WO2022144811A1 - Micellar nanoparticles and uses thereof - Google Patents

Micellar nanoparticles and uses thereof Download PDF

Info

Publication number
WO2022144811A1
WO2022144811A1 PCT/IB2021/062446 IB2021062446W WO2022144811A1 WO 2022144811 A1 WO2022144811 A1 WO 2022144811A1 IB 2021062446 W IB2021062446 W IB 2021062446W WO 2022144811 A1 WO2022144811 A1 WO 2022144811A1
Authority
WO
WIPO (PCT)
Prior art keywords
cationic carrier
carrier unit
aspects
moiety
cationic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2021/062446
Other languages
English (en)
French (fr)
Inventor
Jin-Hyeob RYU
Yu Na Lim
Hyun Su Min
Han Seok Koh
Dae Hoon Kim
Hyun-Jeong CHO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biorchestra Co Ltd
Original Assignee
Biorchestra Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biorchestra Co Ltd filed Critical Biorchestra Co Ltd
Priority to EP21914849.1A priority Critical patent/EP4271363A4/en
Priority to US18/259,618 priority patent/US20240131048A1/en
Priority to CA3200622A priority patent/CA3200622A1/en
Priority to KR1020237023621A priority patent/KR20230128298A/ko
Priority to CN202180094793.6A priority patent/CN116963722A/zh
Priority to JP2023540026A priority patent/JP2024503302A/ja
Publication of WO2022144811A1 publication Critical patent/WO2022144811A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/107Emulsions ; Emulsion preconcentrates; Micelles
    • A61K9/1075Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/10Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/16Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing nitrogen, e.g. nitro-, nitroso-, azo-compounds, nitriles, cyanates
    • A61K47/18Amines; Amides; Ureas; Quaternary ammonium compounds; Amino acids; Oligopeptides having up to five amino acids
    • A61K47/183Amino acids, e.g. glycine, EDTA or aspartame
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/22Heterocyclic compounds, e.g. ascorbic acid, tocopherol or pyrrolidones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542Carboxylic acids, e.g. a fatty acid or an amino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6907Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a microemulsion, nanoemulsion or micelle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/107Emulsions ; Emulsion preconcentrates; Micelles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0041Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • the blood–brain barrier is a highly selective semipermeable border that separates the circulating blood from the brain and extracellular fluid in the central nervous system (CNS).
  • the blood–brain barrier is formed by endothelial cells of the capillary wall, astrocyte end- feet ensheathing the capillary, and pericytes embedded in the capillary basement membrane. This system allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are crucial to neural function.
  • the blood–brain barrier restricts the passage of pathogens, the diffusion of solutes in the blood, and large or hydrophilic molecules into the cerebrospinal fluid (CSF), while allowing the diffusion of O 2 , CO 2 , hydrophobic molecules (e.g., hormones), and small polar molecules (Johansen et al., (2017) Journal of Cerebral Blood Flow and Metabolism. Epub (4): 659-668).
  • the BBB excludes from the brain almost 100% of large-molecule neurotherapeutics and more than 98% of all molecule drugs. Daneman & Prat (2015) “The Blood Brain Barrier” Cold Spring Harbor Perspectives in Biology 7(1):a020412.
  • polynucleotides have poor bioavailability and uptake into cells, typically less than 1% (Dheur et al, Nucleic Acid Drug Dev., 9:522 (1999); Park et al, J Controlled Release, 93:188 (2003)). Since most polynucleotides are generally above 5,000 Da, they cannot readily diffuse through cellular membranes and uptake into cells is limited primarily to pinocytotic or endocytotic processes. Once inside the cell, polynucleotides can accumulate in lysosomal compartments, limiting their access to the cytoplasm or the nucleus. Parenterally administered polynucleotides are also highly susceptible to rapid nuclease degradation both inside and outside the cytoplasm.
  • the problems facing the delivery of polynucleotide can roughly be divided into two parts.
  • the therapeutic polynucleotide must be formulated in such a way that it can be delivered to the cytoplasm and second, the polynucleotide must reach the cell nucleus intact and fully functional.
  • oligonucleotides and oligonucleotide analogs as therapeutics, the need exists for delivery systems providing improved pharmacological properties, e.g., serum stability, delivery to the right organ, tissue, or cell, and transmembrane delivery.
  • Efforts aimed at improving the transmembrane delivery of nucleic acids and oligonucleotides have utilized protein carriers, antibody carriers, liposomal delivery systems, electroporation, direct injection, cell fusion, viral vectors, and calcium phosphate-mediated transformation.
  • many of these techniques are limited by the types of cells in which transmembrane transport is enabled and by the conditions needed for achieving such transport.
  • the present disclosure provides a cationic carrier unit comprising [CC]-L1-[CM]-L2-[HM] (Schema I); [CC]-L1-[HM]-L2-[CM] (Schema II); [HM]-L1-[CM]-L2-[CC] (Schema III) [HM]-L1-[CC]-L2-[CM] (Schema IV); [CM]-L1-[CC]-L2-[HM] (Schema V); or [CM]-L1-[HM]-L2-[CC] (Schema VI); wherein CC is a positively charged carrier moiety; CM is a crosslinking moiety; HM is a hydrophobic moiety; and, L1 and L2 are independently optional linkers, and wherein the number of HM is less than about 50% relative to [CC] and [CM].
  • the number of HM is less than about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or about 1% relative to [CC] and [CM].
  • the number of HM is between about 50% and about 1%, about 50% and about 5%, about 50% and about 10%, about 50% and about 15%, about 50% and about 20%, about 50% and about 25%, about 50% and about 30%, about 50% and about 35%, about 50% and about 40%, about 50% and about 45%, about 45% and about 1%, about 45% and about 5%, about 45% and about 10%, about 45% and about 15%, about 45% and about 20%, about 45% and about 25%, about 45% and about 30%, about 45% and about 35%, about 45% and about 40%, about 40% and 1%, about 50% and about 5%, about 40% and about 10%, about 40% and about 15%, about 40% and about 20%, about 40% and about 25%, about 40% and about 30%, about 40% and about 35%, about 35% and about 1%, about 35% and about 5%, about 35% and about 10%, about 35% and about 15%, about 35% and about 20%, about 35% and about 25%, about 35% and about 30%, about 30% and about 1%, about 30% and about 5%, about 50%
  • the number of HM is between about 50% and about 40%, about 40% and about 30%, about 30% and about 20%, about 20% and about 10%, about 10% and about 5%, and about 5% and about 1%. In some aspects, the number of HM is about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, or about 1%.
  • the cationic carrier unit is capable of interacting with an anionic payload.
  • the anionic payload comprises a nucleotide sequence having less than 200 nucleotides in length.
  • the anionic payload comprises a nucleotide sequence having less than about 150, about 140, about 130, about 120, about 110, about 100, about 90, about 80, about 70, about 60, about 50, about 40, about 30, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, or about 10 nucleotides in length.
  • the anionic payload comprises a nucleotide sequence having from about 30 to about 10, from about 25 to about 11, from about 30 to about 15, from about 25 to about 15, from about 24 to about 15, or from about 23 to about 15 nucleotides in length.
  • the anionic payload comprises a nucleotide sequence having about 30, about 29, about 28, about 27, about 26, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, or about 13 nucleotides in length. In some aspects, the anionic payload comprises a nucleotide sequence having about 22 nucleotides in length.
  • the anionic paylod comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.
  • the cationic carrier unit further comprises a water-soluble polymer (WP).
  • WP water-soluble polymer
  • the water-soluble polymer is attached to [CC], [HM], or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC], [HM], or [CM].
  • the water-soluble polymer is attached to the C terminus of [CC], [HM], or [CM].
  • the cationic carrier unit comprises: [WP]-L3]-[CC]-L1-[CM]-L2-[HM] (Schema I’); [WP]-L3]-[CC]-L1-[HM]-L2-[CM] (Schema II’); [WP]-L3]-[HM]-L1-[CM]-L2-[CC] (Schema III’); [WP]-L3]-[HM]-L1-[CC]-L2-[CM] (Schema IV’); [WP]-L3]-[CM]-L1-[CC]-L2-[HM] (Schema V’); or [WP]-L3]-[CM]-L1-[HM]-L2-[CC] (Schema VI’).
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ - hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ”) poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises: wherein n is 1-1000. [0015] In some aspects, n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, or about 150 to about 160.
  • the water-soluble polymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at last about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55
  • the cationic carrier moiety comprises at least 20, at least 30, at least 40, at least 50, at least 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, or at least about 150 basic amino acids.
  • the cationic carrier moiety comprises about 10 to about 60, about 15 to about 60, about 20 to about 60, about 25 to about 60, about 30 to about 60, about 35 to about 60, about 40 to about 60, about 10 to about 55, about 15 to about 55, about 20 to about 55, about 25 to about 55, about 30 to about 55, about 35 to about 55, about 40 to about 55, about 10 to about 50, about 15 to about 50, about 20 to about 50, about 25 to about 50, about 30 to about 50, about 35 to about 50, about 40 to about 50, about 10 to about 45, about 15 to about 45, about 20 to about 45, about 25 to about 45, about 30 to about 45, about 35 to about 45, about 40 to about 45, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 25 to about 40, about 30 to about 40, about 35 to about 40, about 35 to about 40, about 45, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 25 to about 40, about 30 to about 40, about 35 to
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 10, about 20, about 30, about 40, about 50, or about 60 basic amino acids. In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the cationic carrier moiety comprises about 20, about 30, about 40, about 50, or about 60 lysines. In some aspects, the cationic carrier moity comprises about 32 lysines. [0019] In some aspects, the crosslinking moiety comprises one or more amino acids linked to a crosslinking agent.
  • the crosslinking agent comprises a thiol group, a thiol, derivative, or any combination thereof.
  • the crosslinking moiety comprises a thiol group.
  • the amino acids in the crosslinking moiety comprise at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39 or at least 40 basic amino acids.
  • the amino acids in the crosslinking moiety comprise about 1 to about 40, about 5 to about 40, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 1 to about 35, about 5 to about 35, about 10 to about 35, about 15 to about 35, about 20 to about 35, about 1 to about 30, about 5 to about 30, about 10 to about 30, about 15 to about 30, about 20 to about 30, about 1 to about 25, about 5 to about 25, about 10 to about 25, about 15 to about 25, about 20 to about 25, about 1 to about 20, about 5 to about 20, about 10 to about 20, about 15 to about 20, about 1 to about 15, about 5 to about 15, about 10 to about 15, about 1 to about 10, about 5 to about 10, or about 1 to about 5 basic amino acids.
  • the amino acids in the crosslinking moiety comprise about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 basic amino acids.
  • the basic amino acids in the crosslinking moiety comprise arginine, lysine, histidine, or any combination thereof.
  • the basic amino acids in the crosslinking moiety comprise about 5, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, or about 40 lysines.
  • the basic amino acids in the crosslinking moiety comprise about 10 to about 20 lysines.
  • the basic amino acids in the crosslinking moiety comprises about 16 lysines.
  • the hydrophobic moiety is capable of modulating an immune response, an inflammatory response, or a tissue microenvironment. In some aspects, the hydrophobic moiety is capable of modulating an immune response. In some aspects, the hydrophobic moiety is capable of modulating a tumor microenvironment in a subject with a tumor. [0023] In some aspects, the hydrophobic moiety is capable of inhibiting or reducing hypoxia in the tumor microenvironment. In some aspects, the hydrophobic moiety comprises one or more amino acids linked to an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the hydrophobic moiety is capable of inhibiting or reducing an inflammatory response.
  • the hydrophobic moiety is one or more amino acids linked to a vitamin.
  • the vitamin comprises a cyclic ring or cyclic heteroatom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: wherein each of Y1 and Y2 are independently selected from C, N, O, and S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the hydrophobic moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53,
  • the hydrophobic moiety comprises at least 20, at least 30, at least 40, at least 50, at least 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, or at least about 150 amino acids, each linked to a vitamin.
  • the hydrophobic moiety comprises about 10 to about 60, about 15 to about 60, about 20 to about 60, about 25 to about 60, about 30 to about 60, about 35 to about 60, about 40 to about 60, about 10 to about 55, about 15 to about 55, about 20 to about 55, about 25 to about 55, about 30 to about 55, about 35 to about 55, about 40 to about 55, about 10 to about 50, about 15 to about 50, about 20 to about 50, about 25 to about 50, about 30 to about 50, about 35 to about 50, about 40 to about 50, about 10 to about 45, about 15 to about 45, about 20 to about 45, about 25 to about 45, about 30 to about 45, about 35 to about 45, about 40 to about 45, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 25 to about 40, about 30 to about 40, about 35 to about 40, about 35 to about 40, about 35 to about 40, about 35 to about 40, about 35 to about 40, about 10 to about 40, about 15 to about 40, about 20 to about 40, about
  • the hydrophobic moiety comprises about 10, about 20, about 30, about 40, about 50, or about 60 amino acids, each linked to a vitamin. [0028] In some aspects, the hydrophobic moiety comprises about 10 amino acids, about 20 amino acids, about 30 amino acids, about 40 amino acids, or about 50 amino acids, each linked to vitamin B3. [0029] In some aspects, the cationic carrier unit comprises about 25 to about 40 lysines, the crosslinking moiety comprises about 10 to about 20 lysine-thiol, and the hydrophobic moiety comprises about 25 to about 40 lysine-vitamin B3.
  • the cationic carrier moiety comprises about 30 to about 35 lysines, the crosslinking moiety comprises about 13 to about 20 lysine-thiol, and the hydrophobic moiety comprises about 30 to about 35 lysine-vitamin B3.
  • the cationic carrier moiety comprises about 32 lysines, the crosslinking moiety comprises about 16 lysine-thiol, and the hydrophobic moiety comprises about 32 lysine-vitamin B3.
  • the cationic carrier unit comprises about 35 to about 60 lysines, the crosslinking moiety comprises about 5 to about 15 lysine-thiol, and the hydrophobic moiety comprises about 15 to about 30 lysine-vitamin B3.
  • the cationic carrier unit comprises a water-soluble biopolymer moiety, wherein the water-soluble biopolymer moiety comprises about 120 to about 130 PEG units.
  • the cationic carrier unit further comprises a targeting moiety (TM).
  • the targeting moiety is capable of targeting a tissue.
  • the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.
  • the targeting moiety is capable of being transported by large neutral amino acid transporter 1 (LAT1).
  • the targeting moiety is an amino acid.
  • targeting moiety comprises a branched-chain or aromatic amino acid.
  • the targeting moiety is phenylalanine, valine, leucine, and/or isoleucine. In some aspects, the amino acid is phenylalanine. In some aspects, the targeting moiety is linked to the water-soluble polymer. In some aspects, the targeting moiety is linked to the water-soluble polymer by a linker. [0033]
  • the present disclosure also provides a micelle comprising the cationic carrier unit disclosed herein and an anionic payload, wherein the cationic carrier moiety of the cationic carrier complex and the anionic payload are associated with each other. In some aspects, the association is a covalent bond. In other aspects, the association is a non-covalent bond. In some aspects, the association is an ionic bond.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with an anionic payload in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the anionic payload in the solution is about 1:3 and about 3:1.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with an anionic payload in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the anionic payload in the solution is about 1:3, about 1:2.5; about 1:2, about 1:1.5; about 1:1, about 1:0.5; about 0.5:1, about 1.5:1; about 2:1, about 2.5:1, or about 3:1.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with an anionic payload in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the anionic payload in the solution is about 1:3, about 1:2.5; about 1:2, about 1:1.5; about 1:1, about 1:0.5; about 0.5:1, about 1.5:1; about 2:1, about 2.5:1, or about 3:1.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with an anionic payload in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the anionic payload in the solution is about 1:1.
  • the cationic carrier unit is capable of protecting the anionic payload from degradation by a DNase and/or an RNase.
  • the anionic payload is not conjugated to the cationic carrier unit by a covalent bond and/or the anionic payload interacts with the cationic carrier moiety of the cationic carrier unit only via an ionic interaction.
  • the half-life of the anionic payload is extended compared to the half-life of a free anionic payload not incorporated into a micelle.
  • the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the anionic payload in the micelle are at an ionic ratio of about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1
  • the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the anionic payload in the micelle are at an ionic ratio of about 3:1 to about 1:3.
  • the diameter of the micelle is between about 1nm and 100nm, between about 10nm and about 100nm, between about 10nm and about 90nm, between about 10nm and about 80nm, between about 10nm and about 70nm, between about 20nm and about 100nm, between about 20nm and about 90nm, between about 20nm and about 80nm, between about 20nm and about 70nm, between about 30nm and about 100nm, between about 30nm and about 90nm, between about 30nm and about 80nm, between about 30nm and about 70nm, between about 40nm and about 100nm, between about 40nm and about 90nm, between about 40nm and about 80nm, or between about 40nm and about 70nm.
  • the anionic payload comprises a nucleic acid.
  • the nucleic acid comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.
  • the nucleic acid comprises at least one nucleoside analog.
  • the nucleoside analog comprises Locked Nucleic Acid (LNA); 2'-0-alkyl-RNA; 2'-amino-DNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'- MOE), or any combination thereof.
  • the nucleic acid comprises a nucleotide sequence having 5 to 30 nucleotides in length.
  • the nucleotide sequence is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
  • the nucleotide sequence has a backbone, which comprises a phosphodiester linkage, a phosphotriester linkage, a methylphosphonate linkage, a phosphoramidate linkage, a phosphorothioate linkage, and combinations thereof.
  • the nucleic acid comprises the nucleotide sequence as set forth in SEQ ID NO: 18 (miR-4853p inhibitor).
  • the present disclosure also provides a composition comprising the cationic carrier unit disclosed herein and a negatively charged molecule.
  • composition comprising a cationic carrier unit, composition, or micelle disclosed herein, and a pharmaceutically acceptable carrier.
  • the present disclosure also provides a method of preparing the cationic carrier unit disclosed herein comprising linking the cationic carrier moiety to the crosslinking moiety and the hydrophobic moiety. In some aspects, the method further comprises linking a water-soluble polymer and a targeting moiety. In some aspects, the method of preparing a micelle disclosed herein comprises mixing the cationic carrier unit with the anionic payload at an ionic ratio of 1:1 in solution. In some aspects, the method of preparing a micelle disclosed herein comprises mixing the cationic carrier unit with the anionic payload at an ionic ratio of 2:1 in solution.
  • the method of preparing a micelle disclosed herein comprises mixing the cationic carrier unit with the anionic payload at an ionic ratio between about 1:3 and about 3:1 in solution. In some aspects, the method further comprises purifying the micelle. [0042]
  • the present disclosure also provides a method of treating a disease or condition in a subject in need thereof comprising administering a micelle or the pharmaceutical composition of the present disclosure to the subject.
  • the anionic payload in the core of the micelle exhibits a longer half-life than a corresponding anionic payload not integrated into a micelle.
  • the subject is a mammal.
  • the present disclosure also provides a method to reduce inflammation in a subject suffering from a neurodegenerative disease comprising administering a therapeutically effective amount of a micelle disclosed herein to the subject.
  • the present disclosure also provides a method to recover and/or induce neurogenesis in a subject suffering from a neurodegenerative disease comprising administering a therapeutically effective amount of a micelle disclosed herein to the subject.
  • the present disclosure also provides a method to improve cognitive function in a subject suffering from a neurodegenerative disease comprising administering a therapeutically effective amount of a micelle disclosed herein to the subject.
  • the neurodegenerative disease is Alzheimer’s disease.
  • FIGs. 1A-1D show exemplary architectures of carrier units and micelles of the present disclosure.
  • the exemplary carrier units comprise an optional tissue-specific targeting moiety, water-soluble polymer, and cationic carrier unit, comprising a cationic moiety, crosslinking moiety, and hydrophobic moiety, (which can, respectively, interact with anionic payloads) (FIG.1A).
  • the cationic carrier and anionic payload are not tethered and interact electrostatically.
  • FIG. 1B shows a schematic diagram of an anionic payload.
  • the cationic carrier and anionic payload are tethered and interact electrostatically.
  • FIG. 1C shows a schematic diagram of a micelle comprising a cationic carrier and anionic payload of FIGs.1A and 1B.
  • FIG.1D shows a shematic diagram of siRNA and cholesterol conjugated siRNA (e.g., an anionic payload).
  • FIGs. 2A-2I show exemplary compositions of cationic carrier units.
  • FIG. 2A shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein all lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+).
  • a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein all lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+).
  • a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein all lysine residues are unmodified (e.g., contain a positively charged amine, e
  • 2B shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 45 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH 3 + ) and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 45 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH 3 + ) and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • FIG.2C shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3 + ) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a targeting moiety e.g., water-soluble polymer
  • a cationic carrier unit comprising 60 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3 + ) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • FIG.2D shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain positively charged quaternary amine) and wherein 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 20 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • 2E shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 60 lysine residues are unmodified (e.g., contain positively charged quaternary amine) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • 2F shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 50 lysine residues are unmodified (e.g., contain positively charged quaternary amine) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 25 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • 2G shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 45 lysine residues are unmodified (e.g., contain positively charged quaternary amine) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIG.2H shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 40 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH 3 + ) and wherein 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • FIG.2H shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 40 lysine residues are unmodified (e.g., contain a positively charged amine, e.
  • FIG. 2I shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 35 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3 + ) and wherein 15 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIG. 3 shows a tissue specific targeting polymer structure for nucleotide micelle delivery and 1 H-NMR characteristics of a carrier.
  • the 1 H-NMR chart corresponding to the targeting moiety shows that that the targeting moiety (an amino acid moiety containing a ring structure that binds to the LAT1 target on the brain endothelium) was successfully synthesized.
  • a second 1 H-NMR chart shows that the cationic PEG block copolymer (comprising also the cationic carrier moiety and hydrophobic moiety) was also synthesized.
  • FIG. 4A-4E show exemplary compositions of cationic carrier units for antisense oligonucleotide (ASO) micelles.
  • FIG. 4A shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 60 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ).
  • FIG. 4A shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 60 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ).
  • FIG. 4A shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene
  • FIG. 4B shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 45 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 45 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • FIG. 4C shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • 4D shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, wherein 30 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ) and wherein 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 20 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIG.4E shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 35 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 15 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIGs.5A-5E shows particle size and count rate at increasing N/P ratios for different composition of cationic carrier unit and antisense oligonucleotide (ASO) micelles measured by Zeta-sizer.
  • FIG. 5A shows a schematic representation of Compound A (see FIG. 4A).
  • FIG. 5B shows a schematic representation of Compound B (see FIG. 4B).
  • FIG. 5C shows a schematic representation of Compound C (see FIG. 4C).
  • FIG. 5D shows a schematic representation of Compound D (see FIG.4D).
  • FIG.5E shows a schematic representation of Compound I (see FIG. 4E).
  • FIG.5A-5E shows the count rate, polydisperse index (PDI) and size of micelles comprising 21 mer nucleotides (e.g., anionic payload) and Compound A-D and I as the cationic carrier unit from an N/P ratio of 0.2-2.4.
  • FIG. 6 shows that the expression of SIRT1 and PGC-1 ⁇ increases in mouse brain cortex after a single intraventricular administration of micelles encapsulating miR-485 inhibitors (SEQ ID NO: 18) (labeled “RNA”). The expression levels of SIRT1 (left graph) and PGC-1 ⁇ (right graph) at 6, 24, 48, and 72 hours after administration of the miR-485 inhibitor -loaded micelles (100 ⁇ g/mouse) are provided.
  • FIG. 7 shows that the expression of SIRT1 and PGC-1 ⁇ increases in the hippocampus of mouse brain after a single intraventricular administration of RNA-loaded micelles, i.e., micelles encapsulating miR-485 inhibitors (SEQ ID NO: 18).
  • FIG. 8 shows that the expression of CD36 increases in mouse brain after a single after a single intraventricular administration of micelles containing miR-485 inhibitor (100 ⁇ g/mouse).
  • FIG. 9 shows a schematic diagram of molecular forces driving micelle formation between cholesterol-conjugated siRNA and the carrier units described herein.
  • FIGs. 10A-10D show exemplary compositions of cationic carrier units for cholesterol-conjugated siRNA micelles.
  • 10A shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 60 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIG.10B shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 50 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 25 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • 10C shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 45 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • 10D shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 40 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • FIGs. 11A-11D show the molar ratio between polymer (e.g., carrier units) and cholesterol-conjugated siRNA and their corresponding size (nanometers) for the micelles of FIGs. 10A-10D, respectively.
  • FIG.12 shows a chart representing the changes in micelle encapsulation efficiency with hydrophobic interactions for the carrier units shown in FIGs.10A-10D.
  • FIG. 13 shows a carrier unit for optimal cholesterol-conjugated siRNA (e.g., 14 ⁇ 30 mer) micelle encapsulation.
  • FIG. 14 shows the molecular forces for micelle formation between siRNA and polymer (e.g., carrier unit described herein).
  • FIG. 15A-15E show exemplary compositions of cationic carrier units for siRNA (e.g., a 21-mer) micelles.
  • FIG. 15A shows a carrier unit comprising a targeting moiety, water- soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 60 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIG. 15B shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 50 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 25 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • 15C shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 45 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH3 + ) and wherein 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • 15D shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 40 lysine residues are unmodified (e.g., contain a positively charges amine, e.g., -NH 3 + ) and wherein 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • 15E shows a carrier unit comprising a targeting moiety, water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, wherein 35 lysine residues are unmodified (e.g., contain a positivitly charges amine, e.g., -NH3 + ) and wherein 15 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkyl thiol, or lysine-thiol), and wherein 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).
  • a hydrophobic moiety e.g., a vitamin
  • FIG. 16A-16E shows particle size and count rate at increasing N/P ratios for different composition of cationic carrier unit and siRNA (e.g., 21 mer) micelles measured by Zeta- sizer.
  • FIG. 16A shows a schematic representation of Compound E (see FIG. 15A).
  • FIG. 16B shows a schematic representation of Compound F (see FIG. 15B).
  • FIG. 16C shows a schematic representation of Compound G (see FIG. 15C).
  • FIG. 16D shows a schematic representation of Compound H (see FIG. 15D).
  • FIG. 16E shows a schematic representation of Compound I (see FIG. 15E).
  • FIG. 16A-16E also shows the count rate and size of micelles comprising 21-mer nucleotides (e.g., anionic payload) and Compound E-I as the cationic carrier unit from an N/P ratio of 0.2-2.4.
  • FIGs. 17A-17E show the molar ratio between polymer (e.g., carrier units) and siRNA for the micelles of FIGs.15A-15E, respectively (i.e., Compounds E, F, G, H, and I).
  • FIG. 18 shows a carrier unit for optimal siRNA (e.g., 14 ⁇ 30 mer) micelle encapsulation.
  • FIG. 17A-17E show the molar ratio between polymer (e.g., carrier units) and siRNA for the micelles of FIGs.15A-15E, respectively (i.e., Compounds E, F, G, H, and I).
  • FIG. 18 shows a carrier unit for optimal siRNA (e.g., 14 ⁇ 30 mer) micelle en
  • FIGs.20A and 20B show in vitro mRNA knock-down efficacy of siRNA micelles using Luciferase assay measured by IVIS ® .
  • carrier units comprising a water-soluble biopolymer moiety (e.g., PEG), a charged moiety (e.g., a polylysine), a crosslinking moiety, and a hydrophobic moiety.
  • the cationic carrier units can be packaged into micelles when the units interact with anionic payloads, wherein the payload is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent, wheren the crosslinking moiety crosslinks one unit to other carrior units, and wherein the hydrophobic moiety is exposed on the surface of the micelles.
  • anionic payloads wherein the payload is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent, wheren the crosslinking moiety crosslinks one unit to other carrior units, and wherein the hydrophobic moiety is exposed on the surface of the micelles.
  • ranges recited are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints.
  • a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
  • nucleotide sequences are written left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-letter symbols recommended by the IUPAC- IUB Biochemical Nomenclature Commission. Accordingly, ‘a’ represents adenine, ‘c’ represents cytosine, ‘g’ represents guanine, ‘t’ represents thymine, and ‘u’ represents uracil. [0080] Amino acid sequences are written left to right in amino to carboxy orientation. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • the term “about” is used herein to mean approximately, roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower).
  • administration refers to introducing a composition, such as a micelle of the present disclosure, into a subject via a pharmaceutically acceptable route.
  • a composition such as a micelle of the present disclosure
  • introduction of a composition is by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intra-arterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly or topically.
  • Administration includes self-administration and the administration by another.
  • a suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
  • the term “approximately,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain aspects, the term “approximately” refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.
  • Any amino acids, e.g., lysines, used in the context of the cationic carrier possess a positive charge by having its natural side group (e.g., -NH3 + for lysine) or by having a modified side gropu.
  • any amino acids, e.g., lysines, used in the context of the crosslinking moiety or the hydrophobic moiety may not possess any positive charges and can be linked to a crosslinking agent (e.g., thiol) or a hydrophobic agent (e.g., vitamin B3), respectively, by an amide bond or a linker.
  • a crosslinking agent e.g., thiol
  • a hydrophobic agent e.g., vitamin B3
  • two or more sequences are said to be “completely conserved” or “identical” if they are 100% identical to one another.
  • two or more sequences are said to be “highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another.
  • two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another.
  • two or more sequences are said to be "conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “conserved” if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence may apply to the entire length of a polynucleotide or polypeptide or may apply to a portion, region or feature thereof.
  • derived from refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism.
  • a nucleic acid sequence that is derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence.
  • the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis.
  • the mutagenesis used to derive nucleotides or polypeptides can be intentionally directed or intentionally random, or a mixture of each.
  • the mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide or polypeptide can be made by appropriate screening methods, e.g., as discussed herein.
  • Mutagenesis of a polypeptide typically entails manipulation of the polynucleotide that encodes the polypeptide.
  • a nucleotide or amino acid sequence that is derived from a second nucleotide or amino acid sequence has a sequence identity of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 8
  • complementary and complementarity refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules.
  • nucleobase sequence “T-G-A (5’ ⁇ 3’) is complementary to the nucleobase sequence “A-C-T (3’ ⁇ 5’).
  • Complementarity may be "partial,” in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules.
  • complementarity between a given nucleobase sequence and the other nucleobase sequence may be about 70%, about 75%, about 80%, about 85%, about 90% or about 95%. Or, there may be "complete” or “perfect” (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. The degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences. [0090]
  • downstream refers to a nucleotide sequence that is located 3’ to a reference nucleotide sequence. In certain aspects, downstream nucleotide sequences relate to sequences that follow the starting point of transcription.
  • the translation initiation codon of a gene is located downstream of the start site of transcription.
  • excipient and “carrier” are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound.
  • the term “homology” refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Generally, the term “homology” implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous will have a common evolutionary ancestor. In the context of the present disclosure, the term homology encompasses both identity and similarity.
  • polymeric molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions).
  • the term "homologous” necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).
  • identity refers to the overall monomer conservation between polymeric molecules, e.g., between polypeptide molecules or polynucleotide molecules (e.g. DNA molecules and/or RNA molecules).
  • polypeptide molecules or polynucleotide molecules e.g. DNA molecules and/or RNA molecules.
  • identity without any additional qualifiers, e.g., protein A is identical to protein B, implies the sequences are 100% identical (100% sequence identity).
  • the length of a sequence aligned for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides are then compared. [0096] When a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • Suitable software programs are available from various sources, and for alignment of both protein and nucleotide sequences.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data.
  • a suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI.
  • T-Coffee available at www.tcoffee.org, and alternatively available, e.g., from the EBI.
  • the final alignment used to calculate percent sequence identity can be curated either automatically or manually.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g., a fraction) of a composition of the present disclosure from a sample containing contaminants.
  • an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount.
  • an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity.
  • the isolated composition is enriched as compared to the starting material from which the composition is obtained. This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material.
  • isolated preparations are substantially free of residual biological products.
  • the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter.
  • Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites.
  • the term "linked” as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • the term "linked” means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5’-end or the 3’-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively).
  • the first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker.
  • the linker can be, e.g., a polynucleotide.
  • miRNA or “miR” or “microRNA” are used interchangeably and refer to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. Names of miRNAs and their sequences related to the present disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression.
  • miRNA binding site can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.
  • miRNA binding site generally a molecule comprising a sequence complementary to the seed region of the miRNA
  • miRNA binding site can reduce or inhibit the miRNA-induced translational inhibition leading to an upregulation of the target gene.
  • antisense oligomers of the disclosure include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunits of the 5' and/or 3' terminus. In certain aspects, one, two, or three nucleobases can be removed and still provide on-target binding.
  • the terms “modulate,” “modify,” and grammatical variants thereof, generally refer when applied to a specific concentration, level, expression, function or behavior, to the ability to alter, by increasing or decreasing, e.g., directly or indirectly promoting/stimulating/up-regulating or interfering with/inhibiting/down-regulating the specific concentration, level, expression, function or behavior, such as, e.g., to act as an antagonist or agonist.
  • a modulator can increase and/or decrease a certain concentration, level, activity or function relative to a control, or relative to the average level of activity that would generally be expected or relative to a control level of activity.
  • Nucleic acid refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.
  • RNA molecules phosphate ester polymeric form of ribonucleosides
  • deoxyribonucleosides deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine
  • DNA molecules or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded
  • Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double stranded DNA- DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double- stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.
  • a "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein.
  • parenteral administration and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
  • pharmaceutically-acceptable carrier “pharmaceutically-acceptable excipient,” and grammatical variations thereof, encompass any of the agents approved by a regulatory agency of the U.S.
  • the term "pharmaceutical composition” refers to one or more of the compounds described herein, such as, e.g., a micelle of the present disclosure, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically-acceptable carriers and excipients.
  • polynucleotide refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • DNA triple-, double- and single-stranded deoxyribonucleic acid
  • RNA triple-, double- and single-stranded ribonucleic acid
  • polynucleotide includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids "PNAs”) and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
  • PNAs peptide nucleic acids
  • a polynucleotide can be, e.g., an oligonucleotide, such as an antisense oligonucleotide.
  • the oligonucleotide is an RNA.
  • the RNA is a synthetic RNA.
  • the synthetic RNA comprises at least one unnatural nucleobase.
  • all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine).
  • polypeptide polypeptide
  • peptide protein
  • protein polymers of amino acids of any length.
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • polypeptide refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly, disulfide linkages are found in multichain polypeptides.
  • the term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • prevent refers partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment.
  • prophylactic refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • a “prophylaxis” refers to a measure taken to maintain health and prevent or delay the onset of a bleeding episode, or to prevent or delay symptoms associated with a disease or condition.
  • similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the amino acids are compared, e.g., according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
  • subject refers to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • domestic animals e.g., dogs, cats and the like
  • farm animals e.g., cows, sheep, pigs, horses and the like
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like
  • the phrase "subject in need thereof” includes subjects, such as mammalian subjects, that would benefit from administration of a micelle of the disclosure, e.g., to improve hemostasis.
  • systemic administration means the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
  • terapéuticaally effective amount is the amount of reagent or pharmaceutical compound comprising a micelle of the present disclosure that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a "prophylactically effective amount” as prophylaxis can be considered therapy.
  • treat refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • the term also include prophylaxis or prevention of a disease or condition or its symptoms thereof.
  • the term “treating” or “treatment” means inducing an immune response in a subject against an antigen.
  • upstream refers to a nucleotide sequence that is located 5’ to a reference nucleotide sequence. II.
  • Carrier Units [0125] The present disclosure provides carrier units that can self-assemble into micelles or be incorporated into micelles.
  • Carrier units of the present disclosure comprise a water-soluble biopolymer moiety (e.g., PEG), a charged carrier moiety, a crosslinking moiety, and a hydrophobic moiety.
  • the charged carrier moiety is cationic (e.g., a polylysine), as exemplified in FIGs. 1A-1D and 2A-2I.
  • the cationic charged carrier moiety and the anionic payloads can electrostatically interact with each other.
  • Carrier unit:payload complexes can self-associate, alone or in combination with other molecules, to yield micelles in which the anionic payload is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent.
  • the term "micelles of the present disclosure” encompasses not only classic micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes. Given that polymersomes comprise a luminal space, it is to be understood that all the disclosures related to the "core" of classic micelles are equally applicable to the luminal space in polymersomes comprising carrier units of the present disclosure.
  • the carrier units of the present disclosure can also comprise a targeting moiety (e.g., a targeting ligand) covalently linked to the water-soluble biopolymer moiety via one or more optional linkers.
  • the targeting moiety can be located on the surface of the micelle and can deliver the micelle to a specific target tissue, to a specific cell type, and/or facilitate transport across a physiological barrier (e.g., cell plasma membrane or BBB) (FIG.1C).
  • the micelles of the present disclosure can comprises more than one type of targeting moiety.
  • the carrier units of the present disclosure can also comprise a hydrophobic moiety (HM) covalently linked to the charged cationic carrier moiety.
  • the hydrophobic moiety can have, e.g., a therapeutic, a co-therapeutic effect, or positively affect the homeostasis of the target cell or target tissue.
  • the HM comprises one or more amino acids.
  • the HM compises one or more amino acids linked to a hydrophobic molecule (e.g., a vitamin).
  • the HM comprises one or more lysine residues covalently bound to a hydrophobic molecule (e.g., a vitamin).
  • the anionic payload is not covalently linked to the carrier unit.
  • the cationic payload can be covalently linked to the cationic carrier unit, e.g., a linker such as cleavable linker.
  • Non-limiting examples of various aspects are shown in the present disclosure.
  • the disclosure refers in particular to the use of cationic carrier units, e.g., to deliver anionic payloads such as nucleic acids.
  • anionic payloads such as nucleic acids.
  • the disclosures can be equally applied to the delivery of cationic payloads or to the delivery of neutral payloads by reversing the charges of the carrier moiety and payload (i.e., using an anionic carrier moiety in the carrier unit to deliver a cationic payload), or by using a neutral payload linked to a cationic or anionic adapter that would electrostatically interact with an anionic or cationic carrier moiety, respectively.
  • the present disclosure provides cationic carrier units of Schemas I through Schema VI [CC]-L1-[CM]-L2-[HM] (Schema I) [CC]-L1-[HM]-L2-[CM] (Schema II); [HM]-L1-[CM]-L2-[CC] (Schema III); [HM]-L1-[CC]-L2-[CM] (Schema IV); [CM]-L1-[CC]-L2-[HM] (Schema V); or [CM]-L1-[HM]-L2-[CC] (Schema VI); wherein CC is a cationic carrier moiety, e.g., a polylysine; CM is a crosslinking moiety; HM is a hydrophobic moiety, e.g., vitamin, e.g., vitamin B3; and, L1 and L2 are independently optional linkers, and wherein the number of HM is less than about 50%
  • the cationic carrier unit further comprises a water-soluble polymer (WP).
  • WP water-soluble polymer
  • the water-soluble polymer is attached to [CC], [HM], and/or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC], [HM], or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC].
  • the water-soluble polymer is attached to the C terminus of [CC], [HM], or [CM].
  • the water-soluble polymer is attached to the C terminus of [CC].
  • the cationic carrier unit comprises: [WP]-L3-[CC]-L1-[CM]-L2-[HM] (Schema I’); [WP]-L3-[CC]-L1-[HM]-L2-[CM] (Schema II’); [WP]-L3-[HM]-L1-[CM]-L2-[CC] (Schema III’); [WP]-L3-[HM]-L1-[CC]-L2-[CM] (Schema IV’); [WP]-L3-[CM]-L1-[CC]-L2-[HM] (Schema V’); or [WP]-L3-[CM]-L1-[HM]-L2-[CC] (Schema VI’).
  • the cationic carrier unit is capable of interacting, e.g., electrostatically, with an anionic payload.
  • the [WP] component can be connected to at least one targeting moiety, i.e., [T] n -[WP]-... wherein n is an integer, e.g., 1, 2 or 3.
  • FIGs.2A-2I presents schematic representations of exemplary cationic carrier units of the present disclosure. For simplicity, the units in FIGs.2A-2I have been represented linearly.
  • the carrier units can comprises the CC, CM, and HM moieties organized in a branched scaffold arrangement (see FIG. 3), for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a HM (e.g., lysine linked to a hydrophobic agent,e.g., lysine linked to Vitamin B3) attached toe the N or C terminus of the CM.
  • a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or
  • cationic carrier units of the present disclosure are mixed with an anionic payload (e.g., a nucleic acid) at an ionic ratio of about 5:about 1, i.e., the number of negative charges in the anionic payload is about five times higher than the number of positive charges in the cationic carrier moiety, to about 1:about 5, i.e., the number of positive charges in the cationic carrier moiety is about five times higher than the number of negative charges in the anionic payload
  • the neutralization of negative charges in the anionic payload by positive charges in the cationic carrier moiety mainly via electrostatic interaction leads to the formation of a cationic carrier unit:anionic payload complex having an unaltered hydrophilic portion (comprising the WP moiety) and a substantially more hydrophobic portion (resulting from the association between the cationic carrier moiety plus hydrophobic moiety and crosslinking moiety and the anionic payload).
  • the hydropbobic moiety can contribute its own positive charges to the positive charges of the cationic carrier moiety, which would interact with the negative charges of the anionic payload. It is to be understood that references to the interactions (e.g., electrostatic interactions) between a cationic carrier moiety and an anionic payload also encompass interactions between the charges of a cationic carrier moiety plus hydrophobic moiety and the charges of an anionic payload. [0139] The increase in the hydrophobicity of the cationic carrier moiety of the cationic carrier unit due to the neutralization of its positive charges via electrostatic interaction with the negative charges of the anionic payload results in an amphipathic complex.
  • Such amphipathic complexes can self-organize, alone or combination with other amphipathic components, into micelles.
  • the resulting micelles comprise the WP moieties facing the solvent (i.e., the WP moieties are facing the external surface of the micelle) (FIG. 1C), whereas the CC, CM, and HM moieties as well as the associated payload (e.g., a nucleotide sequence, e.g., an oligonucleotide, an siRNA, an shRNA, an "antimir", or any combination thereof) are in the core of the micelle.
  • a nucleotide sequence e.g., an oligonucleotide, an siRNA, an shRNA, an "antimir", or any combination thereof
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 30 to about 40 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises, about 10 to about 20 lysines, each of which is linked to a crosslinking agent, e.g., 10-20 lysine-thiol, and, (c) an HM moiety, wherein the hydrophobic moiety has about 30 to
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 30 to about 35 lysines, e.g., about 32 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 15 lysines to about 20 lysines, e.g., 16 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 30 to about 35 lysines, e.g., about 32 lysines, each of which is linked to a hydrophobic agent (e.g., lysine-vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 30 to about 35 lysines, e.g., about 32 lysines
  • a CM moiety wherein the crosslinking mo
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 25 to about 35 lysines, e.g., about 30, 31, or 32 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 15 lysines to about 20 lysines, e.g., 15, 16, or 17 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 25 to about 35 lysines, e.g., about 30, 31, or 32 lysines, each of which is linked to a hydrophobic agent (e.g., lysine- vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 25 to about 35 lysines, e.g., about 30, 31, or 32 lysines
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 60 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 5 lysines to about 15 lysines, e.g., 5 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 15 to about 30 lysines, e.g., about 15 lysines, each of which is linked to a hydrophobic agent (e.g., lysine-vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 60 lysines
  • a CM moiety wherein the crosslinking mo
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 50 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 5 lysines to about 15 lysines, e.g., 5 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 15 to about 30 lysines, e.g., about 25 lysines, each of which is linked to a hydrophobic agent (e.g., lysine-vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 50 lysines
  • a CM moiety wherein the crosslinking mo
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 45 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 5 lysines to about 15 lysines, e.g., 5 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 15 to about 30 lysines, e.g., about 30 lysines, each of which is linked to a hydrophobic agent (e.g., lysine-vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 45 lysines
  • a CM moiety wherein the crosslinking mo
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 40 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 5 lysines to about 15 lysines, e.g., 10 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 15 to about 30 lysines, e.g., about 30 lysines, each of which is linked to a hydrophobic agent (e.g., lysine-vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 40 lysines
  • a CM moiety wherein the crosslinking mo
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 35 lysines; (b) a CM moiety, wherein the crosslinking moiety comprises about 5 lysines to about 15 lysines, e.g., 15 lysines, each of which is linked to a crosslinking agent (e.g., lysine-thiol); and (c) a HM moiety, wherein the hydrophobic moiety comprises about about 15 to about 30 lysines, e.g., about 30 lysines, each of which is linked to a hydrophobic agent (e.g., lysine-vitamin B3).
  • a CC moiety wherein the cationic carrier motiey comprises about 30 to about 60 lysines, e.g., about 35 lysines
  • a CM moiety wherein the crosslinking mo
  • the cationic carrier unit comprises: (a) a CC moiety, wherein the number of the cationic carrier motiey is the number of the charge (e.g., siRNA charge)/2, e.g., about 13 to about 30 for 14mer to 31mer; (b) a CM moiety, wherein the number of the crosslinking moiety (e.g., lysine-thiol) is at least one, at least two, at least three, or more; and (c) a HM moiety, wherein the hydrophobic moiety is linked to a hydrophobic agent (e.g., lysine- vitamin B3), wherein the ratio of the CM moiety and the HM moiety is 1:3, Wherein the total number of (the anionic charge/2)(X) + the number of CM (Y) + the number of HM (Z) equals or is higher than 17.
  • the charge e.g., siRNA charge
  • a CM moiety wherein the number of the crosslinking
  • the cationic carrier unit further comprises at least one targeting moiety attached to the WP moiety of the cationic carrier unit.
  • the number and/or density of targeting moieties displayed on the surface of the micelle can be modulated by using a specific ratio of cationic carrier units having targeting moieties to cationic carrier units not having targeting moieties.
  • the ratio of cationic carrier units having a targeting moiety to cationic carrier units not having a targeting moiety is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000.
  • the cationic carrier unit comprises (i) a targeting moiety (A) which targets the transporter LAT1 (e.g., phenylalanine), (ii) a water-soluble polymer which is PEG, (iii) a cationic carrier moiety comprising cationic polymer blocks which are lysine, (iv) a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties, and (v) a hydrophobic moiety comprising hydrophobic polymer blocks which are lysines linked to vitamin B3.
  • a targeting moiety A
  • targets the transporter LAT1 e.g., phenylalanine
  • a water-soluble polymer which is PEG e.g., a cationic carrier moiety comprising cationic polymer blocks which are lysine
  • a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties
  • a targeting moiety A
  • targets the transporter LAT1 e.g., phenylalanine
  • A targets the transporter LAT1 (e.g., phenylalanine)
  • A targets the transporter LAT
  • the cationic carrier unit comprises a HM, wherein the number of HM is between about 50% and about 1%, between about 50% and about 5%, between about 50% and about 10%, between about 50% and about 15%, between about 50% and about 20%, between about 50% and about 25%, between about 50% and about 30%, between about 50% and about 35%, between about 50% and about 40%, between about 50% and about 45%, between about 45% and about 1%, between about 45% and about 5%, between about 45% and about 10%, between about 45% and about 15%, between about 45% and about 20%, between about 45% and about 25%, between about 45% and about 30%, between about 45% and about 35%, between about 45% and about 40%, between about 40% and 1%, between about 50% and about 5%, between about 40% and about 10%, between about 40% and about 15%, between about 40% and about 20%, between about 40% and about 25%, between about 40% and about 30%, between about 40% and about 35%, between about 35% and about 40%, between about 40% and 1%, between about 50% and about 5%, between about 40% and
  • the number of HM is between about 50% and about 40%, between about 40% and about 30%, between about 30% and about 20%, between about 20% and about 10%, between about 10% and about 5%, or between about 5% and about 1%. In some aspects, the number of HM is about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, or about 1%. In some aspects, the number of HM is about 40% relative to [CC] and [CM]. In some aspects, the number of HM is expressed as the percentage of [HM] relative to [CC] and [CM].
  • the cationic carrier unit of the present disclosure interacts with an antisense oligonucleotide payload targeting miR-485-3p, e.g., AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18).
  • the carrier unit complexed the payload forms a micelle.
  • the vitamin B3 unit are introduced into the side chains of the HM moiety, e.g., by a coupling reaction between NH 2 groups in the lysines and COOH groups of vitamin B3, in the presence of suitable conjugation reagents, for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • suitable conjugation reagents for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • EDC 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide
  • NHS N-hydroxy succinimide
  • the present disclosure provides complexes comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure non- covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an oligonucleotide, an siRNA, an shRNA, an "antimir", or any combination thereof ), wherein the carrier unit and the payload interact electrostatically.
  • a carrier unit e.g., a cationic carrier unit unit
  • a payload e.g., an anionic payload such a nucleotide sequence, e.g., an oligonucleotide, an siRNA, an shRNA, an "antimir", or any combination thereof
  • the present disclosure provides conjugates comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an oligonucleotide, an siRNA, an shRNA, an "antimir", or any combination thereof), wherein the carrier unit and the payload interact electrostatically.
  • a carrier unit e.g., a cationic carrier unit unit
  • a payload e.g., an anionic payload such a nucleotide sequence, e.g., an oligonucleotide, an siRNA, an shRNA, an "antimir", or any combination thereof
  • the carrier unit and the payload can be linked via a cleavable linker.
  • the carrier unit and the payload in addition to interacting electrostatically, can interact covalently (e.g., after electrostatic interaction the carrier unit and the payload can be "locked” via a disulfide bond or a cleavable bond).
  • the cationic carrier unit comprises a water-soluble polymer comprising a PEG with about 120 to about 130 units, a cationic carrier moiety comprising a polylysine with about 30 to about 40 lysine units, a crosslinking moiety comprising about 10 to about 20 lysines-thiol units, and a hydrophobic moiety comprising about 30 to about 40 lysines linked to vitamin B3 units.
  • the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, e.g., an oligonucleotide (e.g., an antisense oligonucleotide), an siRNA, an shRNA, an "antimir", or any combination thereof), which interacts with the cationic carrier unit via at least one ionic bond (i.e., via electrostatic interaction) with the cationic carrier moiety of the cationic carrier unit.
  • a negatively charged payload e.g., a nucleotide sequence, e.g., an oligonucleotide (e.g., an antisense oligonucleotide), an siRNA, an shRNA, an "antimir", or any combination thereof.
  • the cationic carrier units of the present disclosure comprise at least one water-soluble biopolymer.
  • water-soluble biopolymer refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, e.g., PEG.
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ - hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble biopolymer is linear, branched, or dendritic.
  • the water-soluble biopolymer comprises polyethylene glycol (“PEG”), polyglycerol (“PG”), or poly(propylene glycol) (“PPG”).
  • PPG is less toxic than PEG, so many biological products are now produced in PPG instead of PEG.
  • the water-soluble biopolymer comprises a PEG characterized by a formula R 3 -(O-CH 2 -CH 2 ) n - or R 3 -(0-CH 2 -CH 2 ) n -O- with R 3 being hydrogen, methyl or ethyl and n having a value from 2 to 200.
  • the PEG has the formula wherein n is 1 to 1000.
  • the n of the PEG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
  • n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about
  • n is between about 50 and about 100, between about 100 and about 150, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, between about 450 and about 500, between about 500 and about 550, between about 550 and about 600, between about 600 and about 650, between about 650 and about 700, between about 700 and about 750, between about 750 and about 800, between about 800 and about 850, between about 850 and about 900, between about 900 and about 950, or between about 950 and about 1000.
  • n is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about
  • n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165. [0171] In some aspects, n is about 100 to about 150.
  • n is about 100 to about 140. In some aspects, n is about 100 to about 130. In some aspects, n is about 110 to about 150. In some aspects, n is about 110 to about 140. In some aspects, n is about 110 to about 130. In some aspects, n is about 110 to about 120. In some aspects, n is about 120 to about 150. In some aspects, n is about 120 to about 140. In some aspects, n is about 120 to about 130. In some aspects, n is about 130 to about 150. In some aspects, n is about 130 to about 140. [0172] Thus, is some aspects, the PEG is a branched PEG. Branched PEGs have three to ten PEG chains emanating from a central core group.
  • the PEG moiety is a monodisperse polyethylene glycol.
  • a monodisperse polyethylene glycol is a PEG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography. In certain formulae, a monodisperse PEG moiety is assigned the abbreviation mdPEG.
  • the PEG is a Star PEG. Star PEGs have 10 to 100 PEG chains emanating from a central core group.
  • the PEG is a Comb PEGs. Comb PEGs have multiple PEG chains normally grafted onto a polymer backbone.
  • the PEG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PEG is PEG 100 , PEG 200, PEG 300, PEG 400, PEG 500, PEG 600, PEG700, PEG800, PEG900, PEG1000, PEG1100, PEG1200, PEG1300, PEG1400, PEG1500, PEG1600, PEG1700, PEG1800, PEG1900, PEG2000, PEG2100, PEG2200, PEG2300, PEG2400, PEG 2500 , PEG1600, PEG1700, PEG1800, PEG 1900, PEG 2000, PEG 2100, PEG 2200, PEG 2300, PEG 2400, PEG 2500, PEG 2600, PEG 2700, PEG 2800, PEG 2900, PEG 3000 , PEG 3100 , PEG 3200 , PEG 3300 , PEG 3400 , PEG 3500 , PEG 3600 , PEG 3700 , PEG 3800 , PEG 3900 , PEG 3000 , PEG
  • the PEG is PEG 5000 . In some aspects, the PEG is PEG 6000 . In some aspects, the PEG is PEG 4000 . [0176] In some aspects, the PEG is monodisperse, e.g., mPEG100, mPEG200, mPEG300, mPEG 400, mPEG 500, mPEG 600, mPEG 700, mPEG 800, mPEG 900, mPEG 1000, mPEG 1100, mPEG 1200, mPEG 1300, mPEG 1400, mPEG 1500, mPEG 1600, mPEG 1700, mPEG 1800, mPEG 1900, mPEG 2000, mPEG 2100, mPEG2200, mPEG2300, mPEG2400, mPEG 2500 , mPEG1600, mPEG1700, mPEG1800, mPEG1900,
  • the mPEG is mPEG 5000 . In some aspects, the mPEG is mPEG6000. In some aspects, the mPEG is mPEG4000.
  • the water-soluble biopolymer moiety is a polyglycerol (PG) described by the formula ((R 3 —O—(CH 2 —CHOH—CH 2 O)n—) with R 3 being hydrogen, methyl or ethyl, and n having a value from 3 to 200.
  • PG polyglycerol
  • the water-soluble biopolymer moiety is a branched polyglycerol described by the formula (R 3 —O—(CH 2 —CHOR 5 —CH 2 —O)n—) with R 5 being hydrogen or a linear glycerol chain described by the formula (R 3 —O—(CH 2 — CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl.
  • the water-soluble biopolymer moiety is a hyperbranched polyglycerol described by the formula (R 3 —O—(CH 2 — CHOR 5 —CH 2 —O) n —) with R 5 being hydrogen or a glycerol chain described by the formula (R 3 — O—(CH 2 —CHOR 6 —CH 2 —O) n —), with R 6 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 7 —CH 2 —O)n—), with R 7 being hydrogen or a linear glycerol chain described by the formula (R 3 —O—(CH 2 —CHOH—CH 2 —O)n—) and R 3 being hydrogen, methyl or ethyl.
  • the PG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PG is PG100, PG200, PG300, PG400, PG500, PG600, PG700, PG800, PG 900, PG 1000, PG 1100, PG 1200, PG 1300, PG 1400, PG 1500, PG 1600, PG 1700, PG 1800, PG 1900, PG 2000, PG 2100, PG 2200, PG 2300, PG 2400, PG 2500, PG 1600, PG 1700, PG 1800, PG 1900, PG 2000, PG 2100, PG 2200, PG 2300, PG 2400, PG 2500 , PG 2600 , PG 2700 , PG 2800 , PG 2900 , PG 3000 , PG 3100 , PG 3200 , PG 3300 , PG 3400 , PG 3500 , PG 3600 , PG 3700 , PG 3800 , PG 3900 , PG 3000 , PG
  • the PG is PG5000. In some aspects, the PG is PG 6000 . In some aspects, the PG is PG 4000 . [0180] In some aspects, the PG is monodisperse, e.g., mPG 100 , mPG 200, mPG 300, mPG 400, mPG500, mPG600, mPG700, mPG800, mPG900, mPG1000, mPG1100, mPG1200, mPG1300, mPG1400, mPG1500, mPG 1600, mPG 1700, mPG 1800, mPG 1900, mPG 2000, mPG 2100, mPG 2200, mPG 2300, mPG 2400, mPG 2500, mPG 1600, mPG 1700, mPG 1800, mPG 1900, mPG 2000, mPG 2100, mPG 2200, mPG 2300, mPG 2400, mPG 2500, m
  • the water-soluble biopolymer comprises poly(propylene glycol) ("PPG").
  • PPG is characterized by the following formula, with n having a value from 1 to 1000.
  • the n of the PPG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
  • n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about
  • the n of the PPG is between about 50 and about 100, between about 100 and about 150, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, between about 450 and about 500, between about 500 and about 550, between about 550 and about 600, between about 600 and about 650, between about 650 and about 700, between about 700 and about 750, between about 750 and about 800, between about 800 and about 850, between about 850 and about 900, between about 900 and about 950, or between about 950 and about 1000.
  • the n of the PPG is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about
  • the n of the PPG is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.
  • the PPG is a branched PPG. Branched PPGs have three to ten PPG chains emanating from a central core group.
  • the PPG moiety is a monodisperse polyethylene glycol.
  • a monodisperse polyethylene glycol is a PPG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography.
  • mdPPG is assigned the abbreviation mdPPG.
  • the PPG is a Star PPG.
  • Star PPGs have 10 to 100 PPG chains emanating from a central core group.
  • the PPG is a Comb PPGs.
  • Comb PPGs have multiple PPG chains normally grafted onto a polymer backbone.
  • the PPG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PPG is PPG100, PPG200, PPG300, PPG400, PPG500, PPG600, PPG700, PPG800, PPG900, PPG1000, PPG1100, PPG1200, PPG1300, PPG1400, PPG1500, PPG1600, PPG1700, PPG1800, PPG 1900, PPG 2000, PPG 2100, PPG 2200, PPG 2300, PPG 2400, PPG 2500, PPG 1600, PPG 1700, PPG 1800, PPG 1900, PPG2000, PPG2100, PPG2200, PPG2300, PPG2400, PPG 2500 , PPG 2600 , PPG 2700 , PPG 2800 , PPG 2900 , PPG 3000 , PPG 3100 , PPG 3200 , PPG 3300 , PPG 3400 , PPG 3500 , PPG 3600 , PPG 3700 , PPG 3800 , PPG 3900 , PPG 3000 , P
  • the PPG is PPG5000. In some aspects, the PPG is PPG6000. In some aspects, the PPG is PPG4000. [0191] In some aspects, the PPG is monodisperse, e.g., mPPG100, mPPG200, mPPG300, mPPG 400, mPPG 500, mPPG 600, mPPG 700, mPPG 800, mPPG 900, mPPG 1000, mPPG 1100, mPPG 1200, mPPG1300, mPPG1400, mPPG1500, mPPG1600, mPPG1700, mPPG1800, mPPG1900, mPPG2000, mPPG2100, mPPG2200, mPPG2300, mPPG2400, mPPG 2500 , mPPG1600, mPPG1700, mPPG1800, mPPG1900, mPPG2000,
  • the mPPG is mPPG 5000 . In some aspects, the mPPG is mPPG 6000 . In some aspects, the mPPG is mPPG4000.
  • the cationic carrier units of the present disclosure comprise at least one cationic carrier moiety.
  • the term "cationic carrier" refers to a moiety or portion of a cationic carrier unit of the present disclosure comprising a plurality of positive charges that can interact and bind electrostatically an anionic payload (or an anionic carrier attached to a payload).
  • the number of positive charges or positively charged groups on the cationic carrier is similar to the number of negative charges or negatively charged groups on the anionic payload (or an anionic carrier attached to a payload).
  • the cationic carrier comprises a biopolymer, e.g., a peptide (e.g., a polylysine).
  • the cationic carrier comprises one or more basic amino acids (e.g., lysine, arginine, histidine, or a combination thereof).
  • the cationic carrier comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55,
  • the cationic carrier unit comprises at least about 30 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 35 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 40 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises at least about 60 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 80 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises about 30 to about 1000, about 30 to about 900, about 30 to about 800, about 30 to about 700, about 30 to about 600, about 30 to about 500, about 30 to about 400, about 30 to about 300, about 30 to about 200, about 30 to about 100, about 40 to about 1000, about 40 to about 900, about 40 to about 800, about 40 to about 700, about 40 to about 600, about 40 to about 500, about 40 to about 400, about 40 to about 300, about 40 to about 200, or about 40 to about 100 basic amino acids, e.g., lysines.
  • basic amino acids e.g., lysines.
  • the basic amino acids e.g., lysines
  • the basic amino acids are not modified such that they possess a quaternary amine (e.g., positive charge).
  • the cationic carrier unit comprises about 30 to about 100, about 30 to about 90, about 30 to about 80, about 30 to about 70, about 30 to about 60, about 30 to about 50, about 30 to about 40, about 40 to about 100, about 40 to about 90, about 40 to about 80, about 40 to about 70, about 40 to about 60, about 70 to about 80, about 75 to about 85, about 65 to about 75, about 65 to about 80, about 60 to about 85, or about 40 to about 500 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 900, about 200 to about 800, about 200 to about 700, about 200 to about 600, about 200 to about 500, about 200 to about 400, about 200 to about 300, about 300 to about 1000, about 300 to about 900, about 300 to about 800, about 300 to about 700, about 300 to about 600, about 300 to about 500, about 300 to about 400, about 400 to about 1000, about 400 to about 900, about 400 to about 800, about 400 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 600, about 600 to about 1000, about 600 to about 900, about 600 to about 800, about 600 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 600, about 600
  • the number of basic amino acids can be adjusted based on the length of the anionic payload and/or charge of the anionic payload (e.g., single stranded nucleic acid or double stranded nucleic acid).
  • the anionic payload e.g., single stranded nucleic acid or double stranded nucleic acid.
  • an anionic payload with a longer sequence can be paired with higher number of basic amino acids, e.g., lysines.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit can be calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.
  • an anionic payload e.g., oligonucleotide, e.g., antimir
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.3 to about 1.7, e.g., about 1.5.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.4.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.6.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.3.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., oligonucleotide, e.g., antimir (N/P ratio) is about 1.7.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., cholesterol conjugated siRNA (N/P ratio) is about 1.0.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., siRNA (N/P ratio) is about 2.0.
  • a role of the cationic carrier moiety is to neutralize negative charges on the payload (e.g., negative changes in the phosphate backbone of an antisense oligonucleotide) via electrostatic interaction, in some aspects (e.g., when the payload is a nucleic acid such as an antimir), the length of the cationic carrier, number of positively charged groups on the cationic carrier, and distribution and orientation of charges present on the cationic carrier will depend on the length and charge distribution on the payload molecule.
  • the cationic carrier comprises between about 5 and about 10, between about 10 and about 15, between about 15 and about 20, between about 20 and about 25, between about 25 and about 30, between about 30 and about 35, between about 35 and about 40, between about 40 and about 45, between about 45 and about 50, between about 50 and about 55, between about 55 and about 60, between about 60 and about 65, between about and about 70, between about 70 and about 75, or between about 75 and about 80 basic amino acids.
  • the positively charged carrier comprises between 30 and about 50 basic amino acids.
  • the positively charged carrier comprises between 70 and about 80 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the basic amino acid is a D-amino acid. In some aspects, the basic amino acid is an L-amino acid. In some aspects, the positively charged carrier comprises D- amino acids and L-amino acids. In some aspects, the basic amino comprises at least one unnatural amino acid or a derivative thereof.
  • the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4-aminomethyl-N- isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4-aminomethylcyclohexyl-alanine, L-4- piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4-guanidinobutyric acid, L-2-amino-3- guanidinopropionic acid, DL-5-hydroxylysine, pyrrolysine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof.
  • the positively charged carrier comprises about 40 lysines. In a particular aspect, the positively charged carrier comprises about 50 lysines. In a particular aspect, the positively charged carrier comprises about 60 lysines. In a particular aspect, the positively charged carrier comprises about 70 lysines. In a particular aspect, the positively charged carrier comprises about 80 lysines. In a particular aspect, the positively charged carrier comprises about 30 lysines. In a particular aspect, the positively charged carrier comprises about 40 lysines. In a particular aspect, the positively charged carrier comprises about 38 lysines. In a particular aspect, the positively charged carrier comprises about 32 lysines. In a particular aspect, the positively charged carrier comrpsies about 35 lysines.
  • the cationic carrier comprises a polymer or copolymer comprising at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63,
  • the cationic carrier comprises a polymer or copolymer comprising between about 5 and about 10 cationic groups, between about 10 and about 15 cationic groups, between about 15 and about 20 cationic groups, between about 20 and about 25 cationic groups, between about 25 and about 30 cationic groups, between about 30 and about 35 cationic groups, between about 35 and about 40 cationic groups, between about 40 and about 45 cationic groups, between about 45 and about 50 cationic groups, between about 50 and about 55 cationic groups, between about 55 and about 60 cationic groups, between about 60 and about 65 cationic groups, between about 65 and about 70 cationic groups, between about 70 and about 75 cationic groups, or between about 45 and about 50 cationic groups (e.g., amino groups).
  • amino groups e.g., amino groups
  • the cationic carrier comprises a polymer or copolymer comprising between 30 and about 50 cationic groups (e.g., amino groups). In some specific aspects, the cationic carrier comprises a polymer or copolymer comprising between 70 and about 80 cationic groups (e.g., amino groups). In some aspects, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide. [0205] In some aspects, the cationic carrier moiety binds to a single payload molecule. In other aspects, a cationic carrier moiety can bind to multiple payload molecules, which may be identical or different.
  • the positive charges of the cationic carrier moiety and negative charges of a nucleic acid payload are at an ionic ratio of about 5:1, about 4:1, about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2.1:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, about 1:3, about 1:4, or about 1:5.
  • the positive charges of the cationic carrier moiety and the negative charged of the nucleic acid payload are at a charge ratio of 1:1. In some aspects, the positive charges of the cationic carrier moiety and the negative charged of the nucleic acid payload are at a charge ratio of 2:1. In some aspects, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are at a charge ratio of 3:2. In some aspects, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are at a charge ratio of 2:3. In some aspects, the positive charges of the cationic carrier moiety and the negative charged of the nucleic acid payload are at a charge ratio of 1:1.
  • the cationic carrier moiety has a free terminus wherein the end group is a reactive group. In some aspects, the cationic carrier moiety has a free terminus (e.g., the C-terminus in a poly-lysine cationic carrier moiety) wherein the end group is an amino (-NH2) group. In some aspects, the cationic carrier moiety has a free terminus wherein the end group is an sulfhydryl group. In some apects, the reactive group of the cationic carrier moiety is attached to an hydrophobic moiety, e.g., a vitamin B3 hydrophobic moiety. c.
  • the cationic carrier units of the present disclosure comprise at least one crosslinking moiety.
  • crosslinking moiety refers to a moiety or portion of a polymer block comprising a plurality of agents that are capable of forming crosslinks.
  • the number of agents that are capable of forming crosslinks comprises an amino acid with a side chain of a crosslinking agent.
  • the CM comprises a biopolymer, e.g., a peptide (e.g., a polylysine) linked to a crosslinking agent.
  • the crosslinking moiety comprises one or more amino acids (e.g., lysine, arginine, histidine, or a combination thereof). In some aspects, the crosslinking moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 amino acids, e.g., lysines, arginines, or combinations thereof, each of which is linked to a crosslinking agent.
  • amino acids e.g., lysine, arginines, or combinations thereof.
  • the lysines of the crosslinking moeity possess a neutral charge (e.g., contain a tertiary amine).
  • lysines of the crosslinking moiety contain a thiol (e.g., lysine-thiol) and a tertiary amine, such that the lysines possess a neutral charge.
  • the crosslinking moiety forms a crosslink through the tertiary amine.
  • the crosslinking moiety forms a crosslink through the thiol.
  • lysine in the context of the crosslinking moiety, refers to lysines with a neutral charge (e.g., containing a tertiary amine), such that the lysines of the crosslinking moiety do not contribute to the overall charge of the carrier unit.
  • the lysines of the crosslinking moiety are linked to a crosslinking agent through an amide bond.
  • the crosslinking moiety comprises at least about 5 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 10 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 11 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 12 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 13 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 14 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 15 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 16 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 17 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 18 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 19 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 20 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. [0212] In some aspects, a crosslinking agent is a thiol. In some aspects, a crosslinking agent is a thiol derivative. c.
  • the cationic carrier units of the present disclosure comprise at least one hydrophobic moiety.
  • hydrophobic moiety refers to a molecular entity that can, e.g., (i) complement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and/or prophylactic agent in the target tissue or target cells, (iv) facilitate the transport of the cationic carrier unit across a physiological barrier, e.g., the BBB and/or the plasma membrane, (v) improve the homeostasis of the target tissue or target cell, (vi) contribute positively charges groups to the cationic carried moiety, or (vii) any combination thereof.
  • the lysines of the hydrophobic moeity possess a neutral charge (e.g., contain a tertiary amine).
  • lysines of the hydrophobic moiety contain a thiol (e.g., lysine-thiol) and a tertiary amine, such that the lysines possess a neutral charge.
  • the hydrophobic moiety is linked to a vitamin through the tertiary amine (e.g., a neutrally charged amine), such that the lysines of the hydrophobic moiety do not contribute to the overall charge of the carrier unit.
  • the hydrophobic moiety is linked to a vitamin through the thiol, such that the lysines of the hydrophobic moiety do not contribute to the overall charge of the carrier unit. In some aspects, the lysines of the hydrophobic moiety are linked to a vitamin through an amide bond. [0215] In some aspects, the hydrophobic moiety is capable of modulating, e.g., an immune response, an inflammatory response, or a tissue microenvironment. [0216] In some aspects, a hydrophobic moiety capable of modulating an immune response can comprise, e.g., tyrosine or dopamine. Tyrosine can be transformed into L-DOPA, and then be converted to dopamine via 2-step enzymatic reaction.
  • tyrosine is a hydrophobic moiety in cationic carrier units used for the treatment of Parkinson’s disease. Tryptophan can be converted to serotonin, a neurotransmitter thought to play a role in appetite, emotions, and motor, cognitive, and autonomic functions. Accordingly, in some aspects, cationic carrier units of the present disclosure used for the treatment of disease or conditions related to low serotonin levels comprise tryptophan as a hydrophobic moiety.
  • a hydrophobic moiety can modulate a tumor microenvironment in a subject with a tumor, for example, by inhibiting or reducing hypoxia in the tumor microenvironment.
  • the hydrophobic moiety comprises, e.g., an amino acid linked to an imidazole derivative, a vitamin, or any combination thereof.
  • the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to an imidazole derivative comprising: wherein each of G1 and G2 is independently H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to nitroimidazole. Nitroimidazoles function as antibiotics.
  • the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, nitroimidazole, or any combination thereof.
  • the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to
  • the hydrophobic moiety is capable of inhibiting or reducing an inflammatory response.
  • the hydrophobic moiety is an amino acid (e.g., lysine) linked to a vitamin.
  • the vitamin comprises a cyclic ring or cyclic heteroatom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A (retinol), vitamin B1 (Thiamine Chloride), vitamin B2 (Riboflavin), vitamin B3 (Niacinamide), vitamin B6 (Pyridoxal), vitamin B7 (Biotin), vitamin B9 (Folic acid), vitamin B12 (Cobalamin), vitamin C (Ascorbic acid), vitamin D2, vitamin D3, vitamin E (Tocopherol), vitamin M, vitamin H, a derivative thereof, and any combination thereof.
  • the vitamin is vitamin B3 (also known as niacin or nicotinic acid).
  • the hydrophobic moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, or at least about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • amino acids e.g., lysines
  • the hydrophobic moiety comprises about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 31 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 32 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 33 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 34 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the hydrophobic moiety comprises about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 31 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 32 amino acids
  • the hydrophobic moiety comprises about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 36 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 37 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 38 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 39 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the hydrophobic moiety comprises about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 36 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the hydrophobic moiety comprises about 37 amino acids
  • the hydrophobic moiety comprises about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the hydrophobic moiety comprises from about 20 to about 25 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 25 to about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 30 to about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 35 to about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 40 to about 45 amino acids (e.g., lysines), each of which is linked to vitamin B3, or about 45 to about 50 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the hydrophobic moiety comprises from about 20 to about 30 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 30 to about 40 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 40 to about 50 amino acids (e.g., lysines), each of which is linked to vitamin B3, about 25 to about 35 amino acids (e.g., lysines), each of which is linked to vitamin B3, or about 35 to about 45 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • amino acids e.g., lysines
  • Niacin is a precursor of the coenzymes nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP) in vivo.
  • NAD converts to NADP by phosphorylation in the presence of the enzyme NAD+ kinase.
  • NADP and NAD are coenzymes for many dehydrogenases, participating in many hydrogen transfer processes.
  • NAD is important in catabolism of fat, carbohydrate, protein, and alcohol, as well as cell signaling and DNA repair, and NADP mostly in anabolism reactions such as fatty acid and cholesterol synthesis.
  • Niacin produces marked anti-inflammatory effects in a variety of tissues – including the brain, gastrointestinal tract, skin, and vascular tissue – through the activation of NIACR1. Niacin has been shown to attenuate neuroinflammation and may have efficacy in treating neuroimmune disorders such as multiple sclerosis and Parkinson's disease. See Offermanns & Schwaninger (2015) Trends in Molecular Medicine 21:245-266; Chai et al (2013) Current Atherosclerosis Reports 15:325; Graff et al.
  • the cationic carrier unit comprises a targeting moiety, which is linked to the water-soluble polymer optionally via a linker.
  • targeting moiety refers to a biorecognition molecule that binds to a specific biological substance or site.
  • the targeting moiety is specific for a certain target molecule (e.g., a ligand targeting a receptor, or an antibody targeting a surface protein), tissue (e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium), or facilitate transport through a physiological barrier (e.g., a peptide or other molecule that may facilitate transport across the brain blood barrier or plasma membrane).
  • a certain target molecule e.g., a ligand targeting a receptor, or an antibody targeting a surface protein
  • tissue e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium
  • a physiological barrier e.g., a peptide or other molecule that may facilitate transport across the brain blood barrier or plasma membrane.
  • a targeting moiety can be coupled to a cationic carrier unit, and therefore, to the external surface of a micelle, whereas the micelle has the payload entrapped within its core.
  • the targeting moiety is a targeting moiety capable of targeting the micelle of the present disclosure to a tissue.
  • the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.
  • the tissue is cancer tissue, e.g., liver cancer, brain cancer, kidney cancer, lung cancer, ovary cancer, pancreas cancer, thyroid cancer, breast cancer, stomach cancer, or any combination thereof.
  • the tissue is liver.
  • the targeting moiety targeting liver is cholesterol.
  • the targeting moiety targeting liver is a ligand that binds an asialoglycoprotein receptor-targeting moiety.
  • the asialoglycoprotein receptor-targeting moiety comprises a GalNAc cluster.
  • the GalNAc cluster is a monovalent, divalent, trivalent, or tetravalent GalNAc cluster.
  • the tissue is pancreas.
  • the targeting moiety targeting pancreas comprises a ligand targeting ⁇ v ⁇ 3 integrin receptors on pancreatic cells.
  • the targeting moiety comprises an arginylglycylaspartic acid (RGD) peptide sequence (L- Arginyl-Glycyl-L-Aspartic acid; Arg-Gly-Asp).
  • RGD arginylglycylaspartic acid
  • the tissue is a tissue in the central nervous system, e.g., neural tissue.
  • the targeting moiety targeting the central nervous system is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 Large-neutral Amino Acid Transporter 1
  • LAT1 (SLC7A5) is a transporter for both the uptake of large neutral amino acids and a number of pharmaceutical drugs. LAT1 can transport drugs such as L-dopa or gabapentin.
  • a targeting moiety comprises glucose, e.g., D-glucose, which can bind to Glucose transporter 1 (or GLUT1) and cross BBB.
  • GLUT1 also known as solute carrier family 2, facilitated glucose transporter member 1 (SLC2A1), is a uniporter protein that in humans is encoded by the SLC2A1 gene. GLUT1 facilitates the transport of glucose across the plasma membranes of mammalian cells.
  • a targeting moiety comprises galactose, e.g., D-galactose, which can bind to GLUT1 transporter to cross BBB.
  • a targeting moiety comprises glutamic acid, which can bind to acetylcholinesterase inhibitor (AChEI) and/or EAATs inhibitors and cross BBB.
  • Acetylcholinesterase is the enzyme that is the primary member of the cholinesterase enzyme family.
  • acetylcholinesterase inhibitor is the inhibitor that inhibits acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia and neuromuscular junctions, which are rich in acetylcholine receptors.
  • Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors; the other being butyryl-cholinesterase inhibitors.
  • a targeting moiety is GABA, which can bind to GABA receptors to cross BBB.
  • GABA receptors are a class of receptors that respond to the neurotransmitter gamma-aminobutyric acid (GABA), the chief inhibitory compound in the mature vertebrate central nervous system.
  • GABAA and GABAB There are two classes of GABA receptors: GABAA and GABAB.
  • GABAA receptors are ligand-gated ion channels (also known as ionotropic receptors); whereas GABAB receptors are G protein-coupled receptors, also called metabotropic receptors.
  • a targeting moiety comprises tyrosine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises lysine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises glutamine, which can bind to LAT1 and cross BBB.
  • a targeting moiety comprises phenylalanine, which can bind to GABA receptors, LAT1, CNS reverse transcriptase inhibitors, and/or dopamine (DA) receptors and cross BBB.
  • Dopamine receptors are a class of G protein-coupled receptors that are prominent in the vertebrate central nervous system (CNS). Dopamine receptors activate different effectors through not only G-protein coupling, but also signaling through different protein (dopamine receptor-interacting proteins) interactions. The neurotransmitter dopamine is the primary endogenous ligand for dopamine receptors.
  • a targeting moiety comprises valine, which can bind to CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises tryptophan, which can bind to GABA receptors and/or CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises leucine, which can bind to GABA receptors and/or CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises methionine, which can bind to GABA receptors and/or CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises histidine, which can bind to GABA receptors and cross BBB.
  • a targeting moiety comprises isoleucine, which can bind to CNS reverse transcriptase inhibitors and cross BBB.
  • a targeting moiety comprises Glutathione, which can bind to GSH transporter and cross BBB. In some aspects, a targeting moiety comprises Glutathione-Met, which can bind to GSH transporter and cross BBB. In some aspects, a targeting moiety comprises Urea/Thiourea, which can bind to Nitric oxide synthase (NOS) and bind to BBB. In some aspects, a targeting moiety comprises NAD+/NADH, which is capable of crossing BBB by REDOX mechanism. In some aspects, a targeting moiety comprises purine and can cross BBB. Additional examples of targeting moieties for CNS targeting are shown in Sutera et al.
  • the tissue targeted by a targeting moiety is a skeletal muscle.
  • the targeting moiety targeting skeletal muscle is capable being transported by Large- neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 Large- neutral Amino Acid Transporter 1
  • the targeting moiety targeting a micelle of the present disclosure to the LAT1 transporter is an amino acid, e.g., a branched-chain or aromatic amino acid.
  • the amino acid is valine, leucine, and/or isoleucine.
  • the amino acid is tryptophan and/or tyrosine.
  • the amino acid is tryptophan.
  • the amino acid is tyrosine.
  • the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-DOPA, gabapentin, 3,5- I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof.
  • the LAT1 ligand is [1] l-Phenylalanine, [2] o-Sarcolysin, [3] m- Sarcolysin.
  • the LAT1 ligand is a LAT1-targeting prodrug shown below.
  • a ligand functions as a type of targeting moiety defined as a selectively bindable material that has a selective (or specific), affinity for another substance.
  • the ligand is recognized and bound by a usually, but not necessarily, larger specific binding body or "binding partner,” or "receptor.”
  • binding partner or "receptor.”
  • ligands suitable for targeting are antigens, haptens, biotin, biotin derivatives, lectins, galactosamine and fucosylamine moieties, receptors, substrates, coenzymes and cofactors among others.
  • a ligand When applied to the micelles of the present disclosure a ligand includes an antigen or hapten that is capable of being bound by, or to, its corresponding antibody or fraction thereof. Also included are viral antigens or hemagglutinins and neuraminidases and nucleocapsids including those from any DNA and RNA viruses, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses and viroids; any bacterial antigens including those of gram-negative and gram-positive bacteria, Acinetobacter, Achromobacter, Bacter
  • cancer and tumor antigens such as alpha-fetoproteins, prostate specific antigen (PSA) and CEA, cancer markers and oncoproteins, among others.
  • Other substances that can function as ligands for targeting a micelle of the present disclosure are certain vitamins (i.e. folic acid, B 12 ), steroids, prostaglandins, carbohydrates, lipids, antibiotics, drugs, digoxins, pesticides, narcotics, neuro-transmitters, and substances used or modified such that they function as ligands.
  • the targeting moiety comprises a protein or protein fragment (e.g., hormones, toxins), and synthetic or natural polypeptides with cell affinity.
  • Ligands also include various substances with selective affinity for ligators that are produced through recombinant DNA, genetic and molecular engineering. Except when stated otherwise, ligands of the instant disclosure also include ligands as defined in U.S. Pat. No. 3,817,837, which is herein incorporated by reference in its entirety.
  • a ligator functions as a type of targeting moiety defined for this disclosure as a specific binding body or "partner" or “receptor,” that is usually, but not necessarily, larger than the ligand it can bind to. For the purposes of this disclosure, it can be a specific substance or material or chemical or "reactant" that is capable of selective affinity binding with a specific ligand.
  • a ligator can be a protein such as an antibody, a nonprotein binding body, or a "specific reactor.”
  • a ligator includes an antibody, which is defined to include all classes of antibodies, monoclonal antibodies, chimeric antibodies, Fab fractions, fragments and derivatives thereof.
  • the term “antibody” encompasses an immunoglobulin whether natural or partly or wholly synthetically produced, and fragments thereof. The term also covers any protein having a binding domain that is homologous to an immunoglobulin binding domain.
  • Antibody further includes a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen.
  • antibody is meant to include whole antibodies, polyclonal, monoclonal and recombinant antibodies, fragments thereof, and further includes single-chain antibodies, humanized antibodies, murine antibodies, chimeric, mouse-human, mouse-primate, primate-human monoclonal antibodies, anti-idiotype antibodies, antibody fragments, such as, e.g., scFv, scFab, (scFab) 2 , (scFv) 2 , Fab, Fab', and F(ab') 2 , F(ab1) 2 , Fv, dAb, and Fd fragments, diabodies, and antibody-related polypeptides.
  • Antibody includes bispecific antibodies and multispecific antibodies so long as they exhibit the desired biological activity or function.
  • the targeting moiety is an antibody or a molecule comprising an antigen-binding fragment thereof.
  • the antibody is a nanobody.
  • the antibody is an ADC.
  • the terms "antibody-drug conjugate” and “ADC” are used interchangeably and refer to an antibody linked, e.g., covalently, to a therapeutic agent (sometimes referred to herein as agent, drug, or active pharmaceutical ingredient) or agents.
  • the targeting moiety is an antibody-drug conjugate. [0255] Under certain conditions, the instant disclosure is also applicable to using other substances as ligators.
  • ligators suitable for targeting include naturally occurring receptors, any hemagglutinins and cell membrane and nuclear derivatives that bind specifically to hormones, vitamins, drugs, antibiotics, cancer markers, genetic markers, viruses, and histocompatibility markers.
  • Another group of ligators includes any RNA and DNA binding substances such as polyethylenimine (PEI) and polypeptides or proteins such as histones and protamines.
  • Other ligators also include enzymes, especially cell surface enzymes such as neuraminidases, plasma proteins, avidins, streptavidins, chalones, cavitands, thyroglobulin, intrinsic factor, globulins, chelators, surfactants, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.
  • Targeting moieties also include various substances such as any proteins, protein fragments or polypeptides with affinity for the surface of any cells, tissues or microorganisms that are produced through recombinant DNA, genetic and molecular engineering.
  • the targeting moiety directs a micelle of the present disclosure to a specific tissue (i.e., liver tissue or brain tissue), to a specific type of cell (e.g., a certain type of cancer cells), or to a physiological compartment or physiological barrier (e.g., the BBB).
  • a cationic carrier unit disclosed herein can comprise, as shown, e.g., in FIGs. 2A-I, one or more linkers.
  • linker refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence), or a non-peptide linker for which its main function is to connect two moieties in a cationic carrier unit disclosed herein.
  • cationic carrier units of the present disclosure can comprise at least one linker connecting a tissue-specific targeting moiety (TM) with a water-soluble polymer (WS), at least one linker connecting a water-soluble biopolymer (WP) with cationic carrier (CC) or a hydrophobic moiety (HM) or a crosslinking moiety (CM), at least one linker connecting a cationic carrier (CC) with a hydrophobic moiety (HM), or any combination thereof.
  • two or more linkers can be linked in tandem.
  • each of the linkers can be the same or different.
  • linkers provide flexibility to the cationic carrier unit.
  • Linkers are not typically cleaved; however, in certain aspects, such cleavage can be desirable. Accordingly, in some aspects a linker can comprise one or more protease-cleavable sites, which can be located within the sequence of the linker or flanking the linker at either end of the linker sequence. [0260] In one aspect, the linker is a peptide linker.
  • the peptide linker can comprise at least about two, at least about three, at least about four, at least about five, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 amino acids.
  • the peptide linker can comprise at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 amino acids.
  • the peptide linker can comprise at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1,000 amino acids.
  • the peptide linker can comprise between 1 and about 5 amino acids, between 1 and about 10 amino acids, between 1 and about 20 amino acids, between about 10 and about 50 amino acids, between about 50 and about 100 amino acids, between about 100 and about 200 amino acids, between about 200 and about 300 amino acids, between about 300 and about 400 amino acids, between about 400 and about 500 amino acids, between about 500 and about 600 amino acids, between about 600 and about 700 amino acids, between about 700 and about 800 amino acids, between about 800 and about 900 amino acids, or between about 900 and about 1000 amino acids.
  • Examples of peptide linkers are well known in the art. In some aspects, the linker is a glycine/serine linker.
  • the peptide linker is glycine/serine linker according to the formula [(Gly)n-Ser]m where n is any integer from 1 to 100 and m is any integer from 1 to 100.
  • the glycine/serine linker is according to the formula [(Gly)x-Sery]z (SEQ ID NO: 1) wherein x in an integer from 1 to 4, y is 0 or 1, and z is an integers from 1 to 50.
  • the peptide linker comprises the sequence Gn, where n can be an integer from 1 to 100.
  • the sequence of the peptide linker is GGGG (SEQ ID NO: 2).
  • the peptide linker can comprise the sequence (GlyAla)n (SEQ ID NO: 3), wherein n is an integer between 1 and 100. In other aspects, the peptide linker can comprise the sequence (GlyGlySer)n (SEQ ID NO: 4), wherein n is an integer between 1 and 100. [0266] In other aspects, the peptide linker comprises the sequence (GGGS)n (SEQ ID NO: 5). In still other aspects, the peptide linker comprises the sequence (GGS)n(GGGGS)n (SEQ ID NO: 6). In these instances, n can be an integer from 1-100.
  • n can be an integer from one to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
  • linkers include, but are not limited to, GGG, SGGSGGS (SEQ ID NO: 7), GGSGGSGGSGGSGGG (SEQ ID NO: 8), GGSGGSGGGGSGGGGS (SEQ ID NO: 9), GGSGGSGGSGGSGGSGGS (SEQ ID NO: 10), or GGGGSGGGGSGGGGS (SEQ ID NO: 11).
  • the linker is a poly-G sequence (GGGG)n (SEQ ID NO: 12), where n can be an integer from 1-100.
  • the peptide linker is synthetic, i.e., non-naturally occurring.
  • a peptide linker includes peptides (or polypeptides) (e.g., natural or non-naturally occurring peptides) which comprise an amino acid sequence that links or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids to which it is not naturally linked or genetically fused in nature.
  • the peptide linker can comprise non-naturally occurring polypeptides that are modified forms of naturally occurring polypeptides (e.g., comprising a mutation such as an addition, substitution or deletion).
  • the peptide linker can comprise non-naturally occurring amino acids.
  • the peptide linker can comprise naturally occurring amino acids occurring in a linear sequence that does not occur in nature. In still another aspect, the peptide linker can comprise a naturally occurring polypeptide sequence. [0269] In some aspects, the linker comprises a non-peptide linker. In other aspects, the linker consists of a non-peptide linker.
  • the non-peptide linker can be, e.g., maleimido caproyl (MC), maleimido propanoyl (MP), methoxyl polyethyleneglycol (MPEG), succinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (SMCC), m-maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB), N- succinimidyl(4-iodoacetyl)aminobenzonate (SIAB), succinimidyl 6-[3-(2-pyridyldithio)- propionamide]hexanoate (LC-SPDP), 4-succinimidyloxycarbonyl-alpha-methyl-alpha-(2- pyridyldithio)toluene (SMPT), etc.
  • MC maleimido caproy
  • Linkers can be introduced into polypeptide sequences using techniques known in the art (e.g., chemical conjugation, recombinant techniques, or peptide synthesis). Modifications can be confirmed by DNA sequence analysis. In some aspects, the linkers can be introduced using recombinant techniques. In other aspects, the linkers can be introduced using solid phase peptide synthesis. In certain aspects, a cationic carrier unit disclosed herein can contain simultaneously one or more linkers that have been introduced using recombinant techniques and one or more linkers that have been introduced using solid phase peptide synthesis or methods of chemical conjugation known in the art.
  • the linker comprises a cleavage site.
  • payload refers to a biologically active molecule, e.g., a therapeutic agent that can interactive by itself or via an adapter with a cationic carrier unit of the present disclosure, and be included within the core of a micelle of the present disclosure.
  • anti-viral drugs include those against any DNA and RNA viruses, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picomaviruses, poxviruses, reoviruses, thabdoviruses, rhinoviruses, togaviruses and viriods; any anti-bacterial drugs, nucleic acids and other anti-bacterial substances including those against gram-negative and grampositive bacteria, Acinetobacter, Achromobacter, Bacteroides, Clostridium, Chlamydia, enterobacteria, Haemophilus, Lactobacillus, Neisseria, Staphyloccu
  • the biologically active molecule is a nucleic acid, e.g., an RNA or a DNA.
  • Nucleic acid active agents suitable for delivery using the micelles of the present disclosure include all types of RNA and all types of DNA, including also oligonucleotides such as probes and primers used in the polymerase chain reaction (PCR), hybridizations, or DNA sequencing.
  • the nucleic acid comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA (TD), antimir (antagomir), small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.
  • the biologically active molecule comprises a short interfering RNA (siRNA), which is a double-stranded RNA that can induce sequence-specific post- transcriptional gene silencing, thereby decreasing or even inhibiting gene expression.
  • siRNAs can trigger the specific degradation of homologous RNA molecules, such as mRNAs, within the region of sequence identity between both the siRNA and the target RNA.
  • Non-limiting exemplary siRNAs are disclosed in WO 02/44321, which is incorporated by reference in its entirety.
  • siRNA can be about 20-27 base pairs in length.
  • the siRNA can be chemically modified.
  • the siRNA can be conjugated to cholesterol.
  • the cholesterol can be conjugated to a 3’ end of a sense or antisense strand of the siRNA.
  • the cholesterol can be conjugated to a 5’ end of a sense or antisense strand of the siRNA.
  • the cholesterol can be conjugated to both the 3’ and 5’ end of a sense or antisense strand of the siRNA.
  • the number of charge in siRNA is the number of nucleotides -2.
  • the biologically active molecule e.g., anionic payload
  • the biologically active molecule comprises a short hairpin RNAs (shRNAs).
  • the biologically active molecule comprises an miRNA or a miRNA inhibitor (antimiR).
  • the biologically active molecule e.g., anionic payload
  • the biologically active molecule e.g.
  • anionic payload has a length of 16-30 nucleotides, 18-25 nucleotides, particularly 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
  • the biologically active molecule e.g., anionic payload
  • the anionic payload comprises a nucleotide sequence having less than 200 nucleotides in lenth.
  • the anionic payload comprises a nucleotide sequence having less than about 150, about 140, about 130, about 120, about 110, about 100, about 90, about 80, about 70, about 60, about 50, about 40, about 30, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, or about 10 nucleotides in length.
  • the anionic payload comprises a nucleotide sequence having from about 30 to about 10, from about 25 to about 11, from about 30 to about 15, from about 25 to about 15, from about 24 to about 15, or from about 23 to about 15 nucleotides in length. In some aspects, the anionic payload comprises a nucleotide sequence having about 30, about 29, about 28, about 27, about 26, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, or about 13 nucleotides in length. In some aspects, the anionic payload comprises a nucleotide sequence having about 22 nucleotides in length.
  • miRNA inhibitors are oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or modifications thereof.
  • the miRNA antagonists are antimir.
  • Antimirs are a specific class of miRNA inhibitors that are described, for example, in US2007/0213292 to Stoffel et al.
  • Antimirs are RNA-like oligonucleotides that contain various modifications for RNase protection and pharmacologic properties such as enhanced tissue and cellular uptake.
  • Antimirs differ from normal RNA by having complete 2′-O-methylation of sugar, phosphorothioate backbone and a cholesterol-moiety at 3′-end.
  • Non-limiting examples of antimirs and other miRNA inhibitors are described in WO2009/020771, WO2008/091703, WO2008/046911, WO2008/074328, WO2007/090073, WO2007/027775, WO2007/027894, WO2007/021896, WO2006/093526, WO2006/112872, WO2007/112753, WO2007/112754, WO2005/023986, or WO2005/013901, all of which are hereby incorporated by reference.
  • the anionic paylod comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.
  • the anionic payload is an siRNA.
  • the anionic payload is mRNA.
  • the anionic payload is a PNA.
  • the nucleic acids are phosphodiester antisense oligonucleotides, and any oligonucleotides where the sugar-phosphate "backbone” has been derivatized or replaced with "backbone analogues” such as with phosphorothioate, phosphorodithioate, phosphoroamidate, alkyl phosphotriester, or methylphosphonate linkages.
  • the nucleic acids active agents are antisense oligonucleotides, and any oligonucleotides or oligodeoxynucleotides with non-phosphorous backbone analogues such as sulfamate, 3'- thioformacetal, methylene(methylimino) (MMI), 3'-N-carbamate, or morpholino carbamate.
  • the biologically active molecule is an antimir.
  • the terms "antimir,” “anti microRNA,” “anti miRNA,” and variants thereof refer to molecules (e.g., synthetically generated molecules) that are used to neutralize microRNA (miRNA) function in cells for desired responses.
  • miRNA are complementary sequences (approx. 20-22bp) to mRNA that are involved in the cleavage of RNA or the suppression of the translation.
  • antimirs also called anti-miRNA oligonucleotides, AMOs, or antagomirs
  • AMOs anti-miRNA oligonucleotides
  • antagomirs can be used as further regulation as well as for therapeutic for certain cellular disorders. This regulation can occur through a steric blocking mechanism as well as hybridization to miRNA.
  • Some of the miRNA linked disorders that are encountered in the humans include cancers, muscular diseases, autoimmune disorders, and viruses.
  • Various components of antimirs can be manipulated to affect the binding affinity and potency of the antimir.
  • the 2’-sugar of the antimirs can be modified to be substituted with fluorine and various methyl groups, almost all with an increase in binding affinity.
  • some of these modified 2’-sugar antimirs lead to negative effects on cell growth. Modifying the 5'-3' phosphodiester backbone linkage to a phosphorothioate (P-S) backbone linkage is also known to have an effect on target affinity.
  • P-S phosphorothioate
  • the payload is a polynucleotide comprising a nucleotide sequence having 5 to 30 nucleotides in length.
  • the polynucleotide has 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • the nucleotide sequence has 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
  • the payload comprises a nucleotide sequence having less than 200 nucleotides in length.
  • the payload comprises a nucleotide sequence having less than about 150, about 140, about 130, about 120, about 110, about 100, about 90, about 80, about 70, about 60, about 50, about 40, about 30, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, or about 10 nucleotides in length.
  • the payload comprises a nucleotide sequence having from about 30 to about 10, from about 25 to about 11, from about 30 to about 15, from about 25 to about 15, from about 24 to about 15, or from about 23 to about 15 nucleotides in length.
  • the payload comprises a nucleotide sequence having about 30, about 29, about 28, about 27, about 26, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, or about 13 nucleotides in length.
  • the payload e.g., antimir
  • the payload is a nucleotide sequence targeting hsa- miR-485, e.g., hsa-miR-485-3p.
  • the hsa-miR-485-3p has the sequence GUCAUACACGGCUCUCCUCUCU (SEQ ID NO: 17).
  • the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), wherein U can be optionally T.
  • the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), wherein the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches.
  • the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), wherein the nucleotide sequence has one or two mismatches.
  • the payload (e.g., antimir) is a nucleotide sequence targeting the seed sequence of hsa-miR-485-3p (UCAUACA; SEQ ID NO: 19).
  • the payload (e.g., antimir) is a nucleotide sequence comprising UCAUACA (SEQ ID NO: 19), wherein U can be optionally T (complement of the seed), wherein the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10 to 25, 10 to 24, 10 to 23, 10 to 22, 10 to 21, 10 to 20, 10 to 19, or 10 to 18) in length.
  • the payload (e.g., antimir) is a nucleotide sequence comprising UGUAUGA (SEQ ID NO: 20), wherein U can be optionally T (complement of the seed), wherein the nucleotide sequence comprises one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' terminus of the complement of the seed sequence and/or one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' terminus of the complement of the seed sequence.
  • UGUAUGA SEQ ID NO: 20
  • the nucleotide sequence comprises one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' terminus of the complement of the seed sequence and/or one, two three, four, five, six, seven, eight, nine, ten, 11,
  • the payload is a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 23), 5'-GUGUAUGA-3' (SEQ ID NO: 24), 5'- CGUGUAUGA-3' (SEQ ID NO: 25), 5'-CCGUGUAUGA-3' (SEQ ID NO: 26), 5'- GCCGUGUAUGA-3' (SEQ ID NO: 27), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 28), 5'- GAGCCGUGUAUGA-3' (SEQ ID NO: 29), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 30), 5'- GAGAGCCGUGUAUGA-3' (SEQ ID NO: 31), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 32), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 33), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 33),
  • the payload is a nucleotide sequence comprising 5'-TGTATGA-3' (SEQ ID NO: 51), 5'-GTGTATGA-3' (SEQ ID NO: 52), 5'-CGTGTATGA-3' (SEQ ID NO: 53), 5'-CCGTGTATGA-3' (SEQ ID NO: 54), 5'-GCCGTGTATGA-3' (SEQ ID NO: 55), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 56), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 57), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 58), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 59), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 60), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 61), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 61), 5
  • the payload (e.g., antimir) is a nucleotide sequence targeting hsa- miR-204, e.g., hsa-miR-204-5p.
  • the hsa-miR-204-5p is shown at TABLE 1 as UUCCCUUUGUCAUCCUAUGCCU (SEQ ID NO: 13).
  • the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can be optionally T.
  • the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting ofAGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can be optionally T and wherein the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches.
  • the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), wherein U can be optionally T and wherein the nucleotide sequence has one or two mismatches.
  • the payload (e.g., antimir) is a nucleotide sequence targeting the seed sequence of hsa-miR-204-5p (UCCCUUU; SEQ ID NO: 21).
  • the payload (e.g., antimir) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement of the seed), wherein U can be optionally T and wherein the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10 to 25, 10 to 24, 10 to 23, 10 to 22, 10 to 21, 10 to 20, 10 to 19, or 10 to 18) in length.
  • the payload (e.g., antimir) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement to the seed), wherein the nucleotide sequence comprises one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' terminus of the complement of the seed sequence and/or one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' terminus of the complement of the seed sequence.
  • the nucleotide sequence comprises one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' terminus of the complement of the seed sequence and/or one, two three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' terminus of
  • a polynucleotide of the present disclosure e.g., an antimir, e.g., an miR485 antimir
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • an organic base e.g., a purine or pyrimidine
  • a “nucleotide” refers to a nucleoside including a phosphate group.
  • Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
  • the modified polynucleotides disclosed herein can comprise various distinct modifications. In some aspects, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified polynucleotide can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non-specific binding to other microRNA or other molecules, as compared to an unmodified polynucleotide.
  • a polynucleotide of the present disclosure is chemically modified.
  • the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.
  • a polynucleotide of the present disclosure can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation
  • the polynucleotide of the present disclosure e.g., an antimir
  • Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine, or uracil.
  • TD TD
  • the polynucleotide (e.g., an antimir, e.g., an miR485 antimir) includes a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.
  • the nucleobases, sugar, backbone linkages, or any combination thereof in a polynucleotide are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100%.
  • the chemical modification is at nucleobases in a polynucleotide of the present disclosure (e.g., an antimir, e.g., an miR485 antimir).
  • the at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine ( ⁇ ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1 ⁇ ), 1-ethyl-pseudouridine (e1 ⁇ ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)) a modified adenosine (e.g, 1-methyl- adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (e.g., 7-methyl-guanos
  • the polynucleotide of the present disclosure e.g., an antimir, e.g., an miR485 antimir
  • an antimir e.g., an miR485 antimir
  • a polynucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl-cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C).
  • m5C 5-methyl-cytidine
  • a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.
  • the polynucleotide of the present disclosure e.g., an antimir, e.g., an miR485 antimir
  • the polynucleotide of the present disclosure includes a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases.
  • a type of nucleobases in a polynucleotide of the present disclosure e.g., an antimir, e.g., an miR485 antimir
  • the payload can comprise a "polynucleotide of the present disclosure” (for example comprising an antimir, e.g., an miR485 antimir), wherein the polynucleotide includes any useful modification to the linkages between the nucleosides.
  • a polynucleotide of the present disclosure for example comprising an antimir, e.g., an miR485 antimir
  • the polynucleotide includes any useful modification to the linkages between the nucleosides.
  • Such linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )- CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH 3 )- CH 2 -CH 2 -, oli
  • the presence of a backbone linkage disclosed above increase the stability (e.g., thermal stability) and/or resistance to degradation (e.g., enzyme degradation) of a polynucleotide of the present disclosure (e.g., an antimir, e.g., an miR485 antimir).
  • a polynucleotide of the present disclosure e.g., an antimir, e.g., an miR485 antimir.
  • the stability and/or resistance to degradation increases by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%,or at least about 100% in the modified polynucleotide compared to a corresponding polynucleotide without the modification (reference or control polynucleotide) [0307]
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 backbone linkages in a polynucleotide of the present disclosure are modified (e.g., phosphorothioate).
  • the backbone comprises linkages selected from the group consisting of phosphodiester linkage, phosphotriesters linkage, methylphosphonate linkage, phosphoramidate linkage, phosphorothioate linkage, and combinations thereof. 3.
  • the modified nucleosides and nucleotides that can be incorporated into a polynucleotide of the present disclosure can be modified on the sugar of the nucleic acid.
  • the payload comprises a nucleic acid, wherein the nucleic comprises at least one nucleoside analog (e.g., a nucleoside with a sugar modification).
  • the sugar modification increases the affinity of the binding of a polynucleotide to its target miRNA.
  • Incorporating affinity-enhancing nucleotide analogues in the polynucleotide, such as LNA or 2’-substituted sugars can allow the length of polynucleotide to be reduced, and also may reduce the upper limit of the size a polynucleotide before non-specific or aberrant binding takes place.
  • At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the nucleotides in a polynucleotide of the present disclosure e.g., an antimir, e.g., an miR485 antimir
  • sugar modifications e.g., LNA
  • nucleotide units in a polynucleotide of the present disclosure are sugar modified (e.g., LNA).
  • sugar modified e.g., LNA
  • RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
  • modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.
  • GAA glyco
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar.
  • the 2′ hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents.
  • substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C1-6 alkyl; optionally substituted C1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl-C 1-6 alkoxy, optionally substituted C1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to
  • nucleoside analogues present in a polynucleotide of the present disclosure comprise, e.g., 2’-O-alkyl-RNA units, 2’- OMe-RNA units, 2’-O-alkyl-SNA, 2’-amino-DNA units, 2’-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2’-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2’MOE units, or any combination thereof.
  • an antimir e.g., an miR485 antimir
  • nucleoside analogues present in a polynucleotide of the present disclosure comprise, e.g., 2’-O-alkyl-RNA units, 2’- OMe-RNA units, 2’-O-alkyl-SNA, 2’-amino-DNA units, 2’-fluoro-DNA units, LNA units, arabino nucleic
  • the LNA is, e.g., oxy-LNA (such as beta-D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino-LNA or alpha-L- amino-LNA), thio-LNA (such as beta-D-thio0-LNA or alpha-L-thio-LNA), ENA (such a beta-D- ENA or alpha-L-ENA), or any combination thereof.
  • oxy-LNA such as beta-D-oxy-LNA, or alpha-L-oxy-LNA
  • amino-LNA such as beta-D-amino-LNA or alpha-L- amino-LNA
  • thio-LNA such as beta-D-thio0-LNA or alpha-L-thio-LNA
  • ENA such a beta-D- ENA or alpha-L-ENA
  • nucleoside analogs present in a polynucleotide of the present disclosure comprise Locked Nucleic Acid (LNA); 2'-0-alkyl-RNA; 2'-amino-DNA; 2'-fluoro- DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'-MOE), or any combination thereof.
  • LNA Locked Nucleic Acid
  • 2'-0alkyl-RNA 2'-amino-DNA
  • 2'-fluoro- DNA arabino nucleic acid
  • ANA arabino nucleic acid
  • INA intercalating nucleic acid
  • cEt constrained ethyl nucleoside
  • 2'-OMe
  • a polynucleotide of the present disclosure can comprise both modified RNA nucleotide analogues (e.g., LNA) and DNA units.
  • a polynucleotide of the present disclosure is a gapmer. See, e.g., U.S. Pat. Nos.8,404,649; 8,580,756; 8,163,708; 9,034,837; all of which are herein incorporated by reference in their entireties.
  • a polynucleotide of the present disclosure is a micromir. See U.S. Pat. Appl. Publ. No.
  • the present disclosure also provides micelles comprising the cationic carrier units of the present disclosure.
  • the micelles of the present disclosure comprise cationic carriers unit of the present disclosure and negatively charged payload, wherein the negatively charged payload and the cationic carrier unit are associate with each other.
  • the association is comprises a covalent bond.
  • the association does not comprise a covalent bond.
  • the association is via an ionic bond, i.e., via electrostatic interaction.
  • the negatively charged payload (e.g., a DNA and/or RNA) is not conjugated to the cationic carrier unit by a covalent bond and/or the negatively charged payload interacts with the cationic carrier moiety of the cationic carrier unit only via an ionic interaction.
  • the cationic carrier units and micelles of the present disclosure protect the payload (e.g., a DNA and/or RNA) from degradation (e.g., by a DNase and/or an RNase).
  • the cationic carrier unit is capable of protecting the payload through electrostatic interaction.
  • the micelle sequesters the payload to the core of the micelle, i.e., out of the reach of DNases and/or an RNases.
  • the protection of the payload from circulating enzymes can increase the half-life of the negatively charged payload (e.g., a DNA and/or RNA) compared to the free payload.
  • encapsulation of the payload in a micelle of the present disclosure can increase the plasma half-life of the payload at least about 2- fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11- fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.
  • the positive charge of the cationic carrier unit, and in particular the charge of the cationic carrier moiety is sufficient to form a micelle when mixed with a negatively charged payload (e.g., a nucleic acid) in a solution, wherein the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., a nucleic acid) is about 1:1.
  • a negatively charged payload e.g., a nucleic acid
  • the positive charge of the cationic carrier unit, and in particular the charge of the cationic carrier moiety is sufficient to form a micelle when mixed with a negatively charged payload (e.g., a nucleic acid) in a solution, wherein the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., a nucleic acid) is about 2:1.
  • the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., a nucleic acid) is higher than 1:1, i.e., an excess of cationic carrier unit is used.
  • the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload is lower than 1:1, i.e., an excess of negatively change payload is used.
  • a suitable buffer e.g., PBS
  • the complexes formed between the cationic carrier units of the present disclosure and payload e.g., an antisense oligonucleotides such as an antimir
  • a micelle is a water-soluble or colloidal structure or aggregate composed of one or more amphiphilic molecules.
  • Amphiphilic molecules are those that contain at least one hydrophilic (polar) moiety and at least one hydrophobic (nonpolar) moiety.
  • “Classic micelles” have a single, central and primarily hydrophobic zone or “core” surrounded by a hydrophilic layer or “shell.” In aqueous solution, the micelle forms an aggregate with the hydrophilic "head” regions of the amphiphilic molecule in contact with the surrounding solvent, sequestering the hydrophobic single-tail regions of the amphiphilic molecule in the micelle core.
  • Micelles are approximately spherical in shape. Other shapes, e.g., ellipsoids, cylinders, rod-like structures, or polymersomes are also possible.
  • the shape and size, and therefore loading capacity, of the micelles disclosed can be modified by altering the ratio between water-soluble biopolymer (e.g., PEG) and cationic carrier (e.g., poly lysine).
  • the carrier units can organize as small particles, small micelles, micelles, rod-like structures, or polymersomes.
  • the term "micelles of the present disclosure” encompasses not only classic micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes.
  • the micelles of the present disclosure can be composed of either a single monomolecular polymer containing hydrophobic and hydrophilic moieties or an aggregate mixture containing many amphiphilic (i.e.
  • Micelles of the present disclosure can range in size from 5 to about 2000 nanometers. In some aspects, the diameter of the micelle is between about 10 nm and about 200 nm.
  • the diameter of the micelle is between about 1nm and about 100nm, between about 10nm and about 100nm, between about 10nm and about 90nm, between about 10nm and about 80nm, between about 10nm and about 70nm, between about 20nm and about 100nm, between about 20nm and about 90nm, between about 20nm and about 80nm, between about 20nm and about 70nm, between about 30nm and about 100nm, between about 30nm and about 90nm, between about 30nm and about 80nm, between about 30nm and about 70nm, between about 40nm and about 100nm, between about 40nm and about 90nm, between about 40nm and about 80nm, or between about 40nm and about 70nm.
  • the diameter of the micelles of the present disclosure is between about 30 nm and about 60 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 15 nm and about 90 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 15 nm and about 80 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 15 nm and about 70 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 15 nm and about 60 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 15 nm and about 50 nm.
  • the diameter of the micelles of the present disclosure is between about 20 nm and about 60 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 20 nm and about 50 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 20 nm and about 40 nm. In some aspects, the diameter of the micelles of the present disclosure is between about 25 nm and about 35 nm. In some aspects, the diameter of the micelles of the present disclosure is about 32 nm. [0326] In some aspects, the micelle can comprise a single type of antimir, e.g., miR485 antimir.
  • the micelle can comprise more than one type antimir, e.g., (i) antimir with different architectures targeting the same miRNA; (ii) antimir with different architectures targeting different miRNAs; (iii) antimir with the same architecture targeting the same miRNA; or, (iv) combinations thereof.
  • the micelles of the present disclosure comprise a single type of cationic carrier unit.
  • the micelles of the present disclosure comprise more than one type of cationic carrier unit (e.g., targeting different receptor on the surface of a target cell).
  • micelles of the present disclosure can comprise cationic carrier units with different targeting moieties, different cationic carrier moieties (e.g., to accommodate different payloads), and/or different hydrophobic and/or crosslinking units.
  • different types of cationic or anionic carrier unit can be combined together.
  • the micelle of the present disclosure can comprise a cationic (or an anionic) carrier unit linked to a targeting moiety and a cationic (or an anionic) carrier unit not linked to a targeting moiety.
  • a micelle comprises about 50 to about 200 cationic or anionic carrier units.
  • a micelle comprises about 50 to about 150, about 50 to about 140, about 50 to about 130, about 50 to about 120, about 50 to about 110, or about 50 to about 100 cationic or anionic carrier units. In some aspects, a micelle comprises about 60 to about 200 cationic or anionic carrier units. In other aspects, a micelle comprises about 60 to about 150, about 60 to about 140, about 60 to about 130, about 60 to about 120, about 60 to about 110, about 60 to about 100, about 60 to about 90, about 60 to about 80, or about 60 to about 70 cationic or anionic carrier units. In some aspects, a micelle comprises about 70 to about 200 cationic or anionic carrier units.
  • a micelle comprises about 70 to about 150, about 70 to about 140, about 70 to about 130, about 70 to about 120, about 70 to about 110, about 70 to about 100, about 70 to about 90, or about 70 to about 80 cationic or anionic carrier units. In some aspects, a micelle comprises about 80 to about 200 cationic or anionic carrier units. In other aspects, a micelle comprises about 80 to about 150, about 80 to about 140, about 80 to about 130, about 80 to about 120, about 80 to about 110, about 80 to about 100, or about 80 to about 90 cationic or anionic carrier units. In some aspects, a micelle comprises about 90 to about 200 cationic or anionic carrier units.
  • a micelle comprises about 90 to about 150, about 90 to about 140, about 90 to about 130, about 90 to about 120, about 90 to about 110, or about 90 to about 100 cationic or anionic carrier units. In some aspects, a micelle comprises about 100 to about 200 cationic or anionic carrier units. In other aspects, a micelle comprises about 100 to about 150, about 100 to about 140, about 100 to about 130, about 100 to about 120, about 100 to about 110, or about 100 to about 100 cationic or anionic carrier units.
  • the present disclosure also includes a micelle comprising (i) a nucleotide sequence (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length) and (ii) a cationic carrier unit described herein.
  • a nucleotide sequence e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length
  • a cationic carrier unit described herein described herein.
  • the disclosure is directed to a micelle comprising (i) a nucleotide sequence, e.g., miRNA, or a miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 80 to about 120 (e.g., about 85 to about 115, about 90 to about 110, about 95 to about 105) cationic carrier units described herein, e.g., Schemas I-VI, Schemas I’-VI’, or a combination thereof (see FIGs.2A-2I).
  • a nucleotide sequence e.g., miRNA
  • a miRNA inhibitor e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length
  • about 80 to about 120 e.g., about 85 to about 115, about 90 to about 110, about 95 to about 105
  • the micelle comprises (i) a nucleotide sequence, e.g., miRNA, or a miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 80 to about 120 (e.g., about 80, about 85, about 90, about 95, about 100, about 105, or about 110) of a cationic carrier unit described herein, e.g., optional [CC]- L1-[CM]-L2-[HM] (see FIG.2).
  • a cationic carrier unit described herein, e.g., optional [CC]- L1-[CM]-L2-[HM] (see FIG.2).
  • the micelle comprises (i) a nucleotide sequence, e.g., miRNA, or a miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 90 to about 110, e.g., about 100, cationic carrier units, wherein (a) about 45 to about 90, e.g., about 80 of the cationic carrier units comprise [CC]- L1-[CM]-L2-[HM] and (b) about 45 to about 55, e.g., about 50 of the cationic carrier units comprise WP-CC-CM, wherein TM is phenyl alanine, WP is (PEG) 5000 , and CC is about 40 to about 50 lysines, e.g., about 45, about 46, about 47, about 48, about 49, or about 50 lysines, and wherein each of about 5 to about 15 of lys
  • the disclosure is directed to a micelle comprising (i) a nucleotide sequence, e.g., siRNA (e.g., 21-mer), and (ii) about 35 to about 60 (e.g., about 35, about 40, about 45, about 50, about 55 or about 60) cationic carrier units described herein, wherein the charge ratio between the cationic carrier and the siRNA is about 2.0 (See FIGs.15A-15E and 17A-17E).
  • a nucleotide sequence e.g., siRNA (e.g., 21-mer)
  • about 35 to about 60 e.g., about 35, about 40, about 45, about 50, about 55 or about 60
  • the charge ratio between the cationic carrier and the siRNA is about 2.0 (See FIGs.15A-15E and 17A-17E).
  • the disclosure is directed to a micelle comprising (i) a nucleotide sequence, e.g., cholesterol conjugated siRNA (e.g., 21-mer), and (ii) about 35 to about 60 (e.g., about 35, about 40, about 45, about 50, about 55 or about 60) cationic carrier units described herein, wherein the charge ratio between the cationic carrier and the siRNA is about 1.0 (See FIGs. 8A- 8D and 9A-9D).
  • a nucleotide sequence e.g., cholesterol conjugated siRNA (e.g., 21-mer)
  • about 35 to about 60 e.g., about 35, about 40, about 45, about 50, about 55 or about 60
  • the charge ratio between the cationic carrier and the siRNA is about 1.0 (See FIGs. 8A- 8D and 9A-9D).
  • a micelle of the present disclosure comprises (i) a nucleotide sequence, e.g., a miR485-3p inhibitor, e.g., 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO:18), and (ii) about 100 cationic carrier units, wherein (a) about 50 of the cationic carrier units comprise TM-WP-CC-AM and (b) about 50 of the cationic carrier units comprise WP-CC-CM, wherein TM is phenyl alanine, WP is (PEG) 5000 , and CC is about 47 lysines, and wherein each of about 10 lysines is fused to Vitamin B3 (nicotinamide).
  • a nucleotide sequence e.g., a miR485-3p inhibitor, e.g., 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO:18)
  • about 100 cationic carrier units wherein (
  • the micelle can comprise a single payload (e.g., a single oligonucleotide, e.g., an antimir). In other aspects, the micelle can comprise more than one payload (e.g., multiple oligonucleotides, e.g., multiple antimirs).
  • V. Methods of manufacture The present disclosure also provides methods of making the cationic carrier units and micelles of the present disclosure. In general, the present disclosure provides a method of preparing a cationic carrier unit of the present disclosure comprising synthesizing the cationic carrier unit as described, e.g., in the Examples section.
  • the term "synthesizing” refers the assembling the cationic carrier unit using methods known in the art.
  • protein components e.g., an antibody targeting moiety
  • each one of the components of the cationic carrier unit can be prepared using methods known in the art, e.g., recombinant protein production, solid phase peptide or nucleic acid synthesis, chemical synthesis, enzymatic synthesis, or any combination thereof, and the resulting component can be conjugated using chemical and/or enzymatic methods known in the art.
  • the cationic carrier units of the present disclosure can be purified to remove contaminants.
  • the cationic carrier unit comprises a uniform population of cationic carrier units.
  • the cationic carrier unit can comprise multiple species (e.g., some of them comprising a targeting moiety, and some comprising the remaining moieties but without a targeting moiety).
  • the manufacture of the cationic carrier units of the present disclosure comprise lyophilization or any other form of dry storage suitable for reconstitution.
  • the preparation of the cationic carrier unit in a dry form takes place after combination of the cationic carrier units with the payload (e.g., a nucleic acid).
  • the method of preparing a micelle of the present disclosure comprises mixing the cationic carrier unit with the negatively charged payload (e.g., a nucleic acid such an antisense oligonucleotide, e.g., an antimir) at an ionic ratio of 1:1.
  • the cationic carrier unit and the negatively charged payload are combined in solution.
  • the resulting solution is lyophilized or dried.
  • the combination of the cationic carrier and the negative charged payload is conducted in dry form.
  • A water-soluble polymer
  • B e.g., poly lysine
  • the micelles of the present disclosure can be generation using any of the techniques known in the art, for example, vortexing, extrusion, or sonication.
  • the formation of micelles depends on applying conditions that are above the critical micelle concentration (CMC) of a solution comprising the cationic carrier units of the present disclosure. After they reach a certain value of concentration, surfactants begin to associate and to organize themselves into more complex units, such as micelles.
  • CMC critical micelle concentration
  • the CMC of a solution comprising the cationic carriers of the present disclosure can be determined by any physical property (e.g., surface tension) that shows a distinct transition around the CMC.
  • the well-known Smith-Ewart theory predicts that the number of particles nucleated leading to the formation of micelles above the CMC is proportional to the surfactant (in the present disclosure, the cationic carrier units complexed or associated to the anionic payload) concentration to the 0.6 power. This is so because for a given surfactant the number of micelles formed generally increases with an increase in the surfactant concentration.
  • the micelles of the present disclosure can be purified, e.g., to remove contaminants and/or to generate an uniform population of micelles (e.g., micelles having the same size, or micelles having the same payload or the same targeting moiety).
  • compositions comprising cationic carrier units and/or micelles of the present disclosure (i.e., micelles comprising cationic carrier units of the present disclosure) that are suitable for administration to a subject.
  • micelles of the present disclosure can be homogeneous (i.e., all micelles comprises the same type of cationic carrier unit, with the same targeting moiety and the same payload).
  • the micelles can comprise multiple targeting moieties, multiple payloads, etc.
  • the pharmaceutical compositions generally comprise a cationic carrier unit and/or micelle of the present disclosure and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject.
  • compositions comprising micelles of the present disclosure (See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa.18th ed. (1990)).
  • the pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
  • GMP Good Manufacturing Practice
  • the pharmaceutical composition comprises one or more micelles described herein.
  • the micelles described herein are co-administered with one or more additional therapeutic agents, in a pharmaceutically acceptable carrier.
  • the pharmaceutical composition comprising the micelles described herein is administered prior to administration of the additional therapeutic agent(s). In other aspects, the pharmaceutical composition comprising the micelles described herein is administered after the administration of the additional therapeutic agent(s). In further aspects, the pharmaceutical composition comprising the micelles described herein is administered concurrently with the additional therapeutic agent(s). [0346] In some aspects, the pharmaceutical carrier is added following micelle formation. In other aspects, the pharmaceutical carrier is added before micelle formation.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine,
  • Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin.
  • the use of such media and compounds for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or compound is incompatible with the cationic carrier units or micelles disclosed herein, use thereof in the compositions is contemplated.
  • Supplementary therapeutic agents can also be incorporated into the compositions of the present disclosure. Typically, a pharmaceutical composition is formulated to be compatible with its intended route of administration.
  • the micelles described herein can be administered by parenteral, topical, intravenous, oral, subcutaneous, intra-arterial, intradermal, transdermal, rectal, intracranial, intraperitoneal, intranasal, intratumoral, intramuscular route or as inhalants.
  • the pharmaceutical composition micelles described herein is administered intravenously, e.g. by injection.
  • the micelles described herein can optionally be administered in combination with other therapeutic agents that are at least partly effective in treating the disease, disorder or condition for which the micelles described herein are intended.
  • Solutions or suspensions can include the following components: a sterile diluent such as water, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial compounds such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating compounds such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and compounds for the adjustment of tonicity such as sodium chloride or dextrose.
  • the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • compositions suitable for injectable use include sterile aqueous solutions (if water-soluble) or dispersions and sterile powders.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition is generally sterile and fluid to the extent that easy syringeability exists.
  • the carrier can be a solvent or dispersion medium containing, e.g., water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, e.g., by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal compounds, e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic compounds e.g., sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride can be added to the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition a compound which delays absorption, e.g., aluminum monostearate and gelatin.
  • Pharmaceutical compositions of the present disclosure can be sterilized by conventional, well known sterilization techniques. Aqueous solutions can be packaged for use or filtered under aseptic conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.
  • Sterile injectable solutions can be prepared by incorporating the micelles described herein in an effective amount and in an appropriate solvent with one or a combination of ingredients enumerated herein, as desired.
  • dispersions are prepared by incorporating the micelles described herein into a sterile vehicle that contains a basic dispersion medium and any desired other ingredients.
  • methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • compositions comprising micelles described herein can be administered in the form of a depot injection or implant preparation which can be formulated in such a manner to permit a sustained or pulsatile release of the micelles described herein.
  • Systemic administration of compositions comprising micelles described herein can also be by transmucosal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, e.g., for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of, e.g., nasal sprays.
  • the pharmaceutical composition comprising micelles described herein is administered intravenously into a subject that would benefit from the pharmaceutical composition.
  • the composition is administered to the lymphatic system, e.g., by intralymphatic injection or by intranodal injection (see e.g., Senti et al., PNAS 105( 46): 17908 (2008)), or by intramuscular injection, by subcutaneous administration, by intratumoral injection, by direct injection into the thymus, or into the liver.
  • the pharmaceutical composition comprising micelles described herein is administered as a liquid suspension.
  • the pharmaceutical composition is administered as a formulation that is capable of forming a depot following administration.
  • the depot slowly releases the micelles described herein into circulation, or remains in depot form.
  • pharmaceutically-acceptable compositions are highly purified to be free of contaminants, are biocompatible and not toxic, and are suited to administration to a subject. If water is a constituent of the carrier, the water is highly purified and processed to be free of contaminants, e.g., endotoxins.
  • the pharmaceutically-acceptable carrier can be lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginates, gelatin, calcium silicate, micro- crystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and/or mineral oil, but is not limited thereto.
  • the pharmaceutical composition can further include a lubricant, a wetting agent, a sweetener, a flavor enhancer, an emulsifying agent, a suspension agent, and/or a preservative.
  • the pharmaceutical compositions described herein comprise the micelles described herein and optionally a pharmaceutically active or therapeutic agent.
  • the therapeutic agent can be a biological agent, a small molecule agent, or a nucleic acid agent.
  • Dosage forms are provided that comprise micelles described herein. In some aspects, the dosage form is formulated as a liquid suspension for intravenous injection.
  • the micelles disclosed herein or pharmaceutical composition comprising the micelles may be used concurrently with other drugs. To be specific, the micelles or pharmaceutical compositions of the present disclosure may be used together with medicaments such as hormonal therapeutic agents, chemotherapeutic agents, immunotherapeutic agents, medicaments inhibiting the action of cell growth factors or cell growth factor receptors and the like. VII.
  • the present disclosure also provides methods of treating a disease or condition in a subject in need thereof comprising administering a micelle of the present disclosure or a combination thereof to the subject, e.g., a mammal, such as human subject.
  • the present disclosure provides a method of treating a neurodegenerative disorder or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, or a pharmaceutical composition of the present disclosure.
  • the micelles of the present disclosure can administered via intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
  • the micelles of the present disclosure can be used concurrently with other medicaments or treatment suitable for the treatment of the diseases and conditions disclosed herein.
  • the present disclosure also provides methods to encapsulate a payload for delivery, comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • the present disclosure also provides methods to increase the resistance of a payload to degradation (e.g., nuclease-mediated degradation), comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • the present disclosure provides methods of crossing blood brain barrier (BBB) comprising administering the micelles disclosed herein, e.g., micelles comprising tryptophan and/or tyrosine as a targeting moiety.
  • BBB blood brain barrier
  • a micelle of the present disclosure loaded with anti-miRNA can be targeted to a BBB receptor, e.g., LAT1, as disclosed above.
  • the payload e.g., an antimir
  • the payload e.g., an antimir
  • an intracellular target e.g., the antimir can bind to a target microRNA and trigger RNAse H mediated degradation.
  • encapsulation of the payload in a micelle of the present disclosure can increase the resistance of the payload to degradation at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload (i.e., not in a micelle, e.g., free in solution).
  • encapsulation of the payload in a micelle of the present disclosure can increase the resistance of the payload to degradation at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.
  • the present disclosure also provides methods to increase the stability of a payload during administration (e.g., while in the subject’s bloodstream) comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • a payload e.g., an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • encapsulation of the payload in a micelle of the present disclosure can increase the stability (e.g., increase the resistance to nucleases) of the payload at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.
  • stability e.g., increase the resistance to nucleases
  • encapsulation of the payload in a micelle of the present disclosure can increase the stability (e.g., increase the resistance to nucleases) of the payload at least about 2- fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11- fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.
  • the present disclosure also provides methods to increase a payload’s plasma half- life comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • an anionic payload such as a nucleic acid (e.g., an antimir)
  • encapsulation of the payload in a micelle of the present disclosure can increase the plasma half-life of the payload at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, at least about 1000%, at least about 1100%, at least about 1200%, at least about 1300%, at least about 1400%, at least about 1500%, at least about 1600%, at least about 1700%, at least about 1800%, at least about 1900%, or at least about 2000%,
  • encapsulation of the payload in a micelle of the present disclosure can increase the plasma half-life of the payload at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold compared to the free payload.
  • the encapsulated payload is an antimir disclosed herein, e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18) wherein the encapsulation of the antimir in a micelle of the present disclosure increases the plasma half-life of the antimir at least about 10-fold, at least about 12-fold, at least about 14-fold, at least about 16-fold, at least about 18-fold, or at least about 20-fold compared to the plasma half- life of the free antimir.
  • an antimir disclosed herein e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18
  • the encapsulated payload is an antimir disclosed herein, e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18) wherein the encapsulation of the antimir in a micelle of the present disclosure increases the plasma half-life of the antimir at least about 20-fold compared to the plasma half-life of the free antimir.
  • an antimir disclosed herein e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18) wherein the encapsulation of the antimir in a micelle of the present disclosure increases the plasma half-life of the antimir at least about
  • the plasma half-life of the antimir encapsulated in a micelle of the present disclosure is at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 60 minutes, at least about 70 minutes, at least about 80 minutes, at least about 90 minutes, at least about 100 minutes, or at least about 120 minutes.
  • the plasma half-life of the antimir e.g., an antisense oligonucleotide of SEQ ID NO: 18
  • the plasma half-life of the antimir e.g., an antisense oligonucleotide of SEQ ID NO: 18
  • the present disclosure also provides methods to increase the permeation, delivery, transit, or transport of a payload through a physiological barrier, e.g., the BBB or the plasma membrane, comprising incorporating the payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • a physiological barrier e.g., the BBB or the plasma membrane
  • an anionic payload such as a nucleic acid (e.g., an antimir) into a micelle of the present disclosure.
  • encapsulation of a payload in a micelle of the present disclosure can increase the permeation, delivery, transit, or transport of the payload through a physiological barrier, e.g., the BBB or the plasma membrane, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.
  • a physiological barrier e.g., the BBB or the plasma membrane
  • encapsulation of a payload in a micelle of the present disclosure can increase the permeation, delivery, transit, or transport of the payload through a physiological barrier, e.g., the BBB or the plasma membrane, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold , at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least
  • the micelles of the present disclosure can be used to target stem cells, e.g., to deliver therapeutic molecules (e.g., therapeutic polynucleotides) or gene therapy components.
  • the micelles of the present disclosure can be used to treat cancer.
  • micelles of the present disclosure can target a marker specific for a certain type of cancer, e.g., a glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer, and carry as payload a therapeutic molecule (e.g., a therapeutic polynucleotide, a peptide, or a small molecule).
  • the micelles of the present disclosure can be used to treat pancreatic cancer.
  • the targeting moiety directing the micelles of the present disclosure to pancreatic tissues is a cyclic RGD peptide.
  • the targeting moiety directing the micelles of the present disclosure to pancreatic tissues is a biomarker predominantly or exclusively expressed on the surface of normal or cancerous pancreatic cells.
  • the payload of the micelle of the present disclosure is an oligonucleotide targeting K-Ras, wherein the delivery of the payload to pancreatic tissue effectively reduces the expression of K-Ras.
  • the micelles of the present disclosure can be used to treat or ameliorate the symptoms of a neurodegenerative disease, e.g., Alzheimer’s disease.
  • the micelles of the present disclosure comprise a payload, e.g., an antimir, targeting a molecule overexpressed in Alzheimer’s disease neuronal tissue, e.g., miRNA-485-3p.
  • a micelle of the present disclosure e.g., a micelle comprising a LAT1 targeting moiety to effectively transport the micelle across the BBB and an antimir payload targeting miRNA-485-3p
  • the administration of a micelle of the present disclosure can prevent or ameliorate symptoms of Alzheimer’s disease such as apoptosis, loss of mitochondrial function, or inflammation.
  • the present disclosure provides a method to reduce inflammation, e.g., neuroinflammation, in a subject suffering from a neurodegenerative disease (e.g., Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively reducing inflammation, e.g., neuroinflammation, in the subject.
  • a neurodegenerative disease e.g., Alzheimer’s disease
  • the present disclosure provides a method to reduce inflammation, e.g., neuroinflammation, in a subject suffering from a neurodegenerative disease (e.g., Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively reducing inflammation, e.g., neuroinflammation, in the subject.
  • the neuroinflammation is cortex inflammation.
  • the neuroinflammation is hippocampus inflammation.
  • the therapeutic agent is an antimir targeting miRNA- 485-3p (e.g., an antimir of SEQ ID NO:18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can decrease the level of neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the neuroinflammation compared to the level of neuroinflammation observed in a subject or a population of subjects not treated with a micelle of
  • the present disclosure provides a method to reduce amyloid plaque burden in a subject suffering from Alzheimer’s disease comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively reducing amyloid plaque burden in the subject.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO:18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can decrease at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the amyloid plaque burden in the subject compared to the amyloid plaque burden observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g., Alzheimer’s disease
  • the present disclosure provides a method to recover and/or induce neurogenesis in a subject suffering from a neurodegenerative disease (e.g., Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises a therapeutic agent capable of effectively recovering and/or inducing neurogenesis in the subject.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO:18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can recover and/or induce neurogenesis in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the level of neurogenesis observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g., Alzheimer’s disease
  • the present disclosure provides a method to improve cognitive function in a subject suffering from a neurodegenerative disease (e.g., Alzheimer’s disease) comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, wherein the micelle comprises an therapeutic agent capable of effectively improving cognitive function in the subject.
  • the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO:18 or fragment or variant thereof) wherein the antimir can reduce the levels of miRNA-485-3p in the subject.
  • the administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease can increase the cognitive function of the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the cognitive function observed in a subject or a population of subjects not treated with a micelle of the present disclosure.
  • a neurodegenerative disease e.g., Alzheimer’s disease
  • kits, or products of manufacture comprising a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure and optionally instructions for use.
  • the kit or product of manufacture comprises a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure in one or more containers.
  • the kit or product of manufacture comprises a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure and a brochure.
  • the kit or product of manufacture comprises a cationic carrier unit, a micelle, or a pharmaceutical composition of the present disclosure and instructions for use.
  • the kit or product of manufacture comprises a cationic carrier unit of the present disclosure in dry form in a container (e.g., a glass vial), and optionally a vial with a solvent suitable to hydrate the dry the cationic carrier unit, and optionally instructions for the hydration of the cationic carrier unit and the formation of micelles.
  • a container e.g., a glass vial
  • a vial with a solvent suitable to hydrate the dry the cationic carrier unit, and optionally instructions for the hydration of the cationic carrier unit and the formation of micelles.
  • the kit or product of manufacture further comprises at least one additional container (e.g., a glass vial) with the micelle’s anionic payload (e.g., an antisense oligonucleotide).
  • the kit or product of manufacture comprises a cationic carrier unit of the present disclosure in a dry form and the micelle’s anionic payload also in dry form in the same container, or in different containers.
  • the kit or product of manufacture comprises a cationic carrier unit of the present disclosure in solution and the micelle’s anionic payload also in solution in the same container, or in different containers.
  • the kit or product of manufacture comprises a micelle of the present disclosure in solution, and instructions for use.
  • the kit or product of manufacture comprises a micelle of the present disclosure in dry form, and instructions for use (e.g., instructions for reconstitution and administration).
  • instructions for use e.g., instructions for reconstitution and administration.
  • *** [0393] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N.
  • reaction mixture was extracted by using water with Ethyl acetate (EA). Then, the organic layer was washed with a brine solution.
  • EA Ethyl acetate
  • the crude material was purified by flash column (EA in hexane 10%). Next, the resulting product was dissolved in Tetrahydrofuran (7.0 ml) and 6.0 M HCl (7.0 ml), and heated at 65 °C for 16 hrs. The dioxane was removed and extracted by EA. Then, an aqueous NaOH (1.0 M) solution was added to the mixture until the pH was 7. The reactant was concentrated by evaporator and centrifuged at 12,000 rpm at 0°C.
  • N3-PEG 600 mg, 0.12 mmol
  • Lys(TFA)-NCA 1447 mg, 5.4 mmol
  • DMF 1M thiourea
  • Lys(TFA)-NCA solution was dropped into the N3-PEG solution by micro syringe needle and the reaction mixture was stirred at 37 °C for 3 days.
  • the reaction bottles were purged with Ar and vacuum. All reactions were conducted under Ar atmosphere. [0399] After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The mixture was filtered and the product was obtained as a white powder after drying in vacuo.
  • N3-PEG-PLL 500 mg was dissolved in methanol (60 mL) and 1N NaOH (6 mL), and was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES and distilled water for 4 times. A white powder of N3-PEG- PLL(NH 2 ) was obtained after lyophilization.
  • PEG 5K -PLL(NH 3 + /Cl-) 46 , PEG 5K -PLL(NH 3 + /Cl-) 58 and PEG 5K -PLL(NH 3 + /Cl-) 80 were also polymerized through this synthetic method by controlling feed amounts of reagents.
  • a schematic of PEG 5K -PLL(NH3 + /Cl-)58 is shown in FIG. 2A (Compound A).
  • EDC 134.0 mg, 1.2 equiv. to NH 2 of PEG-PLL
  • NHS 80.4 mg, 1.2 equiv. to NH2 of PEG-PLL
  • EDC 34.7 mg, 0.3 equiv.
  • PEG 5K -PLL 80 -NH 2 (200.0 mg), nicotinic acid (Nic, 22.1 mg, 17 equiv.), 3,3’- dithiodipropionic acid (DTDPA, 10.2 mg, 4.5 equiv.), N-(3-dimethylaminopropyl)-N′-ethyl carbodiimide hydrochloride (EDC, 52.5 mg, 25 equiv.), N-hydroxy succinimide (NHS, 31.5 mg, 25 equiv.), and triethylamine (TEA, 30.0 ⁇ L, 20 equiv.) were separately dissolved in 20 mL of dimethyl sulfoxide.
  • DTDPA 3,3’- dithiodipropionic acid
  • EDC N-(3-dimethylaminopropyl)-N′-ethyl carbodiimide hydrochloride
  • NHS N-hydroxy succinimide
  • TEA triethyl
  • DTT 1,4-dithiotritol
  • FIG.2E A schematic of PEG 5K - PEG 5K -PLL 80 (Nic 14 /SH 6 )) is shown in FIG.2E.
  • PEG 5K -PLL 80 -NH 2 200 mg
  • NA 36.8 mg, 27.5 equiv.
  • DTDPA 8.7 mg, 4 equiv.
  • EDC 78.3 mg, 37.5 equiv.
  • NHS 47.0 mg, 37.5 equiv.
  • triethylamine TEA, 50.1 ⁇ L, 33 equiv.
  • 1,4-dithiotritol (DTT, 19.0 mg, 11 equiv.) was directly added into the membrane to cleave the disulfide bond of the polymer side chain.
  • the membrane was incubated for 30 min, dialyzed against D.I.-water for 2 hours, and dialyzed against deionized water for 24 hours.
  • the solution was filtered with a syringe filter (0.45 ⁇ m) and lyophilized for 2 days.
  • a schematic of PEG 5K -PLL 80 (Nic23/SH6) is shown in FIG. 2F.
  • PEG 5K -PLL 80 -NH2 (200.0 mg), NA (44.2 mg, 33 equiv.), DTDPA (7.8 mg, 3.4 equiv.), EDC (91.2 mg, 44 equiv.), NHS (54.8 mg, 44 equiv.), and triethylamine (TEA, 60.0 ⁇ L, 40 equiv.) were separately dissolved in 20 mL of dimethyl sulfoxide. The reaction mixture was maintained at 37 °C for 16 hours with stirring.
  • PEG 5K -PLL 80 -NH 2 (200.0 mg), NA (44.2 mg, 33 equiv.), DTDPA (15.7 mg, 7 equiv.), EDC (99.8 mg, 48 equiv.), NHS (59.9 mg, 48 equiv.), and triethylamine (TEA, 60.0 ⁇ L, 40 equiv.) were separately dissolved in 20 mL of dimethyl sulfoxide. The reaction mixture was maintained at 37 °C for 16 hours with stirring.
  • PEG 5K -PLL 80 -NH 2 (200.0 mg), NA (44.2 mg, 33 equiv.), DTDPA (23.6 mg, 10 equiv.), EDC (108.4 mg, 52 equiv.), NHS (65.1 mg, 52 equiv.), and triethylamine (TEA, 60.0 ⁇ L, 40 equiv.) were separately dissolved in 20 mL of dimethyl sulfoxide. The reaction mixture was maintained at 37 °C for 16 hours with stirring.
  • N3-PEG-PLL(Nic/ss) (30 mg, 3.2 ⁇ mol) and alkyne modified phenyl alanine (1.31 mg, 6.4 ⁇ mol) were dissolved in deionized water.
  • CuSO4•H2O (0.172 mg, 0.69 ⁇ mol) and ascorbic acid (0.3 mg, 1.7 ⁇ mol) were added into the mixture solution.
  • Example 2 Polyion Complex (PIC) micelle preparation
  • PIC Polyion Complex
  • RNAse free water was mixed with the polymer solution at a 1:1 N/P ratio (positive charge/negative charge) ratio of polymer to miRNA.
  • the mixing ratio of polymer to anti-miRNA was determined by optimizing micelle forming conditions, i.e., optimizing the ratio between amine-in-polymer (carrier of the present disclosure) to phosphate-in-anti-miRNA (payload).
  • the mixture of polymer (carrier) and anti- miRNA (payload) was vigorously mixed for 90 seconds by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity were measured by Zeta- sizer with 634 nm wavelength. Anti-miRNA loaded micelles had a particle size ⁇ 60 nm with low PDI distribution, which indicated that the complex was a homogeneous particle. The peak of the distribution was at 32 nm.
  • Example 3 Polyion Complex (PIC) micelle preparation ASO Payload [0427] Once the cationic carrier units of the present disclosure were generated as described in Example 1, micelles were produced. The micelles described in the present example comprised cationic carrier units combined with an ASO payload. [0428] (a) Optimization of N to P ratio with MeO- or Phe-PEG 5K -PLL(NH 3 + /Cl-) 58 (Compound A): Nano-sized PIC micelles were prepared by mixing of MeO- or Phe-PEG 5K - PLL(NH 3 + /Cl-) 58 and ASO.
  • PEG 5K -PLL(NH 3 + /Cl-) 58 was dissolved in HEPES buffer (10 mM) at 2.5 mg/mL (stock solution). The polymer stock solution was diluted in order to achieve the appropriate N to P ratio concentration. Then, an ASO solution (22.5 ⁇ M) in RNase free water was mixed with the polymer solution at a 2:1 (v/v) ratio of ASO to polymer. The mixture of polymer and ASO was vigorously mixed for 1 min by multi-vortex at 3000 rpm and kept at room temperature for 30 min to stabilize the micelles. Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength. See FIG.5A.
  • SLI scattering light intensity
  • MeO- or Phe-PEG 5K -PLL58(Nic30) was dissolved in HEPES buffer (10 mM) at 2.5 mg/mL (stock solution).
  • the polymer stock solution was diluted in order to achieve the appropriate N to P ratio concentration.
  • an ASO solution (22.5 ⁇ M) in RNase free water was mixed with the polymer solution at a 2:1 (v/v) ratio of ASO to polymer.
  • the mixture of polymer and ASO was vigorously mixed for 1 min by multi-vortex at 3000 rpm and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength. See FIG.5C.
  • an ASO solution (22.5 ⁇ M) in RNase free water was mixed with the polymer solution at 2:1 (v/v) ratio of ASO to polymer.
  • the mixing ratio of polymer to siRNA was determined by the optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-ASO (P). The optimal N to P ratio was 1.4.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength. See FIG.5D.
  • the mixing ratio of polymer to siRNA was determined by the optimization of micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-ASO (P). The optimal N to P ratio was 1.4.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • Micelles (15 ⁇ M of ASO Conc.) were stored at 4 oC prior to use. See FIG.5E.
  • Example 4 Delivery of miR-485 inhibitors to Brain using Micelles [0433] To further assess the delivery of miR-485 inhibitors in the micelles disclosed herein, the expression of SIRT1, PGC-1 ⁇ , and CD36 was tested after a single dose (100 ⁇ g/mouse; 5 mg/kg) of micelles containing miR-485 inhibitor (see Example 2) was administered (via intraventricular administration) to wild-type male Crl:CD1 (ICR) mice, which were purchased from KOATECH (Korea). It was hypothesized that SIRT1, PGC-1 ⁇ , and CD36 are upregulated by the miR-485 inhibitor. Control animals received a miR-control.
  • ICR wild-type male Crl:CD1
  • the animals were sacrificed at various time points post-administration, and the expression levels of SIRT1, PGC-1 ⁇ , and CD36 were assessed in both the cortex and hippocampus regions of the brain using Western blot.
  • a single administration of the micelles containing miR-485 inhibitor resulted in rapid increase in SIRT1, PGC-1 ⁇ , and CD36 expression in both the cortex and the hippocampus.
  • peak expression was observed in the cortex at about 48 hours post-administration (approximately 300% increase over the expression in control animals) and in the hippocampus at about 24 hours post-administration (approximately 150% increase over the control) (see FIGs.6 and 7, respectively).
  • Example 5 Polyion Complex (PIC) micelle preparation siRNA Payload
  • mice formulated with siRNA and MeO- or Phe-PEG 5K -PLL 80 (Nic 31 /SH 11 )
  • Compound H Nano-sized PIC micelle were prepared by mixing of MeO- or Phe- PEG 5K - PLL 80 (Nic31/SH11) and siRNA.
  • PEG 5K - PLL 80 (Nic 15 /SH 6 ) was dissolved in a 200 mM DTT solution (in 10 mM of HEPES buffer) at 1 mg/mL. The polymer solution was incubated for 30 min with stirring.
  • a siRNA solution (15 ⁇ M) in RNase free water was mixed with the polymer solution at a 2:1 (v/v) ratio of siRNA to polymer.
  • the mixing ratio of polymer to siRNA was determined by the optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine- in-polymer (N) and phosphate-in-siRNA (P). The optimal N to P ratio was 1.6.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi-vortex at 3000 rpm and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • Micelles (10 ⁇ M of siRNA Conc.) were stored at 4 oC prior to use.
  • mice formulated with siRNA and PEG 5K -PLL 80 (Nic 30 /SH 15 )
  • Compound I Nano-sized PIC micelles were prepared by mixing of MeO- or Phe-PEG 5K -PLL 80 (Nic 30 /SH 15 ) and siRNA.
  • PEG 5K -PLL 80 (Nic22/SH6) was dissolved in a 200 mM DTT solution (in 10 mM of HEPES buffer) at 0.87 mg/mL. The polymer solution was incubated for 30 min with stirring.
  • the siRNA solution (15 ⁇ M) in RNase free water was mixed with the polymer solution at a 2:1 (v/v) ratio of siRNA to polymer.
  • the mixing ratio of polymer to siRNA was determined by optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-siRNA (P). The optimal N to P ratio was 1.0.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • Micelles (10 ⁇ M of siRNA Conc.) were stored at 4 oC prior to use.
  • Micelles formulated with siRNA-cholesterol and PEG 5K -PLL 80 (Nic 14 /SH 6 ) (Compound E): Nano-sized PIC micelles were prepared by mixing of MeO- or Phe-PEG 5K - PLL 80 (Nic 15 /SH 6 ) and siRNA.
  • PEG 5K - PLL 80 (Nic 15 /SH 6 ) was dissolved in a 200 mM DTT solution (in 10 mM of HEPES buffer) at 0.63 mg/mL. And the polymer solution was incubated for 30 min with stirring.
  • siRNA solution 15 ⁇ M in RNase free water was mixed with the polymer solution at 2:1 (v/v) ratio of siRNA to polymer.
  • the mixing ratio of polymer to siRNA was determined by optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-siRNA (P). The optimal N to P ratio was 1.6.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi-vortex at 3000 rpm and kept at room temperature for 30 min to stabilize the micelles. Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • SLI scattering light intensity
  • mice (10 ⁇ M of siRNA Conc.) were stored at 4 oC prior to use.
  • Micelles formulated with siRNA-cholesterol and PEG 5K -PLL 80 (Nic 22 /SH 6 ) (Compound F): Nano-sized PIC micelles were prepared by mixing of MeO- or Phe-PEG 5K - PLL 80 (Nic 22 /SH 6 ) and siRNA.
  • PEG 5K -PLL 80 (Nic 22 /SH 6 ) was dissolved in a 200 mM DTT solution (in 10 mM of HEPES buffer) at 0.74 mg/mL.
  • siRNA solution 15 ⁇ M in RNase free water was mixed with the polymer solution at 2:1 (v/v) ratio of siRNA to polymer.
  • the mixing ratio of polymer to siRNA was determined by optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-siRNA (P). The optimal N to P ratio was 1.6.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi- vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • mice (10 ⁇ M of siRNA Conc.) were stored at 4 oC prior to use.
  • Micelles formulated with siRNA-cholesterol and PEG 5K -PLL 80 (Nic 28 /SH 7 ) (Compound G): Nano-sized PIC micelle were prepared by mixing of MeO- or Phe-PEG 5K - PLL 80 (Nic28/SH7) and siRNA.
  • PEG 5K - PLL 80 (Nic28/SH7) was dissolved in a 200 mM DTT solution (in 10 mM of HEPES buffer) at 0.89 mg/mL.
  • siRNA solution 15 ⁇ M in RNase free water was mixed with the polymer solution at 2:1 (v/v) ratio of siRNA to polymer.
  • the mixing ratio of polymer to siRNA was determined by optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-siRNA (P). The optimal N to P ratio was 1.6.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi- vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • mice (10 ⁇ M of siRNA Conc.) were stored at 4 oC prior to use.
  • Micelle formulated with siRNA-cholesterol and PEG 5K -PLL 80 (Nic 31 /SH 10 ) (Compound H): Nano-sized PIC micelle were prepared by mixing of MeO- or Phe-PEG 5K - PLL 80 (Nic 31 /SH 10 ) and siRNA.
  • PEG 5K - PLL 80 (Nic 31 /SH 10 ) was dissolved in a 200 mM DTT solution (in 10 mM of HEPES buffer) at 1.03 mg/mL.
  • siRNA solution 15 ⁇ M in RNase free water was mixed with the polymer solution at 2:1 (v/v) ratio of siRNA to polymer.
  • the mixing ratio of polymer to siRNA was determined by optimization of the micelle forming conditions, i.e., by optimizing the ratio between amine-in-polymer (N) and phosphate-in-siRNA (P). The optimal N to P ratio was 1.6.
  • the mixture of polymer and siRNA was vigorously mixed for 1 min by multi- vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • Particle size distribution and scattering light intensity (SLI) were measured by Zeta-sizer with 634 nm wavelength.
  • mice (10 ⁇ M of siRNA Conc.) were stored at 4 oC prior to use.
  • Example 7 In vitro Cytotoxicity [0442] Cell Culture: The GL261 Red-FLuc cells were incubated in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) supplemented with 10% FBS and antibiotics (100 ⁇ g mL ⁇ 1 of streptomycin and 100 U mL ⁇ 1 of penicillin, Gibco, USA) in a humidified 5% CO2 incubator at 37 °C. [0443] Cell cytotoxicity: Cells at a density of 10,000 cells per well were seeded in 96-well plates and allowed to grow for 24 h before the treatment.
  • DMEM Dulbecco’s modified Eagle’s medium
  • antibiotics 100 ⁇ g mL ⁇ 1 of streptomycin and 100 U mL ⁇ 1 of penicillin, Gibco, USA
  • results showed low cell viability in the H2O2 treated group, whereas in the micelle treated group cell death was not observed even at high micelle concentrations. This result indicated that siRNA loaded micelles were not cytotoxic at a range of siRNA concentration between 10 nM and 1000 nM. See FIG.19.
  • Example 8 In vitro mRNA Knock-Down Luciferase (KD-Luc) assay
  • Cell culture GL261 Red-FLuc cells were incubated in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) supplemented with 10% FBS and antibiotics (100 ⁇ g mL ⁇ 1 of streptomycin and 100 U mL ⁇ 1 of penicillin, Gibco, USA) in a humidified 5% CO2 incubator at 37 °C.
  • DMEM Dulbecco’s modified Eagle’s medium
  • antibiotics 100 ⁇ g mL ⁇ 1 of streptomycin and 100 U mL ⁇ 1 of penicillin, Gibco, USA
  • Bioluminescence Imaging (BLI) in vitro To measure luciferase activity, GL261_Luc cells (1x10 4 /well) were plated in 96-well plates.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Neurosurgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Dispersion Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Nanotechnology (AREA)
  • Inorganic Chemistry (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/IB2021/062446 2020-12-30 2021-12-29 Micellar nanoparticles and uses thereof Ceased WO2022144811A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP21914849.1A EP4271363A4 (en) 2020-12-30 2021-12-29 Micellar Nanoparticles and Their Uses
US18/259,618 US20240131048A1 (en) 2020-12-30 2021-12-29 Micellar nanoparticles and uses thereof
CA3200622A CA3200622A1 (en) 2020-12-30 2021-12-29 Micellar nanoparticles and uses thereof
KR1020237023621A KR20230128298A (ko) 2020-12-30 2021-12-29 미셀 나노입자 및 이의 용도
CN202180094793.6A CN116963722A (zh) 2020-12-30 2021-12-29 胶束纳米粒子及其用途
JP2023540026A JP2024503302A (ja) 2020-12-30 2021-12-29 ミセルナノ粒子及びその使用

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063199471P 2020-12-30 2020-12-30
US63/199,471 2020-12-30
US202163260782P 2021-08-31 2021-08-31
US63/260,782 2021-08-31
US202163260989P 2021-09-08 2021-09-08
US63/260,989 2021-09-08

Publications (1)

Publication Number Publication Date
WO2022144811A1 true WO2022144811A1 (en) 2022-07-07

Family

ID=82259191

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/062446 Ceased WO2022144811A1 (en) 2020-12-30 2021-12-29 Micellar nanoparticles and uses thereof

Country Status (7)

Country Link
US (1) US20240131048A1 (https=)
EP (1) EP4271363A4 (https=)
JP (1) JP2024503302A (https=)
KR (1) KR20230128298A (https=)
CA (1) CA3200622A1 (https=)
TW (1) TW202241460A (https=)
WO (1) WO2022144811A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11839624B2 (en) 2019-06-26 2023-12-12 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof
WO2025149946A1 (en) * 2024-01-10 2025-07-17 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019204799A1 (en) * 2018-04-20 2019-10-24 University Of Pittsburgh -Of The Commonwealth System Of Higher Education Cationic amphiphilic polymers for codelivery of hydrophobic agents and nucleic acids
US20190350870A1 (en) * 2017-02-03 2019-11-21 Omid C. Farokhzad Particles as Delivery Systems
US20200095605A1 (en) * 2016-12-14 2020-03-26 Ligandal, Inc. Compositions and methods for nucleic acid and/or protein payload delivery
CN111632153A (zh) * 2020-06-23 2020-09-08 宁夏医科大学 一种化学基因药物共载的靶向纳米递药系统及其制备方法
CN111819217A (zh) * 2018-02-13 2020-10-23 上海时莱生物技术有限公司 一种两亲性嵌段共聚物及其制备方法和纳米胶束载药系统

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018139759A1 (ko) * 2017-01-26 2018-08-02 주식회사 바이오오케스트라 마이크로 rna를 이용한 알츠하이머병 진단방법
US20210024694A1 (en) * 2018-02-01 2021-01-28 The University Of Tokyo Polymer compound for nucleic acid delivery
WO2020261227A1 (en) * 2019-06-26 2020-12-30 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof
KR102304878B1 (ko) * 2019-12-12 2021-09-27 주식회사 바이오오케스트라 miR-485-3p 활성 억제제를 이용한 알츠하이머병 치료 방법
US20250313835A1 (en) * 2022-07-07 2025-10-09 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200095605A1 (en) * 2016-12-14 2020-03-26 Ligandal, Inc. Compositions and methods for nucleic acid and/or protein payload delivery
US20190350870A1 (en) * 2017-02-03 2019-11-21 Omid C. Farokhzad Particles as Delivery Systems
CN111819217A (zh) * 2018-02-13 2020-10-23 上海时莱生物技术有限公司 一种两亲性嵌段共聚物及其制备方法和纳米胶束载药系统
WO2019204799A1 (en) * 2018-04-20 2019-10-24 University Of Pittsburgh -Of The Commonwealth System Of Higher Education Cationic amphiphilic polymers for codelivery of hydrophobic agents and nucleic acids
CN111632153A (zh) * 2020-06-23 2020-09-08 宁夏医科大学 一种化学基因药物共载的靶向纳米递药系统及其制备方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4271363A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11839624B2 (en) 2019-06-26 2023-12-12 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof
WO2025149946A1 (en) * 2024-01-10 2025-07-17 Biorchestra Co., Ltd. Micellar nanoparticles and uses thereof

Also Published As

Publication number Publication date
KR20230128298A (ko) 2023-09-04
CA3200622A1 (en) 2022-07-07
EP4271363A4 (en) 2025-11-26
US20240131048A1 (en) 2024-04-25
TW202241460A (zh) 2022-11-01
EP4271363A1 (en) 2023-11-08
JP2024503302A (ja) 2024-01-25

Similar Documents

Publication Publication Date Title
US11839624B2 (en) Micellar nanoparticles and uses thereof
US20110111056A1 (en) Peptide dicer substrate agents and methods for their specific inhibition of gene expression
WO2015175545A1 (en) Highly stable biodegradable gene vector platforms for overcoming biological barriers
US20240131048A1 (en) Micellar nanoparticles and uses thereof
EP4183879A1 (en) Double-stranded oligonucleotide and composition for treating covid-19 containing same
US20250313835A1 (en) Micellar nanoparticles and uses thereof
US20240091151A1 (en) Micellar nanoparticles and uses thereof
WO2025149946A1 (en) Micellar nanoparticles and uses thereof
CN116963722A (zh) 胶束纳米粒子及其用途
US20240216529A1 (en) Extracellular vesicles with targeting moiety
US20240209035A1 (en) Polynucleotides capable of enhanced protein expression and uses thereof
WO2023079499A1 (en) Use of mir-485 inhibitors to treat age-associated diseases or conditions
WO2025104709A1 (en) Microrna-378a-3p antisense oligonucleotides and uses thereof
WO2024127317A1 (en) Treating mitochondrial dysfunction with mirna-485 inhibitor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21914849

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3200622

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023540026

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 20237023621

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021914849

Country of ref document: EP

Effective date: 20230731

WWE Wipo information: entry into national phase

Ref document number: 202180094793.6

Country of ref document: CN