
Jochen Beninga
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi SA
Innate Pharma SA
Original Assignee
Sanofi SA
Innate Pharma SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3206883A priority Critical patent/CA3206883A1/en
Priority to AU2021414400A priority patent/AU2021414400A1/en
Priority to KR1020237025940A priority patent/KR102868401B1/ko
Priority to CN202180088872.6A priority patent/CN117255807A/zh
Priority to KR1020257032805A priority patent/KR20250152662A/ko
Priority to MX2023007901A priority patent/MX2023007901A/es
Priority to JP2023539973A priority patent/JP7623497B2/ja
Priority to EP21840696.5A priority patent/EP4271709A1/en
Application filed by Sanofi SA, Innate Pharma SA filed Critical Sanofi SA
Publication of WO2022144836A1 publication Critical patent/WO2022144836A1/en
Priority to IL304124A priority patent/IL304124A/en
Anticipated expiration legal-status Critical
Priority to CONC2023/0008958A priority patent/CO2023008958A2/es
Priority to JP2025005123A priority patent/JP2025063183A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/283Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against Fc-receptors, e.g. CD16, CD32, CD64
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/64Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising a combination of variable region and constant region components
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/74Inducing cell proliferation

Definitions

  • the disclosure relates to multifunctional binding proteins comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region 10 or variant thereof, wherein the first ABD binds specifically to human CD123 and the second ABD binds specifically to human NKp46 and wherein all or part of the immunoglobulin Fc region or variant thereof to a human Fc- ⁇ receptor.
  • ABSDs antigen binding domains
  • the disclosure also relates to methods for making said binding proteins, compositions thereof, and their uses including the treatment or prevention of proliferative 15 disorders, including Acute Myeloid Leukemia (AML) and myelodysplastic syndromes (MDS).
  • AML Acute Myeloid Leukemia
  • MDS myelodysplastic syndromes
  • AML Acute myeloid leukemia
  • MDS myelodysplastic syndromes
  • NK Natural killer
  • NK cells provide an efficient immunosurveillance mechanism by which undesired cells such as tumor- or virally-infected cells can be 25 eliminated.
  • Characteristics and biological properties of NK cells include the expression of surface antigens including CD16, CD56 and/or CD57, the absence of the ⁇ / ⁇ or ⁇ / ⁇ TCR complex on the cell surface, the ability to bind to and kill cells in a MHC-unrestrictive manner and in particular cells that fail to express "self" MHC/HLA antigens by the activation of specific cytolytic enzymes, the ability to kill tumor cells or other diseased cells that 30 express a ligand for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate the immune response.
  • NK natural killer cells due to their potential anti- tumor properties. 1 Still, there is an urgent need for active agents for treating or preventing proliferative disorders such as Acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS). There is also a need for novel NK engagers with a therapeutic effect. There is also a need for novel compounds which are easier to manufacture and/or administer, with no or decreased side-effects. In particular, there is a need for novel compounds with no or decreased risk of cytokine release syndrome in patients (e.g. no or decreased IL-6 associated cytokine release).
  • AML Acute myeloid leukemia
  • MDS myelodysplastic syndromes
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABD comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (VL), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10 to 12 respectively; (ii)
  • the binding protein comprises three polypeptide chains (I), (II) and (III) that form two ABDs, as defined below: V 1A – C 1A – Hinge1 – (C H 2-C H 3)A (I) V 1B – C 1B – Hinge 2 – (C H 2-C H 3) B – L 1 – V 2A – C 2A – Hinge 3 (II) V 2B – C 2B (III) wherein : V 1A and V 1B form a binding pair V 1 (V H1 /V L1 ); V 2A and V 2B form a binding pair V2 (V H2 /V L2 ); C 1A and C 1B form a pair C 1 (C H 1/C L ) and C 2A and C 2B form a pair C 2 (C H 1/C L ) wherein C H 1 is an immunoglobulin heavy chain constant domain 1 and C L is an immunoglobulin light chain constant domain; Hing
  • C 1B is an immunoglobulin heavy chain constant domain 1 (C H 1);
  • C 2A is an immunoglobulin heavy chain constant domain 1 (C H 1);
  • C L corresponds to an immunoglobulin kappa light chain constant domain (C ⁇ );
  • C H 2-C H 3)A corresponds to the amino acid sequence of SEQ ID NO: 69;
  • C H 2-C H 3) B corresponds to the amino acid sequence of SEQ ID NO: 70;
  • Hinge1 corresponds to the amino acid sequence of SEQ ID NO:74;
  • Hinge2 corresponds to the amino acid sequence of SEQ ID NO:75;
  • Hinge3 corresponds to the amino acid sequence of SEQ ID NO: 77;
  • L 1 corresponds to the amino acid sequence of SEQ ID NO: 76.
  • the residue N297 of the Fc region or variant thereof according to EU numbering comprises a N-linked glycosylation.
  • the all or part of the Fc region or variant thereof binds to a human CD16A (Fc ⁇ RIII) polypeptide.
  • the binding protein comprises at least two polypeptide chains linked by at least one disulfide bridge.
  • the polypeptide chains (I) and (II) are linked by at least one disulfide bridge between C 1A and Hinge 2 and/or wherein the polypeptide chains (II) and (III) are linked by at least one disulfide bridge between Hinge3 and C 2B .
  • V 1A is V L1 and V 1B is V H1 .
  • V 2A is V H2 and V 2B is V L2 .
  • V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3;
  • V L1 comprises a CDR- L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 9;
  • V H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15;
  • V H1 and V L1 corresponds to the amino acid sequences of SEQ ID NO: 41 and 43 respectively or corresponds to the amino acid sequences of SEQ ID NO: 42 and 44 respectively; and/or (b) V H2 and V L2 corresponds to the amino acid sequences of SEQ ID NO: 45 and 53 respectively; the amino acid sequences of SEQ ID NO: 46 and 54 respectively; the amino acid sequences of SEQ ID NO: 47 and 55 respectively; the amino acid sequences of SEQ ID NO: 48 and 56 respectively; the amino acid sequences of SEQ ID NO: 49 and 57 respectively; the amino acid sequences of SEQ ID NO: 50 and 58 respectively; the amino acid sequences of SEQ ID NO: 51 and 59 respectively; or the amino acid sequences of SEQ ID NO: 52 and 60 respectively.
  • polypeptide (I) comprises an amino acid sequence of SEQ ID NO: 64; polypeptide (II) comprises an amino acid sequence of SEQ ID NO: 65; and polypeptide (III) comprises an amino acid sequence of SEQ ID NO: 66.
  • polypeptide (I) consists of an amino acid sequence of SEQ ID NO: 64; polypeptide (II) consists of an amino acid sequence of SEQ ID NO: 65; and polypeptide (III) consists of an amino acid sequence of SEQ ID NO: 66.
  • the disclosure relates to a pharmaceutical composition comprising the binding protein defined above, and a pharmaceutically acceptable carrier.
  • the disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes the binding protein defined above. In one embodiment, the disclosure relates to an expression vector comprising the nucleic acid molecule defined above. In one embodiment, the disclosure relates to an isolated cell comprising the nucleic acid molecule defined above. In one embodiment, the disclosure relates to an isolated cell comprising the expression vector defined above. In certain embodiments, the host cell is a mammalian cell.
  • the disclosure relates to a method for making the binding protein defined above, comprising the steps of: (a) introducing the expression vector defined above into a host cell; (b) culturing the host cell under conditions suitable for expressing the binding protein; and (c) optionally recovering the expressed binding protein.
  • the disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a binding protein as defined above, and characterized in that it comprises a first and a second antigen binding domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABD comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (VL), wherein each V H and VL comprises three complementary determining regions (CDR-1 to CDR-3); wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9
  • the disclosure relates to an expression vector comprising a nucleic acid molecule comprising a nucleotide sequence that encodes of or more polypeptide chains of the binding protein, as defined above. In one embodiment, the disclosure relates to an isolated cell comprising the nucleic acid molecule as defined above. In one embodiment, the disclosure relates to an isolated cell comprising the expression vector as defined above.
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing a plurality of recombinant polypeptides, said plurality comprising (i) a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, and (ii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 65, and (iii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 66; (b) optionally recovering the expressed recombinant polypeptides.
  • the disclosure relates to a method of treating or preventing a blood cancer, the method comprising administering to a subject in need of said treatment or prevention the pharmaceutical composition defined above.
  • the disclosure relates to a method of treating or preventing a myelodysplastic syndrome (MDS) or a lymphoproliferative disorder, the method comprising administering to a subject in need of said treatment or prevention the pharmaceutical composition defined above.
  • the disclosure relates to a method of treating or preventing an Acute Myeloid Leukemia (AML), the method comprising administering to a subject in need of said treatment or prevention the pharmaceutical composition defined above.
  • AML Acute Myeloid Leukemia
  • the disclosure relates to a method of treating or preventing a CD64-positive and CD64-negative Acute Myeloid Leukemia (AML), the method comprising administering to a subject in need of said treatment or prevention the pharmaceutical composition defined above.
  • the disclosure relates to a method of treating or preventing a CD64-positive Acute Myeloid Leukemia (AML), the method comprising administering to a subject in need of said treatment or prevention a binding protein comprising a first and a second antigen binding domain (ABD) and all or part of an immunoglobulin Fc region or variant thereof, wherein the first ABD binds specifically to human CD123, the second ABD binds specifically to human NKp46, and wherein all or part of the immunoglobulin Fc region or variant thereof binds to a human Fc- ⁇ receptor.
  • AML CD64-positive Acute Myeloid Leukemia
  • the binding proteins of the present disclosure are oriented with the amino terminal direction (“N-terminal end” or “N-term”) on the left-hand side and the carboxyl-terminal direction (“C-terminal end” or “C-term”) on the right-hand side, in accordance with standard usage and convention.
  • Figure 1 Tri-dimensional schematic representation of the F25 format which is a variant of the bispecific F5 format, including one human NKp46 binding site and one human CD123 binding site. On figure 1, the C-term of the polypeptide is on the left-hand side and the N-term is on the right-hand side.
  • Figure 2A - Figure 2D show two-dimensional schematic representations of the F25, F5, F26 and F6 formats respectively including the relevant domains for each polypeptide chain.
  • the C-term of the polypeptide is on the left-hand side and the N-term is on the right-hand side.
  • the human NKp46 binding domain is formed by the VH/VL pair on the left side.
  • the human CD123 binding domain is formed by the VH/VL pair on the right side.
  • Figure 2A shows a two-dimensional schematic representation of the F25 format. This representation represents the claimed “NKp46-CD123_F25” binding protein.
  • Figure 2B shows a two-dimensional schematic representation of the F5 format.
  • the F5 differs in that the C L and CH pair of the NKp46 binding domain are swapped, with the third polypeptide chain comprising a C H 1 domain and a V L domain.
  • Figure 2C shows a two-dimensional schematic representation of the F26 format. This F26 differs from F25 of figure 2A in that it includes a Fc-silent N297S mutation on each C H 2 domain.
  • Figure 2D shows a two-dimensional schematic representation of the F6 format. This F6 differs from F5 of figure 2B in that it includes a Fc-silent N297S mutation on each C H 2 domain.
  • Figure 2E shows a two-dimensional detailed representation of a variant of the F25 format.
  • FIG. 3 shows a proposed mechanism of action of a NK Cell Engager (NKCE) for killing, following joint binding of a tumor cell (i.e. an AML cell line; i.e. MOLM-13) expressing CD123 and a NK cell expressing NKp46 and a Fc ⁇ receptor (CD16a).
  • a tumor cell i.e. an AML cell line; i.e. MOLM-13
  • CD123 a NK cell expressing NKp46 and a Fc ⁇ receptor (CD16a).
  • NKCE NK Cell Engager
  • Figure 4A – Figure 4B report the in vitro cytotoxicity of the NKp46- CD123_F25 binding protein of the present disclosure against AML cell line (MOLM-13) or primary AML blast cells respectively.
  • Figure 4A shows the in vitro cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure and negative isotype control variant of format F25 binding NKp46 only (NKp46-IC_F25) against AML cell line (MOLM-13).
  • Figure 4B reproduces the same experiment with ex vivo patient samples where the cytotoxicity of NKp46-CD123_F25, NKp46-IC_F25, an anti-CD123 ADCC-enhanced antibody with no specificity for NKp46 (Reference-1) and a negative isotype control Fc- optimized antibody with increased ADCC activity and no specificity for NKp46 nor CD123 (IC-hIgG1-ADCC-enh) is assessed against primary AML blast cells.
  • Figure 5 provides in-vitro cytotoxicity data using fresh healthy donor NK cells against MOLM-13 AML cell line (EC50 data) of the NKp46-CD123_F25 binding protein of the present disclosure which is capable of activating human NK cells by engaging both NKp46 and CD16a, inducing ADCC activity with its Fc competent format (F25), and a NKp46-CD123_F6 binding protein activating human NK cells by engaging NKp46 only and not CD16a, inducing reduced ADCC-activity with its Fc silent format (F6).
  • Figures 6A – Figure 6B upper panels report the in vitro cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure, an anti-CD123 ADCC- enhanced antibody with no binding for NKp46 (Reference-1) and a negative isotype control Fc-optimized antibody with increased ADCC activity with no specificity for NKp46 nor CD123 (IC_hIgG1-ADCC-enh) against different AML cell lines.
  • the AML cell lines tested are: THP-1, a cell line expressing CD64(+) and CD32(+) ( Figure 6A); MOLM-13, a cell line not expressing CD64(-) but expressing CD32(+) ( Figure 6A), THP-1 CD64KO, a cell line knockout for CD64(-) expressing CD32(+) ( Figure 6B); and THP-1 CD32KO, a cell line expressing CD64(+) and knockout for CD32(-) ( Figure 6B).
  • Figure 6A and 6B lower panels reports the phenotype of the malignant AML cell lines and sub-clones and the expression of CD123, CD64, CD32a/b by flow cytometry analysis.
  • Figures 7A – Figure 7B report the ex vivo induction of NK degranulation measured through the percentage of CD107a-positive NK cells against primary AML blasts from two different donors.
  • Primary AML blasts from donor #1 are CD64(+) ( Figure 7A) and primary AML blasts from donor #2 are CD64(-) ( Figure 7B).
  • the tested binding proteins are the NKp46-CD123_F25 binding protein of the present disclosure, an anti- CD123 ADCC-enhanced antibody with no specificity for NKp46 (Reference-1), a negative isotype control variant of format F25 not binding CD123 but binding NKp46 and CD16a (NKp46-IC_F25) and a negative isotype control Fc-optimized antibody with increased ADCC activity with no specificity for NKp46 nor CD123 (IC_hIgG1-ADCC-enh).
  • Figure 8 reports dose-dependent anti-tumor activity with the muNKp46- huCD123_F25 binding protein (carrying anti-murineNKp46 and anti-humanCD123 binding domains and also known as moNKp46-huCD123) against MOLM-13 human cells in a Severe Combined ImmunoDeficient mice (SCID) mouse model.
  • SCID Severe Combined ImmunoDeficient mice
  • Figure 9A – Figure 9C report the CD123-positive basophil depletion for up to 28 days after the administration NKp46-CD123_F25 binding protein of the present disclosure in non-human primates (M1, M2, M3, M4 and M6) at 3000 ⁇ g/kg or 3 mg/kg (Figure 9A), at 3 ⁇ g/kg ( Figure 9B), and at 0.5 ⁇ g/kg (Figure 9C).
  • Figure 10A – Figure 10B reports the in-vitro cytotoxicity of two NKp46- CD123 NKCE Fc-competent binding proteins (the NKp46-CD123_F25 of the present disclosure and NKp46-CD123_F5) and a control variant of format F5 binding CD123 and CD16a but not binding NKp46 (CD123-IC_F5) against two AML cell lines, MOLM-13 ( Figure 10A) and THP-1 ( Figure 10B) in presence of NK cell healthy donor sample (D648).
  • Central panel reports NKp46-CD123_F25 maximum depletion activity at the highest dose tested (10 ⁇ g/mL, 68 nM).
  • TCE tool bispecific T Cell Engager tool
  • Figure 13A - Figure 13F show the individual IL-6 and IL-10 plasma concentration versus time profiles in correlation with NKp46-CD123_F25 binding protein concentrations at 3000 ⁇ g/kg (Figure 13A and Figure 13B), 3 ⁇ g/kg ( Figure 13C and Figure 13D), 0.5 ⁇ g/kg (Figure 13E) and ⁇ 0.5 ⁇ g/kg (Figure 13F) for 6 male Cynomolgus monkeys (M1 to M6).
  • Figure 14A displays the cytotoxicity of NKp46-CD123_F25 binding protein of the present disclosure as compared to an anti-CD123 ADCC-enhanced antibody with no specificity for NKp46 (Reference-1) and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 nor CD123 (IC-hIgG1-ADCC- enh) against AML blasts from patients expressing (#AML5, #AML6) or not (#AML1, #AML2) CD64. Malignant cells from AML patients were used as targets and purified healthy donor NK cells were used as effectors. Results are shown for all healthy donor NK cells tested.
  • Figure 14B reports the phenotype of the malignant AML cells from patients used in Figure 14A showing the expression of CD33, CD123, CD32a/b, and CD64 by flow cytometry analysis.
  • Figure 15A is a comparison of the cytotoxicities of NKCEs targeting CD123 on tumor cells and not engaging NK cells (IC-CD123_F6) or engaging NK cells by CD16a only (IC-CD123_F25) or NKp46 only (NKp46-CD123_F6) or co-engaging NKp46+CD16 (NKp46-CD123_F25).
  • MOLM-13 cells were used as the target cells and purified resting healthy donor NK cells as effectors. Two NK donors are shown.
  • Figure 15B reports the cytotoxicity of NKp46-CD123_F25 binding protein of the present disclosure as compared to a negative isotype control NKCE molecule not binding to CD123 (NKp46-IC_F25) against AML cell line MOLM-13. Results for five healthy NK- cell donors are shown.
  • Figure 16A is a flow cytometric analysis of NK and malignant cells from AML patients (AML #8-#10). Upper panels display the expression of CD123 on AML blasts (gated on the CD33-positive population); middle panels display the expression of CD64 (CD64 staining in black and isotype control in gray) on CD123-positive AML blasts; and lower panels display expression of NKp46 and CD16a on NK AML sample NK cells.
  • Figure 16B is an analysis of CD107a/b expression by NK cells after the overnight treatment with NKp46-CD123_F25 (CD123-NKCE), anti-CD123 ADCC- enhanced antibody with no specificity for NKp46 (Reference-1 or CD123-IgG1+ in the graph), a control isotype NKp46-IC_F25 not binding CD123 but binding NKp46 and CD16a (600 and 120 ng/mL) (IC-NKCE) and an IgG1 isotype control (600 ng/ml) (IC-IgG1+) on PBMCs from AML patient samples expressing CD64 (AML #8 and #9) and not expressing CD64 (AML #10) at the cell surface of their blasts.
  • Figure 17 shows percent of marker expression (CD107, CD69, TNF- ⁇ , IFN- ⁇ , and MIP-1 ⁇ ) expression by NK cells treated with increasing concentrations of NKp46- CD123_F25 in comparison to controls, including one engaging NKp46 and CD16 only (NKp46-IC_F25) in an experimental setting using NK cells co-cultured or not with MOLM- 13 cells (NK + MOLM-13 versus NK alone). Results for three NK cell donors are shown.
  • Figure 18 shows the activity of the surrogate muNKp46-huCD123_F25 bispecific antibody (also known as moNKp46-huCD123) against disseminated human AML, MOLM-13, in SCID mice.
  • muNKp46-huCD123_F25 bispecific antibody also known as moNKp46-huCD123
  • MOLM-13 cells were injected intravenously at day 0 in a single administration. Treatments were administered on day 1 post tumor implantation by intraperitoneal route. An isotype control antibody binding muNKp46 and murine Fc ⁇ Rs but not huCD123 (muNKp46-IC) was administered at 0.5 mg/kg. muNKp46-huCD123_F25 and Reference-1 were administered at 5, 0.5, 0.25 and 0.05 mg/kg. The control group was left untreated. Graphs represent Kaplan-Meier curves for animals treated by muNKp46- huCD123_F25 bispecific antibody, Reference-1 and controls at 5, 0.5, 0.25 and 0.05 mg/kg.
  • n 5 to 10 mice / group.
  • Figure 19 evaluates the impact of NK depletion on the in vivo efficacy of surrogate muNKp46-huCD123_F25 bispecific antibody in SCID mice bearing disseminated human MOLM-13 tumor cells. NK depletion was induced by 2 intraperitoneal administrations of anti-asialo GM1 serum one day before tumor cell implantation and at day 5 after implantation.
  • Figure 20A depicts the depletion of CD123-positive basophils from the blood of monkeys M3 and M4 treated at the low dose of 3 ⁇ g/kg as single 1-hour intravenous infusion. Blood samples were collected before dosing (pre-dose) and 24 hours after the start of the infusion and analyzed by flow cytometry. CD123-positive basophils are shown in the gate.
  • Figure 20B displays the numbers of circulating CD123-positive basophils (open symbols) and total CD123-positive leukocytes (close symbols) at time of study in monkeys M1 (orange) and M2 (purple) treated with 3 mg/kg as single 1-hour intravenous infusion, and monkeys M3 (red) and M4 (blue) treated with 3 ⁇ g/kg as single 1-hour intravenous infusion.
  • Figure 20C reports cytokine production in cynomolgus monkeys treated with the high and low doses of 3 mg/kg and 3 ⁇ g/kg as single 1-hour intravenous infusion, respectively. Plasma IL-6 and IL-10 concentrations are shown before dosing (0), and 1.5, 5 and 24 hours after the start of the treatment.
  • Figure 20D reports the plasma NKp46-CD123_F25 (CD123-NKCE) concentration monitored 1.5, 5, 24, 48, 72, 168, 240, 336, 504 and 672 hours (i.e., 0.04, 0.06, 0.21, 1, 2, 3, 7, 10, 14, 21 and 28 days) after the start of the 1-hour infusion of cynomolgus monkeys treated with the high and low doses of 3 mg/kg and 3 ⁇ g/kg.
  • the lower limit of quantification (LLOQ; 0.25 ng/mL) is indicated by the horizontal dotted line.
  • Figure 21A shows the toxicokinetics (TK) of the NKp46-CD123_F25 (CD123- NKCE) molecule in male monkey M5 weekly treated at a dose of 3 mg/kg/administration for four weeks (on Days 1, 8, 15 and 22).
  • Plasma CD123-NKCE concentrations were determined before dosing (predose) and 1, 1.5, 5, 24, and/or 72 hours after the start of the 1- hour infusion on days 1, 8, 15 and before dosing and, 1, 1.5, 5, 24, and 168 hours after the start of the last fourth 1-hour infusion on day 22. Values below the lower limit of quantification (LLOQ: 0.25 ng/mL) are not reported on the graphs. Infusion days are indicated by vertical dotted lines.
  • Figure 21B is an analysis of the interleukin-6 production in monkey M5 weekly treated with the high dose of 3 mg/kg/administration for four weeks. Plasma IL-6 concentrations were monitored before dosing and 1, 1.5, 5 and 24 hours after the start of the one-hour infusion on days 1, 8, 15 and before dosing and 1, 1.5, 5, 24, and 168 hours after the start of the last fourth one-hour infusion on day 22.
  • Figure 21C quantifies the number of circulating CD123-positive basophils (open symbols) and total CD123-positive leukocytes (closed symbols) in blood (left panel) or bone marrow (right panel), by timepoint in the study, for monkey M5, treated at a dose of 3 mg/kg/week.
  • Figure 22 graphically depicts THP1 cytotoxic activity in an assay with human peripheral blood mononuclear cells (PBMC) from 2 healthy donors (HD).
  • PBMC peripheral blood mononuclear cells
  • HD healthy donors
  • NK cells and THP1 GFP target cells were incubated in presence of NKp46-CD123_F25 or its isotype control IC-CD123_F6 engaging CD123 and inducing reduced ADCC-activity with its Fc silent format (F6) at 0.1, 1, 10 and 100 ng/mL.
  • F6 Fc silent format
  • the disclosure provides multifunctional binding proteins that bind one surface biomarker on immune NK cells, i.e., NKp46 and one antigen of interest on tumoral target cells i.e., CD123 and is capable of redirecting NK cells to lyse a target cell that expresses the CD123 surface biomarker.
  • the multifunctional binding proteins of the present disclosure further comprises all or part of a Fc region or variant thereof which binds a Fc- ⁇ receptor (Fc ⁇ R), in particular an activating Fc- ⁇ receptor (Fc ⁇ R), for example Fc ⁇ RIIIa also called CD16a.
  • the exemplified multifunctional binding proteins of the present disclosure also possess a dimeric Fc domain that comprises N-linked glycosylation and bind an activating Fc- ⁇ receptor (Fc ⁇ R) such as receptor CD16a thereby providing advantageous immune enhancing activity.
  • Fc ⁇ R activating Fc- ⁇ receptor
  • the inventors provide experimental evidence that optimal NK cell modulation, in particular NK cell activation, can be achieved with a better safety profile, both in vitro on AML cell lines MOLM-13 and THP1 and ex vivo on primary samples from AML patients (e.g., peripheral blood lymphocytes from AML patients), by engaging NKp46, a Fc ⁇ R such as CD16a, and the cell surface biomarker CD123.
  • the in vitro cytotoxic activity of the NKp46-CD123 binding protein of the present disclosure characterized by a format reported herein as the “F25” and comprising a central Fragment crystallizable (Fc) region retaining binding to a human CD16 polypeptide, was reproduced ex vivo.
  • the inventors provide experimental support of the therapeutic properties of a bispecific NKp46/CD16-CD123 binding protein in particular for use in treating and preventing AML and other proliferative disorders.
  • the inventors further provide experimental evidence that NKp46-CD123 binding protein activate NK cells in primary samples from AML patients irrespective of their CD64 expression status.
  • CD123 is also known as “Interleukin 3 receptor, alpha (IL3RA)” or “IL3R”, “IL3RX”, “IL3RY”, “IL3RAY”, “hlL-3Ra” and denotes an interleukin 3 specific subunit of a heterodimeric cytokine receptor.
  • the functional interleukin 3 receptor is a heterodimer that comprises a specific alpha chain (IL-3A; CD123) and the IL-3 receptor beta chain ( ⁇ ; CD131) that is shared with the receptors for granulocyte macrophage colony stimulating factor (GM-CSF) and interleukin 5 (IL-5).
  • CD123 is a type I integral transmembrane protein with a deduced Molecular Weight of about 43kDa containing an extracellular domain involved in IL-3 binding, a transmembrane domain and a short cytoplasmic tail of about 50 amino acids.
  • the extracellular domain is composed of two regions: a N-terminal region of about 100 amino acids, the sequence of which exhibits similarity to equivalent regions of the GM-CSF and IL-5 receptor alpha-chains; and a region proximal to the transmembrane domain that contains four conserved cysteine residues and a motif, common to other members of this cytokine receptor family.
  • the IL-3 binding domain comprises about 200 amino acid residue cytokine receptor motifs (CRMs) made up of two Ig-like folding domains.
  • CCMs cytokine receptor motifs
  • the protein family gathers three members: IL3RA (CD123A), CSF2RA and IL5RA.
  • the overall structure is well conserved between the three members, but sequence homologies are very low.
  • One 300 amino-acid long isoform of CD123 has been discovered so far, but only on the RNA level which is accessible on the Getentry database under the accession number ACM24116.1.
  • a reference sequence of full- length human CD123 protein, including signal peptide, is available from the NCBI database under the accession number NP_002174.1 and under the Uniprot accession number P26951.
  • the extracellular domain of human CD123 (ECD) consists of the amino acid sequence of SEQ ID NO: 86.
  • CD123 (the interleukin-3 receptor alpha chain IL-3Ra) is a tumor antigen overexpressed in a variety of hematological neoplasms. The majority of AML blasts express surface CD123 and this expression does not vary by subtype of AML. Higher expression of CD123 on AML at diagnosis has been reported to be associated with poorer prognosis. CD123 expression has been reported in other hematological malignancies including myelodysplasia, systemic mastocytosis, blastic plasmacytoid dendritic cell neoplasm (BPDCN), ALL and hairy cell leukemia.
  • BPDCN blastic plasmacytoid dendritic cell neoplasm
  • NK cells refers to a sub-population of lymphocytes that is involved in non-conventional immunity.
  • NK cells can be identified by virtue of certain characteristics and biological properties, such as the expression of specific surface antigens including CD16, CD56 and/or CD57, NKp46 for human NK cells, the absence of the alpha/beta or gamma/delta TCR complex on the cell surface, the ability to bind to and kill cells that fail to express “self” MHC/HLA antigens by the activation of specific cytolytic machinery, the ability to kill tumor cells or other diseased cells that express a ligand for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit the immune response.
  • NK cells any of these characteristics and activities can be used to identify NK cells, using methods well known in the art. Any subpopulation of NK cells will also be encompassed by the term NK cells.
  • active NK cells designate biologically active NK cells, including NK cells having the capacity of lysing target cells or enhancing the immune function of other cells.
  • NK cells can be obtained by various techniques known in the art, such as isolation from blood samples, cytapheresis, tissue or cell collections, etc.
  • Useful protocols for assays involving NK cells can be found in Natural Killer Cells Protocols (edited by Campbell KS and Colonna M). Human Press. pp.219-238 (2000).
  • NKp46 Natural cytotoxicity triggering receptor 1
  • CD335 also known as “CD335” or “NKP46” or “NK-p46” or “LY94” refers to a protein - or polypeptide – encoded by the Ncr1 gene.
  • a reference sequence of full-length human NKp46 protein is available from the NCBI database under the accession number NP_004820.
  • the human NKp46 extracellular domain (ECD) corresponds to the amino acid sequence of SEQ ID NO: 84.
  • the human NKp46 mRNA sequence is described in NCBI accession number NM_004829.
  • Fc- ⁇ receptor or “Fc ⁇ R” or “Fc-gamma receptor” may refer to both activating and inhibitory Fc ⁇ Rs.
  • Fc-gamma receptors are cellular receptors for the Fc region of an Immunoglobulin G (IgG). Upon binding of complexed IgG, Fc ⁇ Rs can modulate cellular immune effector functions, thereby linking the adaptive and innate immune systems, including ADCC-mediated immune responses.
  • Fc ⁇ Rs In humans, six classic Fc ⁇ Rs are currently reported: one high-affinity receptor (Fc ⁇ RI) and five low-to- medium-affinity Fc ⁇ Rs (Fc ⁇ RIIA, -B and -C, Fc ⁇ RIIIA and -B). All Fc ⁇ Rs bind the same region on IgG Fc, yet with differing high (FcgRI) and low (FcgRII and FcgRIII) affinities. On a functional level, most of the Fc ⁇ Rs are activating receptors that can induce the cellular responses mentioned above, including ADCC-mediated immune response.
  • Fc ⁇ RI, Fc ⁇ RIIa, Fc ⁇ RIIc, and Fc ⁇ RIIIa are activating receptors characterized by an intracellular immunoreceptor tyrosine-based activation motif (ITAM), Fc ⁇ RIIb has an inhibition motif (ITIM) and is therefore inhibitory.
  • ITAM immunoreceptor tyrosine-based activation motif
  • Fc ⁇ RIIb has an inhibition motif (ITIM) and is therefore inhibitory.
  • ITIM immunoreceptor tyrosine-based activation motif
  • Fc ⁇ Rs encompasses activating receptors, including Fc ⁇ RI (CD64), Fc ⁇ RIIA (CD32a), Fc ⁇ RIIIa (CD16a) and Fc ⁇ RIIIb (CD16b), and preferably Fc ⁇ RIIIa (CD16a).
  • Fc ⁇ RIIIa (CD16a)” or “Fc ⁇ RIIIa” or “CD16a” or “CD16” or “Cluster of Differentiation 16” may refer to a 50-65 kDa cell surface molecule expressed on mast cells, macrophages, and natural killer cells as a transmembrane receptor.
  • Fc ⁇ RIIIa is an activating receptor containing immunoreceptor tyrosine activating motifs (ITAMs) in the associated FcR ⁇ -chain, ITAMs being necessary for receptor expression, surface assembly and signaling.
  • ITAMs immunoreceptor tyrosine activating motifs
  • CD16a is a low affinity receptor for IgG and is an important receptor mediating ADCC (antibody dependent cell mediated cytotoxicity) by NK cells.
  • the high affinity receptor CD16a is preferentially found on NK cells and monocytes and induces antibody-dependent cellular cytotoxicity (ADCC) upon IgG binding.
  • ADCC antibody-dependent cellular cytotoxicity
  • the term “Fc ⁇ RII CD32”, “Fc ⁇ RII”, “FCGR2” or “CD32a” or “CD32A” or “CD32” or “cluster of differentiation 32” is a surface receptor glycoprotein belonging to the Ig gene superfamily. CD32A is expressed on all myeloid cells but not on lymphocytes. CD32 has a low-affinity for the Fc region of IgG antibodies in monomeric form, but high affinity for IgG immune complexes. CD32 has two major functions: cellular response regulation, and the uptake of immune complexes.
  • CD32A is an activating subtype of CD32 that can be found on a variety of immune cells.
  • CD32A (Fc ⁇ RIIA) mediates effector functions of granulocytes, monocytes, B cells, platelets, and dendritic cells upon low affinity binding of aggregated IgG.
  • the cytosolic ITAM can promote phagocytic activity and cytokine secretion in neutrophils and macrophages.
  • the term “hFc ⁇ RICD64”, “hFc ⁇ RI”, or “CD64” or “Cluster of Differentiation 64” is a surface receptor expressed constitutively only on monocytes and macrophages, but is upregulated on granulocytes upon cytokine stimulation.
  • Form 5 or “F5”, “Format 25” or “F25”, “Format F6” or “F6” and “Format 26” or “F26” refer to specific binding protein configurations of bispecific or multispecific antibodies specifically designed to engineer multiple antigen binding domains into a single antibody molecule.
  • the multifunctional binding proteins of the present disclosure which comprise a NKp46-binding domain and a CD123-binding domain, are made based on the F25 format, as exemplified in Figure 1 and Figure 2.
  • F25 and format F26 respectively differ from format F5 and F6 in that one C H 1/C L pair between the second and third polypeptide chain are swapped to form a C L / C H 1 pair.
  • bispecific binding protein refers to a binding protein that specifically binds to two different antigen targets (e.g. human NKp46 and human CD123) through two distinct antigen-binding domains (ABDs).
  • the term “specifically binds to” or “binds specifically to” refers to the ability of an antigen-binding domain (ABD) to bind to an antigen (e.g.
  • human NKp46 and/or human CD123 containing an epitope with an Kd of at least about 1 x 10 -6 M, 1 x 10- 7 M, 1 x 10 -8 M, 1 x 10 -9 M, 1 x 10 -10 M, 1 x 10 -11 M, 1 x 10 -12 M, or more, and/or to bind to an epitope with an affinity that is at least twofold greater than its affinity for a nonspecific antigen.
  • the term “specifically binds to human NK46 polypeptide” may refer to a specific binding toward a polypeptide comprising an amino acid sequence of SEQ ID NO: 84.
  • the term “specifically to a human CD123 polypeptide” may refer to a specific binding toward a polypeptide comprising an amino acid sequence of SEQ ID NO: 86.
  • the term “binds to a human Fc- ⁇ receptor polypeptide” may refer to a binding toward a polypeptide comprising an amino acid sequence of SEQ ID NO: 87 or SEQ ID NO: 88.
  • Competitive binding assays and other methods for determining specific binding are further described below and are well known in the art. Expressions such as “specifically binds to”, or “with specificity for” are used interchangeably.
  • Binding specificity can be quantitatively determined by an affinity constant KA (or K A ) and a dissociation constant KD (or KD).
  • affinity affinity
  • concentration EC50
  • KD equilibrium dissociation constant
  • the affinity of an antibody is given by a specific type of equilibrium constant, which is the dissociation constant KD, defined as [Ab] x [Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antibody-antigen complex, [Ab] is the molar concentration of the unbound antibody and [Ag] is the molar concentration of the unbound antigen.
  • KD dissociation constant
  • KA is defined by 1/KD.
  • a KD of less than 50 nM as determined by SPR, and under physiological conditions may generally be considered as indicative of specificity of binding for antigen-antigen binding domain (ABD) interactions.
  • binding proteins reported herein comprise: - an antigen binding domain which binds specifically to human CD123 with a K D of less than 10 nM, in particular with a KD of less than 0.5 nM, as determined by SPR, under physiological conditions; - an antigen binding domain which binds specifically to human NKp46 with a KD of less than 50 nM, in particular with a K D of less than 20 nM, as determined by SPR, under physiological conditions.
  • the term “and/or” is a grammatical conjunction that is to be interpreted as encompassing that one or more of the cases it connects may occur.
  • treating refers to a therapeutic use (i.e., on a subject having a given disease) and means reversing, alleviating, inhibiting the progress of one or more symptoms of such disorder or condition. Therefore, treatment does not only refer to a treatment that leads to a complete cure of the disease, but also to treatments that slow down the progression of the disease and/or prolong the survival of the subject.
  • preventing means a prophylactic use (i.e., on a subject susceptible of developing a given disease and encompasses the treatment of relapsed AML patient.
  • therapeutically effective amount of the multifunctional binding protein or pharmaceutical composition thereof is meant a sufficient amount of the antibody-like multifunctional binding protein to treat said cancer disease, at a reasonable benefit/risk ratio applicable to any medical treatment. It will be understood, however, that the total daily usage of the polypeptides and compositions of the present disclosure will be decided by the attending physician within the scope of sound medical judgment.
  • the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific polypeptide employed; the specific composition employed, the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific polypeptide employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well known within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
  • the term “subject” or “individual” or “patient” are used interchangeably and may encompass a human or a non-human mammal, rodent or non- rodent.
  • the term includes, but is not limited to, mammals, e.g., humans including man, woman and child, other primates (monkey), pigs, rodents such as mice and rats, rabbits, guinea pigs, hamsters, cows, horses, cats, dogs, sheep and goats.
  • the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
  • the term “a pharmaceutically acceptable carrier” encompasses a plurality of pharmaceutically acceptable carriers, including mixtures thereof.
  • antibody or “immunoglobulin” may refer to a natural or conventional antibody in which two heavy chains are linked to each other by disulfide bonds and each heavy chain is linked to a light chain by a disulfide bond.
  • light chain There are two types of light chain, lambda ( ⁇ ) and kappa ( ⁇ ).
  • lambda
  • kappa
  • the light chain includes two domains or regions, a variable domain (V L ) and a constant domain (C L ).
  • the heavy chain generally includes four domains, a variable domain (V H ) and three constant domains (C H 1, C H 2 and C H 3, collectively referred to as C H ).
  • classes IgG, IgA, and IgD have three heavy chain constant region domains, which are designated C H 1 C H 2, and CH3; and the IgM and IgE classes have four heavy chain constant region domains, C H 1, C H 2, C H 3, and C H 4.
  • the variable regions of both light (VL) and heavy (VH) chains determine binding recognition and specificity to the antigen.
  • the constant region domains of the light (C L ) and heavy (CH) chains confer important biological properties such as antibody chain association, secretion, trans-placental mobility, complement binding, and binding to Fc receptors (FcR).
  • the Fv fragment is the N-terminal part of the antigen-binding fragment (Fab) of an immunoglobulin and consists of the variable portions of one light chain and one heavy chain.
  • IgG immunoglobulin G
  • IgG1 IgG2
  • IgG3 and IgG4 are included, unless defined otherwise.
  • IgG is IgG1.
  • antibody-like or “immunoglobulin-like” polypeptide may also refer to non-conventional or synthetic antigen-binding polypeptides or binding protein, including single domain antibodies and fragments thereof, in particular variable heavy chain of single domain antibodies, and chimeric, humanized, bispecific or multimeric antibodies.
  • multifunctional binding protein encompass a multi- chain protein, including but not limited to antibody-like polypeptide or protein formats, which comprises at least one first variable region (e.g. a first immunoglobulin heavy chain variable domain (V H ) and/or an immunoglobulin light chain variable domain (VL)) binding specifically to a human CD123 polypeptide, and at least one second variable region (e.g.
  • V H immunoglobulin heavy chain variable domain
  • V L immunoglobulin light chain variable domain
  • humanized refers to a polypeptide (i.e., an antibody or an antibody-like polypeptide) which is wholly or partially of non-human origin and which has been modified to replace certain amino acids, in particular in the framework regions of the heavy and light chains, in order to avoid or minimize an immune response in humans.
  • the constant domains of a humanized antibody are most of the time human CH and C L domains. Numerous methods for humanization of an antibody sequence are known in the art; see e.g., the review by Almagro & Fransson (2008) Front Biosci. 13: 1619-1633.
  • CDR grafting or antibody reshaping, which involves grafting of the CDR sequences of a donor antibody, generally a mouse antibody, into the framework scaffold of a human antibody of different specificity.
  • humanization typically involves modification of the framework regions of the variable region sequences. Amino acid residues that are part of a CDR will typically not be altered in connection with humanization, although in certain cases it may be desirable to alter individual CDR amino acid residues, for example to remove a glycosylation site, a deamidation site or an undesired cysteine residue.
  • N-linked glycosylation occurs by attachment of an oligosaccharide chain to an asparagine residue in the tripeptide sequence Asn-X-Ser or Asn-X-Thr, where X may be any amino acid except Pro. Removal of an N-glycosylation site may be achieved by mutating either the Asn or the Ser/Thr residue to a different residue, in particular by way of conservative substitution. Deamidation of asparagine and glutamine residues can occur depending on factors such as pH and surface exposure. Asparagine residues are particularly susceptible to deamidation, primarily when present in the sequence Asn-Gly, and to a lesser extent in other dipeptide sequences such as Asn- Ala.
  • substitution in a CDR sequence to remove one of the implicated residues is also intended to be encompassed by the claimed multifunctional binding protein.
  • conservative amino acid substitution refers to substitutions in which an amino acid residue is replaced with an amino acid residue having a side chain with similar physicochemical properties.
  • Families of amino acid residues having similar side chains are known in the art, and include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid, glutamic acid
  • uncharged polar side chains e.g., glycine, asparagine, glutamine,
  • domain may be any region of a protein, generally defined on the basis of sequence homologies or identities, which is related to a specific structural or functional entity. Accordingly, the term “region”, as used in the context of the present disclosure, is broader in that it may comprise additional regions beyond the corresponding domain.
  • linker region refers to any amino acid sequence suitable for covalently linking two polypeptide domains, such as two antigen-binding domains together and/or a Fc region to one or more variable regions, such as one or more antigen- binding domains.
  • amino acid linkers are generally less than 50 amino acids in length, preferably less than 30 amino acids in length, for instance 20 or less than 20 amino acids in length, for instance 15 or less than 15 amino acids in length.
  • amino acid linkers may optionally comprise all or part of an immunoglobulin polypeptide chain, such as all or part of a hinge region of an immunoglobulin.
  • the amino acid linker may comprise a polypeptide sequence that is not derived from a hinge region of an immunoglobulin, or even that is not derived from an immunoglobulin heavy or light polypeptide chain.
  • an immunoglobulin hinge region, or a fragment thereof may thus be considered as a particular type of linker, which is derived from an immunoglobulin polypeptide chain.
  • hinge region refers to a generally flexible region and born by the corresponding heavy chain polypeptides, and which separates the Fc and Fab portions of certain isotypes of immunoglobulins, more particularly of the IgG, IgA or IgD isotypes.
  • Such hinge regions are known in the Art to depend upon the isotype of immunoglobulin which is considered.
  • the hinge region thus separates the C H 1 domain and the C H 2 domain and is generally cleaved upon papain digestion.
  • the region corresponding to the hinge in IgM and IgE heavy chains is generally formed by an additional constant domain with lower flexibility.
  • the hinge region may comprise one or more cysteines involved in interchain disulfide bonds.
  • the hinge region may also comprise one or more binding sites to a Fc ⁇ receptor, in addition to Fc ⁇ R binding sites born by the C H 2 domain, when applicable.
  • the hinge region may comprise one or more post-translational modification, such as one or more glycosylated residues depending on the isotype which is considered.
  • the hinge regions which are still particularly considered comprise all or part of a hinge from an immunoglobulin belonging to one isotype selected from: the IgG isotype, the IgA isotype and the IgD isotype; in particular the IgG isotype.
  • the terms “CH domain”, or “C H domain”, or “constant domain”, can be used interchangeably and refer to any one or more heavy chain immunoglobulin constant domain(s).
  • Such C H domains are natively folded as immunoglobulin-like domains, although they may be partly disordered in an isolated form (e.g., C H 1 domains when not associated with the constant domain of a light chain (C L )).
  • the term may thus refer to a C H 1 domain, a C H 2 domain, a CH3 domain; or any combinations thereof.
  • the terms “CH1 domain”, or “C H 1 domain”, or “constant domain 1”, can be used interchangeably and refer to the corresponding heavy chain immunoglobulin constant domain 1.
  • the term “CH2 domain”, or “C H 2 domain”, or “constant domain 2” can be used interchangeably and refer to the corresponding heavy chain immunoglobulin constant domain 2.
  • the term “CH3 domain”, or “C H 3 domain”, or “constant domain 3” can be used interchangeably and refer to the corresponding heavy chain immunoglobulin constant domain 3.
  • C H 2-C H 3 refers to a polypeptide sequence comprising an immunoglobulin heavy chain constant domain 2 (C H 2) and an immunoglobulin heavy chain constant domain 3 (CH3).
  • CL domain or “C L domain” can be used interchangeably and refer to the corresponding light chain immunoglobulin constant domain. Unless instructed otherwise, this term may thus encompass a C L domain of the kappa ( ⁇ or K) or lambda ( ⁇ ) class of immunoglobulin light chains, including all known subtypes (e.g. ⁇ 1 , ⁇ 2 , ⁇ 3 , and ⁇ 7 ).
  • the C L domain when the C L domain is of the kappa class, it may also be referred herein as a C ⁇ or CK or Ck domain.
  • the terms “pair C (C H 1/C L )”, or “paired C (C H 1/C L )” “refers to one constant heavy chain domain 1 and one constant light chain domain (e.g., a kappa ( ⁇ or K) or lambda ( ⁇ ) class of immunoglobulin light chains) bound to one another by covalent or non-covalent bonds, preferably non-covalent bonds; thus forming a heterodimer.
  • this term may thus encompass all possible combinations.
  • the corresponding C H 1 and C L domains will thus be selected as complementary to each other, such that they form a stable pair C (C H 1/C L ).
  • the binding protein comprises a plurality of paired C domains, such as one “pair C 1 (C H 1/C L )” and one “pair C 2 (C H 1/C L )”
  • each C H 1 and C L domain forming the pairs will be selected so that they are formed between complementary C H 1 and C L domains. Examples of complementary C H 1 and C L domains have been previously described in the international patent applications WO2006064136 or WO2012089814 or WO2015197593A1.
  • the terms “pair C 1 (C H 1/C L )” or “pair C 2 (C H 1/C L )” may refer to distinct constant pair domains (C 1 and C 2 ) formed by identical or distinct constant heavy 1 domains (C H 1) and identical or distinct constant light chain domains (C L ).
  • the terms “pair C 1 (C H 1/C L )” or “pair C2 (C H 1/CL)” may refer to distinct constant pair domains (C1 and C 2 ) formed by identical constant heavy 1 domains (C H 1) and identical constant light chain domains (C L ).
  • Fc region or “fragment crystallizable region”, or alternatively “Fc portion”, encompasses all or parts of the “Fc domain”, which may thus include all or parts of an immunoglobulin hinge region (which natively bears a first binding site to Fc ⁇ Rs), a C H 2 domain (which natively bears a second binding site to Fc ⁇ Rs), and a CH3 domain of an immunoglobulin (e.g. of an IgG, IgA or IgD immunoglobulin), and/or when applicable of a C H 4 domain of an immunoglobulin (e.g. for IgM and IgE).
  • an immunoglobulin hinge region which natively bears a first binding site to Fc ⁇ Rs
  • C H 2 domain which natively bears a second binding site to Fc ⁇ Rs
  • CH3 domain of an immunoglobulin e.g. of an IgG, IgA or IgD immunoglobulin
  • C H 4 domain of an immunoglobulin e.g.
  • the Fc region includes all or parts of, at least, a C H 2 domain and a CH3 domain, and optionally all or parts of an immunoglobulin hinge region.
  • the term may thus refer to a molecule comprising the sequence of a non-antigen-binding fragment resulting from digestion of an antibody or produced by other means, whether in monomeric or multimeric form, and can contain the hinge region.
  • the original immunoglobulin source of the native Fc is, in particular, of human origin and can be any of the immunoglobulins, although IgG1 are preferred.
  • Native Fc molecules are made up of monomeric polypeptides that can be linked into dimeric or multimeric forms by covalent (i.e., disulfide bonds) and non-covalent association.
  • the number of intermolecular disulfide bonds between monomeric subunits of native Fc molecules ranges from 1 to 13 depending on class (e.g., IgG, IgA, and IgE) or subclass (e.g., IgG1, IgG2, lgG3, IgGA1, and IgGA2).
  • class e.g., IgG, IgA, and IgE
  • subclass e.g., IgG1, IgG2, lgG3, IgGA1, and IgGA2
  • native Fc is a disulfide-bonded dimer resulting from papain digestion of an IgG.
  • native Fc as used herein is generic to the monomeric, dimeric, and multimeric forms.
  • a “Fc region” may thus comprise or consist of C H 2-C H 3 (e.g., ( C H 2-C H 3)A or (C H 2-C H 3) B or a binding pair thereof, and optionally all or part of an immunoglobulin hinge region, comprising a binding site to a human Fc ⁇ R.
  • the term “Fc region” may refer to either a native or variant Fc region.
  • the term “Fc variant” as used herein refers to a molecule or sequence that is modified from a native Fc but still comprises a binding site for the receptor, FcRn (neonatal Fc receptor). Exemplary Fc variants, and their interaction with the receptor, are known in the art.
  • Fc variant can comprise a molecule or sequence that is humanized from a non-human native Fc.
  • a native Fc comprises regions that can be removed because they provide structural features or biological activity that are not required for the antibody-like binding proteins of the invention.
  • Fc variant comprises a molecule or sequence that lacks one or more native Fc sites or residues, or in which one or more Fc sites or residues has be modified, that affect or are involved in: (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to an Fc receptor other than a salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC).
  • ADCC antibody-dependent cellular cytotoxicity
  • the fragment crystallizable (Fc) regions (e.g., native or variant) according to the present disclosure retain a capacity to bind to a human Fc- ⁇ receptor polypeptide (Fc ⁇ ) which generally occurs on native Fc regions through binding of the antibody Fc-hinge region.
  • Fc ⁇ human Fc- ⁇ receptor polypeptide
  • overall structures of IgG1, IgG2, and IgG4 are similar with more than 90% sequence homology, the major differences residing in the hinge region and C H 2 domain, which form primary binding sites to Fc ⁇ Rs.
  • the hinge region also functions as a flexible linker between the Fab and Fc portion.
  • Fc regions having one or more amino acid modifications e.g., substitutions, deletions, insertions
  • modifications increase the affinity and avidity of the variant Fc region for an Fc ⁇ R are further considered as Fc regions.
  • said one or more amino acid modifications increase the affinity of the Fc region for Fc ⁇ RIIIA and/or Fc ⁇ RIIA.
  • the variant Fc region further specifically binds Fc ⁇ RIIB with a lower affinity than does the Fc region of the reference parent antibody (e.g., an antibody having the same amino acid sequence as the antibody except for the one or more amino acid modifications in the Fc region).
  • native and variant Fc regions considered herein generally comprise a domain (i.e., a C H 2 domain) capable of binding to human CD16, e.g., a human Fc domain comprising N-linked glycosylation at amino acid residue N297 (according to EU numbering).
  • a domain i.e., a C H 2 domain
  • human Fc domain comprising N-linked glycosylation at amino acid residue N297 (according to EU numbering).
  • the term “Fc-competent” thus refers to a binding protein that is capable of binding specifically to a Fc ⁇ R, in particular of an activating Fc ⁇ R, in particular to one selected from Fc ⁇ RI (CD64a), Fc ⁇ RIIa (CD32a), and Fc ⁇ RIIIa (CD16a), and more particularly to Fc ⁇ RIIIa (CD16a).
  • Fc-silent refers to a binding protein with a Fc region, wherein the Fc region lacks a binding site to a Fc ⁇ R (e.g., a Fc region lacking a C H 2 domain with said binding site and hinge region with said binding site); in particular Fc ⁇ RI, Fc ⁇ RIIa, and Fc ⁇ RIIIa, and more particularly to Fc ⁇ RIIIa (CD16a).
  • variable refers to certain portions of the relevant binding protein which differ extensively in sequence between and among antibodies and are used in the specific recognition and binding of a particular antibody for its particular target. However, the variability is not evenly distributed throughout the entire variable domains of antibodies. The variability is concentrated in three segments called complementarity determining regions (CDRs; i.e., CDR1, CDR2, and CDR3) also known as hypervariable regions, both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework (FR) regions or sequences.
  • CDRs complementarity determining regions
  • FR framework
  • VH domain or “V H domain” can be used interchangeably and refer to the corresponding heavy chain immunoglobulin variable domain.
  • VL domain can be used interchangeably and refer to the corresponding light chain immunoglobulin variable domain.
  • VH or VL domains are associated to a first antigen-binding domain (ABD) or to a second antigen-binding domain, they may also be respectively referred herein as “V H 1” and “V L 1”, or “V H 2” and “V L 2”.
  • binding pair V (VH/VL)”, “V H /V L pair” or “(V H /V L ) pair” or “V L /V H pair” or “(V L /V H ) pair” can be used interchangeably.
  • Heavy chain and light chain variable domain can pair in parallel to form the antigen binding domains (ABDs).
  • Each binding pair includes both a V H and a VL region. Unless instructed otherwise, these terms do not specify which immunoglobulin variable regions are V H or V L regions and which ABD will bind specifically the protein expressed on the surface of an immune effector cell or a target cell (e.g., NKp46 and CD123).
  • the term “hypervariable region’ when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. This term may be substituted by the terms “Complementarity Determining Regions” or “CDRs”.
  • CDRs refer to amino acid sequences that together define the binding affinity and specificity of the natural Fv region of a native immunoglobulin binding site.
  • the light and heavy chains of an immunoglobulin each have three CDRs, designated CDR-L1, CDR-L2, CDR-L3 and CDR -H1, CDR-H2, CDR-H3, respectively.
  • a conventional antibody antigen-binding domain therefore, includes six CDRs, comprising the CDR set from each of a heavy and a light chain variable region.
  • FRs Framework Regions
  • the light and heavy chains of an immunoglobulin each have four FRs, designated FR-L1, FR-L2, FR-L3, FR-L4, and FR-H1, FR-H2, FR-H3, FR-H4, respectively.
  • the light chain variable domain may thus be designated as (FR-L1)-(CDR-L1)- (FR-L2)-(CDR-L2)-(FR-L3)-(CDR-L3)-(FR-L4) and the heavy chain variable domain may thus be designated as (FR-H1)-(CDR-H1)-(FR-H2)-(CDR-H2)-(FR-H3)-(CDR-H)-(FR4- H3).
  • the hypervariable region generally comprises amino acid residues from a “complementarity-determining region” or “CDR” (e.g.
  • the numbering of amino acid residues in this region is performed by the method described in Kabat et al., supra. Accordingly, phrases such as “Kabat position”, “variable domain residue numbering as in Kabat” and “according to Kabat” herein refer to this numbering system for heavy chain variable domains or light chain variable domains. Using the Kabat numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain.
  • a heavy chain variable domain may include a single amino acid insert (residue 52a according to Kabat) after residue 52 of CDR H2 and inserted residues (e.g., residues 82a, 82b, and 82c, etc. according to Kabat) after heavy chain FR residue 82.
  • the Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Kabat numbered sequence.
  • CDRs are as defined by EU, Kabat, Chotia or IMGT numbering.
  • cytotoxicity refers to the quality of a compound, such as the multifunctional binding protein according to the present disclosure, to be toxic to tumoral cells. Cytotoxicity may be induced by different mechanisms of action and can thus be divided into cell-mediated cytotoxicity, apoptosis, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP) or complement- dependent cytotoxicity (CDC).
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • ADCP antibody-dependent cellular phagocytosis
  • CDC complement- dependent cytotoxicity
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • proliferative disorders include cancers of the breast, respiratory tract, brain, reproductive organs, digestive tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid and their distant metastases, but also include blood cancers, including tumors of the hematopoietic and lymphoid tissues, such as lymphomas, myelomas, and leukemias.
  • Leukemias include, but are not limited to acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia.
  • AML acute myelogenous leukemia
  • AML-LSCs Leukemic Stem Cells
  • AML-LSCs Leukemic Stem Cells
  • These progenitors generate the large numbers of leukemic blasts readily detectable in patients at diagnosis and relapse, leading ultimately to mortality.
  • AML-LSC have been commonly reported as quiescent cells, in contrast to rapidly dividing clonogenic progenitors.
  • relapse may in particular be defined as the reoccurrence of AML after complete remission.
  • complete remission or “CR” may be defined as follows: normal values for neutrophil (>1.0*10 9 /L), haemoglobin level of 10g/dl and platelet count (>100*10 9 /L) and independence from red cell transfusion; blast cells less than 5%, no clusters or collections of blasts, and absence of Auer rods on bone marrow examination; and normal maturation of blood cells (morphology; myelogramme) and absence of extramedullary leukemia.
  • MDS myelodysplastic syndromes
  • preleukemia formerly known as preleukemia
  • MDS myelodysplastic syndromes
  • AML acute myeloid leukemia
  • IMS International Prognostic Scoring System
  • a “pharmaceutically acceptable carrier” is intended to include any and all carrier (such as any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like) which is compatible with pharmaceutical administration, in particular parenteral administration.
  • carrier such as any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like.
  • the use of such media and agents for pharmaceutically active substances are known. Except insofar as any conventional media or agent is incompatible with the active compound, such media can be used in the compositions of the present disclosure.
  • preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • pharmaceutically acceptable carriers include, but are not limited to, 0.01-0.1M (e.g., 0.05M) phosphate buffer or 0.8% saline.
  • Other common parenteral vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present such as for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. More particularly, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like.
  • isotonic agents are included, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
  • the term “at least one” may encompass “one or more”, or even “two or more” (or “a plurality”).
  • it may encompass 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more than 100.
  • the term “less than...” may encompass all values from 0 to the corresponding threshold, For instance, it may encompass less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or less than 100, when applicable.
  • the term “cell” may encompass any prokaryotic cell or eukaryotic cell.
  • Cell types which are particularly considered are those suitable for the production and/or engineering of recombinant antibodies, or fragments, or polypeptide chains thereof.
  • such cells may be selected from the group consisting of: bacterial cells, yeast cells, mammalian cells, non-mammalian cells, insect cells, and plant cells.
  • the terms “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells.
  • Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
  • a host cell is any type of cellular system that can be used to generate binding proteins of the present disclosure.
  • Host cells may thus include cultured cells, e.g., mammalian cultured cells, such as CHO cells, HEK cells, BHK cells, NS0 cells, SP2/0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, bacterial cells, yeast cells, insect cells, and plant cells, to name only a few.
  • cultured cells e.g., mammalian cultured cells, such as CHO cells, HEK cells, BHK cells, NS0 cells, SP2/0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, bacterial cells, yeast cells, insect cells, and plant cells, to name only a few.
  • isolated nucleic acid molecule or polynucleotide is intended a nucleic acid molecule, DNA or RNA, which has been
  • a recombinant polynucleotide encoding a polypeptide contained in a vector is considered isolated for the purposes of the present disclosure.
  • Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution.
  • An isolated polynucleotide includes a polynucleotide molecule contained in cells that ordinarily contain the polynucleotide molecule, but the polynucleotide molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.
  • Isolated RNA molecules include in vivo or in vitro RNA transcripts of the present disclosure, as well as positive and negative strand forms, and double-stranded forms. Isolated polynucleotides or nucleic acids according to the present disclosure further include such molecules produced synthetically.
  • a polynucleotide or a nucleic acid may be or may include a regulatory element such as a promoter, ribosome binding site, or a transcription terminator.
  • vector or “expression vector” is intended to mean the vehicle by which a nucleic acid, in particular a DNA or RNA sequence (e.g., a foreign gene), can be introduced into a host cell, so as to transform the host and promote expression (e.g., transcription and translation) of the introduced sequence.
  • binding protein characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor.
  • ABSD first antigen-binding domain
  • ABS second antigen-binding domain
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide and comprising at least one CDR selected from SEQ ID NO: 1 to SEQ ID NO: 12, or a variant thereof with one or more conservative substitution(s); (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABSD first antigen-binding domain
  • a second antigen-binding domain comprising a variable region which binds specifically to a human NKp46 polypeptide
  • all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • the disclosure relates to a binding protein characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide and comprising at least one CDR selected from SEQ ID NO: 13 to SEQ ID NO: 40, or a variant thereof with one or more conservative substitution(s); and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABSD antigen-binding domain
  • ABSD second antigen-binding domain
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide and comprising at least one CDR selected from SEQ ID NO: 1 to SEQ ID NO: 12, or a variant thereof with one or more conservative substitution(s); and (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide and comprising at least one CDR selected from SEQ ID NO: 13 to SEQ ID NO: 40, or a variant thereof with one or more conservative substitution(s); and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABSD first antigen-binding domain
  • a second antigen-binding domain comprising a variable region which binds specifically to a human NKp46 polypeptide and comprising at least one CDR selected from
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide and comprising three CDRs selected from SEQ ID NO: 1 to SEQ ID NO: 12, or a variant thereof with one or more conservative substitution(s), and (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide and comprising three CDRs selected from SEQ ID NO: 13 to SEQ ID NO: 40, or a variant thereof with one or more conservative substitution(s), and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABSD first antigen-binding domain
  • a second antigen-binding domain comprising a variable region which binds specifically to a human NKp46 polypeptide and comprising three CDRs selected from SEQ ID
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) and an immunoglobulin light chain variable region (VL), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3 respectively), and (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and comprising an immunoglobulin light chain variable region (V L ), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3 respectively), and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABS first antigen-binding domain
  • V H immunoglobulin heavy chain variable region
  • VL immunoglobulin light
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) with three complementary determining regions, at least one being selected from SEQ ID NO: 1 to SEQ ID NO: 6, and an immunoglobulin light chain variable region (VL) with three complementary determining regions, at least one being selected from SEQ ID NO: 7 to SEQ ID NO: 12; (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) with three complementary determining regions at least one being selected from SEQ ID NO: 13 to SEQ ID NO: 26, and an immunoglobulin light chain variable region (VL) with three complementary determining regions at least one being selected from SEQ ID NO: 27 to SEQ ID
  • ABS first
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) with three complementary determining regions, at least two being selected from SEQ ID NO: 1 to SEQ ID NO: 6, and an immunoglobulin light chain variable region (V L ) with three complementary determining regions at least two being selected from SEQ ID NO: 7 to SEQ ID NO: 12; (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) with three complementary determining regions at least two being selected from SEQ ID NO: 13 to SEQ ID NO: 26, and an immunoglobulin light chain variable region (V L ) with three complementary determining regions at least two being selected from SEQ ID NO: 27 to SEQ
  • the binding protein is characterized in that it comprises: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) with three complementary determining regions, selected from SEQ ID NO: 1 to SEQ ID NO: 6, and an immunoglobulin light chain variable region (VL) with three complementary determining regions selected from SEQ ID NO: 7 to SEQ ID NO: 12; (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and comprising an immunoglobulin heavy chain variable region (V H ) with three complementary determining regions selected from SEQ ID NO: 13 to SEQ ID NO: 26, and an immunoglobulin light chain variable region (V L ) with three complementary determining regions selected from SEQ ID NO: 27 to SEQ ID NO: 40; and (iii) all or part of an immuno
  • the binding protein is characterized in that the first ABD binds specifically to human CD123 and comprises an immunoglobulin heavy chain variable domain (V H ) comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to SEQ ID NO: 6 respectively.
  • V H immunoglobulin heavy chain variable domain
  • the binding protein is characterized in that the first ABD binds specifically to human CD123 and comprises an immunoglobulin light chain variable domain (VL) comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to SEQ ID NO: 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10 to SEQ ID NO: 12 respectively.
  • VL immunoglobulin light chain variable domain
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 13 to SEQ ID NO: 15 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 16 to SEQ ID NO: 18 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 19 to SEQ ID NO: 21 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 22 to SEQ ID NO: 24 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin heavy chain variable domain (V H ) comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 16, SEQ ID NO: 25 and SEQ ID NO: 26 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin light chain variable domain (VL) comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 27 to SEQ ID NO: 29 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 30 to SEQ ID NO: 32 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin light chain variable domain (VL) comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 33 to SEQ ID NO: 35 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin light chain variable domain (VL) comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 36 to SEQ ID NO: 38 respectively.
  • the binding protein is characterized in that the second ABD binds specifically to human NKp46 and comprises an immunoglobulin light chain variable domain (V L ) comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 39, SEQ ID NO: 31 and SEQ ID NO: 40 respectively.
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain ( V H ) and an immunoglobulin light chain variable domain (V L ), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to SEQ ID NO: 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to SEQ ID NO: 9 respectively or corresponding to the amino acid sequence
  • the above described binding protein may consist of one single polypeptide chain, or be a multimeric binding protein, and hence comprise a plurality (two or more) polypeptide chains.
  • the binding protein is a multimeric binding protein, and the two antigen-binding domains may be born at least in part by distinct polypeptide chains.
  • the binding protein comprises a plurality of polypeptide chains, (e.g., two or three polypeptide chains), some of those polypeptide chains may be linked covalently.
  • the covalent linker(s) may advantageously be selected from disulfide bridges, or any other covalent linker, including peptide bond(s) bridging one polypeptide chain with another, and/or linker peptide(s) bridging one polypeptide chain with another.
  • the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) that form two ABDs: V 1A – C 1A – L3 – (C H 2-C H 3)A (I) V 1B – C 1B – L 4 – (C H 2-C H 3) B – L 1 – V 2A – C 2A – L 2 (II) V 2B – C 2B (III) wherein : V 1A and V 1B form a binding pair V1 (V H1 /V L1 ); V 2A and V 2B form a binding pair V 2 (V H2 /V L2 ); C 1A and C 1B form a pair C1 (C H 1/C L ) and C 2A and C 2B form a pair C 2 (C H 1/C L ) wherein C H 1 is an immunoglobulin heavy chain constant domain 1 and C L is an immunoglobulin light chain constant domain; (C H 2-
  • the (C H 2-C H 3) A and (C H 2-C H 3) B comprise each at least one identical C H 2 domain, such as a C H 2 domain corresponding to the amino acid sequence of SEQ ID NO: 71.
  • the (C H 2-C H 3)A and (C H 2-C H 3)B are identical or different and may comprise a polypeptide sequence selected from amino acid sequences of SEQ ID NO: 69 or SEQ ID NO: 70.
  • L1, L2, L3 and L4 may be identical or different, and may comprise all or part of an amino acid sequence selected from SEQ ID NO: 74 to SEQ ID NO: 79; for example, one or more than four consecutive amino acids of an amino acid sequence selected from SEQ ID NO: 74 to SEQ ID NO: 79.
  • L1, L2, L3 and L4 may be identical or different, and may comprise all or part of an immunoglobulin hinge region, such as one selected from amino acid sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79; for example four or more than four consecutive amino acids of an immunoglobulin hinge region, such as one selected from amino acid sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79.
  • an immunoglobulin hinge region such as one selected from amino acid sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79.
  • L 2 , L 3 and L 4 may be identical or different, and may comprise all or part of an immunoglobulin hinge region, such as one selected from sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79; for example, four or more than four consecutive amino acids of an immunoglobulin hinge region, such as one selected from sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79.
  • an immunoglobulin hinge region such as one selected from sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79.
  • L 2 , L 3 and L 4 may be identical or different, and may comprise all or part of an immunoglobulin hinge region, such as one selected from sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79 (for example four or more than four consecutive amino acids of an immunoglobulin hinge region, such as one selected from sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79), and L1 may comprise all or part of the linker which corresponds to the amino acid sequence of SEQ ID NO: 76.
  • an immunoglobulin hinge region such as one selected from sequences SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 78 and/or SEQ ID NO: 79
  • L1 may comprise all or part of the linker which corresponds to the amino acid sequence of SEQ
  • the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) that form two ABDs, as defined below: V 1A – C 1A – L 3 – (C H 2-C H 3)A (I) V 1B – C 1B – L 4 – (C H 2-C H 3) B – L 1 – V 2A – C 2A – L 2 (II) V 2B – C 2B (III) wherein: V 1A and V 1B form a binding pair V 1 (V H1 /V L1 ), which binds specifically to a human CD123 polypeptide; V 2A and V 2B form a binding pair V 2 (V H2 /V L2 ), which binds specifically to a human NKp46 polypeptide; C 1A and C 1B form a pair C 1 (C H 1/C L ) and C 2A and C 2B form a pair C 2 (C H 1/C L )
  • the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) that form two ABDs, as defined below: V 1A – C 1A – Hinge 1 – (C H 2-C H 3) A (I) V 1B – C 1B – Hinge2 – (C H 2-C H 3)B – L1 – V 2A – C 2A – Hinge3 (II) V 2B – C 2B (III) wherein : V 1A and V 1B form a binding pair V1 (V H1 /V L1 ); V 2A and V 2B form a binding pair V 2 (V H2 /V L2 ); C 1A and C 1B form a pair C1 (C H 1/C L ) and C 2A and C 2B form a pair C 2 (C H 1/C L ) wherein C H 1 is an immunoglobulin heavy chain constant domain 1 and C L is an immunoglobulin light chain
  • the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) that form two ABDs, as defined below: V 1A – C 1A – Hinge1 – (C H 2-C H 3)A (I) V 1B – C 1B – Hinge 2 – (C H 2-C H 3) B – L 1 – V 2A – C 2A – Hinge 3 (II) V 2B – C 2B (III) wherein : V 1A and V 1B form a binding pair V1 (V H1 /V L1 ) which binds specifically to a human CD123 polypeptide; V 2A and V 2B form a binding pair V 2 (V H2 /V L2 ) which binds specifically to a human NKp46 polypeptide; C 1A and C 1B form a pair C 1 (C H 1/C L ) and C 2A and C 2B form a pair C 2 (C H H 1/C
  • the polypeptide chains (I), (II) and (III) are characterized in that: C 1A comprises a C L domain; C 1B comprises a C H 1 domain; C 2A comprises a C H 1 domain; C 2B comprises a C L domain.
  • the polypeptide chains (I), (II) and (III) are characterized in that: C 1A comprises a C H 1 domain; C 1B comprises a C L domain; C 2A comprises a C L domain; C 2B comprises a C H 1 domain.
  • the polypeptide chains (I), (II) and (III) are characterized in that: C 1A comprises a C H 1 domain; C 1B comprises a C L domain; C 2A comprises a C H 1 domain; C 2B comprises a C L domain. According to some of those particular embodiments of the binding protein, the polypeptide chains (I), (II) and (III) are characterized in that: C 1A comprises a C L domain; C 1B comprises a C H 1 domain; C 2A comprises a C L domain; C 2B comprises a C H 1 domain.
  • C L and C H 1 domains which form C 1A , C 1B , C 2A , and C 2B may be identical or different.
  • the polypeptide chains (I), (II) and (III) are characterized in that: - C 1A and C 2A are identical and comprise a C L domain; or - C 1A and C 2B are identical and comprise a C L domain; or - C 1B and C 2A are identical and comprise a C L domain; or - C 1B and C 2B are identical and comprise a C L domain.
  • the polypeptide chains (I), (II) and (III) are characterized in that: - C 1A and C 2A are identical and comprise a C H 1 domain; or - C 1A and C 2B are identical and comprise a C H 1 domain; or - C 1B and C 2A are identical and comprise a C H 1 domain; or - C 1B and C 2B are identical and comprise a C H 1 domain.
  • V 1A is a V H and V 1B is a V L .
  • V 1A is a V L and V 1B is a V H .
  • V 2A is a V H and V 2B is a VL.
  • V 2A is a V L and V 2B is a V H .
  • V 1A is a V H and V 1B is a V L ; and V 2A is a V H and V 2B is a V L .
  • V 1A is a VL and V 1B is a VH; and V 2A is a V H and V 2B is a V L .
  • V 1A is a V H and V 1B is a V L ; and V 2A is a V L and V 2B is a V H .
  • V 1A is a VL and V 1B is a V H ; and V 2A is a V L and V 2B is a V H .
  • V 1A is V L1 and V 1B is V H1 ; and V 2A is V H2 and V 2B is V L2 . In some embodiment of the binding protein, V 1A is V L1 and V 1B is V H1 . In some embodiment of the binding protein, V 2A is V H2 and V 2B is V L2 .
  • the polypeptide chains (I), (II) and (III) are characterized in that: C 1B is an immunoglobulin heavy chain constant domain 1 (C H 1); C 2A is an immunoglobulin heavy chain constant domain 1 (C H 1); C L corresponds to an immunoglobulin kappa light chain constant domain (C ⁇ ); (C H 2-C H 3) A corresponds to the amino acid sequence of SEQ ID NO: 69; (C H 2-C H 3)B corresponds to the amino acid sequence of SEQ ID NO: 70; L2 or Hinge1 corresponds to the amino acid sequence of SEQ ID NO:74; L3 or Hinge2 corresponds to the amino acid sequence of SEQ ID NO:75; L4 or Hinge3 corresponds to the amino acid sequence of SEQ ID NO: 77.
  • L1 corresponds to the amino acid sequence of SEQ ID NO: 76.
  • the polypeptide chains (I), (II) and (III) are characterized in that: C 1B is an immunoglobulin heavy chain constant domain 1 (C H 1); C 2A is an immunoglobulin heavy chain constant domain 1 (C H 1); C L corresponds to an immunoglobulin kappa light chain constant domain (C ⁇ ); (C H 2-C H 3) A corresponds to the amino acid sequence of SEQ ID NO: 69 ; (C H 2-C H 3)B corresponds to the amino acid sequence of SEQ ID NO: 70; Hinge 1 corresponds to the amino acid sequence of SEQ ID NO:74; Hinge2 corresponds to the amino acid sequence of SEQ ID NO:75; Hinge3 corresponds to the amino acid sequence of SEQ ID NO: 77; L 1 corresponds to the amino acid sequence of SEQ ID NO: 76.
  • V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3;
  • V L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO:9;
  • V H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15;
  • V L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO:
  • V H1 and V L1 corresponds to the amino acid sequences of SEQ ID NO: 41 and 43 respectively or corresponds to the amino acid sequences of SEQ ID NO: 42 and 44 respectively; and/or (b) V H2 and V L2 corresponds to the amino acid sequences of SEQ ID NO: 45 and 53 respectively; the amino acid sequences of SEQ ID NO: 46 and 54 respectively; the amino acid sequences of SEQ ID NO: 47 and 55 respectively; the amino acid sequences of SEQ ID NO: 48 and 56 respectively; the amino acid sequences of SEQ ID NO: 49 and 57 respectively; the amino acid sequences of SEQ ID NO: 50 and 58 respectively; the amino acid sequences of SEQ ID NO: 51 and 59 respectively; or the amino acid sequences of SEQ ID NO: 52 and 60 respectively.
  • V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 45; V L2 comprises the amino acid sequence of SEQ ID NO: 53; (b) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 46; V L2 comprises the amino acid sequence of SEQ ID NO: 54; (c) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 47; V L2 comprises the amino acid sequence of SEQ ID NO: 55; (d) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 45; V L2 comprises the
  • the binding protein comprises at least two polypeptide chains linked by at least one disulfide bridge.
  • polypeptide chains (I), (II) and (III) are characterized in that: polypeptide chain (I) is covalently linked to polypeptide chain (II), in particular covalently liked to polypeptide (II) by one or more disulfide bonds.
  • polypeptide chain (II) is covalently linked to polypeptide chain (III), by one or more disulfide bonds.
  • the polypeptide chains (I) and (II) are linked by at least one disulfide bridge between C 1A and Hinge2 and/or wherein the polypeptide chains (II) and (III) are linked by at least one disulfide bridge between Hinge3 and C 2B .
  • the binding protein is characterized in that the Fc region or variant thereof (e.g.
  • the binding protein which binds to a human Fc- ⁇ receptor polypeptide, comprises a C H 2 heavy chain constant domain with a N-linked glycosylation at residue N297 according to EU numbering.
  • the binding protein is characterized in that the residue N297 of the Fc region or variant thereof according to EU numbering comprises a N-linked glycosylation.
  • the binding protein is characterized in that all or part of the Fc region or variant thereof binds to a human Fc- ⁇ receptor polypeptide.
  • the binding protein is characterized in that all or part of the Fc region or variant thereof binds to a human CD16A (Fc ⁇ RIII) polypeptide.
  • the binding protein comprises: - a polypeptide comprising an amino acid sequence of SEQ ID NO: 61, a polypeptide comprising an amino acid sequence of SEQ ID NO: 62 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 63, or a variant thereof with at least 80% of sequence identity; or - a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, a polypeptide comprising an amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 66 or a variant thereof with at least 80% of sequence identity; and/or - a polypeptide comprising an amino acid sequence of SEQ ID NO: 61 or 64, a polypeptide comprising an amino acid sequence of SEQ ID NO: 62 or 65 and a
  • the binding protein comprises: - a polypeptide comprising an amino acid sequence SEQ ID NO: 61, a polypeptide comprising an amino acid sequence SEQ ID NO: 62 and a polypeptide comprising an amino acid sequence SEQ ID NO: 63 or a variant thereof with at least 80% of sequence identity; or - a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, a polypeptide comprising an amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 66 or a variant thereof with at least 80% of sequence identity.
  • the binding protein comprises: a polypeptide comprising an amino acid sequence of SEQ ID NO: 61, a polypeptide comprising a sequence SEQ ID NO: 62 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 63 or a variant thereof with at least 80% of sequence identity.
  • the binding protein comprises: a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, a polypeptide comprising an amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 66 or a variant thereof with at least 80% of sequence identity.
  • the binding protein comprises: a polypeptide comprising an amino acid sequence of SEQ ID NO: 61, a polypeptide comprising an amino acid sequence of SEQ ID NO: 62 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 63 or a variant thereof with at least 90% of sequence identity.
  • the binding protein comprises: a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, a polypeptide comprising a amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 66 or a variant thereof with at least 90% of sequence identity.
  • the binding protein comprises: a polypeptide comprising an amino acid sequence of SEQ ID NO: 61, a polypeptide comprising an amino acid sequence of SEQ ID NO: 62 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 63 or a variant thereof with at least 95% of sequence identity.
  • the binding protein comprises: a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, a polypeptide comprising a amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising an amino acid sequence of SEQ ID NO: 66 or a variant thereof with at least 95% of sequence identity.
  • the binding protein comprises: a polypeptide (I) comprising an amino acid sequence of SEQ ID NO: 61, a polypeptide (II) comprising an amino acid sequence of SEQ ID NO: 62 and a polypeptide (III) comprising an amino acid sequence of SEQ ID NO: 63.
  • the binding protein comprises: - polypeptide (I) consisting of an amino acid sequence of SEQ ID NO: 61; - polypeptide (II) consisting of an amino acid sequence of SEQ ID NO: 62; and - polypeptide (III) consisting of an amino acid sequence of SEQ ID NO: 63.
  • the binding protein comprises: a polypeptide (I) comprising an amino acid sequence of SEQ ID NO: 64, a polypeptide (II) comprising an amino acid sequence of SEQ ID NO: 65 and a polypeptide (III) comprising an amino acid sequence of SEQ ID NO: 66.
  • the binding protein comprises: - polypeptide (I) consisting of an amino acid sequence of SEQ ID NO: 64; - polypeptide (II) consisting of an amino acid sequence of SEQ ID NO: 65; and - polypeptide (III) consisting of an amino acid sequence of SEQ ID NO: 66.
  • the binding protein comprises polypeptide sequences derived from immunoglobulins chains (in particular immunoglobulins of the IgG type), and/or amino acid sequences selected from any one of SEQ ID NO: 1 to SEQ ID NO: 79, which may thus include any variant sequence with conservative substitutions, and/or any variant with a degree of percent sequence identity with a reference sequence; especially a reference sequence derived from an immunoglobulin chain.
  • the binding protein comprises polypeptide sequences derived from immunoglobulins chains of the IgG type, in particular of the IgG1, IgG2, IgG3 or IgG4 type, preferably of the IgG1 type.
  • variants of Fc and constant regions and non-CDRs polypeptide sequences from a variable region may consist of Fc and constant regions and non-CDRs polypeptide sequences having at least 80% of sequence identity with a reference polypeptide sequence; more particularly having at least 90% of sequence identity with a reference polypeptide sequence; and preferably having at least 95% of sequence identity with a reference polypeptide sequence.
  • variants of polypeptide sequences include CDR polypeptide sequences (e.g., CDR1, CDR2, and CDR3 from either one of a VH or VL domain), it will be understood herein that those variants do not have modifications on their CDR polypeptide sequences.
  • the binding protein comprises an amino acid sequence having at least 80% of sequence identity with an amino acid sequence selected from SEQ ID NO: 67 to 73. In some embodiments, the binding protein comprises a amino acid sequence having at least 90% of sequence identity with an amino acid sequence selected from SEQ ID NO: 67 to 73. In some embodiments, the binding protein comprises an amino acid sequence having at least 95% of sequence identity with an amino acid sequence selected from SEQ ID NO: 67 to 73. In some embodiments, the binding protein comprises a Fc region or variant thereof having at least 80% of sequence identity with an amino acid sequence selected from SEQ ID NO: 69 to 73.
  • the binding protein comprises a Fc region or variant thereof having at least 90% of sequence identity with an amino acid sequence selected from SEQ ID NO: 69 to 73. In some embodiments, the binding protein comprises a Fc region or variant thereof having at least 95% of sequence identity with an amino acid s sequence selected from SEQ ID NO: 69 to 73.
  • the binding protein comprises a Fc region or variant thereof with a C H 2-C H 3 domain having at least 80% of sequence identity with an amino acid sequence selected from SEQ ID NO: 69 or 70; or alternatively comprises a Fc region or variant thereof with a C H 2 domain having at least 80% of sequence identity with an amino acid sequence of SEQ ID NO: 71; or alternatively comprises a Fc region or variant thereof with a C H 3 domain having at least 80% of sequence identity with an amino acid sequence of SEQ ID NO: 72 or 73.
  • the binding protein comprises a Fc region or variant thereof with a C H 2-C H 3 domain having at least 90% of sequence identity with an amino acid sequence selected from SEQ ID NO: 69 or 70; or alternatively comprises a Fc region or variant thereof with a C H 2 domain having at least 90% of sequence identity with an amino acid sequence SEQ ID NO: 71; or alternatively comprises a Fc region or variant thereof with a C H 3 domain having at least 90% of sequence identity with an amino acid sequence of SEQ ID NO: 72 or 73.
  • the binding protein comprises a Fc region or variant thereof with a C H 2-C H 3 domain having at least 95% of sequence identity with an amino acid sequence selected from SEQ ID NO: 69 or 70; or alternatively comprises a Fc region or variant thereof with a C H 2 domain having at least 95% of sequence identity with an amino acid sequence of SEQ ID NO: 71; or alternatively comprises a Fc region or variant thereof with a CH3 domain having at least 95% of sequence identity with an amino acid sequence of SEQ ID NO: 72 or 73.
  • the multispecific binding proteins of the present disclosure are bispecific binding proteins.
  • the disclosure further relates to a pharmaceutical composition comprising a binding protein as defined above, and a pharmaceutically acceptable carrier.
  • the disclosure relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a binding protein, and a pharmaceutically acceptable carrier, said binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABSD first antigen-binding domain
  • ABS second antigen-binding domain
  • Fc immunoglobulin fragment crystallizable
  • the disclosure relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the binding protein defined above, and a pharmaceutically acceptable carrier, said binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (VL), wherein each V H and VL comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding
  • the disclosure relates to a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region which binds to a human Fc- ⁇ receptor polypeptide; for use as a medicament.
  • ABS first antigen-binding domain
  • ABS second antigen-binding domain
  • Fc immunoglobulin fragment crystallizable
  • the disclosure relates to a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region which binds to a human Fc- ⁇ receptor polypeptide; for use in a method for the treatment or prevention of cancer.
  • ABS first antigen-binding domain
  • ABS second antigen-binding domain
  • Fc immunoglobulin fragment crystallizable
  • the disclosure relates to a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region which binds to a human Fc- ⁇ receptor polypeptide; for use in a method for the treatment or prevention of blood cancer.
  • a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc)
  • the disclosure relates to a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region which binds to a human Fc- ⁇ receptor polypeptide; for use in a method for the treatment or prevention of a myelodysplastic syndrome (MDS) or of a lymphoproliferative disorder.
  • ABS myelodysplastic syndrome
  • the disclosure relates to a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region which binds to a human Fc- ⁇ receptor polypeptide; for use in a method for the treatment or prevention of Acute Myeloid Leukemia (AML).
  • AML Acute Myeloid Leukemia
  • the disclosure relates to a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin fragment crystallizable (Fc) region which binds to a human Fc- ⁇ receptor polypeptide; for use in a method for the treatment or prevention of CD64-positive and CD64-negative Acute Myeloid Leukemia (AML).
  • AML Acute Myeloid Leukemia
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (VL), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10 to 12 respectively; (ii) the first ABD
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (VL), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10 to 12 respectively; (ii) the first ABD
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (V L ), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10 to
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (V L ), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (VL), wherein each V H and VL comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences SEQ ID NO: 10 to 12 respectively
  • the disclosure relates to a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (V H ) and an immunoglobulin light chain variable domain (V L ), wherein each V H and V L comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a V H1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a V L1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament.
  • the disclosure further relates to a use of the above-mentioned binding proteins as a medicament.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of cancer.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of cancer characterized by tumor cells that express CD123 at their surface.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of cancer characterized by tumor cells that express CD123 and CD64 at their surface.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of blood cancer.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of blood cancer characterized by tumor cells that express CD123 at their surface.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of blood cancer characterized by tumor cells that express CD123 and CD64 at their surface.
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of a myelodysplastic syndrome (MDS) or of a lymphoproliferative disorder.
  • MDS myelodysplastic syndrome
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of Acute Myeloid Leukemia (AML).
  • the disclosure further relates to a use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of CD64-positive and CD64- negative Acute Myeloid Leukemia (AML).
  • a method for treating a cancer characterized by tumor cells that express CD123 and CD64 at their surface comprising administering to and individual having such cancer a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a CD123-expressing tumor e.g.
  • a hematological malignancy in an individual who is susceptible to having tumor cells that express CD64 at their surface
  • the method comprising administering to the individual a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part
  • AML in an individual, the method comprising administering to the individual a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc
  • a method of treating a hematological malignancy comprising: (a) assessing or determining whether malignant cells (e.g. AML cells) from the individual express CD64 at their surface; and (b) if the individual is determined to have malignant cells (e.g., AML cells) expressing CD64 at their surface (e.g., at a predetermined level), administering to the individual a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which bind
  • a method for depleting malignant cells in an individual, and/or directing NK cell-mediated cytotoxicity toward CD64-expressing malignant cells comprising administering, to an individual having malignant cells (e.g.
  • AML cells expressing CD64 at their surface, a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a method of causing NK cells to eliminate malignant cells that express both CD123 and CD64 comprising bringing the malignant cells (e.g.
  • AML cells into contact, in the presence of NK cells, with a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds to a human NKp46 polypeptide, and (iii) all or part of an Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a binding protein comprising: (i) a first antigen-binding domain (ABD) comprising a variable region which binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds to a human NKp46 polypeptide, and (iii) all or part of an Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • a biological sample from an individual can be obtained and assessed and expression of CD64 in tumor cells can be determined using assays such as immunohistochemistry (IHC) assays, fluorescence activated cell sorting (FACS) assays, for example quantitative FACS, ELISA, immunoblotting (e.g., western blotting, dot blotting, or in-cell western blotting), and other immunoassays.
  • assays such as immunohistochemistry (IHC) assays, fluorescence activated cell sorting (FACS) assays, for example quantitative FACS, ELISA, immunoblotting (e.g., western blotting, dot blotting, or in-cell western blotting), and other immunoassays.
  • Anti-CD64 antibodies for use in such assays are available in the art.
  • Means for making the binding protein Means for making the binding protein of the present disclosure in vitro are further disclosed herein.
  • a “binding protein of present disclosure” refers to multifunctional binding proteins comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein the first ABD binds specifically to human CD123 and the second ABD binds specifically to human NKp46 and wherein all or part of the immunoglobulin Fc region or variant thereof to a human Fc- ⁇ receptor. It also refers to all particular embodiments of the binding protein which are described throughout the disclosure.
  • the provided means may refer to the making of a binding protein comprising a first and a second antigen binding domains (ABDs) and all or part of an immunoglobulin Fc region or variant thereof, wherein each of said ABDs comprises an immunoglobulin heavy chain variable domain (VH) and an immunoglobulin light chain variable domain (VL), wherein each VH and VL comprises three complementary determining regions (CDR-1 to CDR-3); and wherein: (i) the first ABD binds specifically to human CD123 and comprises: - a VH1 comprising a CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO:1 to 3 respectively or corresponding to the amino acid sequences of SEQ ID NO: 4 to 6 respectively, and - a VL1 comprising a CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to 9 respectively or corresponding to the amino acid sequences of SEQ ID NO: 10 to 12 respectively; (ii)
  • the disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a binding protein of the present disclosure.
  • the disclosure relates to an expression vector comprising a nucleic acid molecule comprising a nucleotide sequence that encodes the binding protein of the present disclosure.
  • the disclosure relates to an isolated cell comprising the nucleic acid molecules of the present disclosure.
  • the disclosure relates to an isolated cell comprising the expression vector of the present disclosure.
  • the cell is an eukaryotic cell, in particular an insect cell or a mammalian cell.
  • the cell is a mammalian cell and the expression vector is a mammalian expression vector.
  • the disclosure relates to a method for making the binding protein of the present disclosure, comprising a step of making a binding protein comprising (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide.
  • ABS first antigen-binding domain
  • ABS second antigen-binding domain
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing one or more recombinant polypeptide(s) comprising (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and/or (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and/or (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide; (b) optionally recovering the expressed recombinant polypeptide(s).
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing one or more recombinant polypeptide(s) comprising (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide; (b) optionally recovering the expressed recombinant polypeptide(s).
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing a plurality of recombinant polypeptides, said plurality comprising (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide; (b) optionally recovering the expressed recombinant polypeptides.
  • ABS antigen-binding domain
  • ABS second antigen-binding domain
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing a plurality of recombinant polypeptides, said plurality comprising (i) a polypeptide comprising an amino acid sequence of SEQ ID NO: 61 or 64, and (ii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the expressed recombinant polypeptides.
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing a plurality of recombinant polypeptides, said plurality comprising (i) a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, and (ii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 65, and (iii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 66; (b) optionally recovering the expressed recombinant polypeptides.
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for co-expressing a plurality of recombinant polypeptides, said plurality comprising (i) a polypeptide comprising an amino acid sequence of SEQ ID NO: 61 or 64, and (ii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the co-expressed recombinant polypeptides.
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for co-expressing a plurality of recombinant polypeptides, said plurality comprising (i) a polypeptide comprising an amino acid sequence of SEQ ID NO: 64, and (ii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 65, and (iii) a polypeptide comprising an amino acid sequence of SEQ ID NO: 66; (b) optionally recovering the expressed recombinant polypeptides.
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing a plurality of recombinant polypeptides, said plurality comprising (i) a first polypeptide chain (I), (ii) a second polypeptide chain (II), and (iii) a third polypeptide (III), that form two antigen- binding domains (ABD), one ABD which binds specifically to a human CD123 polypeptide and the one other ABD which binds specifically to a human NKp46 polypeptide; characterized in that it the three polypeptide chains (I), (II) and (III) consist of: V 1A – C 1A – L 3 – (C H 2-C H 3)A (I) V 1B – C 1B – L 4 – (C H 2-C H 3) B – L 1 – V 2A – C 2A – L 2 (
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for co-expressing a plurality of recombinant polypeptides, said plurality comprising (i) a first polypeptide chain (I), (ii) a second polypeptide chain (II), and (iii) a third polypeptide (III), that form two antigen- binding domains (ABD), one ABD which binds specifically to a human CD123 polypeptide and the one other ABD which binds specifically to a human NKp46 polypeptide; characterized in that it the three polypeptide chains (I), (II) and (III) consist of: V 1A – C 1A – L 3 – (C H 2-C H 3) A (I) V 1B – C 1B – L 4 – (C H 2-C H 3)B– L1 – V 2A – C 2A – L2 (
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for expressing a plurality of recombinant polypeptides, said plurality comprising (i) a first polypeptide chain (I) comprising an amino acid sequence of SEQ ID NO: 61 or 64, (ii) a second polypeptide chain (II) comprising an amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a third polypeptide (III) comprising an amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the expressed polypeptide chains (I), (II) and (III).
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) culturing host cell(s) under conditions suitable for co-expressing a plurality of recombinant polypeptides, said plurality comprising (i) a first polypeptide chain (I) comprising an amino acid sequence of SEQ ID NO: 61 or 64, (ii) a second polypeptide chain (II) comprising an amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a third polypeptide (III) comprising an amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the co-expressed polypeptide chains (I), (II) and (III).
  • Methods for making the binding protein of the disclosure may further include a prior step of providing host cell(s) with a nucleic acid, in particular an isolated nucleic acid (i.e., a recombinant nucleic acid), encoding all or part(s) of the said binding protein.
  • a prior step of providing host cell(s) with a nucleic acid, in particular an isolated nucleic acid (i.e., a recombinant nucleic acid), encoding all or part(s) of the said binding protein.
  • such step may comprise or consist of transfecting said host cell(s) with a nucleic acid, in particular an isolated nucleic acid, encoding all or part(s) of the said binding protein.
  • the disclosure relates to a method for making the binding protein, comprising a step of: (a) providing host cell(s) with a nucleic acid encoding all or part(s) of the said binding protein; (b) culturing said host cell(s) under conditions suitable for expressing one or more recombinant polypeptide(s) comprising (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, and/or (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, and/or (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide; (c) optionally recovering the expressed recombinant polypeptide(s).
  • ABS antigen-binding domain
  • ABS second antigen-binding domain
  • the method for making the binding protein of the present disclosure comprises a step of (a) providing one or more nucleic acid(s) encoding a first polypeptide chain (I), a second polypeptide chain (II), and a third polypeptide chain (III); (b) transfecting host cell(s) with the one or more nucleic acid(s); (c) culturing the host cell(s) under conditions suitable to express (or co-express) the said polypeptide chain(s); and (d) optionally recovering the expressed (or co-expressed) polypeptide chain(s) (I), (II) and (III).
  • the method for making the binding protein of the present disclosure comprises a step of (a) providing one or more nucleic acid(s) encoding a first polypeptide chain (I) comprising an amino acid sequence of SEQ ID NO: 61 or 64, a second polypeptide chain (II) comprising an amino acid sequence of SEQ ID NO: 62 or 65, and a third polypeptide chain (III) comprising an amino acid sequence of SEQ ID NO: 63 or 66; (b) transfecting host cell(s) with the one or more nucleic acid(s); (c) culturing the host cell(s) under conditions suitable to express (or co-express) the said polypeptide chain(s); and (d) optionally recovering the expressed (or co-expressed) polypeptide chain(s) (I), (II) and (III).
  • a method of making the binding protein of the present disclosure comprises: (a) providing a first nucleic acid encoding a first polypeptide chain according to any of amino acid sequences of SEQ ID NO: 61 or 64, a second nucleic acid encoding a second polypeptide according to any of amino acid sequences of SEQ ID NO: 62 or 65, and a third nucleic acid encoding a third polypeptide chain according to any of amino acid sequences of SEQ ID NO: 63 or 66; and (b) expressing said first, second and third nucleic acids in the one or more host cell(s) to produce a binding protein comprising said first, second and third polypeptide chains, respectively; (c) optionally loading the protein produced onto an affinity purification support, optionally a Protein-A support, and recovering the binding protein.
  • such method of making the binding protein of the disclosure may encompass the production and assembly of some or all of the above-mentioned polypeptides, polypeptide chains and/or regions (e.g. variable regions and Fc region or variants thereof) within one or more host cell(s), as part of an in vitro method of production.
  • the method may encompass the production of some or all of the above-mentioned polypeptides, polypeptide chains and/or regions within one or more host cell(s), and their assembly outside of the host cell(s).
  • the step of bringing into contact said polypeptides, polypeptide chains and/or regions can thus be achieved simultaneously or sequentially.
  • one or more of said regions may be present in distinct polypeptide chain(s) or fragments thereof.
  • the “F25” format of binding proteins which is described herein in the examples section possesses four predicted interchain disulfide bridges: - one disulfide bridge connecting a cysteine within the C L domain of polypeptide (I) to the first cysteine within the Hinge region of polypeptide chain (II); - two disulfide bridges connecting two cysteines within the Hinge regions of polypeptide chain (I) and (II); - one disulfide bridge connecting a C-terminal cysteine at the C L domain of polypeptide chain (III) to a C-terminal cysteine on polypeptide chain (II).
  • the disclosure relates to a method for making the binding protein of the present disclosure, comprising a step of bringing into contact (i) a first antigen- binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, said variable region comprising at least one complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 1 to 12, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, said variable region comprising at least one complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 13 to 40 and (iii) all or part of a Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide, especially which binds to a human CD16a Fc- ⁇ receptor polypeptide.
  • a first antigen- binding domain comprising a variable region which binds specifically to
  • the disclosure relates to a method for making the binding protein of the present disclosure, comprising a step of bringing into contact (i) a first antigen- binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, said variable region comprising at least one complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 1 to 6 and at least one complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 7 to 12, (ii) a second antigen-binding domain (ABD) comprising a variable region suitable which binds specifically to a human NKp46 polypeptide, said variable region comprising at least one complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 13 to 26 and at least one complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 27 to 40, and (iii) all or part
  • the disclosure relates to a method for making the binding protein of the present disclosure, comprising a step of bringing into contact (i) a first antigen- binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, said variable region comprising at least two complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 1 to 6 and at least two complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 7 to 12, (ii) a second antigen-binding domain (ABD) comprising a variable region which binds specifically to a human NKp46 polypeptide, said variable region comprising at least two complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 13 to 26 and at least two complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 27 to 40, and (iii) all or part
  • the disclosure relates to a method for making the binding protein related to the present disclosure, comprising a step of bringing into contact (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, said variable region comprising three complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 1 to 6 and three complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 7 to 12, (ii) a second antigen- binding domain (ABD) comprising variable region which binds specifically to a human NKp46 polypeptide, said variable region comprising three complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 13 to 26 and three complementary determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NO: 27 to 40, and (iii) all or part of an immunoglobulin Fc region
  • the disclosure relates to a method for making the binding protein related to the present disclosure, comprising a step of bringing into contact (i) a first antigen-binding domain (ABD) comprising a variable region which binds specifically to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region suitable which binds specifically to a human NKp46 polypeptide, and (iii) all or part of an immunoglobulin Fc region or variant thereof which binds to a human Fc- ⁇ receptor polypeptide, especially which binds to a human CD16 Fc- ⁇ receptor polypeptide; characterized in that the step of bringing into contact said regions comprises bringing into contact a plurality of polypeptide chains selected from of amino acid sequences SEQ ID NO: 61 to 66.
  • All or parts of the above-mentioned antigen-binding domain(s) and immunoglobulin Fc region or variant thereof may be expressed in vitro, through recombinant means, in an isolated cell or population of cells, in particular in a eukaryotic cell, and preferably in a mammalian or insect cell. Most preferably, the expression system relates to a mammalian cell. According to alternative embodiments, parts of the above-mentioned antigen- binding domain(s) and Fc region or variant thereof may be expressed in a first population of isolated cells, whereas other parts of the above-mentioned antigen-binding domain(s) and Fc region or variant thereof may be expressed in a second population of isolated cells.
  • the method for making the binding protein may comprise the steps of : (a) expressing at least one of said first antigen-binding domain and/or said second antigen-binding domain and/or said all or part of immunoglobulin Fc region or variant thereof in an isolated cell or population of cells, most preferably in a mammalian cell; (b) recovering said first antigen-binding domain and/or said second antigen- binding domain and/or said all or part of Fc region or variant thereof.
  • the disclosure relates to a method for making the binding protein related to the present disclosure, which comprises the steps of : (a) expressing at least one of said first antigen-binding domain and/or said second antigen-binding domain and/or said all or part of Fc region or variant thereof in an isolated cell or population of cells, most preferably in a mammalian cell; (b) recovering said first antigen-binding domain and/or said second antigen- binding domain and/or said all or part of Fc region or variant thereof; (c) bringing into contact the said first antigen-binding domain and/or said second antigen-binding domain and/or said all or part of Fc region or variant thereof, steps (b) and (c) being achieved simultaneously or sequentially.
  • the method for making the binding protein comprises the steps of : (a) expressing said first antigen-binding domain and said second antigen-binding domain and said all or part of immunoglobulin Fc region or variant thereof in an isolated cell; (b) recovering said first antigen-binding domain and said second antigen-binding domain and said all or part of immunoglobulin Fc region or variant thereof; (c) bringing into contact the said first antigen-binding domain and said second antigen-binding domain and said all or part of immunoglobulin Fc region or variant thereof, steps (b) and (c) being achieved simultaneously or sequentially.
  • the said first antigen-binding domain and said second antigen-binding domain and said all or part of immunoglobulin Fc region or variant thereof when expressed in the same isolated cell or population of cells and/or the same cell culture thereof, they may be brought into contact during the recovery step, thereby making the binding protein.
  • the said first antigen-binding domain and/or said second antigen-binding domain and/or said all or part of immunoglobulin Fc region or variant thereof are expressed in different isolated cells or population of cells, they may be brought into contact after the recovery step.
  • the recovery step may consist of any method known in the Art.
  • the recovery of the expressed polypeptides bearing all or part of the antigen-binding domain(s) and Fc region or variant thereof may comprise the following steps: (b1) recovering the isolated cell or cell culture thereof, (b2) optionally centrifugating, depth filtering, membrane filtering, ultrafiltering and/or diafiltering the isolated cell or cell culture thereof.
  • the left-hand direction is the amino terminal direction (the “N terminus” or “N-term”) and the right-hand direction is the carboxyl- terminal direction (the “C terminus” or “C-term”), in accordance with standard usage and convention.
  • NKp46-CD123 NKCE expression by transient transfection of EXPI-293F TM cells The sequences encoding each polypeptide chain of NKp46-CD123_F25 binding proteins of the present disclosure were inserted into the pTT-5 vector between the HindIII and BamHI restriction sites. The three vectors (made as endotoxin-free midipreps) were used to cotransfect EXPI-293F cells (Life Technologies) in the presence of PEI (37°C, 5% CO2, 150 rpm). The cells were used to seed culture flasks at a density of 1 x 106 cells per ml (EXPI293 medium, Gibco).
  • NKp46-CD123_F25 binding protein we used a DNA ratio of 0.1 ⁇ g/ml (polypeptide chain I), 0.4 ⁇ g/ml (polypeptide chain II), or 0.8 ⁇ g/ml (polypeptide chain III). Valproic Acid (final concentration 0.5 mM), glucose (4 g/L) and tryptone N1 (0.5%) were added. The supernatant was harvested after six days after and passed through a Stericup filter with 0.22 ⁇ m pores. A.2. Purification of NKCEs.
  • NKp46-CD123_F25 binding proteins of the present disclosure were purified from the supernatant following harvesting using rProtein A Sepharose Fast Flow (GE Healthcare, reference 17-1279-03).
  • a Cation Ion Exchange Chromatography (CIEX) purification was then performed after dialysis of the sample in a Na 2 HPO 4 /KH 2 PO 4 50mM pH 6.2 phosphate buffer.
  • CIEX Cation Ion Exchange Chromatography
  • the starting and the elution buffers were respectively Na 2 HPO 4 /KH 2 PO 4 50mM pH 6.2 and Na 2 HPO 4 /KH 2 PO 4 25mM pH 6.2; 1M NaCl.
  • the elution was performed using a linear gradient from 0% to 50% (elution buffer) on 100 CV.
  • the peak of interest is finally dialyzed against PBS1X, overnight at 4°C under agitation.
  • A.3. Biological samples Healthy Human buffy coats were provided by the Etablatorium für du Sang (EFS, Marseille; AC-2019-3428).
  • Peripheral mononuclear cells (PBMC) were isolated from buffy coats by using Ficoll density gradient centrifugation.
  • Human NK cells were purified from PBMC by using beads-based negative selection kit from StemCell or Miltenyi.
  • Acute myeloid leukemia (AML) samples from patients were provided by Institut Paoli-Calmettes (Marseille, SA-IPH-MImAbs Contract).
  • Cell lines CD123 expressing Acute myeloid leukemia (AML) cell line: MOLM-13 and THP-1 were purchased at ATCC.
  • Cells were cultured in complete RPMI medium (RPMI-1640 containing 10 % FBS, 2 mM L-Glutamine, 1 mM Sodium pyruvate and non-essential amino- acids 1X).25mM HEPES were added in the culture medium for THP-1 cells.
  • THP-1 CD64KO and THP-1 CD32KO cells were generated with CRISPR/Cas endonucleases.
  • THP-1 cells were cultured in RPMI-1640, 10%SVF, 2mM L-Glu, 1mM sodium pyruvate, 0.1mM non-essential amino acid.
  • CD64 deficient THP-1 cells 2,5.106 cells were nucleofected (Neon Transfection System, 100ul tip, 1700V, 20ms, 1 pulse) with two sgRNAs (CD64.1: CUUGAGGUGUCAUGCGUGGA (SEQ ID NO: 80); CD64.2: AAGCAUCGCUACACAUCAGC (SEQ ID NO: 81; Synthego) at a CAS9:sgRNA ratio of 1:9 (Alt-RTM S.p. Cas9 Nuclease 3NLS, Integrated DNA Technology). Lack of CD64 expression was monitored by flow cytometry and cells were either sorted or sub-cloned.
  • THP-1-knockout (KO) THP-1 cells 2.5.10 6 cells were nucleofected (Neon Transfection System, 100 ⁇ L tip, 1700 V, 20 ms, 1 pulse) with a couple of sgRNAs (CD32A: AUGUAUGUCCCAGAAACCUG ; CD32B: AAGCAUAUGACCCCAAGGCU (Integrated DNA Technologies)) at a CAS9:sgRNA ratio of 1:9 (Alt-RTM S.p. Cas9 Nuclease 3NLS, Integrated DNA Technology).
  • the THP-1 CD32KO cells were cell sorted only. Following cell sorting, absence of CD32 expression was monitored by flow cytometry. A.5.
  • NK cell-based cytotoxic assay Target cells were loaded with 51 Cr (for MOLM-13, THP-1 or THP-1 CD64KO, THP- 1 CD32KO cells) or with CalceinAM (Life technologies, ref: C3100MP or equivalent) for AML blasts from patient samples.
  • Tested antibodies, labelled target cells and fresh or overnight-rested human NK cells from healthy donors were successively added in each well of round bottom 96-well plates to obtain a 10:1 (E:T) ratio. After 4h of co-incubation, the supernatant was transferred into a Lumaplate (for 51 Cr) or into a flat bottom culture plate (for CalceinAM).
  • Phenotyping AML cells The expression of CD32, CD64 and CD123 on AML samples derived from patient blood and on AML cell lines was controlled by flow cytometry using Anti-human CD33- BB515 (BD Biosciences 564588 Clone WM53), Anti-human CD45-Viogreen (Miltenyi 130-096-906 Clone 5B1), Anti-human CD123-AF647 (BD Biosciences 563599 Clone 9F5), Anti-human CD32-PE (Beckman Coulter IM1935 Clone 2E1), Anti-human CD64-PE (Beckman Coulter IM3601U Clone 22), Anti-human CD123-PE (Biolegend 306006 Clone 6H6), and cognate isotype control antibodies mIgG1-PE (IC-1 ; BD Biosciences 555749 Clone MOPC-21), and mIgG2a-PE (IC-2a ; Beckman Coulter A09142 Clone 7T4-1F5).
  • Target cells were saturated with normal mouse serum diluted at 1/10e in staining buffer (SB) and then mix with antibodies coupled to dyes. Cells were fixed in BD Cellfix diluted at 1/10e in H2O during 30 min after staining and analyzed by flow cytometry with a FACS Canto II.
  • FSC-A, FSC-H, SSC-A, SSC-H, FL2-A, FL4-A and FL7-A or FSC-A, FSC-H, SSC-A, SSC-H, FL1-A, FL2-A, FL3-A, FL5-A and FL8-A (for AML samples derived from patient blood) parameters were recorded and the analyses were done with FlowJo software.
  • NK cell degranulation assay with AML samples
  • AML blast and autologous NK cells derived from AML patients were successively added in each well of round bottom 96-well plates. After overnight co-incubation with the NKp46-CD123_F25 binding proteins of the present disclosure, anti-human CD107a and CD107b antibodies were added in each well for 4 hours.
  • Cells were then washed and stained with the following mix: markers of viability, APC-coupled anti-human CD45, BB515-coupled anti-human CD33, PeCy7-coupled anti-human CD56, BV510-coupled anti-human CD3 antibodies. Cells were then washed, fixed and analyzed by flow cytometry. Obtained data were analyzed by using Flowjo Software to analyze NK cell degranulation through the expression of CD107 on NK cells identified as alive CD45 + CD33-CD56 + CD3- cells.
  • NKp46-CD123_F25 binding proteins In order to test NK cell activation and cytokine/chemokine production towards MOLM-13 cells via NKp46-CD123_F25 binding proteins as in Figure 17, flow cytometric analysis was performed using the following antibody markers: CD69, CD107a/b, IFN ⁇ , TNF ⁇ , MIP1 ⁇ .
  • purified primary human NK cells from three separate donors were co-incubated with or without MOLM-13 cells at a 1:1 ratio (seeded at 50,000 cells/well; U bottom 96- well plate) for 4 h at 37°C, in the presence of increasing concentrations of NKp46- CD123_F25 or controls (NKp46-IC_F25 and no antibody).
  • BD GolgiSTOP TM was added to both experimental and control samples at a final dilution of 1/6000 in each well.
  • a positive control of NK cell activation was performed by using 125 ng/mL final of PMA and 1 ⁇ g/mL final of IONO added on 50,000 resting NK cells by well (data not shown).
  • antibody mixtures were centrifuged at 16,000 g for 10 min at 4°C, washed, and resuspended in sample buffer.
  • Flow cytometry was performed on a LSR FortessaTM X-20, equipped with BD FACSDiva acquisition software measuring FSC-A, FSC-H, SSC-A, SSC-H, FL-1, FL-3, FL-6, FL-7, FL-9, FL-13 and FL-16 parameters. All data were analyzed with FlowJo software. Marker percent of NK cell sample was done using GraphPad prism. Top of activation values corresponded to the observed maximum activation.
  • Half maximal effective concentration (EC 50 ) values were calculated using 4 parameter logistics non-linear regression model corresponding to the following equation: Calculated bottom of activation, calculated top of activation, slope and 95% confidence interval (CI) values were calculated using the same model as EC50. These parameters were calculated for each activation marker (CD69, CD107a/b), cytokine (IFN ⁇ , TNF ⁇ ) and chemokine (MIP1 ⁇ ). A.7.
  • the sequence of the amplicon was checked.
  • the vector was then used to transfect a CHO cell line and a clone producing the protein was selected.
  • the protein was purified from the culture supernatant with Ni-NTA beads (Qiagen, #1018244) and S200 size exclusion chromatography was performed to ensure the elimination of aggregates prior to characterization of binding kinetics with surface plasmon resonance (SPR).
  • SPR surface plasmon resonance
  • the sequence encoding the ECD of Cynomolgus NKp46 (Gln17-Asn254, NP_001271509.1) was cloned into the SLX192 vector between the HindIII and XbaI restriction sites. A C-terminal Flag-M2 tag was added for purification.
  • the primers used to amplify the expected sequence from cynomolgus PBMC were: 5’ TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCGTGC 3’ and 5’ CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCATTCTGGGCAG TGTGGTCC 3’.
  • the vector was used to transfect the CHO-K1SV cell line and a producing cell clone was selected.
  • the recombinant Cynomolgus NKp46- FlagM2 protein sequence is reported herein as SEQ ID NO: 85; which includes part of the extracellular domain of NKp46 (GenBank number: CAC41080.1).
  • the first three batches (150602CCe batch 1, 150618CCe batch 2 and 150715CCe batch 3) were purified by M2 affinity chromatography.
  • the beads were incubated with the supernatant containing the recombinant protein overnight.
  • the beads were then washed with PBS1X and the elution is performed with elution peptide at 150 ng/ ⁇ l in PBS1X.
  • the proteins are then dialyzed against PBS1X.
  • the next batches (161003CDe batch 1 and 161116CDe batch 2) were purified by affinity chromatography by coupling the anti-NKp46 antibody HUX1-M-H46-17E1 to the AminoLink Coupling Resin according to the manufacturer’s instructions (GE Healthcare, #20381, batch QB213815).
  • the beads were then incubated with the supernatant containing the recombinant protein overnight.
  • the beads were then washed with PBS1X and the elution is performed using Glycine 0.1M pH2.5.
  • the proteins are then dialyzed against TBS buffer pH7.5 and concentrated to perform a preparative size exclusion chromatography on a Superdex 200 Increase 10/300 GL column.
  • a recombinant human CD123 from ACRO Biosystems catalog no. ILA-H52H6
  • recombinant Human Fc gamma RIIIA/CD16a V176
  • recombinant Human Fc gamma RIIIA/CD16a V176F
  • Biotechne, catalog no. 8894-FC recombinant Human Fc gamma RIIIA/CD16a
  • a Biacore T200 instrument (Cytiva, Uppsala, Catalog No.28975001) was used with a Series S CM5 sensor chip (Cytiva, Uppsala, Catalog No.29149603).
  • HBS-EP+ buffer (Cytiva, Uppsala, Catalog No. BR1006-69) was prepared by mixing 100 mL 10x HBS-EP+ buffer with 900 mL of purified water.
  • Affinity capture of the bispecific Ab sample was achieved using the human antibody capture kit (Cytiva, Uppsala, Catalog No. BR1008-39).
  • the anti- Fc capture antibody was diluted in running buffer 1:20 and coupled to the CM5 chip (Cytiva, Uppsala, Catalog No.29149603) using standard amine coupling to yield approximately 8000 response units (RU) using the amine coupling kit (Cytiva, Uppsala, Catalog No. BR-100- 50).
  • Seven serial 1:1 dilutions of either human NKp46 (Innate Pharma) or human CD123 (ACRO Biosystems) in HBS-EP+ assay buffer were prepared to concentrations of 1.56 nmol/L, 3.13 nmol/L, 6.25 nmol/L, 12.5 nmol/L, 25 nmol/L, 50 nmol/L and 100 nmol/L.
  • the bispecific antibody was diluted with HBS-EP+ buffer to a concentration of 0.06 ⁇ g/mL and used at this concentration in the experiments.
  • the antibody was captured at a flow rate of 10 ⁇ L/min for 90 sec to yield maximal response (Rmax) values of approximately 30 RU.
  • Measurements were performed in multicycle kinetics experiments for both antigens. In each multicycle experiment the antibody was captured via an anti-human Fc antibody immobilized on a series S CM5 sensor chip (human antibody capture kit, Cytiva, Uppsala, Catalog No. BR1008-39).
  • Binding kinetics data were evaluated with the Biacore T200 Evaluation Software version 3.0 (Cytiva, Uppsala) for all other antibodies using a 1:1 binding model with mass transport limitation.
  • HBS-EP+ buffer (Cytiva, Uppsala, Catalog No. BR1006-69) was prepared by mixing 100 mL 10x HBS-EP+ buffer with 900 mL of purified water.
  • Affinity capture of the human CD16a proteins was achieved using the His capture kit (Cytiva, Uppsala, Catalog No.28995056).
  • the anti-His capture antibody was diluted in running buffer 1:20 and coupled to the CM5 chip (Cytiva, Uppsala, Catalog No.
  • CD16a (V/F) proteins were diluted with HBS-EP+ buffer to a concentration of 0.1 ng/mL and used at this concentration in the experiments.
  • CD16a (V176) and CD16a (V176F) were captured at a flow rate of 10 ⁇ L/min for 30 sec on flow cells 2 and 4, respectively to yield maximal response (Rmax) values of approximately 30 RU. Measurements were performed in multicycle kinetics experiments. In each multicycle experiment CD16a was captured via an anti-His antibody immobilized on a series S CM5 sensor chip (human antibody capture kit, Cytiva, Uppsala, Catalog No. BR1008-39).
  • the bispecific antibody diluted into HBS-EP+ buffer was injected in a 1:1 dilution series from 5.8 nmol/L to 3000 nmol/L for 120 sec at a flow rate of 30 ⁇ L/min followed by a dissociation phase of 120 sec. All analyte concentrations were run in duplicate together with multiple buffer blanks for double referencing. Regeneration of the capture surface was performed with two consecutive injects of regeneration solution (10 mmol/L Glycine pH 1.5) for 30 sec at 30 ⁇ L/min.
  • Binding affinities (KD values) of the bispecific antibody to human CD16a were evaluated with the Biacore T200 Evaluation Software version 3.0 (Cytiva, Uppsala) using a steady state fit of the SPR response for the measured antibody concentrations.
  • KD values Binding affinities
  • the efficacy of muNKp46-huCD123_F25 a murine surrogate version of the NKp46- CD123_F25 was evaluated in severe-combined-immunodeficient (SCID) mice engrafted with disseminated human MOLM-13 cells.
  • NKp46- CD123_F25 This surrogate is different from NKp46- CD123_F25 for the arm targeting the NKp46 protein (as it targets the murine protein instead of the human one) and is similar to NKp46-CD123_F25 for the other arms (human CD123 binding arm and human IgG1competent Fc domain able to bind to all activating murine Fc ⁇ Rs, to recruit murine effector cells and to induce ADCC with murine NK cells).
  • the muNKp46-huCD123_F25 activity was compared to an anti-CD123 ADCC- enhanced antibody (Reference-1) able to bind murine Fc ⁇ Rs and to recruit murine effector cells.
  • the muNKp46-huCD123_F25 activity was also compared to an isotype control binding of muNKp46 and murine Fc ⁇ Rs but not to bind to huCD123 (muNKp46-IC).
  • Mice were intravenously inoculated with tumor cells (5x10 6 ) on day 0. Treatments were administered by intraperitoneal route on day 1 post tumor implantation.
  • muNKp46- huCD123_F25 was administered at 0.5, 0.25 and 0.05 mg/kg following intra-parenteral administrations on day 1.
  • mice were randomized into the 4 groups (untreated control group; untreated control group + anti-asialoGM1; NKCE control; or NKCE + anti-asialoGM1). A day before tumor implantation (day -1) as well as at day 5 post- tumor implantation the experimental groups received NK cell depletion antibody, anti-asialo GM1.
  • NKCE Treatments (Vehicle or NKCE) were administered intraperitoneally on day 1 post tumor implantation at a single dose of 0.5 mg/kg.
  • NKCE included Nkp46-CD123_F25, muNKp46-IC, an isotype control antibody binding huCD123 and murine Fc ⁇ Rs but not murine NKp46 (IC-huCD123).
  • Mice were checked and adverse clinical reactions noted. Individual mice were weighed daily until the end of the experiment (day 70). Mice were euthanized when turning moribund according to predefined criteria in order to avoid animal suffering.
  • Clinical signs related to the pathology, considered as critical are limb paralysis, ascites, palpable internal tumor mass, morbidity or weight loss superior or equal to 20%.
  • NCI preclinical in vitro and in vivo models and early clinical trials Br. J. Cancer.2001 May;84(10):1424-31).
  • Long term survivor rate is defined as the number of mice with survival duration superior or equal to 2 times the MST of control group on the total number of mice in the group expressed in percentage.
  • Anti-tumor activity in non-human primate (NHP) A qualified flow cytometry panel used for evaluating in monkey cynomolgus blood samples, the phenotyping and count of Basophils and total CD123 immune cells.
  • the panel was composed by the antibodies against the antigen CD45 (Clone D058-1283), CD14 (clone REA599), CD203c (clone NP4D6) , CD193 (clone 5E8) , IgE (clone REA1049), CD123 (clone CD123), CD33 (clone AC104.3E3) and the viability marker Zombie Nir (Biolegend 423106).
  • 100 ⁇ L of whole blood sample collected into a 3K-EDTA anticoagulated air- vacuum sampling were incubated with a lysis solution (Biocytex CP025) during 10 min following by a centrifugation step at 300 g at room temperature during 5 min with DPBS (Sigma D8537).
  • the resuspended cells were stained during 10 min at room temperature with the antibodies and viability marker.
  • a third step of centrifugation were done in order to eliminate non-fixed antibodies.
  • Cells were resuspended into 250 ⁇ L of fixative solution (Biocytex CP026) and were incubated during one hour at room temperature.100 ⁇ L of Flow count beads (Beckman A91346) were added into cells tube and were acquired on a Gallios Beckman coulter instrument equipped by 3 lasers and 10 colors. A.11.
  • PBMCs from human healthy donors were seeded in 96-well U-bottom plates (Ultra low binding Costar ref#CLS7007) in 190 ⁇ L complete culture medium (500,000 cells per well). and incubated at 37°C in the presence of 5% CO2 for 20 hours with serial dilutions of CD123-NKCE, IC-NKCE control and CD123-TCE molecules.
  • the basophil population defined as TCR ⁇ negative, CD14 negative and IgE receptor positive viable cells, was analyzed by flow cytometry and cytokine absolute concentrations released in the supernatant were analyzed by meso scale discovery (MSD) assay.
  • MSD meso scale discovery
  • Flow cytometry- assay Cell pellets were suspended in cold 50 ⁇ L Stain Buffer (AutoMACS Running Buffer Miltenyi Ref#130-091-221) completed with 1 ⁇ L FcR Blocking reagent, human (Miltenyi Ref#130-059-901). A mix of PBMC subsets specific labelling antibodies and the viability reagent were added into the PBMC suspension following supplier recommendations.
  • the populations were gated from forward scatter/sideward scatter dotplot, single cells and further viable cells were gated on Iodure Propidium viable negative gate. Gates were set according to FMO controls. Cytokine MSD assay Cell supernatant was collected and diluted in MSD buffer following purchaser recommendations. Diluted samples or pre-diluted multi-analyte calibrators samples are added in pre-coated plate supplied in the kit. After adding a solution of detection antibodies conjugated with electrochemiluminescent labels (MSD SULFO-TAG), the plates were incubated at room temperature for 2 hours.
  • MSD SULFO-TAG electrochemiluminescent labels
  • MSD buffer creating the appropriate chemical environment for elctrochemiluminescence (ECL)was added and the plates loaded into an MSD instrument where a voltage applied to the plate electrodes causes the captured labels to emit light.
  • the instrument measures the intensity of emitted light and provide a quantitative measure of each analyte in the samples.
  • Analysis of raw data exported from the MSD instrument was performed using Excel software. Concentrations of IL-6, IL-1b, IFN ⁇ and TNF ⁇ are determined from ECL signals by back-fitting to a calibration curve established with a 4-parameter logistic model with 1/Y2 weighting. A.12.
  • Cytokine release determination in non-human primate (NHP) plasma AnECLIA (Electrochemoluminescence Assay) method using Mesoscale (MSD) Proinflammatory Panel1 (NHP) kit (ref. K15056D) was developed and validated to quantify IL-2, IFN- ⁇ , IL-6, and IL-10 in monkey K3-EDTA plasma. It is a quantitative sandwich enzyme immunoassay using anti-human IL-2, IL-6, IL10 and IFN- ⁇ antibodies immobilized on the working electrode surface and a Ruthenium anti-human IL-2, IL-6, IL-10 and IFN- ⁇ antibodies.
  • Animals were identified as M1 and M2 for males dosed at 0.1 mg/kg/administration, F3 and F4 for females dosed at 0.1 mg/kg/administration, M5 and M6 for males dosed at 3 mg/kg/administration, and F7 and F8 for females dosed at 0.1 mg/kg/administration, respectively. Dosing was performed on Days 1, 8, 15 and 22. The potential delayed onset toxicity and/or the reversibility of potential toxicity was assessed one week (Day 29) and up to 4 weeks (Day 50) after the last (4th) administration. M2, F4, M6 and F8 were euthanized and necropsied on Day 29.
  • Parameters were evaluated for each treated animal: - in blood on pretest (predose) Day 1 at 1.5, 5, 24, 72 hours after the start of infusion Day 8 at 24 hours after the start of infusion Day 15 at 1.5 and 24 hours after the start of infusion Day 22 at 24 hours after the start of infusion Day 29 (1 week after the last administration; all animals) Day 50 (4 weeks after the last administration; recovery animals). - in bone marrow Pretest (predose) Day 9 Day 29 (1 week after the last administration; all animals) Day 50 (4 weeks after the last administration; recovery animals) Blood samples (serial sampling) were withdrawn from brachial or saphenous vein into K3-EDTA polypropylene tubes. Blood samples were placed on wet ice and centrifuged.
  • Plasma samples obtained were frozen at -80°C pending their analyses.
  • CD123-NKCE concentrations were determined in plasma using a dedicated immunoassay method where CD123-NKCE were captured by biotin-coupled CD123 recombinant proteins and revealed by a monkey absorbed alexa-goat anti-human IgG, with a Lower Limit of Quantification (LLOQ) value of 0.250 ng/mL.
  • LLOQ Lower Limit of Quantification
  • NKp46-CD123_F25 binding protein The F25 format, or its variants, is illustrated in Figures 1 and 2, and comprises three polypeptide chains.
  • the NKp46-CD123_F25 binding protein comprises three polypeptide chains including a human CD123 binding domain and a human NKp46 binding domain, respectively including hypervariable regions comprising polypeptide sequences SEQ ID NO: 1, 2, 3, 7, 8, 9 and SEQ ID NO: 13, 14, 15, 27, 28, 29.
  • Each polypeptide chain (I, II, and III) is expressed with a signal (or “leader”) sequence that is cleaved intracellularly before assembly.
  • the first polypeptide chain (or “polypeptide chain (I)” or “Fragment I” or “Fragment 1”) comprises from N-term to C-term, the VL (CD123-binding) domain corresponding to the amino sequence of SEQ ID NO:43, a native C K (or C ⁇ ) domain derived from human IgG1, a modified human IgG1 hinge region (“DKTHTCPPCP”) wherein residue D (position according to EU numbering) is connected to the C-terminal cysteine of the human CK domain.
  • the Fc region or variant thereof is further derived from a native human IgG1 antibody comprising a C H 2-C H 3 domain.
  • the second polypeptide chain (“polypeptide chain (II)” or “Fragment II” or “Fragment 2”) comprises, from N-term to C-term, the V H (CD123-binding) domain corresponding to the amino sequence of SEQ ID NO:41, a native C H 1 domain derived from human IgG1, an unmodified human IgG1 hinge region (“EPKSCDKTHTCPPCP”), and a Fc region or variant thereof derived from a human IgG1 including a C H 2-C H 3 domain wherein the last residue of the C H 3 domain is removed and replaced by a small four amino- acid “STGS” linker, a V H (NKp46-binding) domain corresponding to the amino sequence of SEQ ID NO:45, a second native C H 1 domain which is identical to the C H 1 domain of the first polypeptide chain, and a C-terminal hinge sequence from human
  • the third polypeptide chain (“polypeptide chain (III)” or “Fragment III” or “Fragment 3”) comprises a VL (NKp46-binding) domain corresponding to the amino sequence of SEQ ID NO: 53 and a C K domain terminated with a Cysteine.
  • the C H 2 domains of the Fc part of the NKp46-CD123_F25 binding protein of the present disclosure are glycosylated at position N297 to ensure binding to CD16 (Fc ⁇ R).
  • the NKp46-CD123_F25 binding protein comprises four predicted interchain disulfide bridges: (i) one disulfide bridge connecting the C-term CK cysteine of the first polypeptide chain to the first hinge cysteine of the second polypeptide chain; (ii) two disulfide bridges formed with two cysteines of the hinge region of the first and second polypeptide chains; (iii) one disulfide bridge connecting the last C-term cysteine of the second polypeptide chain to the C-terminal C H 1 domain of the second polypeptide chain.
  • NKp46-CD123_F25 binding protein of the present disclosure comprising polypeptide (I), (II) and (III); wherein the polypeptide (I) consists of an amino acid sequence of SEQ ID NO: 64, the polypeptide (II) consists of an amino acid sequence of SEQ ID NO: 65, and the polypeptide (III) consists of an amino acid sequence of SEQ ID NO: 66. B.3.
  • the NKp46-CD123_F25 binding protein (NKp46-CD123_F25) was tested by SPR in order to confirm its affinity toward a set of human Fc ⁇ receptors, including CD64 and two variants of the CD16a receptor.
  • the human CD16a-V receptor, or CD16a V refers to a polypeptide construct comprising a fragment of the CD16 human receptor binding to a Fc region of a natural antibody, mediating antibody-dependent cellular cytotoxicity and bearing a Valine (V) on position 158, which is also reported in the literature as allotype CD16a V158.
  • the human CD16a-F receptor refers to a polypeptide construct comprising a fragment of the CD16 human receptor binding to a Fc region of a natural antibody, mediating antibody-dependent cellular cytotoxicity and bearing a Phenylalanine (F) on position 158, which is also reported in the literature as allotype CD16a F158.
  • the conclusion of this experiment is that the constant regions which compose NKp46-CD123_F25 retains their affinity toward a plurality of human Fc- ⁇ receptors, including human CD16 and human CD64.
  • NKp46-CD123_F25 binding protein related to the present disclosure retains affinity for NKp46 and CD123 targets, which applies both to human and monkey isoforms.
  • Figure 4A reports in vitro cytotoxicity against MOLM-13 AML cells ( Figure 4A).
  • Figure 4B Cytotoxicity is assessed as a function of the tested NKp46-CD123_F25 binding protein (NKp46-CD123_F25) concentration in the experiment.
  • NKp46-CD123_F25 is responsible for dose- dependent cytotoxicity in both in vitro and ex vivo tested samples.
  • the observed cytotoxicity is also higher than the one observed with an anti- CD123 antibody ADCC-enhanced with no specificity for NKp46 (Reference-1).
  • a negative control variant of format F25 binding NKp46 only shows little cytotoxicity under the tested conditions.
  • the experiments support a synergistic effect of the dual binding toward both CD123 and NKp46 in a Fc-competent construct (F25) to lead to cytotoxicity against CD123-positive tumor cells.
  • Figure 5 provides data based on EC50 on a MOLM-13 cell line. Improvement of in vitro cytotoxicity (which translates into a decreased EC 50 ) is observed with the NKp46- CD123_F25 binding protein (NKp46-CD123_F25). In contrast, the F6 control (NKp46- CD123_F6), which lacks N-glycosylation on residue 297, provides a decreased cytotoxicity since it activates NK cells by engaging NKp46 only and not CD16a. Hence, this second experiment provides evidence of the synergistic effect observed through binding and activation of NKp46 and CD16a NK cell markers.
  • NKp46-CD123_F25 specific lysis was illustrated with NKp46-CD123_F25, and with an anti-CD123 antibody ADCC-enhanced with no specificity for NKp46 (Reference-1) in the presence of human NK cells against CD123-positive MOLM-13 AML cells.
  • the EC 50 value is established based on the variation of cell lysis over the concentration of binders. The results are shown hereafter.
  • the NKp46-CD123_F25 binding protein exhibits a cytotoxic activity which is at least equal or superior to the anti- CD123 ADCC-enhanced antibody (Reference-1).
  • Reference-1 is a fully-humanized monoclonal antibody indicated for the treatment of AML, which targets the alpha chain of the interleukin 3 receptor (IL3R ⁇ ; also known as CD123) and is optimized for enhanced activation of antibody-dependent cell- mediated cytotoxicity (ADCC) via natural killer cells.
  • IL3R ⁇ interleukin 3 receptor
  • ADCC antibody-dependent cell- mediated cytotoxicity
  • CD64 (Fc ⁇ RI) is a high affinity receptor for human IgG expressed on healthy monocytes and macrophages and found expressed on AML blasts in about one third of patients which may be considered as CD64-positive Acute Myeloid Leukemia.
  • NKCE NK Cell engager
  • the expression of CD32a/b and CD64 was selectively knocked down in THP-1 cells.
  • NKp46-CD123_F25 demonstrated consistent killing activity on all AML cell lines and all THP-1 sub-clones emphasizing that the NKp46-CD123_F25 binding proteins related to the present disclosure are more efficient for inducing NK cell-mediated cytotoxicity of AML blasts, as compared to Reference-1, whatever the CD64 expression status.
  • Figure 14A-B confirm that Reference-1 activity is negatively impacted by expression of CD64 on AML cells.
  • Figures 6 and 14 demonstrate that CD123-NKp46_F25 was equally potent against the parental THP-1 cell line, THP-1 subclones, and MOLM-13 cells, regardless of Fc ⁇ R expression status, and, more specifically, CD64 expression on target cells. Moreover, trifunctional NKCE molecules also display killing activity against all primary malignant AML cells, promoting significant antitumor activity in CD64-positive AML patient samples (AML#5 and 6) against which Reference-1 was completely inactive ( Figure 14A).
  • NK cell activation in autologous primary AML samples by NK cell engagers The properties of NKp46-CD123_F25 binding proteins of the present disclosure (NKp46-CD123_F25) to induce NK degranulation against primary CD64(+) or CD64(-) AML blasts were established in figure 7 through measurement of the percentage of CD107- positive NK cells. Overall, this experiment provides evidence that the NKp46-CD123_F25 binding proteins of the present disclosure are able to activate NK cells in primary samples from AML patients in an autologous assay, e.g., with primary blasts and NK cells from the same patient.
  • NKp46-CD123_F25 binding protein of the present disclosure are able to engage NK cells in the presence of CD64(+) cells at a much lower concentration than what is observed in the presence of Reference-1.
  • mean EC 50 were also quantified for NKp46-CD123_F25 and Reference-1, in a blast killing assay using six NK healthy donors against four AML samples (2 CD64(+) and 2 CD64(-), and the results are reproduced here below.
  • NKp46-CD123_F25 binding proteins related to the present disclosure is superior to the Reference-1 antibody, even for CD64(-) AML samples, with Reference-1 being inactive against CD64(+) AML blasts.
  • NKp46-CD123 NK cell engagers induce anti-tumor activity against MOLM-13 human AML injected in a SCID mouse model
  • Figure 8 reports dose-dependent anti-tumor activity with a muNKp46- huCD123_F25 binding protein (muNKp46-huCD123_F25) inducing 50% mice survival at 0.5 mg/kg, 70 days after tumor implantation, using a SCID mouse model.
  • control group treated showed an MST of 27.5 days and 5% of long-term survivors.
  • X-axis marks the number of days after tumor implantation, consisting of an intravenous injection of human MOLM-13, including a single compound administration on day one by the intraperitoneal (i.p.) route.
  • Y-axis marks the percentage of survival based on ten mice for the treated group and twenty mice for the control group.
  • *** marks a p value ⁇ 0.001 vs. control group.
  • the group treated with muNKp46-huCD123_F25 at 0.5 mg/kg showed a MST of 66 days, an increased lifespan of 140% and 50% of long term survivors, muNKp46- huCD123_F25 at 0.5 mg/kg was statistically significantly active as compared to the control group (p ⁇ 0.0001).
  • the group showed an MST of 36 days, an increased lifespan of 31% and 10% of long-term survivors, muNKp46-huCD123_F25 inducing at 0.25 mg/kg was not statistically different to the control group.
  • Reference-1 induced a statistically significant activity at the dose of 5 mg/kg in human MOLM-13 disseminated model, with an ILS of 70% and 40% of long-term survivors. It was not active at the doses of 0.5, 0.25 and 0.05 mg/kg.
  • the muNKp46-huCD123_F25 was statistically significantly more active than Reference-1 at the doses of 0.5 and 0.25 mg/kg.
  • Tabular results for Figure 18 are summarized as follows: In conclusion, muNKp46-huCD123_F25 surrogate showed a dose-dependent activity with a robust activity from 0.25 mg/kg.
  • NKp46-CD123 NK cell engagers induce anti-tumor activity in vivo in non-human primates
  • the absence of pro-inflammatory cytokine release of NKCE in human PBMCs in vitro was further confirmed in two dedicated pharmacokinetic, pharmacodynamic and safety studies performed on NHPs.
  • Cynomolgus monkeys were selected as a relevant species for preclinical pharmacokinetics, pharmacodynamics and toxicological studies on (1) the basis of their tissue distributions of NKp46 and CD123, which are similar to those in humans (Walzer et al. PNAS; 2007; 104:3384-3398 and ChiChili et al. Sci Transl Med; 2015; 7:289) and (2) because the antibodies and Fc fragment constituting the CD123-NKCE molecule bind to cynomolgus antigens and Fc ⁇ Rs with affinities similar to those for human molecules as shown in the Table 4 below.
  • CD16a (Fc ⁇ RIIIA) has a monovalent KD of 0.46 ⁇ 0.01 ⁇ M and 2.61 ⁇ 0.09 ⁇ M for its 158V and 158F isoforms, respectively, and anti- NKp46 and anti-CD123 antibody moieties bind to human NKp46 and human CD123 with monovalent KD of 16.3 ⁇ 2.9 nM and 0.40 ⁇ 0.04 nM, respectively.
  • Table 4 Figure 9 further shows a complete and sustained CD123-positive basophil depletion at 3 ⁇ g/kg for up to 20 days after the injection of the NKp46-CD123_F25 binding protein related to the present disclosure (NKp46-CD123_F25), and up to 5 hours at 0.5 ⁇ g/kg for non-human primates. Accordingly, this result demonstrates that the in vitro, ex vivo and in vivo results previously obtained, including those observed in the SCID mouse model, can be extrapolated to non-human primates for NK cell engagers. Overall, CD123-positive immune cell depletion is a hallmark of in vivo activity of the NKp46-CD123_F25 binding proteins in non-human primate.
  • MOLM-13 cells do not express CD64(-), whereas THP- 1 cells express high level of CD64(+). Both cells express CD32a.
  • this example reports the variation of specific lysis for three distinct binding proteins : (i) a NKp46-CD123_F5 binding protein in the F5 format (NKp46-CD123_F5), (ii) a NKp46-CD123_F25 binding protein in the F25 format (NKp46-CD123_F25), and (iii) a negative isotype control variant of format F5 binding CD123 only (CD123-IC_F5).
  • NKp46-CD123_F5 binding protein in the F5 format NKp46-CD123_F5
  • NKp46-CD123_F25 a NKp46-CD123_F25 binding protein in the F25 format
  • a negative isotype control variant of format F5 binding CD123 only CD123-IC_F5
  • NKp46-CD123 NKCEs-induced CD123-positive basophil depletion is associated to low cytokine release when compared to T-cells engager tool Potent cytotoxicity may be associated with toxicity in patients.
  • CRS potential cytokine release syndrome
  • NKp46-CD123_F25 CD123-NKCE; dose of 0.1, 1, or 10 ⁇ g/mL; 0.68-68 nM
  • NKp46-IC_F25 a negative isotype control variant of format F25 binding NKp46
  • CD123 is constitutively expressed on a subset of circulating basophils and plasmacytoid dendritic cells (pDC). Given that basophils have higher CD123 + expression than pDCs, the percent depletion of basophils was monitored for each treatment group indicated above.
  • Figure 11 shows the treatment of human PBMCs with CD123-NKCE promoted a dose-dependent partial depletion of CD123 + basophils with a median maximum depletion of 37% [31; 50], and a geometric mean EC 50 value of 38 pM (95% CI [12.9; 401]), calculated with six of 10 donor samples.
  • basophil depletion did not occur in a considerable amount in the presence of a F25 binding molecule lacking a CD123 binding site (NKp46-IC_F25).
  • NKp46-IC_F25 a F25 binding molecule lacking a CD123 binding site
  • Figure 12 demonstrates that the in vitro IL-6, and IL-1 ⁇ pro-inflammatory cytokine and TNF- ⁇ and IFN- ⁇ cytokine release associated to the administration of the NKp46-CD123_F25 binding protein related to the present disclosure (NKp46-CD123_F25) was much lower than the corresponding IL-6 release associated with the administration of a positive control known to induce cytokine release syndrome (CRS), Reference-1, at a 100-fold lower dose (0.1 ⁇ g/ml).
  • CD123-NKCE induced much lower levels of cytokine release than CD123-TCE, even at concentrations 42-times higher.
  • Figure 11 and 12 demonstrate that the treatment of PBMCs with CD123- NKCEs promoted a depletion of CD123 + basophils but induced much lower levels of IL-6, IL-1 ⁇ , TNF- ⁇ and IFN- ⁇ release than treatment with CD3-CD123 antibody molecule.
  • the NKp46-CD123_F25 binding protein related to the present disclosure has shown its ability to engage primary NK cells to target and kill CD123+ primary normal mononuclear blood cells associated with minor cytokine release and may have a better benefit/risk profile than TCEs for the treatment of AML.
  • Figure 13A – Figure 13F show that very low cytokine release (IL6 and IL10) was observed in all treated animals (male Cynomolgus monkeys) after the start of the injection of NKp46-CD123_F25 binding protein related to the present disclosure (NKp46-CD123_F25), without any associated clinical signs. No IL-2 nor IFN ⁇ cytokine release were detected. More particularly, transient IL6 and IL10 peaks are detected in non-human primates after a single intravenous injection of F25 constructs at 3 mg/kg. This transient peak occurs from 1 hour to 5 hours and returns to baseline within 1 or 2 days.
  • NKp46-CD123 NK cell engagers promote NK-cell activation in vitro that is commensurate with cytokine/chemokine production
  • Flow cytometric analysis corresponding to Figure 17 demonstrate that NKp46- CD123_F25 binding proteins promoted NK-cell activation only when CD123 expressing target cells are present.
  • NKp46-CD123_F25 binding proteins of the present disclosure activate and commensurately promote cytokine/chemokine production in primary NK cells towards CD123+ AML cells with no off-target activation of NK cells.
  • NK cells are the effector lymphocyte subset responsible for the antitumor activity of NKp46-CD123_F25.
  • mice underwent an NK cell depletion regimen during the experimental set-up outlined in B.8. The results are presented on Figure 18 and Figure 19 and corresponding tabular results are shown in table 5 below. Table 5 The control group treated showed a median survival time (MST) of 29 days and no long-term survivors. The muNKp46-IC isotype control did not show activity with an ILS of 7% and no long-term survivors.
  • MST median survival time
  • NK depletion No impact of the NK depletion is observed on the group treated with muNKp46-IC isotype control with no increased lifespan and 10% of long-term survivors.
  • the IC-huCD123 isotype control was statistically significantly active with an ILS of 28% and 20% of long-term survivors.
  • a statistically significant impact of the depletion was observed on the group treated with IC-huCD123 isotype control with no increased lifespan and no long-term survivors.
  • the muNKp46-huCD123_F25 was statistically significantly active with an ILS of 84% and 40% of long-term survivors.
  • a statistically significant impact of the depletion was observed on the group treated with muNKp46-huCD123_F25 with an ILS of 14% and no long-term survivors.
  • NKp46-CD123 NK cell engagers are safe and efficient in NHPs
  • NHP study conducted in Figure 9 and Figure 13 interrogating the pharmacokinetics and pharmacodynamics of CD123-NKCEs administered by a single i.v.
  • CD123-NKCE Treatment with CD123-NKCE promoted a sustained and complete depletion of CD123 + cells in the blood of all monkeys, for more than 10 days, at both the 3 mg/kg and 3 ⁇ g/kg doses (as exemplified for CD123 + basophils and total CD123 + cells in Figure 20A and Figure 20B), with only very small amounts ( ⁇ 50 pg/mL) of the pro-inflammatory cytokines IL-6 and IL-10 released (Figure 20C) without any associated clinical signs.
  • a transient and partial depletion of CD123 + cells was observed in the monkey treated at the lowest dose (0.5 ⁇ g/kg, data not shown), but 3 ⁇ g/kg was considered to be the lowest effective dose in this species.
  • the PK profiles of the two monkeys treated at the highest dose (3 mg/kg) were marked by an anti-drug antibody (ADA) response (data not shown) occurring 12-14 days after treatment ( Figure 20D) and associated with the recovery of CD123 + cells from the blood at later timepoints.
  • ADA anti-drug antibody
  • the preclinical safety profile of CD123-NKCE was further interrogated through an exploratory repeat-dose toxicity study in which four monkeys (2/sex/dose) were treated weekly, for four weeks, at a dose of 3 mg/kg/administration or 0.1 mg/kg/administration, administered by intravenous infusion for one hour (Figure 21).
  • NKp46-CD123 NK cell engager tumor cell killing with healthy donor NK cells NKp46-CD123_F25 and its isotype control IC-CD123_F6 were tested in an in vitro tumor cell killing assay with NK cells taken from 2 different healthy donors (HD).
  • NK cells purification and AML cell line Human peripheral blood mononuclear cells (PBMC) from anonymous healthy donors (HD) were isolated by Ficoll density gradient centrifugation. NK cells were purified from these PBMCs with MACSxpress® Whole Blood NK cells isolation kit (Miltenyi Biotec). The NK cells were rested overnight in RPMI1640 (Gibco) supplemented with 10 % SVF (BioWest) and 1 % L-Glutamine (Gibco). THP1 cells (CD123+. CD64+) were chosen for this study based on their expression of CD123.
  • THP1 cells were infected with Incucyte® Nuclight Green Lentivirus (Sartorius) to express the Green Fluorescent Protein (GFP).
  • NK functional assay in presence of NKp46-CD123_F25 over time NK cells and THP1 GFP target cells were incubated in presence of NKp46- CD123_F25 or its isotype control IC-CD123_F6 at 0.1, 1, 10 and 100 ng/mL at 37°C.
  • the ratio effector:target cells was 1:1.
  • the medium used was the same as for NK cell culture.
  • the target cells were monitored by florescence imaging over 74h using Incucyte Live Cell Analysis system (EssenBioscience).
  • NKp46-CD123_F25 at different concentrations (1, 10 and 100 ng/mL) enhances the cytotoxic activity of HD NK cells against THP1 GFP AML cells over time at the effector:target cells ratio of 1:1.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Endocrinology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/IB2021/062494 2020-12-31 2021-12-30 Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123 Ceased WO2022144836A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
JP2023539973A JP7623497B2 (ja) 2020-12-31 2021-12-30 NKp46およびCD123に結合する多機能性ナチュラルキラー(NK)細胞エンゲージャ
KR1020237025940A KR102868401B1 (ko) 2020-12-31 2021-12-30 NKp46 및 CD123에 결합하는 다기능성 자연살해(NK) 세포 관여자
CN202180088872.6A CN117255807A (zh) 2020-12-31 2021-12-30 与NKp46和CD123结合的多功能自然杀伤(NK)细胞接合器
KR1020257032805A KR20250152662A (ko) 2020-12-31 2021-12-30 NKp46 및 CD123에 결합하는 다기능성 자연살해(NK) 세포 관여자
MX2023007901A MX2023007901A (es) 2020-12-31 2021-12-30 Acopladores de celulas asesinas naturales (nk) multifuncionales que se unen a nkp46 y a cd123.
CA3206883A CA3206883A1 (en) 2020-12-31 2021-12-30 Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123
AU2021414400A AU2021414400A1 (en) 2020-12-31 2021-12-30 Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123
EP21840696.5A EP4271709A1 (en) 2020-12-31 2021-12-30 Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123
IL304124A IL304124A (en) 2020-12-31 2023-06-28 A multifunctional natural killer (nk) cell activator that binds to nkp46 and cd23
CONC2023/0008958A CO2023008958A2 (es) 2020-12-31 2023-07-05 Acopladores de células asesinas naturales (nk) multifuncionales que se unen a nkp46 y a cd123
JP2025005123A JP2025063183A (ja) 2020-12-31 2025-01-15 NKp46およびCD123に結合する多機能性ナチュラルキラー(NK)細胞エンゲージャ

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP20306717 2020-12-31
EP20306717.8 2020-12-31
US202163256950P 2021-10-18 2021-10-18
US63/256,950 2021-10-18

Publications (1)

Publication Number Publication Date
WO2022144836A1 true WO2022144836A1 (en) 2022-07-07

Family

ID=79316794

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/062494 Ceased WO2022144836A1 (en) 2020-12-31 2021-12-30 Multifunctional natural killer (nk) cell engagers binding to nkp46 and cd123

Country Status (11)

Country Link
US (2) US11692039B2 (cg-RX-API-DMAC7.html)
EP (1) EP4271709A1 (cg-RX-API-DMAC7.html)
JP (2) JP7623497B2 (cg-RX-API-DMAC7.html)
KR (2) KR20250152662A (cg-RX-API-DMAC7.html)
AU (1) AU2021414400A1 (cg-RX-API-DMAC7.html)
CA (1) CA3206883A1 (cg-RX-API-DMAC7.html)
CO (1) CO2023008958A2 (cg-RX-API-DMAC7.html)
IL (1) IL304124A (cg-RX-API-DMAC7.html)
MX (1) MX2023007901A (cg-RX-API-DMAC7.html)
TW (1) TWI905354B (cg-RX-API-DMAC7.html)
WO (1) WO2022144836A1 (cg-RX-API-DMAC7.html)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024155044A1 (ko) * 2023-01-16 2024-07-25 주식회사 드노보 바이오테라퓨틱스 신규한 항-nkp46 항체 및 이의 용도
EP4438614A1 (en) * 2023-03-31 2024-10-02 Sanofi Methods for purifying heteromultimeric antibodies
WO2024224313A1 (en) * 2023-04-24 2024-10-31 Sanofi Use of cd123 nk cell engager for treating aml and related disorders
WO2025012704A1 (en) * 2023-07-13 2025-01-16 Sanofi Natural killer cells and cd123 nk cell engager combination therapy
WO2026055280A1 (en) * 2024-09-04 2026-03-12 Sanofi Interleukin 2 (il-2) and cd123 nk cell engager combination therapy

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK3313876T3 (da) * 2015-06-23 2025-04-22 Innate Pharma Multispecifikke antigenbindende proteiner
TWI905354B (zh) * 2020-12-31 2025-11-21 法商英耐特醫藥公司 結合至NKp46及CD123之多功能自然殺手 (NK) 細胞接合體
KR20250017240A (ko) 2022-05-27 2025-02-04 사노피 FC-조작을 갖는 NKp46 및 BCMA 변이체에 결합하는 자연 살해(NK) 세포 관여자
US20250195653A1 (en) * 2023-11-28 2025-06-19 Sanofi Multifunctional natural killer (nk) cell engager combination therapy for treating hematological neoplastic disorders

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006064136A1 (fr) 2004-12-16 2006-06-22 Centre National De La Recherche Scientifique (Cnrs) Production de formats d'anticorps et applications immunologiques de ces formats
WO2012089814A1 (en) 2010-12-30 2012-07-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Antigen binding formats for use in therapeutic treatments or diagnostic assays
WO2015197593A1 (en) 2014-06-27 2015-12-30 Innate Pharma MULTISPECIFIC NKp46 BINDING PROTEINS
WO2016116626A1 (en) * 2015-01-23 2016-07-28 Sanofi Anti-cd3 antibodies, anti-cd123 antibodies and bispecific antibodies specifically binding to cd3 and/or cd123
WO2017114694A1 (en) 2015-12-28 2017-07-06 Innate Pharma VARIABLE REGIONS FOR NKp46 BINDING PROTEINS
WO2019101695A1 (en) * 2017-11-21 2019-05-31 Innate Pharma Multispecific antigen binding proteins

Family Cites Families (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5288931A (en) * 1991-12-06 1994-02-22 Genentech, Inc. Method for refolding insoluble, misfolded insulin-like growth factor-I into an active conformation
US6177078B1 (en) 1995-12-29 2001-01-23 Medvet Science Pty Limited Monoclonal antibody antagonists to IL-3
JP4327350B2 (ja) 1997-11-17 2009-09-09 マイクロメット アーゲー エピトープへの結合能力を保持する結合部位ドメインの同定のための新規方法
AU773029B2 (en) 1999-02-08 2004-05-13 Medvet Science Pty. Ltd. Cytokine-binding domain
EP1161453A4 (en) 1999-02-08 2005-01-05 Medvet Science Pty Ltd CYTOKIN-BINDING DOMAIN
GB9912350D0 (en) * 1999-05-26 1999-07-28 European Molecular Biology Lab Embl Modified cytokine
NZ521255A (en) 2000-03-06 2007-01-26 Univ Kentucky Res Found Methods to impair hematologic cancer progenitor cells and compounds related thereto
FI117667B (fi) * 2001-07-05 2007-01-15 Univ Zuerich Farmaseuttinen koostumus, joka soveltuu käytettäväksi ortopediassa ja hammaslääketieteessä
RU2005137325A (ru) 2003-05-31 2006-09-10 Микромет Аг (De) Фармацевтическая композиция, содержащая конструкт, специфичный к ерсам
WO2009070844A1 (en) 2007-12-06 2009-06-11 Csl Limited Method of inhibition of leukemic stem cells
US20100209341A1 (en) 2009-02-18 2010-08-19 Csl Limited Treatment of chronic inflammatory conditions
JP5694923B2 (ja) 2009-04-27 2015-04-01 協和発酵キリン株式会社 血液腫瘍治療を目的とした抗IL−3Rα抗体
EP2436397B1 (en) 2009-05-29 2017-05-10 Chugai Seiyaku Kabushiki Kaisha Pharmaceutical composition containing antagonist of egf family ligand as component
AU2011217728B2 (en) 2010-02-17 2013-03-14 Csl Limited Compositions and methods for targeting type 1 interferon producing cells
CA2802046C (en) 2010-06-07 2018-12-11 Stepan Company Dilutable biocidal compositions and methods of use
NZ604510A (en) 2010-08-17 2013-10-25 Csl Ltd Dilutable biocidal compositions and methods of use
EP2626069A4 (en) 2010-10-06 2014-03-19 Univ Tokyo Prophylactic and/or therapeutic agent against lymphedema
US9155802B2 (en) 2010-11-01 2015-10-13 Symphogen A/S Pan-HER antibody composition
MX347981B (es) 2010-11-01 2017-05-22 Symphogen As Composicion de anticuerpos pan-her.
AU2012212047A1 (en) * 2011-02-03 2013-08-22 Xoma Technology Ltd. Methods and materials for enhancing functional protein expression in bacteria
US20160046718A1 (en) 2013-03-14 2016-02-18 Csl Limited Agents that neutralize il-3 signalling and uses thereof
WO2014138805A1 (en) 2013-03-14 2014-09-18 Csl Limited Anti il-3r alpha agents and uses thereof
PE20170255A1 (es) 2014-01-24 2017-03-22 Dana Farber Cancer Inst Inc Moleculas de anticuerpo que se unen a pd-1 y usos de las mismas
PL3119807T3 (pl) 2014-03-19 2019-09-30 Cellectis Specyficzne wobec cd123 chimeryczne receptory antygenowe do immunoterapii nowotworów
SI3148579T1 (sl) 2014-05-28 2021-07-30 Agenus Inc. Proti GITR antitelesa in postopki z njihovo uporabo
US20180134795A1 (en) 2014-06-17 2018-05-17 Cellectis Cd123 specific multi-chain chimeric antigen receptor
WO2015197598A2 (en) 2014-06-27 2015-12-30 Innate Pharma Multispecific antigen binding proteins
CN105367657B (zh) 2014-08-14 2019-09-13 上海生物制品研究所有限责任公司 抗her3抗体、其制法及其应用
EP2990416B1 (en) 2014-08-29 2018-06-20 GEMoaB Monoclonals GmbH Universal chimeric antigen receptor expressing immune cells for targeting of diverse multiple antigens and method of manufacturing the same and use of the same for treatment of cancer, infections and autoimmune disorders
MA40609B1 (fr) 2014-09-05 2020-05-29 Janssen Pharmaceutica Nv Agents de liaison cd123 et leurs utilisations
FI3218005T3 (fi) 2014-11-12 2023-03-31 Seagen Inc Glykaanin kanssa vuorovaikutteisia yhdisteitä ja käyttömenetelmiä
US9879087B2 (en) 2014-11-12 2018-01-30 Siamab Therapeutics, Inc. Glycan-interacting compounds and methods of use
BR112017013981A2 (pt) 2015-01-26 2018-01-02 Cellectis receptores antigênicos quiméricos com uma única cadeia específicos anti-cll1 (sccars) para imunoterapia de câncer
BR112017023862A2 (pt) 2015-05-04 2018-07-17 Cytomx Therapeutics Inc anticorpos anti-cd71, anticorpos anti-cd71 ativáveis, e métodos de uso destes
TW201709932A (zh) 2015-06-12 2017-03-16 西雅圖遺傳學公司 Cd123抗體及其共軛物
AU2016284871B2 (en) 2015-06-23 2022-09-29 Innate Pharma Multispecific NK engager proteins
DK3313876T3 (da) 2015-06-23 2025-04-22 Innate Pharma Multispecifikke antigenbindende proteiner
JP6768011B2 (ja) 2015-06-23 2020-10-14 バイエル ファーマ アクチエンゲゼルシャフト キネシンスピンドルタンパク質(ksp)阻害剤の抗cd123抗体との抗体薬物複合体
WO2017025323A1 (en) 2015-08-11 2017-02-16 Cellectis Cells for immunotherapy engineered for targeting cd38 antigen and for cd38 gene inactivation
CA3002097A1 (en) 2015-11-12 2017-05-18 Siamab Therapeutics, Inc. Glycan-interacting compounds and methods of use
WO2017096276A1 (en) 2015-12-02 2017-06-08 Agenus Inc. Anti-gitr antibodies and methods of use thereof
EP3383431A4 (en) 2015-12-02 2019-08-28 Agenus Inc. ANTI-GITR ANTIBODIES AND METHOD OF USE THEREOF
CN108883173B (zh) 2015-12-02 2022-09-06 阿吉纳斯公司 抗体和其使用方法
MA43389A (fr) 2015-12-02 2021-05-12 Agenus Inc Anticorps anti-ox40 et leurs procédés d'utilisation
WO2017160954A1 (en) 2016-03-15 2017-09-21 Seattle Genetics, Inc. Combinations of pbd-based antibody drug conjugates with bcl-2 inhibitors
WO2017214433A1 (en) 2016-06-09 2017-12-14 Seattle Genetics, Inc. Combinations of pbd-based antibody drug conjugates with flt3 inhibitors
TWI790206B (zh) * 2016-07-18 2023-01-21 法商賽諾菲公司 特異性結合至cd3和cd123的雙特異性抗體樣結合蛋白
KR20210133261A (ko) 2019-02-26 2021-11-05 소렌토 쎄라퓨틱스, 인코포레이티드 Bcma에 결합하는 항원 결합 단백질
TWI905354B (zh) * 2020-12-31 2025-11-21 法商英耐特醫藥公司 結合至NKp46及CD123之多功能自然殺手 (NK) 細胞接合體
WO2022200525A1 (en) 2021-03-26 2022-09-29 Innate Pharma Multispecific proteins comprising an nkp46-binding site, a cancer antgienge binding site fused to a cytokine for nk cell engaging
BR112023025331A2 (pt) 2021-06-09 2024-02-27 Innate Pharma Proteína multiespecífica, composição farmacêutica, célula recombinante, ácido nucleico ou conjunto de ácidos nucleicos, uso de uma proteína ou composição, métodos ou uso

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006064136A1 (fr) 2004-12-16 2006-06-22 Centre National De La Recherche Scientifique (Cnrs) Production de formats d'anticorps et applications immunologiques de ces formats
WO2012089814A1 (en) 2010-12-30 2012-07-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Antigen binding formats for use in therapeutic treatments or diagnostic assays
WO2015197593A1 (en) 2014-06-27 2015-12-30 Innate Pharma MULTISPECIFIC NKp46 BINDING PROTEINS
WO2016116626A1 (en) * 2015-01-23 2016-07-28 Sanofi Anti-cd3 antibodies, anti-cd123 antibodies and bispecific antibodies specifically binding to cd3 and/or cd123
WO2017114694A1 (en) 2015-12-28 2017-07-06 Innate Pharma VARIABLE REGIONS FOR NKp46 BINDING PROTEINS
WO2019101695A1 (en) * 2017-11-21 2019-05-31 Innate Pharma Multispecific antigen binding proteins

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
"Current Protocols in Immunology", 1992, GREENE PUBLISHING ASSOC. AND WILEY INTERSCIENCE
"Natural Killer Cells Protoc", 2000, HUMAN PRESS, pages: 219 - 238
"NCBI", Database accession no. NM 004829
ALMAGROFRANSSON, FRONT BIOSCI., vol. 13, 2008, pages 1619 - 1633
CHOTHIALESK, J. MOL. BIOL, vol. 196, 1987, pages 901 - 917
DONDELINGER, FRONTIERS IN IMMUNOLOGY, vol. 9, 2018, pages 2278
ERNST DANIEL ET AL: "Humanized anti-CD123 antibody facilitates NK cell antibody-dependent cell-mediated cytotoxicity (ADCC) of Hodgkin lymphoma targets via ARF6/PLD-1", BLOOD CANCER JOURNAL, vol. 9, no. 2, 15 January 2019 (2019-01-15), XP055903478, Retrieved from the Internet <URL:http://www.nature.com/articles/s41408-018-0168-2> DOI: 10.1038/s41408-018-0168-2 *
GAUTHIER LAURENT ET AL: "852?Trifunctional NKp46/CD16a-NK cell engager targeting CD123 overcomes acute myeloid leukemia resistance to ADCC", JOURNAL FOR IMMUNOTHERAPY OF CANCER, vol. 9, no. Suppl 2, 1 November 2021 (2021-11-01), pages A893 - A893, XP055903479, DOI: 10.1136/jitc-2021-SITC2021.852 *
GAUTHIER LAURENT ET AL: "Multifunctional Natural Killer Cell Engagers Targeting NKp46 Trigger Protective Tumor Immunity", CELL, ELSEVIER, AMSTERDAM NL, vol. 177, no. 7, 13 June 2019 (2019-06-13), pages 1701 - 1713, XP085712692, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2019.04.041 *
GAUTHIER, L. ET AL.: "Multifunctional natural killer cell engagers targeting NKp46 trigger protective tumor immunity", CELL, vol. 177, 2019, pages 1701 - 1713, XP085712692, DOI: 10.1016/j.cell.2019.04.041
HARLOW ET AL.: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
JOHNSON JIDECKER SZAHAREVITZ DRUBINSTEIN LVVENDITTI JMSCHEPARTZ SKALYANDRUG S ET AL.: "Relationships between drug activity in NCI preclinical in vitro and in vivo models and early clinical trials", BR. J. CANCER, vol. 84, no. 10, May 2001 (2001-05-01), pages 1424 - 31
LEFRANC, BIOMOLECULES, vol. 4, 2014, pages 1102 - 1139
MORAGA IGNACIO ET AL: "Tuning Cytokine Receptor Signaling by Re-orienting Dimer Geometry with Surrogate Ligands", CELL, ELSEVIER, AMSTERDAM NL, vol. 160, no. 6, 26 February 2015 (2015-02-26), pages 1196 - 1208, XP029203787, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2015.02.011 *
MULLER, METH. ENZYMOL., vol. 92, 1983, pages 589 - 601
SALLY YU SHI ET AL: "A biparatopic agonistic antibody that mimics fibroblast growth factor 21 ligand activity", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 293, no. 16, 26 February 2018 (2018-02-26), US, pages 5909 - 5919, XP055722903, ISSN: 0021-9258, DOI: 10.1074/jbc.RA118.001752 *
STEFFEN DICKOPF ET AL: "Format and geometries matter: Structure-based design defines the functionality of bispecific antibodies", COMPUTATIONAL AND STRUCTURAL BIOTECHNOLOGY JOURNAL, vol. 18, 14 May 2020 (2020-05-14), Sweden, pages 1221 - 1227, XP055740966, ISSN: 2001-0370, DOI: 10.1016/j.csbj.2020.05.006 *
STEIN CHRISTOPH ET AL: "Novel conjugates of single-chain Fv antibody fragments specific for stem cell antigen CD123 mediate potent death of acute myeloid leukaemia cells", BRITISH JOURNAL OF HAEMATOLOGY, BLACKWELL PUBLISHING LTD, vol. 148, no. 6, 1 March 2010 (2010-03-01), pages 879 - 889, XP002618076, ISSN: 1365-2141, [retrieved on 20100108], DOI: 10.1111/J.1365-2141.2009.08033.X *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024155044A1 (ko) * 2023-01-16 2024-07-25 주식회사 드노보 바이오테라퓨틱스 신규한 항-nkp46 항체 및 이의 용도
EP4438614A1 (en) * 2023-03-31 2024-10-02 Sanofi Methods for purifying heteromultimeric antibodies
WO2024200815A1 (en) * 2023-03-31 2024-10-03 Sanofi Methods for purifying heteromultimeric antibodies
WO2024224313A1 (en) * 2023-04-24 2024-10-31 Sanofi Use of cd123 nk cell engager for treating aml and related disorders
WO2025012704A1 (en) * 2023-07-13 2025-01-16 Sanofi Natural killer cells and cd123 nk cell engager combination therapy
WO2026055280A1 (en) * 2024-09-04 2026-03-12 Sanofi Interleukin 2 (il-2) and cd123 nk cell engager combination therapy

Also Published As

Publication number Publication date
AU2021414400A1 (en) 2023-08-17
US11692039B2 (en) 2023-07-04
IL304124A (en) 2023-09-01
EP4271709A1 (en) 2023-11-08
KR20230127306A (ko) 2023-08-31
MX2023007901A (es) 2023-07-11
US20220213202A1 (en) 2022-07-07
US20230416383A1 (en) 2023-12-28
KR102868401B1 (ko) 2025-10-14
CO2023008958A2 (es) 2023-08-18
JP2025063183A (ja) 2025-04-15
AU2021414400A9 (en) 2024-10-17
TW202241952A (zh) 2022-11-01
JP2024501539A (ja) 2024-01-12
KR20250152662A (ko) 2025-10-23
TWI905354B (zh) 2025-11-21
JP7623497B2 (ja) 2025-01-28
CA3206883A1 (en) 2022-07-07

Similar Documents

Publication Publication Date Title
US11692039B2 (en) Multifunctional natural killer (NK) cell engagers binding to NKp46 and CD123
US20260098089A1 (en) Antagonist anti-cd7 antibodies
US20250002601A1 (en) Multispecific antibodies binding to cd20, nkp46, cd16 and conjugated to il-2
CN113412279A (zh) 人源化抗SIRPα抗体
CN115461366B (zh) 抗ox40抗体及其用途
JP2022553927A (ja) Ilt-2阻害剤での癌の処置
KR20250039519A (ko) 항-pd-1 항체-약화된 il-2 면역접합체 및 그의 용도
CN117255807A (zh) 与NKp46和CD123结合的多功能自然杀伤(NK)细胞接合器
CN120958025A (zh) 针对含cub结构域的蛋白1(cdcp1)的抗体及其用途
US20250064935A1 (en) Natural killer cells and cd123 nk cell engager combination therapy
US12286475B2 (en) Anti-GPRC5D antibodies and compositions
WO2024251884A1 (en) Nk cell engager proteins comprising anti-cd20 and ant-nkp46 antibody, linked to il-2 in treatment of r/r b-nhl
US20240084014A1 (en) Multispecific binding compounds that bind to pd-l1
CN121511253A (zh) Cd123 nk细胞接合器用于治疗aml和相关障碍的用途
WO2025083273A1 (en) Binding molecules
CN119677776A (zh) FcγRIIB和肿瘤抗体的组合用于FcγRIIB阴性癌症的治疗

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21840696

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: DZP2023001063

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 3206883

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023539973

Country of ref document: JP

Ref document number: MX/A/2023/007901

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 202180088872.6

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: NC2023/0008958

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023013013

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202317050533

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 802315

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 20237025940

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2023119952

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021840696

Country of ref document: EP

Effective date: 20230731

ENP Entry into the national phase

Ref document number: 2021414400

Country of ref document: AU

Date of ref document: 20211230

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: NC2023/0008958

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112023013013

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230628

WWE Wipo information: entry into national phase

Ref document number: 523441076

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523441076

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523441076

Country of ref document: SA

WWP Wipo information: published in national office

Ref document number: 1020257032805

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 523441076

Country of ref document: SA