WO2022125982A1 - Compositions and methods for reducing mhc class ii in a cell - Google Patents

Compositions and methods for reducing mhc class ii in a cell Download PDF

Info

Publication number
WO2022125982A1
WO2022125982A1 PCT/US2021/062946 US2021062946W WO2022125982A1 WO 2022125982 A1 WO2022125982 A1 WO 2022125982A1 US 2021062946 W US2021062946 W US 2021062946W WO 2022125982 A1 WO2022125982 A1 WO 2022125982A1
Authority
WO
WIPO (PCT)
Prior art keywords
chr16
cell
ciita
hla
engineered cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/062946
Other languages
English (en)
French (fr)
Inventor
Srijani SRIDHAR
Yong Zhang
William Frederick HARRINGTON
Surbhi GOEL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Intellia Therapeutics Inc
Original Assignee
Intellia Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020237022783A priority Critical patent/KR20230130635A/ko
Priority to IL303505A priority patent/IL303505A/en
Priority to CA3204997A priority patent/CA3204997A1/en
Priority to AU2021396403A priority patent/AU2021396403A1/en
Priority to EP21852082.3A priority patent/EP4259783A1/en
Priority to CR20230303A priority patent/CR20230303A/es
Priority to CN202180090184.3A priority patent/CN116802274A/zh
Priority to JP2023534899A priority patent/JP2023552816A/ja
Application filed by Intellia Therapeutics Inc filed Critical Intellia Therapeutics Inc
Priority to MX2023006878A priority patent/MX2023006878A/es
Publication of WO2022125982A1 publication Critical patent/WO2022125982A1/en
Priority to US18/332,390 priority patent/US20240016934A1/en
Anticipated expiration legal-status Critical
Priority to CONC2023/0008922A priority patent/CO2023008922A2/es
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/32T-cell receptors [TCR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/15Natural-killer [NK] cells; Natural-killer T [NKT] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/20Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/22Immunosuppressive or immunotolerising
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/418Antigens related to induction of tolerance to non-self
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4705Regulators; Modulating activity stimulating, promoting or activating activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70539MHC-molecules, e.g. HLA-molecules
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • C12N5/0638Cytotoxic T lymphocytes [CTL] or lymphokine activated killer cells [LAK]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0646Natural killers cells [NK], NKT cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11001Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/343Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2302Interleukin-2 (IL-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2307Interleukin-7 (IL-7)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/2315Interleukin-15 (IL-15)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries

Definitions

  • MHC major histocompatibility complex
  • MHC molecules exist in various forms, including e.g., numerous genetic variants of any given MHC gene, i.e., alleles, encoding different forms of MHC protein.
  • the primary classes of MHC molecules are referred to as MHC class I and MHC class II.
  • MHC class I molecules e.g., HLA-A, HLA-B, and HLA-C in humans
  • MHC class II molecules e.g., HLA-DP, HLA-DQ, and HLA-DR in humans
  • B cells e.g., B cells, dendritic cells, and macrophages
  • helper T cells CD4+ T cells or Th cells
  • Alloreactive T cells can become activated e.g., by the presence of another individual’s cells expressing MHC molecules in the body, causing e.g., graft versus host disease and transplant rejection.
  • Methods and compositions for reducing the susceptibility of an allogeneic cell to rejection are of interest, including e.g., reducing the cell’s expression of MHC protein to avoid recipient T cell responses.
  • the present disclosure provides engineered cells with reduced or eliminated surface expression of MHC class II.
  • the engineered cell comprises a genetic modification in the CIITA gene (class II major histocompatibility complex transactivator), which may be useful in cell therapy.
  • the disclosure further provides compositions and methods to reduce or eliminate surface expression of MHC class II protein in a cell by genetically modifying the CIITA gene.
  • the CIITA protein functions as a transcriptional activator (activating the MHC class II promoter) and is essential for MHC class II protein expression.
  • the disclosure further provides compositions and methods to reduce or eliminate surface expression of MHC class I protein in the cell by genetically modifying B2M ( ⁇ -2-microgloblin).
  • the B2M protein forms a heterodimer with MHC class I molecules and is required for MHC class I protein expression on the cell surface.
  • the disclosure further provides expression of an NK cell inhibitor molecule by the cell to reduce or eliminate the lytic activity of NK cells.
  • the methods and compositions further provide for insertion of an exogenous nucleic acid, e.g., encoding a targeting receptor, other polypeptide expressed on the cell surface, or a polypeptide that is secreted from the cell.
  • the engineered cell is useful as a “cell factory” for secreting an exogenous protein in a recipient. In some embodiments, the engineered cell is useful as an adoptive cell therapy.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, is provided, the engineered cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises a modification of at least one nucleotide of a splice acceptor site.
  • the one nucleotide is A. In some embodiments, the one nucleotide is G. In some embodiments, the genetic modification comprises a modification of at least one nucleotide of a splice donor site. In some embodiments, the one nucleotide is G. In some embodiments, the one nucleotide is T. In some embodiments, the genetic modification comprises a modification of a splice site boundary nucleotide.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, is provided, the engineered cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr16:10902174-10902194, chr16:10902179-10902199, chr16:10902183-10902203, chr16:10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:1090
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456- 10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747-10895767, chr16:10916348-10916368, chr16:10910186
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469, and chr16:10923214-10923234.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219- 10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470.
  • a composition comprising: a) a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide; wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171- 10923242.
  • a composition comprising: a) a CIITA guide RNA (gRNA) comprising i) a guide sequence selected from SEQ ID NOs: 1-101; or ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1- 101; or iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-101; or iv) a sequence that comprises 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1; or v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v).
  • gRNA CIITA guide RNA
  • a composition comprising: a) a CIITA guide RNA that is a single-guide RNA (sgRNA) comprising i) a guide sequence selected from SEQ ID NOs: 1-101; or ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-101; or iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-101; or iv) a sequence that comprises 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1; or v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v).
  • sgRNA single-guide RNA
  • a method of making an engineered cell, which has reduced or eliminated surface expression of MHC class II protein relative to an unmodified cell comprising contacting a cell with a composition of any of the embodiments provided herein.
  • the composition comprises a CIITA guide RNA, comprising a nucleotide chosen from: SEQ ID NO: 47, SEQ ID NO: 55, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 100, and SEQ ID NO: 101.
  • a CIITA guide RNA comprising a nucleotide chosen from: SEQ ID NO: 47, SEQ ID NO: 55, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 100, and SEQ ID NO: 101.
  • the composition comprises a CIITA guide RNA, comprising a nucleotide chosen from: SEQ ID NO: 47, SEQ ID NO: 55, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 97, SEQ ID NO: 98, and SEQ ID NO: 100.
  • a method of reducing surface expression of MHC class II protein in an engineered cell relative to an unmodified cell is provided, the method comprising contacting a cell with a composition of any of embodiments provided herein.
  • FIG. 1A-D show results of a screen in T cells comparing editing of CIITA guide RNAs (FIG. 1A (for Cas9 cleavase (Cas9)) and FIG. 1B (a deaminase (BC22)) with the mean percentage of T cells negative for cell surface expression of MHC class II (% MHC II negative”) by flow cytometry for Cas9 (FIG.1C) and BC22 (FIG.1D).
  • FIG. 2 shows the mean percentage of T cells negative for cell surface expression of MHC class II (% MHC II negative”) for several guides using Cas9 and BC22 in relation to the distance from the cut site to the splice site boundary nucleotide shown as base pairs (“bp”).
  • FIGS.3A-3D show the editing profile of T cells as percent of total reads while varying levels of BC22n (“BC22n,” as used herein, refers to BC22 without UGI) mRNA and Cas9 mRNAs.
  • BC22n refers to BC22 without UGI
  • Cells were edited with individual guide RNAs G015995 (FIG.3A), G016017 (FIG.3B), G016206 (FIG.3C), and G018117 (FIG.3D).
  • FIGS.4A-4D show the editing profile for T cells as percent of total reads while varying levels of BC22n mRNA and Cas9 mRNAs, when four guide RNAs were used simultaneously for editing. The percentage of total reads with multi-guide delivery is shown for each of the four loci targeted by G015995 (FIG. 4A), G016017 (FIG. 4B), G016206 (FIG. 4C), and G018117 (FIG. 4D).
  • FIGS. 5A-5H show phenotyping results as percent of cells negative for antibody binding with increasing total RNA for both BC22n and Cas9 samples (as shown in Table 14).
  • FIG. 5A shows the percentage of B2M negative cells when B2M guide G015995 was used for editing.
  • FIG. 5B shows the percentage of B2M negative cells when multi guides were used for editing.
  • FIG. 5C shows the percentage of CD3 negative cells when TRAC guide G016017 was used for editing.
  • FIG. 5D shows the percentage of CD3 negative cells when TRBC guide G016206 was used for editing.
  • FIG.5E shows the percentage of CD3 negative cells when multiple guides were used for editing.
  • FIG.5F shows the percentage of MHC class II negative cells when CIITA guide G018117 was used for editing.
  • FIG.5G shows the percentage of MHC class II negative cells when multiple guides were used for editing.
  • FIG.5H shows the percentage of triple (B2M, CD3, MHC II) negative cells when multiple guides were used for editing.
  • FIGS. 6A-6B show the editing profile in T cells following treatment with different mRNA constructs and CIITA-targeting sgRNAs (FIG. 6A) and MHC class II negative cells assessed by flow cytometry analysis of T cells treated with different mRNA constructs and CIITA guide RNAs (FIG.6B).
  • FIGS. 8A-8D show protein-protein interaction networks enriched among the list of differentially expressed genes in T cells treated with a first guide, UGI mRNA and either Cas9 mRNA (Fig. 8A) or BC22n mRNA (Fig.
  • FIGS. 9A-9C show survival of B2M knockout T cells and B2M knockout/HLA-E T cells at 90 days post injection (FIG.9A), over a 90-day time course (FIG.9B), and over a 30-day time course (FIG.9C), in a murine model of NK cell killing by an in vivo imaging system (IVIS); the IVIS signal was quantitated as average radiance. Data points for individual mice (1-8) are shown.
  • FIGS.10A-10B show the percentage of editing of CIITA, B2M, and TRAC in T cells by NGS sequencing before magnetic cell separation (MACS ® ) processing (FIG. 10A) and after MACS ® processing (FIG.10B).
  • FIGS. 11A-11B show the mean percentage of T cells negative for cell surface expression of MHC class II, B2M, and TRAC by flow cytometry before MACS ® processing (FIG. 11A) and after MACS ® processing (FIG.11B).
  • FIG. 12 shows the chromosomal structural variations in genetically modified cells treated with electroporation, a simultaneous LNP process, or a sequential LNP process, by KromaTiD dGH assay.
  • the present disclosure provides engineered cells, as well as methods and compositions for genetically modifying a cell to make an engineered cell and populations of engineered cells, that are useful, for example, for adoptive cell transfer (ACT) therapies.
  • the disclosure provided herein overcomes certain hurdles of prior methods by providing methods and compositions for genetically modifying CIITA to reduce expression of MHC class II protein on the surface of a cell.
  • the disclosure provides engineered cells with reduced or eliminated surface expression of MHC class II as a result of a genetic modification in the CIITA gene.
  • the disclosure provides compositions and methods for reducing or eliminating expression of MHC class II protein and compositions and methods to further reduce the cell’s susceptibility to immune rejection.
  • the methods and compositions comprise reducing or eliminating surface expression of MHC class II protein by genetically modifying CIITA, and reducing or eliminating surface expression of MHC class I protein and/or inserting an exogenous nucleic acid encoding an NK cell inhibitor molecule, or a targeting receptor, or other polypeptide (expressed on the cell surface or secreted) into the cell by genetic modification.
  • the engineered cell compositions produced by the methods disclosed herein have desirable properties, including e.g., reduced expression of MHC molecules, reduced immunogenicity in vitro and in vivo, increased survival, and increased genetic compatibility with greater subjects for transplant.
  • A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB.
  • expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, CBBA, CABA, and so forth.
  • BB BB
  • AAA AAA
  • AAB AAB
  • CBA BCA
  • BAC BAC
  • CAB CAB
  • expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AAB, BBC, CBBA, CABA, and so forth.
  • the skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
  • kits refers to a packaged set of related components, such as one or more polynucleotides or compositions and one or more related materials such as delivery devices (e.g., syringes), solvents, solutions, buffers, instructions, or desiccants.
  • delivery devices e.g., syringes
  • An “allogeneic” cell refers to a cell originating from a donor subject of the same species as a recipient subject, wherein the donor subject and recipient subject have genetic dissimilarity, e.g., genes at one or more loci that are not identical. Thus, e.g., a cell is allogeneic with respect to the subject to be administered the cell.
  • an “autologous” cell refers to a cell derived from the same subject to whom the material will later be re-introduced. Thus, e.g., a cell is considered autologous if it is removed from a subject and it will then be re-introduced into the same subject.
  • ⁇ 2M refers to nucleic acid sequence or protein sequence of “ ⁇ -2 microglobulin”; the human gene has accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13.
  • NC_000015 accession number 44711492..44718877
  • GRCh38.p13 accession number 44711492..44718877
  • the B2M protein is associated with MHC class I molecules as a heterodimer on the surface of nucleated cells and is required for MHC class I protein expression.
  • CIITA or “CIITA” or “C2TA,” as used herein, refers to the nucleic acid sequence or protein sequence of “class II major histocompatibility complex transactivator;” the human gene has accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13.
  • NC_000016.10 range 10866208..10941562
  • GRCh38.p13 accession number NC_000016.10 (range 10866208..10941562)
  • the CIITA protein in the nucleus acts as a positive regulator of MHC class II gene transcription and is required for MHC class II protein expression.
  • MHC or “MHC molecule(s)” or “MHC protein” or “MHC complex(es),” refers to a major histocompatibility complex molecule (or plural), and includes e.g., MHC class I and MHC class II molecules.
  • MHC molecules are referred to as “human leukocyte antigen” complexes or “HLA molecules” or “HLA protein.”
  • HLA molecules human leukocyte antigen complexes
  • HLA-A refers to the MHC class I protein molecule, which is a heterodimer consisting of a heavy chain (encoded by the HLA- A gene) and a light chain (i.e., beta-2 microglobulin).
  • HLA-A or HLA-A gene refers to the gene encoding the heavy chain of the HLA- A protein molecule.
  • the HLA-A gene is also referred to as “HLA class I histocompatibility, A alpha chain;” the human gene has accession number NC_000006.12 (29942532..29945870).
  • HLA-A gene is known to have thousands of different versions (also referred to as “alleles”) across the population (and an individual may receive two different alleles of the HLA-A gene).
  • a public database for HLA-A alleles, including sequence information, may be accessed at IPD-IMGT/HLA: https://www.ebi.ac.uk/ipd/imgt/hla/. All alleles of HLA-A are encompassed by the terms “HLA- A” and “HLA-A gene.”
  • HLA-B as used herein in the context of nucleic acids refers to the gene encoding the heavy chain of the HLA-B protein molecule.
  • HLA-B is also referred to as “HLA class I histocompatibility, B alpha chain;” the human gene has accession number NC_000006.12 (31353875..31357179).
  • HLA-C as used herein in the context of nucleic acids refers to the gene encoding the heavy chain of the HLA-C protein molecule.
  • the HLA-C is also referred to as “HLA class I histocompatibility, C alpha chain;” the human gene has accession number NC_000006.12 (31268749..31272092).
  • the term “within the genomic coordinates” includes the boundaries of the genomic coordinate range given.
  • the coordinates chr6:29942854- chr6:29942913 are encompassed.
  • the referenced genomic coordinates are based on genomic annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available at the National Center for Biotechnology Information website.
  • Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to the corresponding coordinates in another assembly of the human genome, including conversion to an earlier assembly generated by the same institution or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversion of an assembly generated by a different institution or algorithm (e.g., from GRCh38 to NCBI33, generated by the International Human Genome Sequencing Consortium).
  • Available methods and tools known in the art include, but are not limited to, NCBI Genome Remapping Service, available at the National Center for Biotechnology Information website, UCSC LiftOver, available at the UCSC Genome Brower website, and Assembly Converter, available at the Ensembl.org website.
  • a “splice site,” as used herein, refers to the three nucleotides that make up an acceptor splice site or a donor splice site (defined below), or any other nucleotides known in the art that are part of a splice site. See e.g., Burset et al., Nucleic Acids Research 28(21):4364-4375 (2000) (describing canonical and non-canonical splice sites in mammalian genomes).
  • the three nucleotides that make up an “acceptor splice site” are two conserved residues (e.g., AG in humans) at the 3’ of an intron and a boundary nucleotide (i.e., the first nucleotide of the exon 3’ of the AG).
  • the “splice site boundary nucleotide” of an acceptor splice site is designated as “Y” in the diagram below and may also be referred to herein as the “acceptor splice site boundary nucleotide,” or “splice acceptor site boundary nucleotide.”
  • the terms “acceptor splice site,” “splice acceptor site,” “acceptor splice sequence,” or “splice acceptor sequence” may be used interchangeably herein.
  • the three nucleotides that make up a “donor splice site” are two conserved residues (e.g., GT (gene) or GU (in RNA such as pre-mRNA) in human) at the 5’ end of an intron and a boundary nucleotide (i.e., the first nucleotide of the exon 5’ of the GT).
  • GT gene
  • GU in RNA such as pre-mRNA
  • splice site boundary nucleotide of a donor splice site is designated as “X” in the diagram below and may also be referred to herein as the “donor splice site boundary nucleotide,” or “splice donor site boundary nucleotide.”
  • the terms “donor splice site,” “splice donor site,” “donor splice sequence,” or “splice donor sequence” may be used interchangeably herein.
  • splice site region includes the nucleotides of the splice site, as well as nucleotides that are in proximity to the splice site.
  • the term “subject” is intended to include living organisms in which an immune response can be elicited, including e.g., mammals, primates, humans.
  • “Polynucleotide” and “nucleic acid” are used herein to refer to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof.
  • a nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds (“peptide nucleic acids” or PNA; PCT No. WO 95/32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof.
  • Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy or 2’ halide substitutions.
  • Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others); inosine; derivatives of purines or pyrimidines (e.g., N 4 -methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine), purine bases with a substituent at the 2, 6, or 8 positions, 2- amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4- dimethylhydrazine-pyrimidines, and O 4 -alkyl-pyrimidines; US Pat.
  • Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position(s) of the polymer (US Pat. No.5,585,481).
  • a nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs).
  • Nucleic acid includes “locked nucleic acid” (LNA), an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41).
  • LNA locked nucleic acid
  • RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.
  • RNA RNA-guided DNA binding agent
  • guide can be a single guide RNA, or the combination of a crRNA and a trRNA (also known as tracrRNA).
  • exemplary gRNAs include Class II Cas nuclease guide RNAs, in modified or unmodified forms.
  • the crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA strands (dual guide RNA, dgRNA).
  • sgRNA single guide RNA
  • dgRNA dual guide RNA
  • the trRNA may be a naturally occurring sequence, or a trRNA sequence with modifications or variations compared to naturally-occurring sequences.
  • a “guide sequence” refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct a guide RNA to a target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent.
  • a “guide sequence” may also be referred to as a “targeting sequence,” or a “spacer sequence.”
  • a guide sequence can be 20 base pairs in length, e.g., in the case of Streptococcus pyogenes (i.e., Spy Cas9 (SpCas9)) and related Cas9 homologs/orthologs. Shorter or longer sequences can also be used as guides, e.g., 15-, 16-, 17-, 18-, 19-, 21-, 22-, 23-, 24-, or 25-nucleotides in length.
  • the target sequence is in a gene or on a chromosome, for example, and is complementary to the guide sequence.
  • the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the guide sequence and the target region may be 100% complementary or identical.
  • the guide sequence and the target region may contain at least one mismatch.
  • the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, where the total length of the target sequence is at least 17, 18, 19, 20 or more base pairs.
  • the guide sequence and the target region may contain 1-4 mismatches where the guide sequence comprises at least 17, 18, 19, 20 or more nucleotides.
  • the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches where the guide sequence comprises 20 nucleotides.
  • Target sequences for RNA-guided DNA binding agents include both the positive and negative strands of genomic DNA (i.e., the sequence given and the sequence’s reverse compliment), as a nucleic acid substrate for an RNA-guided DNA binding agent is a double stranded nucleic acid. Accordingly, where a guide sequence is said to be “complementary to a target sequence”, it is to be understood that the guide sequence may direct a guide RNA to bind to the reverse complement of a target sequence.
  • RNA-guided DNA binding agent means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA.
  • Exemplary RNA-guided DNA binding agents include Cas cleavases/nickases and inactivated forms thereof (“dCas DNA binding agents”).
  • Cas nuclease also called “Cas protein” as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents.
  • Cas cleavases/nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases.
  • a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity.
  • Class 2 Cas nucleases include Class 2 Cas cleavases/nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase/nickase activity is inactivated.
  • Class 2 Cas cleavases/nickases e.g., H840A, D10A, or N863A variants
  • Class 2 dCas DNA binding agents in which cleavase/nickase activity is inactivated.
  • Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof.
  • Cas9 Cas9
  • Cpf1, C2c1, C2c2, C2c3, HF Cas9 e.g., N497A, R661A, Q695A, Q926A variants
  • HypaCas9 e.g., N692A, M694
  • Cpf1 protein Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain.
  • Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables S1 and S3. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
  • the term “editor” refers to an agent comprising a polypeptide that is capable of making a modification within a DNA sequence.
  • the editor is a cleavase, such as a Cas9 cleavase. In some embodiments, the editor is capable of deaminating a base within a DNA molecule. In some embodiments, the editor is capable of deaminating a cytosine (C) in DNA. In some embodiments, the editor is a fusion protein comprising an RNA- guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to an APOBEC3A deaminase (A3A).
  • A3A APOBEC3A deaminase
  • the editor comprises a Cas9 nickase fused to an APOBEC3A deaminase (A3A).
  • A3A APOBEC3A deaminase
  • the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase and a UGI.
  • the editor lacks a UGI.
  • a “cytidine deaminase” means a polypeptide or complex of polypeptides that is capable of cytidine deaminase activity, that is catalyzing the hydrolytic deamination of cytidine or deoxycytidine, typically resulting in uridine or deoxyuridine.
  • Cytidine deaminases encompass enzymes in the cytidine deaminase superfamily, and in particular, enzymes of the APOBEC family (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminase (AID or AICDA) and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol.22:367-77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol.
  • APOBEC3 refers to a APOBEC3 protein, such as an APOBEC3 protein expressed by any of the seven genes (A3A-A3H) of the human APOBEC3 locus.
  • the APOBEC3 may have catalytic DNA or RNA editing activity.
  • An amino acid sequence of APOBEC3A has been described (UniPROT accession ID: p31941) and is included herein as SEQ ID NO: 40.
  • the APOBEC3 protein is a human APOBEC3 protein and/or a wild-type protein.
  • Variants include proteins having a sequence that differs from wild-type APOBEC3 protein by one or several mutations (i.e. substitutions, deletions, insertions), such as one or several single point substitutions.
  • a shortened APOBEC3 sequence could be used, e.g. by deleting several N-term or C-term amino acids, preferably one to four amino acids at the C-terminus of the sequence.
  • variant refers to allelic variants, splicing variants, and natural or artificial mutants, which are homologous to a APOBEC3 reference sequence.
  • the variant is “functional” in that it shows a catalytic activity of DNA or RNA editing.
  • an APOBEC3 (such as a human APOBEC3A) has a wild-type amino acid position 57 (as numbered in the wild-type sequence). In some embodiments, an APOBEC3 (such as a human APOBEC3A) has an asparagine at amino acid position 57 (as numbered in the wild- type sequence).
  • a “nickase” is an enzyme that creates a single-strand break (also known as a “nick”) in double strand DNA, i.e., cuts one strand but not the other of the DNA double helix.
  • RNA-guided DNA nickase means a polypeptide or complex of polypeptides having DNA nickase activity, wherein the DNA nickase activity is sequence-specific and depends on the sequence of the RNA.
  • Exemplary RNA-guided DNA nickases include Cas nickases.
  • Cas nickases include nickase forms of a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases.
  • Class 2 Cas nickases include variants in which only one of the two catalytic domains is inactivated, which have RNA-guided DNA nickase activity.
  • Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g, K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof.
  • Cas9 e.g
  • Cpf1 protein Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like protein domain.
  • Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables S1 and S3.
  • “Cas9” encompasses S. pyogenes (Spy) Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
  • fusion protein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins.
  • One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C- terminal) protein thus forming an “amino-terminal fusion protein” or a “carboxy-terminal fusion protein,” respectively.
  • Any of the proteins provided herein may be produced by any method known in the art.
  • the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker.
  • linker refers to a chemical group or a molecule linking two adjacent molecules or moieties. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond.
  • the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein) such as a 16-amino acid residue “XTEN” linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol.27, 1186-1190 (2009)).
  • XTEN 16-amino acid residue
  • the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902).
  • the linker is a peptide linker comprising one or more sequences selected from SEQ ID NOs: 903-971.
  • uracil glycosylase inhibitor or “UGI” refers to a protein that is capable of inhibiting a uracil-DNA glycosylase (UDG) base-excision repair enzyme.
  • open reading frame or “ORF” of a gene refers to a sequence consisting of a series of codons that specify the amino acid sequence of the protein that the gene codes for.
  • the ORF begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon, e.g., TAA, TAG or TGA in DNA or UAA, UAG, or UGA in RNA.
  • ribonucleoprotein or “RNP complex” refers to a guide RNA together with an RNA-guided DNA binding agent, such as a Cas nuclease, e.g., a Cas cleavase, Cas nickase, or dCas DNA binding agent (e.g., Cas9).
  • the guide RNA guides the RNA-guided DNA binding agent such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence; in cases where the agent is a cleavase or nickase, binding can be followed by cleaving or nicking.
  • a first sequence is considered to “comprise a sequence with at least X% identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence in its entirety are matched by the first sequence.
  • the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence.
  • RNA and DNA generally the exchange of uridine for thymidine or vice versa
  • nucleoside analogs such as modified uridines
  • adenosine for all of thymidine, uridine, or modified uridine another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement.
  • sequence 5’-AXG where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5’-CAU).
  • exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art.
  • mRNA is used herein to refer to a polynucleotide and comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs).
  • mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2’-methoxy ribose residues.
  • the sugars of an mRNA phosphate-sugar backbone consist essentially of ribose residues, 2’-methoxy ribose residues, or a combination thereof.
  • “indels” refer to insertion/deletion mutations consisting of a number of nucleotides that are either inserted or deleted, e.g. at the site of double-stranded breaks (DSBs), in a target nucleic acid.
  • reduced or eliminated expression of a protein on a cell refers to a partial or complete loss of expression of the protein relative to an unmodified cell.
  • the surface expression of a protein on a cell is measured by flow cytometry and has “reduced or eliminated” surface expression relative to an unmodified cell as evidenced by a reduction in fluorescence signal upon staining with the same antibody against the protein.
  • a cell that has “reduced or eliminated” surface expression of a protein by flow cytometry relative to an unmodified cell may be referred to as “negative” for expression of that protein as evidenced by a fluorescence signal similar to a cell stained with an isotype control antibody.
  • knockdown refers to a decrease in expression of a particular gene product (e.g., protein, mRNA, or both), e.g., as compared to expression of an unedited target sequence. Knockdown of a protein can be measured by detecting total cellular amount of the protein from a sample, such as a tissue, fluid, or cell population of interest. It can also be measured by measuring a surrogate, marker, or activity for the protein. Methods for measuring knockdown of mRNA are known and include analyzing mRNA isolated from a sample of interest.
  • “knockdown” may refer to some loss of expression of a particular gene product, for example a decrease in the amount of mRNA transcribed or a decrease in the amount of protein expressed by a cell or population of cells (including in vivo populations such as those found in tissues).
  • “knockout” refers to a loss of expression from a particular gene or of a particular protein in a cell. Knockout can result in a decrease in expression below the level of detection of the assay. Knockout can be measured either by detecting total cellular amount of a protein in a cell, a tissue or a population of cells.
  • a “target sequence” or “genomic target sequence” refers to a sequence of nucleic acid in a target gene that has complementarity to the guide sequence of the gRNA. The interaction of the target sequence and the guide sequence directs an RNA-guided DNA binding agent to bind, and potentially nick or cleave (depending on the activity of the agent), within the target sequence.
  • treatment refers to any administration or application of a therapeutic for disease or disorder in a subject, and includes inhibiting the disease, arresting its development, relieving one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including recurrence of the symptom.
  • a conjugate includes a plurality of conjugates and reference to “a cell” includes a plurality of cells and the like.
  • Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement.
  • the use of “comprise”, “comprises”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes”, and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.
  • the present disclosure provides engineered cell compositions which have reduced or eliminated surface expression of MHC class II relative to an unmodified cell.
  • the engineered cell composition comprises a genetic modification in the CIITA gene.
  • the engineered cell is an allogeneic cell.
  • the engineered cell with reduced MHC class II expression is useful for adoptive cell transfer therapies.
  • the engineered cell comprises additional genetic modifications in the genome of the cell to yield a cell that is desirable for allogeneic transplant purposes.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10877360-10923242.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242.
  • the genetic modification comprises a modification of at least one nucleotide of a splice acceptor site. In some embodiments, the genetic modification comprises a modification of at least one nucleotide of a splice acceptor site, wherein the one nucleotide is adenine (A). In some embodiments, the genetic modification comprises a modification of at least one nucleotide of a splice acceptor site, wherein the one nucleotide is guanine (G). In some embodiments, the genetic modification comprises a modification of at least one nucleotide of a splice donor site.
  • the genetic modification comprises a modification of at least one nucleotide of a splice donor site, wherein the one nucleotide is guanine (G). In some embodiments, the genetic modification comprises a modification of at least one nucleotide of a splice donor site, wherein the one nucleotide is thymine (T). In some embodiments, the genetic modification comprises a modification of a splice site boundary nucleotide.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least 5 contiguous nucleotides within the genomic coordinates chr16: 10902171-10923242
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates chr16: 10902171-10923242.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates chr16: 10902171- 10923242.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10903873-chr:10923242
  • a genetic modification in the CIITA gene comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr:16:10906485-chr:10923242.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908130-chr:10923242.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469, and chr16:10923214-10923234.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504- 10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, and chr16:10922478
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908132-10908152.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908131-10908151.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10916456-10916476.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219- 10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910196
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524, chr16:10923218- 10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, and chr16:10922153-10922173.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10923218-10923238.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10923219-10923239.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr16:10902174-10902194, chr16:10902179-10902199, chr16:10902183-10902203, chr16:10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789-10902809,
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469, and chr16:10923214-10923234.
  • the genetic modification comprises an indel, a C
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470.
  • the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, and chr16
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10908132-10908152.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10908131-10908151.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10916456-10916476.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10918504-10918524.
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, and chr16:10922153-10922173.
  • the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinate
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10918504-10918524.
  • an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10923218-10923238.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprises a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chr16:10923219-10923239.
  • the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates.
  • the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates.
  • the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chosen from: chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr16:10902174-10902194, chr16:10902179-10902199, chr16:10902183-10902203, chr16:10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789-10902809, chr16:10902790-109028
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10895410-10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173-10902193, chr16:10902174-10902194, chr16:10902179-10902199, chr16:10902183-10902203, chr16:10902184-10902204, chr16:10902644-10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:10902789-10902809, chr16:10902790-10902810, chr16:109027
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent.
  • the RNA- guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chosen from: chr16:10903873-10903893, chr16:10903878-10903898, chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10906481-10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10903873-10903893, chr16:10903878-10903898, chr16:10903905-10903925, chr16:10903906-10903926, chr16:10904736-10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10906481-10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908150, chr16:1090649
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA- binding agent.
  • the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chosen from: chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:109018-10909038, chr16:10909006-109026,
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10906485-10906505, chr16:10906486- 10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127-10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:10909018-10909038, chr16:
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent.
  • the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042, chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196,
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908130- 10908150, chr16:10908131-10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022-10909042, chr16:10909172-10909192, chr16:10910165-10910185, chr16:10910176-10910196, chr16
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA- binding agent.
  • the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr
  • the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469, and chr16:10923214-10923234.
  • a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 con
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470.
  • a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-109232
  • the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, and chr16:10922478-10922498.
  • a gene editing system that binds to
  • the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10908132-10908152. In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10908131-10908151.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10916456-10916476. In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10918504-10918524. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates.
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent.
  • the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:
  • the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA- binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA-binding agent comprises a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a APOBEC3 deaminase, such as APOBEC3A (A3A).
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, and chr16:10922153-10922173.
  • a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from
  • the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA-binding agent comprises a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a APOBEC3 deaminase, such as APOBEC3A (A3A).
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239.
  • the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates.
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent.
  • the RNA-guided DNA binding agent comprises a deaminase. In some embodiments, the RNA-guided DNA-binding agent comprises a deaminase and an RNA-guided nickase. In some embodiments, the deaminase is a APOBEC3 deaminase, such as APOBEC3A (A3A).
  • APOBEC3A APOBEC3A
  • an engineered cell is provided that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates:10918504- 10918524.
  • an engineered cell that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10923218-10923238. In some embodiments, an engineered cell is provided that has reduced or eliminated surface expression of MHC class II by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10923219-10923239. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates.
  • the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • the gene editing system comprises an RNA-guided DNA-binding agent.
  • the RNA-guided DNA binding agent comprises a deaminase.
  • the RNA-guided DNA-binding agent comprises a deaminase and an RNA-guided nickase.
  • the deaminase is a APOBEC3 deaminase, such as APOBEC3A (A3A).
  • a range may encompass +/- 10 nucleotides on either end of the specified coordinates.
  • the range may encompass +/- 5 nucleotides on either end of the range.
  • the genomic target sequence or genetic modification may fall within chr16:10923212-10923252.
  • a given range of genomic coordinates may comprise a target sequence on both strands of the DNA (i.e., the plus (+) strand and the minus (-) strand).
  • a genetic modification in the CIITA gene comprises any one or more of an insertion, deletion, substitution, or deamination of at least one nucleotide in a target sequence.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification inactivates a splice site.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises an insertion at a splice site nucleotide.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises a deletion of a splice site nucleotide.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises a substitution of a splice site nucleotide.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises a deamination of a splice site nucleotide.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene as described herein, and wherein the cell further has reduced or eliminated surface expression of HLA-A.
  • the engineered cell comprises a genetic modification in the HLA-A gene.
  • the engineered cell comprises a genetic modification in the HLA-A gene and wherein the cell is homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the engineered cell comprises a genetic modification that eliminates expression of HLA-A protein on the surface of the engineered cell.
  • the engineered human cells described herein may comprise a genetic modification in any HLA-A allele of the HLA-A gene.
  • the HLA gene is located in chromosome 6 in a genomic region referred to as the HLA superlocus; hundreds of HLA-A alleles have been reported in the art (see e.g., Shiina et al., Nature 54:15-39 (2009).
  • HLA-A alleles are available in the art (see e.g., IPD-IMGT/HLA database for retrieving sequences of specific HLA-A alleles https://www.ebi.ac.uk/ipd/imgt/hla/allele.html).
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16: 10902171-10923242, further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942854 to chr6:29942913 and chr6:29943518 to chr6: 29943619.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877- 29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549- 29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876- 29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537- 29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16: 10902171-10923242, and wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942854 to chr6:29942913 and chr6:29943518 to chr6: 29943619.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883- 29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589- 29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528- 29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16: 10902171-10923242, and wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942854 to chr6:29942913 and chr6:29943518 to chr6: 29943619.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883- 29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589- 29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528- 29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132- 10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877- 29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549- 29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876- 29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537- 29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504- 10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chrr
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218- 10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, chr16:10916450-10916470, chr16:10923222-10923242, chr16:10916449-10916469, and chr16:10923214-10923234, and wherein the cell further comprises
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877- 29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549- 29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876- 29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537- 29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504- 10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470, and wherein the cell further comprises a genetic modification in an HLA
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218- 10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906485-10906505, chr16:10916359-10916379, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10922153-10922173, and chr16:10916450-10916470, and wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877- 29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549- 29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876- 29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537- 29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell is provided, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132- 10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, and wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942854 to chr6:29942913 and chr6:29943518 to chr6: 29943619.
  • an engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218- 10923238, chr16:10923219-10923239, and wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942854 to chr6:29942913 and chr6:29943518 to chr6: 29943619.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868- 29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530- 29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877- 29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549- 29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876- 29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537- 29943557; chr6:29943549-29943569; chr6:29943589-29943609; and chr6:29944026-29944046.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242, and wherein the cell further has reduced or eliminated surface expression of MHC class I.
  • the engineered cell comprises a genetic modification in the beta-2-microglobulin (B2M) gene.
  • the engineered cell comprises a genetic modification that reduces expression of MHC class I protein on the surface of the engineered cell.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242, and wherein the cell further comprises an exogenous nucleic acid.
  • the exogenous nucleic acid encodes a targeting receptor that is expressed on the surface of the engineered cell.
  • the targeting receptor is a chimeric antigen receptor (CAR).
  • the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR/TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR).
  • BCR B cell receptor
  • the exogenous nucleic acid encodes a polypeptide that is secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242, wherein the cell further has reduced or eliminated surface expression of MHC class I, and wherein the cell further comprises an exogenous nucleic acid.
  • the engineered cell comprises a genetic modification in the beta-2-microglobulin (B2M) gene.
  • B2M beta-2-microglobulin
  • the engineered cell comprises a genetic modification that reduces expression of MHC class I protein on the surface of the engineered cell.
  • the exogenous nucleic acid encodes a targeting receptor that is expressed on the surface of the engineered cell.
  • the targeting receptor is a chimeric antigen receptor (CAR).
  • the targeting receptor is a universal CAR (UniCar).
  • the targeting receptor is a T cell receptor (TCR).
  • the targeting receptor is a WT1 TCR.
  • the targeting receptor is a hybrid CAR/TCR.
  • the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR).
  • the targeting receptor is a cytokine receptor.
  • the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR).
  • BCR B cell receptor
  • the exogenous nucleic acid encodes a polypeptide that is secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine.
  • the exogenous nucleic acid encodes a fusion protein.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of an exon within the genomic coordinates chr16: 10902662-chr16:10923285, wherein the cell further has reduced or eliminated surface expression of HLA-A, and wherein the cell further comprises an exogenous nucleic acid.
  • the engineered cell comprises a genetic modification in the HLA-A gene.
  • the engineered cell comprises a genetic modification that reduces expression of HLA-A protein on the surface of the engineered cell.
  • the exogenous nucleic acid encodes a targeting receptor that is expressed on the surface of the engineered cell.
  • the targeting receptor is a chimeric antigen receptor (CAR).
  • the targeting receptors is a universal CAR (UniCar).
  • the targeting receptor is a T cell receptor (TCR).
  • the targeting receptor is a WT1 TCR.
  • the targeting receptor is a hybrid CAR/TCR.
  • the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR).
  • the targeting receptor is a cytokine receptor.
  • the targeting receptor is a chemokine receptor.
  • the targeting receptor is a B cell receptor (BCR).
  • the exogenous nucleic acid encodes a polypeptide that is secreted by the engineered cell (i.e., a soluble polypeptide).
  • the exogenous nucleic acid encodes a therapeutic polypeptide.
  • the exogenous nucleic acid encodes an antibody.
  • the exogenous nucleic acid encodes an enzyme.
  • the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242, and wherein the cell further has reduced or eliminated expression of an endogenous TCR protein relative to an unmodified cell.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242, and wherein the cell further comprises an exogenous nucleic acid, and further has reduced or eliminated expression of an endogenous TCR protein relative to an unmodified cell.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171- 10923242, and wherein the cell further has reduced or eliminated surface expression of MHC class I, and wherein the cell further has reduced or eliminated expression of an endogenous TCR protein relative to an unmodified cell.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242, and wherein the cell further comprises an exogenous nucleic acid, and wherein the cell further has reduced or eliminated surface expression of MHC class I, and wherein the cell further has reduced or eliminated expression of an endogenous TCR protein relative to an unmodified cell.
  • the engineered cell has reduced or eliminated expression of a TRAC protein relative to an unmodified cell.
  • the engineered cell has reduced or eliminated expression of a TRBC protein relative to an unmodified cell.
  • the engineered cell comprises a genetic modification in the beta-2-microglobulin (B2M) gene.
  • the engineered cell comprises a genetic modification that reduces expression of MHC class I protein on the surface of the engineered cell.
  • the exogenous nucleic acid encodes a targeting receptor that is expressed on the surface of the engineered cell.
  • the targeting receptor is a chimeric antigen receptor (CAR).
  • the targeting receptors is a universal CAR (UniCar).
  • the targeting receptor is a T cell receptor (TCR).
  • the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR/TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide that is secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide.
  • BCR B cell receptor
  • the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.
  • the engineered cell which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell comprising a genetic modification in the CIITA gene, wherein the modification comprises at least one nucleotide of an exon within the genomic coordinates chr16: 10902662- chr16:10923285, and wherein the cell further comprises an exogenous nucleic acid, and wherein the cell further has reduced or eliminated surface expression of HLA-A, and wherein the cell further has reduced or eliminated expression of an endogenous TCR protein relative to an unmodified cell.
  • the engineered cell has reduced or eliminated expression of a TRAC protein relative to an unmodified cell.
  • the engineered cell has reduced or eliminated expression of a TRBC protein relative to an unmodified cell.
  • the engineered cell comprises a genetic modification in the HLA-A gene.
  • the engineered cell comprises a genetic modification that reduces expression of HLA-A protein on the surface of the engineered cell.
  • the exogenous nucleic acid encodes a targeting receptor that is expressed on the surface of the engineered cell.
  • the targeting receptor is a chimeric antigen receptor (CAR).
  • the targeting receptors is a universal CAR (UniCar).
  • the targeting receptor is a T cell receptor (TCR).
  • the targeting receptor is a WT1 TCR.
  • the targeting receptor is a hybrid CAR/TCR.
  • the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR).
  • the targeting receptor is a cytokine receptor.
  • the targeting receptor is a chemokine receptor.
  • the targeting receptor is a B cell receptor (BCR).
  • the exogenous nucleic acid encodes a polypeptide that is secreted by the engineered cell (i.e., a soluble polypeptide).
  • the exogenous nucleic acid encodes a therapeutic polypeptide.
  • the exogenous nucleic acid encodes an antibody.
  • the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.. [00130]
  • the engineered cell may be any of the exemplary cell types disclosed herein. In some embodiments, the engineered cell is an immune cell. In some embodiments, the engineered cell is a hematopoetic stem cell (HSC). In some embodiments, the engineered cell is an induced pluripotent stem cell (iPSC).
  • the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte. In some embodiments, the engineered cell is monocyte. In some embodiments, the engineered cell is a macrophage. In some embodiments, the engineered cell is a mast cell. In some embodiments, the engineered cell is a dendritic cell. [00131] In some embodiments, the engineered cell is a granulocyte. In some embodiments, the engineered cell is a lymphocyte. In some embodiments, the engineered cell is a T cell. In some embodiments, the engineered cell is a CD4+ T cell. In some embodiments, the engineered cell is a CD8+ T cell.
  • the engineered cell is a memory T cell. In some embodiments, the engineered cell is a B cell. In some embodiments, the engineered cell is a plasma B cell. In some embodiments, the engineered cell is a memory B cell. [00132] In some embodiments, the engineered cell is homozygous for HLA-B and homozygous for HLA-C.
  • the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02; HLA-B*08:01; HLA-B*44:02; HLA-B*35:01; HLA-B*40:01; HLA-B*57:01; HLA-B*14:02; HLA-B*15:01; HLA-B*13:02; HLA-B*44:03; HLA-B*38:01; HLA-B*18:01; HLA-B*44:03; HLA-B*51:01; HLA-B*49:01; HLA-B*15:01; HLA-B*18:01; HLA-B*27:05; HLA-B*35:03; HLA-B*18:01; HLA-B*52:01; HLA-B*51:01; HLA-B*37:01; HLA-B*53:01; HLA-B*55:01; HLA-B*40
  • the HLA-C allele is selected from any one of the following HLA-C alleles: HLA-C*07:02; HLA-C*07:01; HLA-C*05:01; HLA-C*04:01 HLA-C*03:04; HLA-C*06:02; HLA-C*08:02; HLA-C*03:03; HLA-C*06:02; HLA-C*16:01; HLA-C*12:03; HLA-C*07:01; HLA-C*04:01; HLA-C*15:02; HLA-C*07:01; HLA-C*03:04; HLA-C*12:03; HLA-C*02:02; HLA-C*04:01; HLA-C*05:01; HLA-C*12:02; HLA-C*14:02; HLA-C*06:02; HLA-C*04:01; HLA-C*03:03
  • the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02; HLA-B*08:01; HLA-B*44:02; HLA-B*35:01; HLA-B*40:01; HLA-B*57:01; HLA-B*14:02; HLA-B*15:01; HLA-B*13:02; HLA-B*44:03; HLA-B*38:01; HLA-B*18:01; HLA-B*44:03; HLA-B*51:01; HLA-B*49:01; HLA-B*15:01; HLA-B*18:01; HLA-B*27:05; HLA-B*35:03; HLA-B*18:01; HLA-B*52:01; HLA-B*51:01; HLA-B*37:01; HLA-B*53:01; HLA-B*55:
  • the engineered cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are selected from any one of the following HLA- B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02; HLA-B*08:01 and HLA-C*07:01; HLA-B*44:02 and HLA-C*05:01; HLA-B*35:01 and HLA-C*04:01; HLA-B*40:01 and HLA- C*03:04; HLA-B*57:01 and HLA-C*06:02; HLA-B*14:02 and HLA-C*08:02; HLA-B*15:01 and HLA-C*03:03; HLA-B*13:02 and HLA-C*06:02; HLA-B*44:03 and HLA-C*16:01; HLA- B*38:
  • the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01.
  • the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01.
  • the disclosure provides a pharmaceutical composition comprising any one of the engineered cells disclosed herein.
  • the pharmaceutical composition comprises a population of any one of the engineered cells disclosed herein.
  • the pharmaceutical composition comprises a population of engineered cells that is at least 65% negative as measured by flow cytometry.
  • the pharmaceutical composition comprises a population of engineered cells that is at least 70% negative as measured by flow cytometry.
  • the pharmaceutical composition comprises a population of engineered cells that is at least 80% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 90% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 91% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 92% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 93% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 94% negative as measured by flow cytometry.
  • the pharmaceutical composition comprises a population of engineered cells that is at least 95% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 97% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 98% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises a population of engineered cells that is at least 99% endogenous TCR protein negative as measured by flow cytometry. [00137] In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject in need thereof.
  • methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as an ACT therapy. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as a treatment for cancer. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as a treatment for an autoimmune disease. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as a treatment for an infectious disease. B.
  • the present disclosure provides methods and compositions for reducing or eliminating surface expression of MHC class II protein on a cell relative to an unmodified cell by genetically modifying the CIITA gene.
  • the resultant genetically modified cell may also be referred to herein as an engineered cell.
  • an already-genetically modified (or engineered) cell may be the starting cell for further genetic modification using the methods or compositions provided herein.
  • the cell is an allogeneic cell.
  • a cell with reduced MHC class II expression is useful for adoptive cell transfer therapies.
  • the methods comprise reducing or eliminating surface expression of MHC class II protein on the surface of a cell comprising contacting a cell with a composition comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA-guided DNA binding agent is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase domain.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • the expression of MHC class II protein on the surface of the cell is thereby reduced.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods comprise making an engineered cell, which has reduced or eliminated surface expression of MHC class II protein relative to an unmodified cell, comprising contact the cell with a composition comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242
  • the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA-guided DNA binding agent is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase region.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA- guided nickase.
  • the expression of MHC class II protein on the surface of the cell is thereby reduced.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods comprise genetically modifying a cell to reduce or eliminate the surface expression of MHC class II protein comprising contacting the cell with a composition comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA-guided DNA binding agent is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase region.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • the expression of MHC class II protein on the surface of the cell is thereby reduced.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods comprise inactivating a splice site in CIITA comprising contacting a cell with a composition comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA-guided DNA binding agent is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase region.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • the expression of MHC class II protein on the surface of the cell is thereby reduced.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods comprise inducing a DSB or an single stranded break (SSB) in CIITA comprising contacting a cell with a composition comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA- guided DNA binding agent is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase region.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • the expression of MHC class II protein on the surface of the cell is thereby reduced.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods comprise reducing expression of the CIITA protein in a cell comprising delivering a composition to a cell comprising contacting a cell with a composition comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods further comprise contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA-guided DNA binding agent is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase region.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • the expression of MHC class II protein on the surface of the cell is thereby reduced.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods of reducing expression of an MHC class II protein on the surface of a cell comprise contacting a cell with any one or more of the CIITA guide RNAs disclosed herein.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • compositions comprising a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the composition further comprises an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the composition comprises an RNA- guided DNA binding agent that is Cas9.
  • the RNA-guided DNA binding agent is S. pyogenes Cas9.
  • the CIITA guide RNA is a S. pyogenes Cas9 guide RNA.
  • the RNA-guided DNA binding agent comprises a deaminase region.
  • the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the composition further comprises a uracil glycosylase inhibitor (UGI).
  • the composition comprises an RNA-guided DNA binding agent that the RNA-guided DNA binding agent generates a cytosine (C) to thymine (T) conversion with the CIITA genomic target sequence.
  • the composition comprises an RNA- guided DNA binding agent that generates a adenosine (A) to guanine (G) conversion with the CIITA genomic target sequence.
  • an engineered cell produced by the methods described herein is provided.
  • the engineered cell produced by the methods and compositions described herein is an allogeneic cell.
  • the methods produce a composition comprising an engineered cell having reduced MHC class II expression.
  • the methods produce a composition comprising an engineered cell having reduced CIITA protein expression.
  • the methods produce a composition comprising an engineered cell having reduced CIITA levels in the cell nucleus.
  • the methods produce a composition comprising an engineered cell that expresses a truncated form of the CIITA protein.
  • the methods produce a composition comprising an engineered cell that produces no detectable CIITA protein.
  • the engineered cell has reduced MHC class II expression, reduced CIITA protein, and/or reduced CIITA levels in the cell nucleus as compared to an unmodified cell.
  • the engineered cell produced by the methods disclosed herein elicits a reduced response from CD4+ T cells as compared to an unmodified cell as measured in an in vitro cell culture assay containing CD4+ T cells.
  • an engineered cell produced by the methods or compositions disclosed herein is provided wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising a modification of at least one nucleotide of a splice acceptor site.
  • an engineered cell produced by the methods or compositions disclosed herein wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising a modification of at least one nucleotide of a splice donor site.
  • an engineered cell produced by the methods or compositions disclosed herein is provided wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising at least 5 contiguous nucleotides within the genomic coordinates chr16: 10902171-10923242.
  • an engineered cell produced by the methods or compositions disclosed herein wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising at least 10 contiguous nucleotides within the genomic coordinates chr16: 10902171-10923242.
  • an engineered cell produced by the methods or compositions disclosed herein is provided wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising at least one C to T substitution or at least one A to G substitution within the genomic coordinates chr16: 10902171-10923242.
  • an engineered cell produced by the methods or compositions disclosed herein wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising at least one nucleotide of a splice site within the genomic coordinates chr16:10903873-chr:10923242.
  • an engineered cell produced by the methods or compositions disclosed herein is provided wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising at least one nucleotide of a splice site within the genomic coordinates chr:16:10906485-chr:10923242.
  • an engineered cell produced by the methods or compositions disclosed herein wherein the cell has reduced or eliminated surface expression of MHC class II protein and wherein the cell comprises a genetic modification comprising at least one nucleotide of a splice site within the genomic coordinates chr16:10908130-chr:10923242.
  • the compositions disclosed herein further comprise a pharmaceutically acceptable carrier.
  • a cell produced by the compositions disclosed herein comprising a pharmaceutically acceptable carrier is provided.
  • compositions comprising the cells disclosed herein are provided. 1.
  • CIITA guide RNAs useful for reducing the expression of MHC class II protein on the surface of a cell.
  • such guide RNAs direct an RNA-guided DNA binding agent to a CIITA genomic target sequence and may be referred to herein as “CIITA guide RNAs.”
  • the CIITA guide RNA directs an RNA-guided DNA binding agent to a human CIITA genomic target sequence.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NO: 1-101.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least one nucleotide within the genomic coordinates chr16:10903873-chr:10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least one nucleotide within the genomic coordinates chr:16:10906485-chr:10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least one nucleotide within the genomic coordinates chr16:10908130- chr:10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice acceptor site.
  • the one nucleotide of the splice acceptor site is A. In some embodiments, the one nucleotide of the splice acceptor site is G. In some embodiments, the one nucleotide is the splice site boundary nucleotide of the splice acceptor site. In some embodiments, the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice donor site. In some embodiments, the one nucleotide of the splice donor site is G. In some embodiments, the one nucleotide of the splice donor site is U/T.
  • the one nucleotide is the splice site boundary nucleotide of the splice donor site.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make cut in a CIITA gene that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make cut in a CIITA gene that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least one nucleotide within the genomic coordinates chr16:10903873-chr:10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make cut in a CIITA gene that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least one nucleotide within the genomic coordinates chr:16:10906485-chr:10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make cut in a CIITA gene that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least one nucleotide within the genomic coordinates chr16:10908130-chr:10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make cut in a CIITA gene that is 5 nucleotides or less from an acceptor splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 5 nucleotides or less from a donor splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the methods and compositions disclose a CIITA guide RNA that directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide.
  • the cut or “cut site” occurs at the third base from the protospacer adjacent motif (PAM) sequence.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 5 nucleotides or less from an acceptor splice site boundary nucleotide, wherein the cut site is 3’ of the acceptor splice site boundary nucleotide.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene at that is 5 nucleotides or less from an acceptor splice site boundary nucleotide, wherein the cut is 5’ of the acceptor splice site boundary nucleotide.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 5 nucleotides or less from a donor splice site boundary nucleotide, wherein the cut is 3’ of the donor splice site boundary nucleotide.
  • the methods and compositions disclosed herein comprise a CIITA guide RNA comprising a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 5 nucleotides or less from a donor splice site boundary nucleotide, wherein the cut is 5’ of the donor splice site boundary nucleotide.
  • the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 4 nucleotides or less from an acceptor splice site boundary nucleotide.
  • the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 3 nucleotides or less from an acceptor splice site boundary nucleotide. In some embodiments, the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 2 nucleotides or less from an acceptor splice site boundary nucleotide.
  • the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 1 nucleotide or less from an acceptor splice site boundary nucleotide. In some embodiments, the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene at an acceptor splice site boundary nucleotide. [00162] In some embodiments, the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 4 nucleotides or less from a donor splice site boundary nucleotide.
  • the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 3 nucleotides or less from a donor splice site boundary nucleotide. In some embodiments, the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 2 nucleotides or less from a donor splice site boundary nucleotide.
  • the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene that is 1 nucleotide or less from a donor splice site boundary nucleotide. In some embodiments, the CIITA guide comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA gene at a donor splice site boundary nucleotide. [00163] In some embodiments, a composition is provided comprising a CIITA guide RNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA- guided DNA binding agent.
  • a composition comprising a CIITA single-guide RNA (sgRNA) comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • sgRNA CIITA single-guide RNA
  • a composition comprising a CIITA sgRNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • a composition comprising a CIITA dual-guide RNA (dgRNA) comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide targets a genomic target comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • a composition comprising a CIITA dgRNA described herein and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • CIITA guide sequences are shown below in Table 1 (SEQ ID NOs: 1-101 with corresponding guide RNA sequences SEQ ID NOs: 200-300 and 301-401). [00167] Table 1. Exemplary CIITA guide sequences.
  • the terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2’-O-Me.
  • the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-101. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-101.
  • the CIITA guide RNA comprises a guide sequence that is at least 95% identical to a sequence selected from SEQ ID NOs: 1-101. [00170] In some embodiments, the CIITA guide RNA comprises a guide sequence that comprises at least 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1. As used herein, at least 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate means, for example, at least 10 contiguous nucleotides within the genomic coordinates wherein the genomic coordinates include 10 nucleotides in the 5’ direction and 10 nucleotides in the 3’ direction from the ranges listed in Table 1.
  • a CIITA guide RNA may comprise 10 contiguous nucleotides within the genomic coordinates chr16:10877360-10877380 or within chr16:10877350-10877390, including the boundary nucleotides of these ranges.
  • the CIITA guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence that comprises 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1.
  • the CIITA guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from a sequence that is 17, 18, 19, or 20 contiguous nucleotides of a sequence that comprises 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1.
  • the CIITA guide RNA comprises a guide sequence that comprises at least 15 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1.
  • the CIITA guide RNA comprises a guide sequence that comprises at least 20 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1.
  • the CIITA guide RNA comprises SEQ ID NO: 1. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 2. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 3. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 4. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 5. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 6. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 7. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 8. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 9.
  • the CIITA guide RNA comprises SEQ ID NO: 10. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 11. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 12. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 13. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 14. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 15. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 16. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 17. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 18. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 19.
  • the CIITA guide RNA comprises SEQ ID NO: 20. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 21. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 22. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 23. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 24. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 25. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 26. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 27. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 28.
  • the CIITA guide RNA comprises SEQ ID NO: 29. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 30. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 31. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 32. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 33. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 34. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 35. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 36. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 37.
  • the CIITA guide RNA comprises SEQ ID NO: 38. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 39. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 40. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 41. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 42. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 43. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 44. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 45. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 46.
  • the CIITA guide RNA comprises SEQ ID NO: 47. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 48. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 49. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 50. In some embodiments, the CIITA guide RNA comprises SEQ ID NO:51. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 52. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 53. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 54. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 55.
  • the CIITA guide RNA comprises SEQ ID NO: 56. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 57. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 58. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 59. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 60. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 61. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 62. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 63. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 64.
  • the CIITA guide RNA comprises SEQ ID NO: 65. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 66. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 67. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 68. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 69. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 70. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 71. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 72. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 73.
  • the CIITA guide RNA comprises SEQ ID NO: 74. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 75. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 76. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 77. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 78. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 79. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 80. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 81. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 82.
  • the CIITA guide RNA comprises SEQ ID NO: 83. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 84. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 85. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 86. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 87. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 88. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 89. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 90. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 91.
  • the CIITA guide RNA comprises SEQ ID NO: 92. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 93. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 94. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 95. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 96. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 97. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 98. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 99. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 100.
  • the CIITA guide RNA comprises SEQ ID NO: 101.
  • the CIITA guide RNA comprises a nucleotide chosen from: SEQ ID NO: 47, SEQ ID NO: 55, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 100, and SEQ ID NO: 101.
  • Additional embodiments of CIITA guide RNAs are provided herein, including e.g., exemplary modifications to the guide RNA. 2.
  • the methods and compositions disclosed herein genetically modify at least one nucleotide of a splice site in the CIITA gene in a cell. Because CIITA protein regulates expression of MHC class II, in some embodiments, the genetic modification to CIITA alters the production of CIITA protein, and thereby reduces the expression of MHC class II protein on the surface of the genetically modified cell (or engineered cell). Genetic modifications encompass the population of modifications that results from contact with a gene editing system (e.g., the population of edits that result from Cas9 and a CIITA guide RNA, or the population of edits that result from BC22 and a CIITA guide RNA).
  • a gene editing system e.g., the population of edits that result from Cas9 and a CIITA guide RNA, or the population of edits that result from BC22 and a CIITA guide RNA.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10903873-chr:10923242. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr:16:10906485- chr:10923242. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908130-chr:10923242.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762 chr16:10916362-10916382 chr16:10916455-10916475 chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747-10895767, chr16:10916348-10916368, chr16:10910
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, and chr16:10922478-10922498.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908132-10908152. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908131- 10908151.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10916456-10916476. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742-10895762, chr16:10916449-10916469, chr16:10923214-
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, 10922173.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524. In some embodiments, the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates, chr16:10923218-10923238.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10923219-10923239. [00183] In some embodiments, the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates chr16: 10902171-10923242. In some embodiments, the genetic modification comprises at least 10 contiguous nucleotides within the genomic coordinates chr16: 10902171-10923242. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates chr16: 10902171-10923242.
  • the modification to CIITA comprises any one or more of an insertion, deletion, substitution or deamination of at least one nucleotide in a target sequence.
  • the modification to CIITA comprises an insertion of 1, 2, 3, 4 or 5 or more nucleotides in a target sequence.
  • the modification to CIITA comprises a deletion of 1, 2, 3, 4 or 5 or more nucleotides in a target sequence.
  • the modification to CIITA comprises an insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 or more nucleotides in a target sequence.
  • the modification to CIITA comprises a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 or more nucleotides in a target sequence.
  • the modification to CIITA comprises an indel, which is generally defined in the art as an insertion or deletion of less than 1000 base pairs (bp).
  • the modification to CIITA comprises an indel which results in a frameshift mutation in a target sequence.
  • the modification to CIITA comprises a substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 25 or more nucleotides in a target sequence.
  • the modification to CIITA comprises one or more of an insertion, deletion, or substitution of nucleotides resulting from the incorporation of a template nucleic acid. In some embodiments, the modification to CIITA comprises an insertion of a donor nucleic acid in a target sequence. In some embodiments, the modification to CIITA is not transient. [00185] In some embodiments, at least one nucleotide of a splice site is modified. In some embodiments, at least one nucleotide of a splice acceptor site is modified. In some embodiments, at least one nucleotide of a splice donor site is modified. In some embodiments, a acceptor splice site boundary nucleotide is modified.
  • a donor splice site boundary nucleotide is modified.
  • one of the conserved nucleotides of a splice acceptor site is modified.
  • the conserved nucleotide of a splice acceptor site, A is modified.
  • the conserved nucleotide of a splice acceptor site, G is modified.
  • one of the conserved nucleotides of a splice donor site is modified.
  • the conserved nucleotide of a splice donor site, G is modified.
  • the conserved nucleotide of a splice donor site, T is modified.
  • a nucleotide that is located 5 nucleotides or less from an acceptor splice site boundary nucleotide is modified. In some embodiments, a nucleotide that is located 4 nucleotides or less from an acceptor splice site boundary nucleotide is modified. In some embodiments, a nucleotide that is located 3 nucleotides or less from an acceptor splice site boundary nucleotide is modified. In some embodiments, a nucleotide that is located 2 nucleotides or less from an acceptor splice site boundary nucleotide is modified.
  • a nucleotide that is located 1 nucleotide or less from an acceptor splice site boundary nucleotide is modified.
  • a nucleotide that is located 5 nucleotides or less from a donor splice site boundary is modified.
  • a nucleotide that is located 4 nucleotides or less from a donor splice site boundary nucleotide is modified.
  • a nucleotide that is located 3 nucleotides or less from a donor splice site boundary nucleotide is modified.
  • a nucleotide that is located 2 nucleotides or less from a donor splice site boundary nucleotide is modified. In some embodiments, a nucleotide that is located 1 nucleotide or less from a donor splice site boundary nucleotide is modified.
  • the methods and compositions disclosed herein modify a splice site of CIITA in a cell using an RNA-guided DNA binding agent (e.g., a Cas enzyme). In some embodiments, the RNA-guided DNA binding agent is Cas9.
  • the RNA- guided DNA binding agent cuts CIITA 5 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the RNA-guided DNA binding agent cuts a CIITA 4 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the RNA-guided DNA binding agent cuts CIITA 3 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the RNA-guided DNA binding agent cuts CIITA 2 nucleotides or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the RNA-guided DNA binding agent cuts CIITA 1 nucleotide or less from a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242. In some embodiments, the RNA-guided DNA binding agent cuts CIITA at a splice site boundary nucleotide, wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • the splice site boundary nucleotide is an acceptor splice site boundary nucleotide. In some embodiments, the splice site boundary nucleotide is a donor splice site boundary nucleotide.
  • the genetic modification to CIITA inactivates the splice site, i.e., splicing does not occur at the modified splice site. In some embodiments, the genetic modification to CIITA inactivates a splice acceptor site. In some embodiments, the genetic modification to CIITA inactivates a splice donor site.
  • the genetic modification to the splice site of CIITA removes all three nucleotides of a splice site. In some embodiments, the genetic modification removes 2 nucleotides of a splice site. In some embodiments, the genetic modification removes 1 nucleotide of a splice site. In some embodiments, the genetic modification to the splice site of CIITA removes 1 or 2 nucleotides of the splice acceptor site. In some embodiments, the genetic modification to the splice site of CIITA removes 1 or 2 nucleotides of the splice donor site. In some embodiments, at least 1 nucleotide of a splice site is deleted.
  • the genetic modification to CIITA results in utilization of an out-of-frame stop codon. In some embodiments, the genetic modification to CIITA results in exon skipping during splicing. In some embodiments, the genetic modification to CIITA results in reduced CIITA protein expression by the cell. In some embodiments, the genetic modification to CIITA results in reduced CIITA in the cell nucleus.
  • the modification to the splice site of CIITA results in reduced MHC class II protein expression on the surface of the cell.
  • the genetic modification to CIITA results in a truncated form of the CIITA protein.
  • the truncated CIITA protein does not bind to GTP.
  • the truncated CIITA protein does not localize to the nucleus.
  • the CIITA protein (e.g., a truncated form of the CIITA protein) has impaired activity as compared to the wildtype CIITA protein’s activity relating to regulating MHC class II expression.
  • MHC class II expression on the surface of a cell is reduced as a result of impaired CIITA protein activity. In some embodiments, MHC class II expression on the surface of a cell is absent as a result of impaired CIITA protein activity. 3. Efficacy of CIITA guide RNAs [00193] The efficacy of a CIITA guide RNA may be determined by techniques available in the art that assess the editing efficiency of a guide RNA, the levels of CIITA protein and/or mRNA, and/or the levels of MHC class II in a target cell. In some embodiments, the reduction or elimination of HLA-A protein on the surface of a cell may be determined by comparison to an unmodified cell (or “relative to an unmodified cell”).
  • the efficacy of a CIITA guide RNA is determined by measuring levels of CIITA protein in a cell.
  • the levels of CIITA protein may be detected by, e.g., cell lysate and western blot with an anti-CIITA antibody.
  • the efficacy of a CIITA guide RNA is determined by measuring levels of CIITA protein in the cell nucleus.
  • the efficacy of a CIITA guide RNA is determined by measuring levels of CIITA mRNA in a cell. The levels of CIITA mRNA may be detected by e.g., RT-PCR.
  • a decrease in the levels CIITA protein and/or CIITA mRNA in the target cell as compared to an unmodified cell is indicative of an effective splice site CIITA guide RNA.
  • An “unmodified cell” refers to a control cell (or cells) of the same type of cell in an experiment or test, wherein the “unmodified” control cell has not been contacted with a CIITA guide (i.e., a non-engineered cell). Therefore, an unmodified cell (or cells) may be a cell that has not been contacted with a guide RNA, or a cell that has been contacted with a guide RNA that does not target CIITA.
  • the efficacy of a CIITA guide RNA is determined by measuring the reduction or elimination of MHC class II protein expression by the target cells.
  • the CIITA protein functions as a transactivator, activating the MHC class II promoter, and is essential for the expression of MHC class II protein.
  • MHC class II protein expression may be detected on the surface of the target cells.
  • MHC class II protein expression is measured by flow cytometry.
  • an antibody against MHC class II protein e.g., anti-HLA-DR, -DQ, -DP
  • a reduction or elimination in MHC class II protein on the surface of a cell (or population of cells) as compared to an unmodified cell (or population of unmodified cells) is indicative of an effective CIITA guide RNA.
  • a cell (or population of cells) that has been contacted with a particular CIITA guide RNA and RNA- guided DNA binding agent that is negative for MHC class II protein by flow cytometry is indicative of an effective CIITA guide RNA.
  • the MHC class II protein expression is reduced or eliminated in a population of cells using the methods and compositions disclosed herein.
  • the population of cells is enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is not enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 65% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 70% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 80% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 90% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 91% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 92% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 93% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 94% MHC class II negative as measured by flow cytometry relative to a population of unmodified cells.
  • the efficacy of a CIITA guide RNA i.e., the potency of the guide RNA is related to the distance between the cut site in the genomic target sequence (e.g., generated by Cas9) relative to a splice site boundary nucleotide in CIITA.
  • the distance between the splice site boundary nucleotide and the cut site is 5 nucleotides or less, 4 nucleotides or less, 3 nucleotides or less, 2 nucleotides or less, or 1 nucleotide or less.
  • the cut site is 5’ of the splice site boundary nucleotide. In some embodiments, the cut site is 3’ of the splice site boundary nucleotide. In some embodiments, the CIITA splice site boundary is an acceptor splice site boundary nucleotide. In some embodiments, the CIITA splice site boundary is a donor splice site boundary nucleotide.
  • an effective CIITA guide RNA may be determined by measuring the response of immune cells in vitro or in vivo (e.g., CD4+ T cells) to the genetically modified target cell.
  • a CD4+ T cell response may be evaluated by an assay that measures the activation response of CD4+ T cells e.g., CD4+ T cell proliferation, expression of activation markers, and/or cytokine production (IL-2, IL-12, IFN- ⁇ ) (e.g., flow cytometry, ELISA).
  • the response of CD4+ T cells may be evaluated in in vitro cell culture assays in which the genetically modified cell is co-cultured with cells comprising CD4+ T cells.
  • the genetically modified cell may be co-cultured e.g., with PBMCs, purified CD3+ T cells comprising CD4+ T cells, purified CD4+ T cells, or a CD4+ T cell line.
  • the CD4+ T cell response elicited from the genetically modified cell may be compared to the response elicited from an unmodified cell.
  • a reduced response from CD4+ T cells is indicative of an effective CIITA guide RNA.
  • the efficacy of a CIITA guide RNA may also be assessed by the survival of the cell post-editing. In some embodiments, the cell survives post editing for at least one week to six weeks. In some embodiments, the cell survives post editing for at least one week to twelve weeks. In some embodiments, the cell survives post editing for at least two weeks. In some embodiments, the cell survives post editing for at least three weeks. In some embodiments, the cell survives post editing for at least four weeks.
  • the cell survives post editing for at least five weeks. In some embodiments, the cell survives post editing for at least six weeks.
  • the viability of a genetically modified cell may be measured using standard techniques, including e.g., by measures of cell death, by flow cytometry live/dead staining, or cell proliferation.
  • MHC class I knock out [00202]
  • methods for reducing or eliminating expression of MHC class II protein on the surface of a cell by genetically modifying CIITA as disclosed herein are provided, wherein the methods further provide for reducing or eliminating expression of MHC class I protein on the surface of the cell relative to an unmodified cell.
  • MHC class I protein expression is reduced or eliminated by genetically modifying the B2M gene. In some embodiments, MHC class I protein expression is reduced or eliminated by contacting the cell with a B2M guide RNA. In another approach, expression of the MHC class I protein HLA-A reduced or eliminated by genetically modifying HLA-A thereby reducing or eliminating the surface expression of HLA-A in a human cell, wherein the human cell is homozygous for HLA-B and homozygous for HLA-C. Therefore, in some embodiments, HLA-A protein expression is reduced or eliminated by contacting a human cell with an HLA-A guide RNA, wherein the human cell is homozygous for HLA-B and homozygous for HLA-C.
  • the resulting cell is an allogeneic cell.
  • the methods comprise reducing expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a B2M guide RNA.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the method further comprises inducing a DSB or an SSB in the B2M target sequence.
  • B2M expression is thereby reduced by the cell.
  • MHC class I protein expression is thereby reduced by the cell.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a B2M guide RNA.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the method further comprises inducing a DSB or an SSB in the B2M target sequence.
  • B2M expression is thereby reduced by the cell.
  • MHC class I protein expression is thereby reduced by the cell.
  • the methods comprise inducing a DSB or an SSB in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a B2M guide RNA.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the method further comprises inducing a DSB or an SSB in the B2M target sequence.
  • B2M expression is thereby reduced by the cell.
  • MHC class I protein expression is thereby reduced by the cell.
  • the methods comprise reducing expression of the CIITA protein in a cell comprising delivering a composition to a cell comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a B2M guide RNA.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the method further comprises inducing a DSB or an SSB in the B2M target sequence.
  • B2M expression is thereby reduced by the cell.
  • MHC class I protein expression is thereby reduced by the cell.
  • the B2M guide RNA targets the human B2M gene.
  • the B2M guide RNA comprises SEQ ID NO: 701. In some embodiments, the B2M guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of SEQ ID NO: 701. In some embodiments, the B2M guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to SEQ ID NO: 701. [00209] Additional embodiments of B2M guide RNAs are provided herein, including e.g., exemplary modifications to the guide RNA. [00210] In some embodiments, the efficacy of a B2M guide RNA is determined by measuring levels of B2M protein in a cell relative to an unmodified cell.
  • the efficacy of a B2M guide RNA is determined by measuring levels of B2M protein expressed by the cell.
  • an antibody against B2M protein e.g., anti-B2M
  • the efficacy of a B2M guide RNA is determined by measuring levels of B2M mRNA in a cell e.g., by RT-PCR.
  • reduction or elimination in the levels of B2M protein or B2M mRNA is indicative of an effective B2M guide RNA as compared to the levels of B2M protein in an unmodified cell.
  • a cell (or population of cells) that is negative for B2M protein by flow cytometry as compared to an unmodified cell (or population of unmodified cells) is indicative of an effective B2M guide RNA.
  • a cell (or population of cells) that has been contacted with a particular B2M guide RNA and RNA-guided DNA binding agent that is negative for MHC class I protein by flow cytometry is indicative of an effective B2M guide RNA.
  • the efficacy of a B2M guide RNA is determined by measuring levels of MHC class I protein on the surface of a cell.
  • MHC class I protein levels are measured by flow cytometry (e.g., with an antibody against HLA-A, HLA-B, or HLA- C).
  • the population of cells is at least 65% MHC I negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 70% MHC I negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 80% MHC class I negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 90% MHC I negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 95% MHC I negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 100% MHC class I negative as measured by flow cytometry relative to a population of unmodified cells.
  • the methods comprise reducing or eliminating surface expression of MHC class II protein in an engineered cell relative to an unmodified cell comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising reducing or eliminating the HLA-A expression of the cell by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883- 29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:
  • the methods comprise reducing or eliminating surface expression of MHC class II protein in an engineered cell relative to an unmodified cell comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising reducing or eliminating the HLA-A expression of the cell by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864- 29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529- 29943549; chr6:29943530-29943550; chr6:29943537
  • the HLA-A genomic coordinates are chosen from chr6:29942864-29942884. In some embodiments, the HLA- A genomic coordinates are chosen from chr6:29942868-29942888. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29942876-29942896. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29942877-29942897. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29942883-29942903. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29943126-29943146.
  • the HLA-A genomic coordinates are chosen from chr6:29943528- 29943548. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29943529-29943549. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29943530-29943550. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29943537-29943557. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29943549-29943569. In some embodiments, the HLA-A genomic coordinates are chosen from chr6:29943589-29943609.
  • the HLA-A genomic coordinates are chosen from chr6:29944026-29944046.
  • the gene editing system comprises an RNA-guided DNA-binding agent.
  • the RNA- guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • the methods comprise reducing or eliminating surface expression of MHC class II protein in an engineered cell relative to an unmodified cell comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with an HLA-A guide RNA.
  • the HLA-A guide RNA comprises a guide sequence selected from SEQ ID NOs: 2001-2095 (with corresponding guide RNA sequences SEQ ID NOs: 1811-1905 and 1906-2000) (see Table 2 below).
  • the method further comprises contacting the cell with an RNA- guided DNA binding agent.
  • the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • methods are provided for making an engineered cell which has reduced or eliminated surface expression of MHC class II protein relative to an unmodified cell, comprising: a. contacting the cell with a CIITA guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-117; and b.
  • the method comprises contacting the cell with an RNA-guided DNA binding agent or nucleic acid encoding an RNA-guided DNA binding agent.
  • the RNA-guided DNA binding agent comprises an S. pyogenes Cas9.
  • the cell is homozygous for HLA-B and homozygous for HLA-C.
  • Exemplary HLA-A guide RNAs are provided in Table 2 (guide sequences SEQ ID NOs: 2001-2095 (with corresponding guide RNA sequences SEQ ID NOs: 1811-1905 and 1906- 2000). [00216] Table 2.
  • Exemplary HLA-A guide RNAs [00217] In some embodiments, the efficacy of an HLA-A guide RNA is determined by measuring levels of HLA-A protein on the surface of a cell.
  • HLA-A protein levels are measured by flow cytometry (e.g., with an antibody against HLA-A2 and/or HLA-A3).
  • the population of cells is at least 65% HLA-A negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 70% HLA-A negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 80% HLA-A negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 90% HLA-A negative as measured by flow cytometry relative to a population of unmodified cells.
  • the population of cells is at least 95% HLA-A negative as measured by flow cytometry relative to a population of unmodified cells. In some embodiments, the population of cells is at least 100% HLA-A negative as measured by flow cytometry relative to a population of unmodified cells.
  • the efficacy of a B2M guide RNA or an HLA-A guide may be determined by measuring the response of immune cells in vitro or in vivo (e.g., CD8+ T cells) to the genetically modified target cell as compared to an unmodified cell. For example, a reduced response from CD8+ T cells is indicative of an effective B2M guide RNA or an HLA-A.
  • a CD8+ T cell response may be evaluated by an assay that measures CD8+ T cell activation responses, e.g., CD8+ T cell proliferation, expression of activation markers, and/or cytokine production (IL-2, IFN- ⁇ , TNF- ⁇ ) (e.g., flow cytometry, ELISA).
  • the CD8+ T cell response may be assessed in vitro or in vivo.
  • the CD8+ T cell response may be evaluated by co-culturing the genetically modified cell with CD8+ T cells in vitro.
  • CD8+ T cell activity may be evaluated in an in vivo model, e.g., a rodent model.
  • genetically modified cells may be administered with CD8+ T cell; survival of the genetically modified cells is indicative of the ability to avoid CD8+ T cell lysis.
  • the methods produce a composition comprising a cell that survives in vivo in the presence of CD8+ T cells for greater than 1 2 3 4 5 or 6 weeks or more In some embodiments the methods produce a composition comprising a cell that survives in vivo in the presence of CD8+ T cells for at least one week to six weeks. In some embodiments, the methods produce a composition comprising a cell that survives in vivo in the presence of CD8+ T cells for at least two to four weeks.
  • the methods produce a composition comprising a cell that survives in vivo in the presence of CD8+ T cells for at least four to six weeks. In some embodiments, the methods produce a composition comprising a cell that survives in vivo in the presence of CD8+ T cells for more than six weeks. [00219] In some embodiments, the methods produce a composition comprising a cell having reduced or eliminated MHC class II expression and reduced or eliminated MHC class I expression relative to an unmodified cell. In some embodiments, the methods produce a composition comprising a cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and or eliminated reduced MHC class I protein expression.
  • the methods produce a composition comprising a cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and or eliminated reduced B2M protein expression. In some embodiments, the methods produce a composition comprising a cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and reduced or eliminated B2M mRNA levels. In some embodiments, the cell elicits a reduced or eliminated response from CD8+ T cells.
  • the methods produce a composition comprising a cell having reduced or eliminated MHC class II expression and reduced or eliminated HLA-A expression relative to an unmodified cell, wherein the cell is homozygous for HLA-B and homozygous for HLA-C.
  • the methods produce a composition comprising a cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and or eliminated reduced HLA-A protein expression.
  • the methods produce a composition comprising a cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and/or eliminated or reduced HLA-A protein expression.
  • the cell elicits a reduced or eliminated response from CD8+ T cells.
  • an engineered cell is provided wherein the cell has reduced or eliminated expression of MHC class II and MHC class I protein on the cell surface, wherein the cell comprises a genetic modification in CIITA, and wherein the cell comprises a modification in B2M.
  • the allogeneic cell elicits a reduced response from CD4+ T cells and elicits a reduced response from CD8+ T cells.
  • an engineered cell is provided wherein the cell has reduced or eliminated expression of MHC class II and HLA-A protein on the cell surface, wherein the cell comprises a genetic modification in CIITA, and wherein the cell comprises a genetic modification in the HLA-A gene, wherein the cell is homozygous for HLA-B and homozygous for HLA-C.
  • an engineered cell wherein the cell has reduced or eliminated expression of MHC class II and HLA-A protein on the cell surface, wherein the cell comprises a genetic modification in CIITA, and wherein the cell comprises a genetic modification in the HLA- A gene.
  • the cell is homozygous for HLA-B and HLAC.
  • the cell elicits a reduced response from CD4+ T cells and elicits a reduced response from CD8+ T cells. 2.
  • the present disclosure provides methods and compositions for reducing or eliminating expression of MHC class II protein on the surface of a cell by genetically modifying CIITA as disclosed herein, wherein the methods and compositions further provide for expression of an exogenous nucleic acid by the engineered cell.
  • a) NK cell inhibitor knock-in [00224]
  • the present disclosure provides methods for reducing or eliminating expression of MHC class II protein on the surface of a cell by genetically modifying CIITA as disclosed herein, wherein the methods further provide for expression of an exogenous nucleic acid by the cell, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule.
  • the NK cell inhibitor molecule is expressed on the surface of the cell, thereby avoiding the activity of NK cells (e.g., lysis of the cell by the NK cell).
  • the ability of the genetically modified cell to avoid NK cell lysis makes the cell amenable to adoptive cell transfer therapies.
  • the cell is an allogeneic cell.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule, and a B2M guide RNA, thereby reducing or eliminating expression of MHC class I protein on the surface of the cell.
  • the method further comprises contacting the cell with an RNA- guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell, comprising genetically modifying the cell with one or more compositions comprising a CIITA guide RNA disclosed herein, a B2M guide RNA, a nucleic acid encoding an NK cell inhibitor molecule, and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule, and a B2M guide RNA, thereby reducing expression of MHC class I protein on the surface of the cell.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the methods comprise inducing a DSB or an SSB in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule.
  • the methods comprise inducing a DSB or an SSB in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule, and a B2M guide RNA, thereby reducing expression of MHC class I protein on the surface of the cell.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of the CIITA protein in a cell comprising delivering a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule.
  • the methods comprise reducing expression of the CIITA protein in a cell comprising delivering a composition comprising a CIITA guide RNA disclosed herein, the method further comprising contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule, and a B2M guide RNA, thereby reducing expression of MHC class I protein on the surface of the cell.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the NK cell inhibitor molecule binds to an inhibitory receptor on an NK cell. In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor specific for MHC class I. In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor that is not specific for MHC class I.
  • NK cell inhibitory receptors include e.g., KIR (human), CD94-NKG2A heterodimer (human/mouse), Ly49 (mouse), 2B4, SLAMF6, NKFP-B, TIGIT, KIR2DL4.
  • the NK cell inhibitor molecule binds to NKG2A.
  • the NK cell inhibitor molecule is an MHC class I molecule.
  • the NK cell inhibitor molecule is a classical MHC class I molecule.
  • the NK cell inhibitor molecule is a non-classical MHC class I molecule.
  • the NK cell inhibitor molecule is an HLA molecule.
  • NK cell inhibitor molecules include e.g., HLA-C, HLA-E, HLA-G, Cd1, CD48, SLAMF6, Clr-b, and CD155.
  • the NK cell inhibitor molecule is HLA-E.
  • the NK cell inhibitor molecule is a fusion protein. In some embodiments, the NK cell inhibitor molecule is a fusion protein comprising HLA-E. In some embodiments, the NK cell inhibitor molecule comprising B2M. In some embodiments, the NK cell inhibitor molecule comprising HLA-E and B2M. In some embodiments, the fusion protein includes a linker. In some embodiments, the HLA-E construct is provided in a vector. In some embodiments, a vector comprising the HLA-E construct is a lentiviral vector. In some embodiments, the HLA-E construct is delivered to the cell via lentiviral transduction.
  • the NK cell inhibitor molecule is inserted into the genome of the target cell. In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell. In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell by homologous recombination (HR). In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell by blunt end insertion. In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the NK cell inhibitor molecule is integrated into a safe harbor locus in the genome of the cell.
  • HR homologous recombination
  • the NK cell inhibitor molecule is integrated into one of the TRAC locus, B2M locus, AAVS1 locus, and/or CIITA locus.
  • the NK cell inhibitor molecule is provided to the cell in a lipid nucleic acid assembly composition.
  • the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP).
  • the methods produce an engineered cell that elicits a reduced response from NK cells.
  • the NK cell response may be assessed in vitro or in vivo.
  • NK cell activity may be evaluated by co-culturing the genetically modified cell with NK cells in vitro.
  • NK cell activity may be evaluated in an in vivo model, e.g., a rodent model.
  • genetically modified cells may be administered with NK cells; survival of the genetically modified cells is indicative of the ability to avoid NK cell lysis.
  • the methods produce a composition comprising a cell that survives in vivo in the presence of NK cells for greater than 1, 2, 3, 4, 5, or 6 weeks or more. In some embodiments, the methods produce a composition comprising a cell that survives in vivo in the presence of NK cells for at least one week to six weeks.
  • the methods produce a composition comprising a cell that survives in vivo in the presence of NK cells for at least two to four weeks. In some embodiments, the methods produce a composition comprising a cell that survives in vivo in the presence of NK cells for at least four to six week. In some embodiments, the methods produce a composition comprising a cell that survives in vivo in the presence of NK cells for more than six weeks. [00237] In some embodiments, the methods produce a composition comprising an engineered cell having reduced or eliminated MHC class II expression and comprising a nucleic acid encoding an NK cell inhibitor molecule.
  • the methods produce a composition comprising an engineered cell having reduced or eliminated MHC class II expression and expression of an NK cell inhibitor molecule on the cell surface. In some embodiments, the methods produce a composition comprising a cell having reduced or eliminated MHC class II expression and eliciting a reduced response from NK cells. In some embodiments, the methods produce a composition comprising a cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and eliciting a reduced response from NK cells, and having reduced or eliminated MHC class I protein expression.
  • the cell elicits a reduced response from CD4+ T cells, CD8+ T cells, and/or NK cells.
  • an allogeneic cell is provided wherein the cell has reduced or eliminated expression of MHC class II and MHC class I protein on the cell surface, wherein the cell comprises a modification in CIITA as disclosed herein, wherein the cell comprises a modification in B2M, and wherein the cell comprises a nucleic acid encoding an NK cell inhibitor molecule.
  • the allogeneic cell elicits a reduced response from CD4+ T cells, CD8+ T cells, and/or NK cells.
  • the present disclosure provides methods for reducing or eliminating expression of MHC class II protein on the surface of a cell by genetically modifying CIITA as disclosed herein, wherein the methods further provide for expression of one or more exogenous nucleic acids (e.g., an antibody, chimeric antigen receptor (CAR), T cell receptor (TCR), cytokine or cytokine receptor, chemokine or chemokine receptor, enzyme, fusion protein, or other type of cell-surface bound or soluble polypeptide).
  • the exogenous nucleic acid encodes a protein that is expressed on the cell surface.
  • the exogenous nucleic acid encodes a targeting receptor expressed on the cell surface (described further herein).
  • the genetically modified cell may function as a “cell factory” for the expression of a secreted polypeptide encoded by an exogenous nucleic acid, including e.g., as a source for continuous production of a polypeptide in vivo (as described further herein).
  • the cell is an allogeneic cell.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, and a B2M guide RNA, thereby reducing or eliminating expression of MHC class I protein on the surface of the cell.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying a splice site of the CIITA gene comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, a cell- surface expressed (e.g. targeting receptor) or soluble (e.g. secreted) polypeptide, and a B2M guide RNA, thereby reducing or eliminating expression of MHC class I protein on the surface of the cell.
  • the methods comprise contacting the cell with more than one exogenous nucleic acid.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, and an HLA-A guide RNA, thereby reducing or eliminating expression of HLA-A protein on the surface of the cell.
  • the methods comprise reducing or eliminating expression of HLA-A protein on the surface of a cell comprising genetically modifying a splice site of the CIITA gene comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, a cell-surface expressed (e.g. targeting receptor) or soluble (e.g. secreted) polypeptide, and an HLA-A guide RNA, thereby reducing or eliminating expression of HLA-A protein on the surface of the cell.
  • the methods comprise contacting the cell with more than one exogenous nucleic acid.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell, comprising genetically modifying the cell with one or more compositions comprising a CIITA guide RNA as disclosed herein, a B2M guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of MHC class II protein and MHC class I protein on the surface of a cell, comprising genetically modifying the cell with one or more compositions comprising a CIITA guide RNA as disclosed herein, a B2M guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • a CIITA guide RNA as disclosed herein, a B2M guide RNA
  • an exogenous nucleic acid encoding an NK cell inhibitor molecule an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor)
  • an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent e.g., a targeting receptor
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA that as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, and a B2M guide, thereby reducing expression of MHC class I protein on the surface of the cell.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, a nucleic acid encoding an NK cell inhibitor, and a B2M guide RNA, thereby reducing expression of MHC class I protein on the surface of the cell.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA that as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, and a nucleic acid encoding an NK cell inhibitor.
  • the methods comprise contacting the cell with more than one exogenous nucleic acid. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent. [00245] In some embodiments, the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid.
  • the methods comprise inactivating a splice site in CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA that as disclosed herein, the method further comprising contacting the cell with an exogenous nucleic acid, and an HLA-A guide, thereby reducing expression of HLA-A protein on the surface of the cell.
  • the methods comprise contacting the cell with more than one exogenous nucleic acid.
  • the method further comprises contacting the cell with an RNA-guided DNA binding agent.
  • the exogenous nucleic acid encodes a polypeptide that is expressed on the surface of the cell.
  • the exogenous nucleic acid encodes a soluble polypeptide.
  • soluble polypeptide refers to a polypeptide that is secreted by the cell.
  • the soluble polypeptide is a therapeutic polypeptide.
  • the soluble polypeptide is an antibody.
  • the soluble polypeptide is an enzyme.
  • the soluble polypeptide is a cytokine.
  • the soluble polypeptide is a chemokine.
  • the soluble polypeptide is a fusion protein.
  • the exogenous nucleic acid encodes an antibody.
  • the exogenous nucleic acid encodes an antibody fragment (e.g., Fab, Fab2). In some embodiments, the exogenous nucleic acid encodes is a full-length antibody. In some embodiments, the exogenous nucleic acid encodes is a single-chain antibody (e.g., scFv). In some embodiments, the antibody is an IgG, IgM, IgD, IgA, or IgE. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG4 antibody. In some embodiments, the heavy chain constant region contains mutations known to reduce effector functions.
  • the heavy chain constant region contains mutations known to enhance effector functions.
  • the antibody is a bispecific antibody.
  • the antibody is a single-domain antibody (e.g., VH domain-only antibody).
  • the exogenous nucleic acid encodes a neutralizing antibody.
  • a neutralizing antibody neutralizes the activity of its target antigen.
  • the antibody is a neutralizing antibody against a virus antigen.
  • the antibody neutralizes a target viral antigen, blocking the ability of the virus to infect a cell.
  • a cell-based neutralization assay may be used to measure the neutralizing activity of an antibody.
  • the exogenous nucleic acid encodes an antibody that binds to an antigen associated with a disease or disorder (see e.g., diseases and disorders described in Section IV).
  • the exogenous nucleic acid encodes a polypeptide that is expressed on the surface of the cell (i.e., a cell-surface bound protein).
  • the exogenous nucleic acid encodes a targeting receptor.
  • a “targeting receptor” is a receptor present on the surface of a cell, e.g., a T cell, to permit binding of the cell to a target site, e.g., a specific cell or tissue in an organism.
  • the targeting receptor is a CAR.
  • the targeting receptor is a universal CAR (UniCAR).
  • the targeting receptor is a TCR.
  • the targeting receptor is a TRuC.
  • the targeting receptor is a B cell receptor (BCR) (e.g., expressed on a B cell).
  • BCR B cell receptor
  • the targeting receptor is chemokine receptor.
  • the targeting receptor is a cytokine receptor.
  • targeting receptors include a chimeric antigen receptor (CAR), a T-cell receptor (TCR), and a receptor for a cell surface molecule operably linked through at least a transmembrane domain in an internal signaling domain capable of activating a T cell upon binding of the extracellular receptor portion.
  • a CAR refers to an extracellular antigen recognition domain, e.g., an scFv, VHH, nanobody; operably linked to an intracellular signaling domain, which activates the T cell when an antigen is bound.
  • CARs are composed of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T-cell signaling domain.
  • Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, WO2018208837).
  • a universal CAR (UniCAR) for recognizing various antigens see, e.g., EP 2 990416 A1
  • a reversed universal CAR (RevCAR) that promotes binding of an immune cell to a target cell through an adaptor molecule see, e.g., WO2019238722
  • CARs can be targeted to any antigen to which an antibody can be developed and are typically directed to molecules displayed on the surface of a cell or tissue to be targeted.
  • the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR (e.g., a TRuC). (See Baeuerle et al. Nature Communications 2087 (2019).)
  • the exogenous nucleic acid encodes a TCR.
  • the exogenous nucleic acid encodes a genetically modified TCR.
  • the exogenous nucleic acid encodes is a genetically modified TCR with specificity for a polypeptide expressed by cancer cells.
  • the exogenous nucleic acid encodes a targeting receptor specific for Wilms’ tumor gene (WT1) antigen.
  • the exogenous nucleic acid encodes the WT1-specific TCR (see e.g., WO2020/081613A1).
  • an exogenous nucleic acid is inserted into the genome of the target cell.
  • the exogenous nucleic acid is integrated into the genome of the target cell.
  • the exogenous nucleic acid is integrated into the genome of the target cell by homologous recombination (HR).
  • the exogenous nucleic acid is integrated into the genome of the target cell by blunt end insertion.
  • the exogenous nucleic acid is integrated into the genome of the target cell by non-homologous end joining.
  • the exogenous nucleic acid is integrated into a safe harbor locus in the genome of the cell. In some embodiments, the exogenous nucleic acid is integrated into one of the TRAC locus, B2M locus, AAVS1 locus, and/or CIITA locus. In some embodiments, the exogenous nucleic acid is provided to the cell in a lipid nucleic acid assembly composition. In some embodiments, the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP). [00254] In some embodiments, the methods produce a composition comprising an engineered cell having reduced or eliminated MHC class II expression and comprising an exogenous nucleic acid.
  • LNP lipid nanoparticle
  • the methods produce a composition comprising an engineered cell having reduced or eliminated MHC class II expression and that secretes and/or expresses a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell.
  • the methods produce a composition comprising an engineered cell having reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and/or reduced or eliminated CIITA levels in the cell nucleus, and eliciting a reduced response from NK cells, and having reduced MHC class I protein expression, and secreting and/or expressing a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell.
  • the engineered cell elicits a reduced response from CD4+ T cells, and/or CD8+ T cells.
  • an engineered cell is provided wherein the cell has reduced or eliminated expression of MHC class II and MHC class I protein on the cell surface, wherein the cell comprises a modification in CIITA as disclosed herein, wherein the cell comprises a modification in B2M, wherein the cell comprises an exogenous nucleic acid encoding an NK cell inhibitor molecule, and wherein the cell further comprises an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • a polypeptide e.g., a targeting receptor
  • the engineered cell elicits a reduced response from CD4+ T cells, and/or CD8+ T cells.
  • an engineered cell is provided wherein the cell has reduced or eliminated expression of MHC class II and HLA-A protein on the cell surface, wherein the cell comprises a modification in CIITA as disclosed herein, wherein the cell comprises a modification in the HLA-A gene, wherein the cell further comprises an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • the engineered cell elicits a reduced response from CD4+ T cells, and/or CD8+ T cells.
  • the present disclosure provides methods for reducing or eliminating expression of MHC class II protein on the surface of a cell by genetically modifying CIITA as disclosed herein, wherein the methods further provide for reducing expression of one or more additional target genes (e.g., TRAC, TRBC).
  • additional target genes e.g., TRAC, TRBC.
  • the additional genetic modifications provide further advantages for use of the genetically modified cells for adoptive cell transfer applications.
  • the cell is an allogeneic cell.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene (e.g., a gene other than CIITA or B2M or HLA-A), thereby reducing or eliminating expression of the other gene.
  • an another gene e.g., a gene other than CIITA or B2M or HLA-A
  • the methods comprise reducing expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, and a B2M guide RNA, thereby reducing or eliminating expression of MHC class I protein on the surface of the cell.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the other gene, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • a polypeptide e.g., a targeting receptor
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing expression of the other gene, a B2M guide RNA, thereby reducing expression of MHC class I protein on the surface of the cell, and an exogenous nucleic acid encoding an NK cell inhibitor.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing expression of the other gene, and an HLA-A guide RNA, thereby reducing expression of HLA-A protein on the surface of the cell.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the other gene, a B2M guide RNA, thereby reducing or eliminating expression of MHC class I protein on the surface of the cell, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • a polypeptide e.g., a targeting receptor
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, an exogenous nucleic acid encoding an NK cell inhibitor molecule, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • a polypeptide e.g., a targeting receptor
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing expression of the other gene, and an HLA-A guide RNA, thereby reducing expression of HLA-A protein on the surface of the cell, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • a polypeptide e.g., a targeting receptor
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell comprising genetically modifying CIITA comprising contacting the cell with a composition comprising a CIITA guide RNA as disclosed herein, the method further comprising contacting the cell with a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the additional gene, a B2M guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of MHC class I protein on the surface of the cell, an exogenous nucleic acid encoding an NK cell inhibitor molecule, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).
  • a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the additional gene
  • B2M guide RNA that direct
  • the method further comprises contacting the cell with an RNA- guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell, comprising genetically modifying the cell with one or more compositions comprising a CIITA guide RNA as disclosed herein, a B2M guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding polypeptide (e.g., a targeting receptor), a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the other gene, and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the methods comprise reducing or eliminating expression of MHC class II protein on the surface of a cell, comprising genetically modifying the cell with one or more compositions comprising a CIITA guide RNA as disclosed herein, an HLA-A guide RNA, an exogenous nucleic acid encoding polypeptide (e.g., a targeting receptor), a guide RNA that directs an RNA-guided DNA binding agent to a target sequence located in an another gene, thereby reducing or eliminating expression of the other gene, and an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
  • the additional target gene is TRAC.
  • the additional target gene is TRBC.
  • D. Exemplary Cell Types methods and compositions disclosed herein genetically modify a cell.
  • the cell is an allogeneic cell.
  • the cell is a human cell.
  • the genetically modified cell is referred to as an engineered cell.
  • An engineered cell refers to a cell (or progeny of a cell) comprising an engineered genetic modification, e.g. that has been contacted with a gene editing system and genetically modified by the gene editing system.
  • engineered cell and “genetically modified cell” are used interchangeably throughout.
  • the engineered cell may be any of the exemplary cell types disclosed herein.
  • the cell is an immune cell.
  • immune cell refers to a cell of the immune system, including e.g., a lymphocyte (e.g., T cell, B cell, natural killer cell (“NK cell”, and NKT cell, or iNKT cell)), monocyte, macrophage, mast cell, dendritic cell, or granulocyte (e.g., neutrophil, eosinophil, and basophil).
  • the cell is a primary immune cell.
  • the immune system cell may be selected from CD3 + , CD4 + and CD8 + T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DC).
  • the immune cell is allogeneic.
  • the cell is a lymphocyte.
  • the cell is an adaptive immune cell.
  • the cell is a T cell.
  • the cell is a B cell.
  • the cell is a NK cell.
  • the lymphocyte is allogeneic.
  • a T cell can be defined as a cell that expresses a T cell receptor (“TCR” or “ ⁇ TCR” or “ ⁇ ⁇ TCR”), however in some embodiments, the TCR of a T cell may be genetically modified to reduce its expression (e.g., by genetic modification to the TRAC or TRBC genes), therefore expression of the protein CD3 may be used as a marker to identify a T cell by standard flow cytometry methods.
  • CD3 is a multi-subunit signaling complex that associates with the TCR. Thus, a T cell may be referred to as CD3+.
  • a T cell is a cell that expresses a CD3+ marker and either a CD4+ or CD8+ marker.
  • the T cell is allogeneic.
  • the T cell expresses the glycoprotein CD8 and therefore is CD8+ by standard flow cytometry methods and may be referred to as a “cytotoxic” T cell.
  • the T cell expresses the glycoprotein CD4 and therefore is CD4+ by standard flow cytometry methods and may be referred to as a “helper” T cell.
  • CD4+ T cells can differentiate into subsets and may be referred to as a Th1 cell, Th2 cell, Th9 cell, Th17 cell, Th22 cell, T regulatory (“Treg”) cell, or T follicular helper cells (“Tfh”).
  • a T cell may be isolated from a subject by CD4+ or CD8+ selection methods.
  • the T cell is a memory T cell.
  • a memory T cell In the body, a memory T cell has encountered antigen.
  • a memory T cell can be located in the secondary lymphoid organs (central memory T cells) or in recently infected tissue (effector memory T cells).
  • a memory T cell may be a CD8+ T cell.
  • a memory T cell may be a CD4+ T cell.
  • a “central memory T cell” can be defined as an antigen-experienced T cell, and for example, may expresses CD62L and CD45RO.
  • a central memory T cell may be detected as CD62L+ and CD45RO+ by Central memory T cells also express CCR7, therefore may be detected as CCR7+ by standard flow cytometry methods.
  • an “early stem-cell memory T cell” (or “Tscm”) can be defined as a T cell that expresses CD27 and CD45RA, and therefore is CD27+ and CD45RA+ by standard flow cytometry methods.
  • a Tscm does not express the CD45 isoform CD45RO, therefore a Tscm will further be CD45RO- if stained for this isoform by standard flow cytometry methods.
  • a CD45RO- CD27+ cell is therefore also an early stem-cell memory T cell.
  • Tscm cells further express CD62L and CCR7, therefore may be detected as CD62L+ and CCR7+ by standard flow cytometry methods.
  • Early stem-cell memory T cells have been shown to correlate with increased persistence and therapeutic efficacy of cell therapy products.
  • the cell is a B cell.
  • a “B cell” can be defined as a cell that expresses CD19 and/or CD20, and/or B cell mature antigen (“BCMA”), and therefore a B cell is CD19+, and/or CD20+, and/or BCMA+ by standard flow cytometry methods.
  • a B cell is further negative for CD3 and CD56 by standard flow cytometry methods.
  • the B cell may be a plasma cell.
  • the B cell may be a memory B cell.
  • the B cell may be a na ⁇ ve B cell.
  • the B cell may be IgM+, or has a class-switched B cell receptor (e.g., IgG+, or IgA+).
  • the B cell is allogeneic.
  • the cell is a mononuclear cell, such as from bone marrow or peripheral blood.
  • the cell is a peripheral blood mononuclear cell (“PBMC”).
  • PBMC peripheral blood mononuclear cell
  • the cell is a PBMC, e.g. a lymphocyte or monocyte.
  • the cell is a peripheral blood lymphocyte (“PBL”).
  • the mononuclear cell is allogeneic.
  • Cells used in ACT and/or tissue regenerative therapy are included, such as stem cells, progenitor cells, and primary cells.
  • Stem cells include pluripotent stem cells (PSCs); induced pluripotent stem cells (iPSCs); embryonic stem cells (ESCs); mesenchymal stem cells (MSCs, e.g., isolated from bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC) or adipose); hematopoietic stem cells (HSCs; e.g. isolated from BM or UC); neural stem cells (NSCs); tissue specific progenitor stem cells (TSPSCs); and limbal stem cells (LSCs).
  • PSCs pluripotent stem cells
  • iPSCs induced pluripotent stem cells
  • ESCs embryonic stem cells
  • MSCs mesenchymal stem cells
  • HSCs hematopoietic stem cells
  • NSCs neural stem cells
  • TPSCs tissue specific progenitor stem cells
  • LSCs limbal stem cells
  • Progenitor and primary cells include mononuclear cells (MNCs, e.g., isolated from BM or PB); endothelial progenitor cells (EPCs, e.g. isolated from BM, PB, and UC); neural progenitor cells (NPCs); and tissue-specific primary cells or cells derived therefrom (TSCs) including chondrocytes, myocytes, and keratinocytes.
  • MNCs mononuclear cells
  • EPCs e.g. isolated from BM, PB, and UC
  • neural progenitor cells NPCs
  • TSCs tissue-specific primary cells or cells derived therefrom
  • Cells for organ or tissue transplantations such as islet cells, cardiomyocytes, thyroid cells, thymocytes, neuronal cells, skin cells, and retinal cells are also included.
  • the cell is a human cell, such as a cell isolated from a human subject.
  • the cell is isolated from human donor PBMCs or leukopaks. In some embodiments, the cell is from a subject with a condition, disorder, or disease. In some embodiments, the cell is from a human donor with Epstein Barr Virus (“EBV”).
  • EBV Epstein Barr Virus
  • the methods are carried out ex vivo. As used herein, “ex vivo” refers to an in vitro method wherein the cell is capable of being transferred into a subject, e.g. as an ACT therapy. In some embodiments, an ex vivo method is an in vitro method involving an ACT therapy cell or cell population. [00281] In some embodiments, the cell is from a cell line.
  • the cell line is derived from a human subject.
  • the cell line is a lymphoblastoid cell line (“LCL”).
  • the cell may be cryopreserved and thawed. The cell may not have been previously cryopreserved.
  • the cell is from a cell bank.
  • the cell is genetically modified and then transferred into a cell bank.
  • the cell is removed from a subject, genetically modified ex vivo, and transferred into a cell bank.
  • a genetically modified population of cells is transferred into a cell bank.
  • a genetically modified population of immune cells is transferred into a cell bank.
  • a genetically modified population of immune cells comprising a first and second subpopulations, wherein the first and second sub-populations have at least one common genetic modification and at least one different genetic modification are transferred into a cell bank.
  • the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02; HLA-B*08:01; HLA- B*44:02; HLA-B*35:01; HLA-B*40:01; HLA-B*57:01; HLA-B*14:02; HLA-B*15:01; HLA- B*13:02; HLA-B*44:03; HLA-B*38:01; HLA-B*18:01; HLA-B*44:03; HLA-B*51:01; HLA- B*49:01; HLA-B*15:01; HLA-B*; HLA-B*
  • the HLA-C allele is selected from any one of the following HLA-C alleles: HLA-C*07:02; HLA-C*07:01; HLA- C*05:01; HLA-C*04:01 HLA-C*03:04; HLA-C*06:02; HLA-C*08:02; HLA-C*03:03; HLA- C*06:02; HLA-C*16:01; HLA-C*12:03; HLA-C*07:01; HLA-C*04:01; HLA-C*15:02; HLA- C*07:01; HLA-C*03:04; HLA-C*12:03; HLA-C*02:02; HLA-C*04:01; HLA-C*05:01; HLA- C*12:02; HLA-C*14:02; HLA-C*06:02; HLA-C*07:02; HLA-C*05:01; HLA- C*12:
  • the cell is homozygous for HLA-B and homozygous for HLA- C and the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02; HLA-B*08:01; HLA-B*44:02; HLA-B*35:01; HLA-B*40:01; HLA-B*57:01; HLA-B*14:02; HLA-B*15:01; HLA-B*13:02; HLA-B*44:03; HLA-B*38:01; HLA-B*18:01; HLA-B*44:03; HLA-B*51:01; HLA-B*49:01; HLA-B*15:01; HLA-B*18:01; HLA-B*27:05; HLA-B*35:03; HLA-B*18:01; HLA-B*52:01; HLA-B*51:01; HLA-B alleles: HLA
  • the cell is homozygous for HLA-B and homozygous for HLA- C and the HLA-B and HLA-C alleles are selected from any one of the following HLA-B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02; HLA-B*08:01 and HLA-C*07:01; HLA- B*44:02 and HLA-C*05:01; HLA-B*35:01 and HLA-C*04:01; HLA-B*40:01 and HLA- C*03:04; HLA-B*57:01 and HLA-C*06:02; HLA-B*14:02 and HLA-C*08:02; HLA-B*15:01 and HLA-C*03:03; HLA-B*13:02 and HLA-C*06:02; HLA-B*44:03 and HLA-C*16:01; HLA- B*38:01
  • the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01.
  • the cell is homozygous for HLA-B and homozygous for HLA-C and the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01. III.
  • Various suitable gene editing systems may be used to make the engineered cells disclosed herein, including but not limited to the CRISPR/Cas system; zinc finger nuclease (ZFN) system; and the transcription activator-like effector nuclease (TALEN) system.
  • the gene editing systems involve the use of engineered cleavage systems to induce a double strand break (DSB) or a nick (e.g., a single strand break, or SSB) in a target DNA sequence.
  • Cleavage or nicking can occur through the use of specific nucleases such as engineered ZFN, TALENs, or using the CRISPR/Cas system with an engineered guide RNA to guide specific cleavage or nicking of a target DNA sequence.
  • targeted nucleases are being developed based on the Argonaute system (e.g., from T.
  • thermophilus known as ‘TtAgo’, see Swarts et al (2014) Nature 507(7491): 258-261), which also may have the potential for uses in gene editing and gene therapy.
  • the gene editing system is a TALEN system.
  • Transcription activator-like effector nucleases are restriction enzymes that can be engineered to cut specific sequences of DNA. They are made by fusing a TAL effector DNA-binding domain to a DNA cleavage domain (a nuclease which cuts DNA strands).
  • Transcription activator-like effectors can be engineered to bind to a desired DNA sequence, to promote DNA cleavage at specific locations (see, e.g., Boch, 2011, Nature Biotech).
  • the restriction enzymes can be introduced into cells, for use in gene editing in situ, a technique known as gene editing with engineered nucleases.
  • Such methods and compositions for use therein are known in the art. See, e.g., WO2019147805, WO2014040370, WO2018073393, the contents of which are hereby incorporated in their entireties.
  • the gene editing system is a zinc-finger system.
  • Zinc-finger nucleases are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain.
  • Zinc finger domains can be engineered to target specific desired DNA sequences to enables zinc-finger nucleases to target unique sequences within complex genomes.
  • the non-specific cleavage domain from the type IIs restriction endonuclease FokI is typically used as the cleavage domain in ZFNs. Cleavage is repaired by endogenous DNA repair machinery, allowing ZFN to precisely alter the genomes of higher organisms.
  • Such methods and compositions for use therein are known in the art.
  • the gene editing system is a CRISPR/Cas system, including e.g., a CRISPR guide RNA comprising a guide sequence and RNA-guided DNA binding agent, and described further herein.
  • CRISPR Guide RNA Provided herein are guide sequences useful for modifying a target sequence, e.g., using a guide RNA comprising a disclosed guide sequence with an RNA-guided DNA binding agent (e.g., a CRISPR/Cas system).
  • Each of the guide sequences disclosed herein may further comprise additional nucleotides to form a crRNA, e.g., with the following exemplary nucleotide sequence following the guide sequence at its 3’ end: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 170) in 5’ to 3’ orientation.
  • the above guide sequences may further comprise additional nucleotides (scaffold sequence) to form a sgRNA, e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 171) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172, which is SEQ ID NO: 171 without the four terminal U’s) in 5’ to 3’ orientation.
  • additional nucleotides e.g., with the following exemplary nucleotide sequence following the 3’ end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACC
  • the four terminal U’s of SEQ ID NO: 171 are not present. In some embodiments, only 1, 2, or 3 of the four terminal U’s of SEQ ID NO: 171 are present.
  • the sgRNA comprises any one of the guide sequences of SEQ ID Nos: 1-101 and additional nucleotides to form a crRNA, e.g., with the following exemplary scaffold nucleotide sequence following the guide sequence at its 3’ end: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGG CACCGAGUCGGUGC (SEQ ID NO: 173) in 5’ to 3’ orientation.
  • SEQ ID NO: 173 lacks 8 nucleotides with reference to a wild-type guide RNA conserved sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172).
  • Other exemplary scaffold nucleotide sequences are provided in Table 23.
  • the sgRNA comprises any one of the guide sequences of SEQ ID Nos: 1-101 and additional guide scaffold sequences, in 5’ to 3’ orientation, in Table 23 including modified versions of the scaffold sequences, as shown.
  • the guide RNA may further comprise a trRNA.
  • the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA).
  • the crRNA and trRNA components may be covalently linked, e.g., via a phosphodiester bond or other covalent bond.
  • a crRNA and/or trRNA sequence may be referred to as a “scaffold” or “conserved portion” of a guide RNA.
  • the guide RNA may comprise two RNA molecules as a “dual guide RNA” or “dgRNA.”
  • the dgRNA comprises a first RNA molecule comprising a crRNA comprising, e.g., a guide sequence shown in Table 1, and a second RNA molecule comprising a trRNA.
  • the first and second RNA molecules may not be covalently linked, but may form an RNA duplex via the base pairing between portions of the crRNA and the trRNA.
  • the guide RNA may comprise a single RNA molecule as a “single guide RNA” or “sgRNA”.
  • the sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1, covalently linked to a trRNA.
  • the sgRNA may comprise 17, 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1.
  • the crRNA and the trRNA are covalently linked via a linker.
  • the sgRNA forms a stem-loop structure via the base pairing between portions of the crRNA and the trRNA.
  • the crRNA and the trRNA are covalently linked via one or more bonds that are not a phosphodiester bond.
  • the trRNA may comprise all or a portion of a trRNA sequence derived from a naturally-occurring CRISPR/Cas system.
  • the trRNA comprises a truncated or modified wild type trRNA.
  • the length of the trRNA depends on the CRISPR/Cas system used.
  • the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides.
  • the trRNA may comprise certain secondary structures, such as, for example, one or more hairpin or stem-loop structures, or one or more bulge structures.
  • a composition comprising one or more guide RNAs comprising a guide sequence of any one in Table 1 is provided.
  • a composition comprising one or more guide RNAs comprising a guide sequence of any one in Table 1 is provided, wherein the nucleotides of SEQ ID NO: 170, 171, 172, or 173 follow the guide sequence at its 3’ end.
  • the one or more guide RNAs comprising a guide sequence of any one in Table 1, wherein the nucleotides of SEQ ID NO: 170, 171, 172, or 173 follow the guide sequence at its 3’ end, is modified according to the modification pattern of SEQ ID NO: 300.
  • a composition comprising one or more guide RNAs comprising a guide sequence of any one in Table 1 is provided.
  • a composition comprising one or more gRNAs is provided, comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-101.
  • a composition comprising at least one, e.g., at least two gRNA’s comprising guide sequences selected from any two or more of the guide sequences shown in Table 1.
  • the composition comprises at least two gRNA’s that each comprise a guide sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the guide sequences shown in Table 1.
  • the guide RNA compositions of the present invention are designed to recognize (e.g., hybridize to) a target sequence in CIITA.
  • the CIITA target sequence may be recognized and cleaved by a provided Cas cleavase comprising a guide RNA.
  • an RNA-guided DNA binding agent such as a Cas cleavase
  • the selection of the one or more guide RNAs is determined based on target sequences within CIITA.
  • compositions comprising one or more guide sequences comprise a guide sequence that is complementary to the corresponding genomic region shown in Table 1, according to coordinates from human reference genome hg38.
  • Guide sequences of further embodiments may be complementary to sequences in the close vicinity of the genomic coordinate listed in any of the Table 1 within CIITA.
  • guide sequences of further embodiments may be complementary to sequences that comprise 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1.
  • modifications e.g., frameshift mutations resulting from indels occurring as a result of a nuclease-mediated DSB
  • modifications may be less tolerable than mutations in other regions, thus the location of a DSB is an important factor in the amount or type of protein knockdown that may result.
  • a gRNA complementary or having complementarity to a target sequence within the target gene used to direct an RNA-guided DNA binding agent to a particular location in the target gene.
  • the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the target gene. In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, or 80% identical to a target sequence present in the human CIITA gene. [00306] In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA.
  • the degree of complementarity or identity between a guide sequence of a guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the target sequence and the guide sequence of the gRNA may be 100% complementary or identical.
  • the target sequence and the guide sequence of the gRNA may contain at least one mismatch.
  • the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is 20.
  • the target sequence and the guide sequence of the gRNA may contain 1-4 mismatches where the guide sequence is 20 nucleotides.
  • a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas nuclease as described herein.
  • an mRNA comprising an ORF encoding an RNA-guided DNA binding agent, such as a Cas nuclease is provided, used, or administered.
  • the gRNA e.g., sgRNA, short-sgRNA, dgRNA, or crRNA is modified.
  • modified or “modification” in the context of a gRNA described herein includes, the modifications described above, including, for example, (a) end modifications, e.g., 5′ end modifications or 3′ end modifications, including 5’ or 3’ protective end modifications, (b) nucleobase (or “base”) modifications, including replacement or removal of bases, (c) sugar modifications, including modifications at the 2′, 3′, and/or 4′ positions, (d) internucleoside linkage modifications, and (e) backbone modifications, which can include modification or replacement of the phosphodiester linkages and/or the ribose sugar.
  • end modifications e.g., 5′ end modifications or 3′ end modifications, including 5’ or 3’ protective end modifications
  • nucleobase (or “base”) modifications including replacement or removal of bases
  • sugar modifications including modifications at the 2′, 3′, and/or 4′ positions
  • internucleoside linkage modifications and
  • backbone modifications which can include modification or replacement of the phosphodiester linkages and/or the rib
  • a modification of a nucleotide at a given position includes a modification or replacement of the phosphodiester linkage immediately 3’ of the sugar of the nucleotide.
  • a nucleic acid comprising a phosphorothioate between the first and second sugars from the 5’ end is considered to comprise a modification at position 1.
  • modified gRNA generally refers to a gRNA having a modification to the chemical structure of one or more of the base, the sugar, and the phosphodiester linkage or backbone portions, including nucleotide phosphates, all as detailed and exemplified herein.
  • a gRNA comprises modifications at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more YA sites.
  • the pyrimidine of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3’ of the sugar of the pyrimidine).
  • the adenine of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3’ of the sugar of the adenine).
  • the pyrimidine and the adenine of the YA site comprise modifications, such as sugar, base, or internucleoside linkage modifications.
  • the YA modifications can be any of the types of modifications set forth herein.
  • the YA modifications comprise one or more of phosphorothioate, 2’-OMe, or 2’-fluoro.
  • the YA modifications comprise pyrimidine modifications comprising one or more of phosphorothioate, 2’-OMe, 2’-H, inosine, or 2’-fluoro.
  • the YA modification comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) within an RNA duplex region that contains one or more YA sites.
  • the YA modification comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) within an RNA duplex region that contains a YA site, wherein the YA modification is distal to the YA site.
  • the guide sequence (or guide region) of a gRNA comprises 1, 2, 3, 4, 5, or more YA sites (“guide region YA sites”) that may comprise YA modifications.
  • one or more YA sites located at 5-end, 6-end, 7-end, 8-end, 9-end, or 10-end from the 5’ end of the 5’ terminus comprise YA modifications.
  • a modified guide region YA site comprises a YA modification.
  • a modified guide region YA site is within 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides of the 3’ terminal nucleotide of the guide region.
  • a modified guide region YA site is within 10 nucleotides of the 3’ terminal nucleotide of the guide region and the guide region is 20 nucleotides long, then the modified nucleotide of the modified guide region YA site is located at any of positions 11-20.
  • a modified guide region YA site is at or after nucleotide 4, 5, 6, 7, 8, 9, 10, or 11 from the 5’ end of the 5’ terminus.
  • a modified guide region YA site is other than a 5’ end modification.
  • a sgRNA can comprise a 5’ end modification as described herein and further comprise a modified guide region YA site.
  • a sgRNA can comprise an unmodified 5’ end and a modified guide region YA site.
  • a short-sgRNA can comprise a modified 5’ end and an unmodified guide region YA site.
  • a modified guide region YA site comprises a modification that at least one nucleotide located 5’ of the guide region YA site does not comprise.
  • nucleotides 1-3 comprise phosphorothioates
  • nucleotide 4 comprises only a 2’-OMe modification
  • nucleotide 5 is the pyrimidine of a YA site and comprises a phosphorothioate
  • the modified guide region YA site comprises a modification (phosphorothioate) that at least one nucleotide located 5’ of the guide region YA site (nucleotide 4) does not comprise.
  • nucleotides 1-3 comprise phosphorothioates
  • nucleotide 4 is the pyrimidine of a YA site and comprises a 2’-OMe
  • the modified guide region YA site comprises a modification (2’-OMe) that at least one nucleotide located 5’ of the guide region YA site (any of nucleotides 1- 3) does not comprise. This condition is also always satisfied if an unmodified nucleotide is located 5’ of the modified guide region YA site.
  • the modified guide region YA sites comprise modifications as described for YA sites above.
  • the guide region of a gRNA may be modified according to any embodiment comprising a modified guide region set forth herein.
  • the 5’ and/or 3’ terminus regions of a gRNA are modified.
  • the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3’ terminus region are modified. Throughout, this modification may be referred to as a “3’ end modification”.
  • the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3’ terminus region comprise more than one modification.
  • the 3’ end modification comprises or further comprises any one or more of the following: a modified nucleotide selected from 2’-O-methyl (2’-O-Me) modified nucleotide, 2’-O-(2-methoxyethyl) (2’- O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or combinations thereof.
  • the 3’ end modification comprises or further comprises modifications of 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 3’ end of the gRNA.
  • the 3’ end modification comprises or further comprises one PS linkage, wherein the linkage is between the last and second to last nucleotide. In some embodiments, the 3’ end modification comprises or further comprises two PS linkages between the last three nucleotides. In some embodiments, the 3’ end modification comprises or further comprises four PS linkages between the last four nucleotides. In some embodiments, the 3’ end modification comprises or further comprises PS linkages between any one or more of the last 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, the gRNA comprising a 3’ end modification comprises or further comprises a 3’ tail, wherein the 3’ tail comprises a modification of any one or more of the nucleotides present in the 3’ tail.
  • the 3’ tail is fully modified.
  • the 3’ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 nucleotides, optionally where any one or more of these nucleotides are modified.
  • a gRNA is provided comprising a 3’ protective end modification.
  • the 3’ tail comprises between 1 and about 20 nucleotides, between 1 and about 15 nucleotides, between 1 and about 10 nucleotides, between 1 and about 5 nucleotides, between 1 and about 4 nucleotides, between 1 and about 3 nucleotides, and between 1 and about 2 nucleotides.
  • the gRNA does not comprise a 3’ tail.
  • the 5’ terminus region is modified, for example, the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the gRNA are modified. Throughout, this modification may be referred to as a “5’ end modification”.
  • the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the 5’ terminus region comprise more than one modification.
  • at least one of the terminal (i.e., first) 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end are modified.
  • both the 5’ and 3’ terminus regions (e.g., ends) of the gRNA are modified.
  • only the 5’ terminus region of the gRNA is modified.
  • only the 3’ terminus region (plus or minus a 3’ tail) of the conserved portion of a gRNA is modified.
  • the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the first 7 nucleotides at a 5’ terminus region of the gRNA. In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the 7 terminal nucleotides at a 3’ terminus region. In some embodiments, 2, 3, or 4 of the first 4 nucleotides at the 5' terminus region, and/or 2, 3, or 4 of the terminal 4 nucleotides at the 3' terminus region are modified. In some embodiments, 2, 3, or 4 of the first 4 nucleotides at the 5' terminus region are linked with phosphorothioate (PS) bonds.
  • PS phosphorothioate
  • the modification to the 5’ terminus and/or 3’ terminus comprises a 2’-O-methyl (2’-O-Me) or 2’-O-(2-methoxyethyl) (2’-O-moe) modification.
  • the modification comprises a 2’-fluoro (2’-F) modification to a nucleotide.
  • the modification comprises a phosphorothioate (PS) linkage between nucleotides.
  • the modification comprises an inverted abasic nucleotide.
  • the modification comprises a protective end modification.
  • the modification comprises a more than one modification selected from protective end modification, 2’-O-Me, 2’-O-moe, 2’-fluoro (2’-F), a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic nucleotide.
  • an equivalent modification is encompassed.
  • a gRNA is provided comprising a 5’ end modification and a 3’ end modification.
  • the gRNA comprises modified nucleotides that are not at the 5’ or 3’ ends.
  • a sgRNA comprising an upper stem modification, wherein the upper stem modification comprises a modification to any one or more of US1-US12 in the upper stem region.
  • a sgRNA is provided comprising an upper stem modification, wherein the upper stem modification comprises a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the upper stem region.
  • an sgRNA is provided comprising an upper stem modification, wherein the upper stem modification comprises 1, 2, 3, 4, or 5 YA modifications in a YA site.
  • the upper stem modification comprises a 2’-OMe modified nucleotide, a 2’-O-moe modified nucleotide, a 2’-F modified nucleotide, and/or combinations thereof.
  • Other modifications described herein, such as a 5’ end modification and/or a 3’ end modification may be combined with an upper stem modification.
  • the sgRNA comprises a modification in the hairpin region.
  • the hairpin region modification comprises at least one modified nucleotide selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, and/or combinations thereof.
  • the hairpin region modification is in the hairpin 1 region. In some embodiments, the hairpin region modification is in the hairpin 2 region. In some embodiments, the hairpin modification comprises 1, 2, or 3 YA modifications in a YA site. In some embodiments, the hairpin modification comprises at least 1, 2, 3, 4, 5, or 6 YA modifications. Other modifications described herein, such as an upper stem modification, a 5’ end modification, and/or a 3’ end modification may be combined with a modification in the hairpin region.
  • a gRNA comprises a substituted and optionally shortened hairpin 1 region, wherein at least one of the following pairs of nucleotides are substituted in the substituted and optionally shortened hairpin 1 with Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and/or H1-4 and H1-9.
  • Watson-Crick pairing nucleotides include any pair capable of forming a Watson-Crick base pair, including A-T, A-U, T-A, U-A, C-G, and G-C pairs, and pairs including modified versions of any of the foregoing nucleotides that have the same base pairing preference.
  • the hairpin 1 region lacks any one or two of H1-5 through H1-8. In some embodiments, the hairpin 1 region lacks one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10 and/or H1-4 and H1-9. In some embodiments, the hairpin 1 region lacks 1-8 nucleotides of the hairpin 1 region.
  • the lacking nucleotides may be such that the one or more nucleotide pairs substituted with Watson-Crick pairing nucleotides (H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and/or H1-4 and H1-9) form a base pair in the gRNA.
  • the gRNA further comprises an upper stem region lacking at least 1 nucleotide, e.g., any of the shortened upper stem regions indicated in Table 7 of U.S. Application No.
  • the gRNA described herein further comprises a nexus region, wherein the nexus region lacks at least one nucleotide.
  • an sgRNA provided herein is a short-single guide RNAs (short- sgRNAs), e.g., comprising a conserved portion of an sgRNA comprising a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides or 6-10 nucleotides.
  • a short-sgRNA lacks at least nucleotides 54-58 (AAAAA) of the conserved portion of a spyCas9 sgRNA.
  • a short-sgRNA is a non- spyCas9 sgRNA that lacks nucleotides corresponding to nucleotides 54-58 (AAAAA) of the conserved portion of a spyCas9 as determined, for example, by pairwise or structural alignment.
  • the short-sgRNA described herein comprises a conserved portion comprising a hairpin region, wherein the hairpin region lacks 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides.
  • the lacking nucleotides are 5-10 lacking nucleotides or 6-10 lacking nucleotides. In some embodiments, the lacking nucleotides are consecutive. In some embodiments, the lacking nucleotides span at least a portion of hairpin 1 and a portion of hairpin 2.
  • the 5-10 lacking nucleotides comprise or consist of nucleotides 54-58, 54-61, or 53-60 of SEQ ID NO: 171.
  • the short-sgRNA described herein further comprises a nexus region, wherein the nexus region lacks at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in the nexus region). In some embodiments, the short-sgRNA lacks each nucleotide in the nexus region.
  • the SpyCas9 short-sgRNA described herein comprises a sequence of NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGCU (SEQ ID NO: 976).
  • the short-sgRNA described herein comprises a modification pattern as shown in SEQ ID NO: 977: mN*mN*mN*NNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmUm GmC*mU (SEQ ID NO: 977), where A, C, G, U, and N are adenine, cytosine, guanine, uracil, and any ribonucleotide, respectively, unless otherwise indicated.
  • the Exemplary SpyCas9 sgRNA-1 further includes one or more of: A. a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein 1.
  • the hairpin 1 region optionally lacks a. any one or two of H1-5 through H1-8, b. one, two, or three of the following pairs of nucleotides: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9, or c. 1-8 nucleotides of hairpin 1 region; or 2.
  • the shortened hairpin 1 region lacks 6-8 nucleotides, preferably 6 nucleotides; and a.
  • one or more of positions H1-1, H1-2, or H1-3 is deleted or substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 172) or b.
  • one or more of positions H1-6 through H1-10 is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 172); or 3.
  • the shortened hairpin 1 region lacks 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n is substituted relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 172); or B.
  • a shortened upper stem region wherein the shortened upper stem region lacks 1-6 nucleotides and wherein the 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region include less than or equal to 4 substitutions relative to Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 172); or C.
  • Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 172) at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2 and H2-14, wherein the substituent nucleotide is neither a pyrimidine that is followed by an adenine, nor an adenine that is preceded by a pyrimidine; or D.
  • the modified nucleotide is optionally selected from a 2’-O-methyl (2’- OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or a combination thereof; or 2.
  • the modified nucleotide optionally includes a 2’-OMe modified nucleotide.
  • Exemplary SpyCas9 sgRNA-1 or an sgRNA, such as an sgRNA comprising Exemplary SpyCas9 sgRNA-1, further includes a 3’ tail, e.g., a 3’ tail of 1, 2, 3, 4, or more nucleotides.
  • the tail includes one or more modified nucleotides.
  • the modified nucleotide is selected from a 2’-O-methyl (2’- OMe) modified nucleotide, a 2’-O-(2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’- fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic modified nucleotide, or a combination thereof.
  • the modified nucleotide includes a 2’-OMe modified nucleotide.
  • the modified nucleotide includes a PS linkage between nucleotides.
  • the modified nucleotide includes a 2’-OMe modified nucleotide and a PS linkage between nucleotides.
  • the gRNA is chemically modified.
  • a gRNA comprising one or more modified nucleosides or nucleotides is called a “modified” gRNA or “chemically modified” gRNA, to describe the presence of one or more non-naturally and/or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues.
  • Modified nucleosides and nucleotides can include one or more of: (i) alteration, e.g., replacement, of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (ii) alteration, e.g., replacement, of a constituent of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar (an exemplary sugar modification); (iii) wholesale replacement of the phosphate moiety with “dephospho” linkers (an exemplary backbone modification); (iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); (v) replacement or modification of the ribose- phosphate backbone (an exemplary backbone modification); (vi) modification of the 3' end or 5' end of the oligonucleotide
  • modified gRNAs comprising nucleosides and nucleotides (collectively “residues”) that can have two, three, four, or more modifications.
  • a modified residue can have a modified sugar and a modified nucleobase.
  • every base of a gRNA is modified, e.g., all bases have a modified phosphate group, such as a phosphorothioate group.
  • all, or substantially all, of the phosphate groups of an gRNA molecule are replaced with phosphorothioate groups.
  • modified gRNAs comprise at least one modified residue at or near the 5' end of the RNA.
  • modified gRNAs comprise at least one modified residue at or near the 3' end of the RNA.
  • the gRNA comprises one, two, three or more modified residues.
  • at least 5% e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%
  • modified nucleosides or nucleotides are modified nucleosides or nucleotides.
  • the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent.
  • the modified residue e.g., modified residue present in a modified nucleic acid
  • the backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.
  • modified phosphate groups include phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters.
  • Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone.
  • the modified nucleosides and modified nucleotides can include one or more modifications to the sugar group, i.e. at sugar modification.
  • the 2' hydroxyl group (OH) can be modified, e.g. replaced with a number of different “oxy” or “deoxy” substituents.
  • modifications to the 2' hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2'-alkoxide ion.
  • Examples of 2' hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), O(CH 2 CH 2 O) n CH 2 CH 2 OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20.
  • the 2' hydroxyl group modification can be 2'-O- Me.
  • the 2' hydroxyl group modification can be a 2'-fluoro modification, which replaces the 2' hydroxyl group with a fluoride.
  • the 2' hydroxyl group modification can include “locked” nucleic acids (LNA) in which the 2' hydroxyl can be connected, e.g., by a C1-6 alkylene or C1-6 heteroalkylene bridge, to the 4' carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges.
  • LNA locked nucleic acids
  • the 2' hydroxyl group modification can included “unlocked” nucleic acids (UNA) in which the ribose ring lacks the C2'-C3' bond.
  • the 2' hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).
  • MOE methoxyethyl group
  • “Deoxy” 2' modifications can include hydrogen (i.e.
  • deoxyribose sugars e.g., at the overhang portions of partially dsRNA
  • halo e.g., bromo, chloro, fluoro, or iodo
  • amino wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH 2 CH 2 NH) n CH2CH 2 - amino (wherein amino can be, e.g., as described herein), -NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alky
  • the sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar.
  • the modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms.
  • the modified nucleic acids can also include one or more sugars that are in the L form, e.g. L- nucleosides.
  • the modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase.
  • a modified base also called a nucleobase.
  • nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids.
  • the nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog.
  • the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.
  • each of the crRNA and the tracr RNA can contain modifications. Such modifications may be at one or both ends of the crRNA and/or tracr RNA.
  • one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified.
  • Certain embodiments comprise a 5' end modification.
  • Certain embodiments comprise a 3' end modification.
  • one or more or all of the nucleotides in single stranded overhang of a gRNA molecule are deoxynucleotides.
  • the gRNAs disclosed herein comprise one of the modification patterns disclosed in WO2018/107028 A1, published June 14, 2018 the contents of which are hereby incorporated by reference in their entirety.
  • the terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2’-O-Me.
  • the terms “fA,” “fC,” “fU,” or “fG” may be used to denote a nucleotide that has been substituted with 2’-F.
  • a “*” may be used to depict a PS modification.
  • the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.
  • the terms “mA*,” “mC*,” “mU*,” or “mG*” may be used to denote a nucleotide that has been substituted with 2’-O-Me and that is linked to the next (e.g., 3’) nucleotide with a PS bond.
  • compositions comprising one or more gRNAs comprising one or more guide sequences from Table 1 and an RNA-guided DNA binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9.
  • a nuclease such as a Cas nuclease, such as Cas9.
  • the RNA- guided DNA-binding agent has cleavase activity, which can also be referred to as double-strand endonuclease activity.
  • the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S.
  • Cas nucleases include a Csm or Cmr complex of a type III CRISPR system or the Cas10, Csm1, or Cmr2 subunit thereof; and a Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof.
  • the Cas nuclease may be from a Type-IIA, Type-IIB, or Type-IIC system.
  • the RNA-guided DNA-binding agent comprises a Cas nickase.
  • the RNA-guided nickase is modified or derived from a Cas protein, such as a Class 2 Cas nuclease (which may be, e.g., a Cas nuclease of Type II, V, or VI).
  • Class 2 Cas nuclease include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins and modifications thereof.
  • Non-limiting exemplary species that the Cas nuclease or Cas nickase can be derived from include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis rougevillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acido
  • the Cas nuclease is the Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is the Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is the Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is the Cas9 nuclease is from Staphylococcus aureus. In some embodiments, the Cas nuclease is the Cpf1 nuclease from Francisella novicida.
  • the Cas nuclease is the Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpf1 nuclease from Lachnospiraceae bacterium ND2006.
  • the Cas nuclease is the Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae.
  • the Cas nuclease is a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae.
  • the Cas nickase is derived from the Cas9 nuclease from Streptococcus pyogenes.
  • the Cas nickase is derived from the Cas9 nuclease from Streptococcus thermophilus.
  • the Cas nickase is a nickase form of the Cas9 nuclease from Neisseria meningitidis.
  • the Cas nickase is derived from the Cas9 nuclease is from Staphylococcus aureus. In some embodiments, the Cas nickase is derived from the Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nickase is derived from the Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nickase is derived from the Cpf1 nuclease from Lachnospiraceae bacterium ND2006.
  • the Cas nickase is derived from the Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae.
  • the Cas nickase is derived from a Cpf1 nuclease from an Acidaminococcus or Lachnospiraceae.
  • a nickase may be derived from a nuclease by inactivating one of the two catalytic domains, e.g., by mutating an active site residue essential for nucleolysis, such as D10, H840, of N863 in Spy Cas9.
  • an active site residue essential for nucleolysis such as D10, H840, of N863 in Spy Cas9.
  • sequence alignment and structural alignment which is discussed in detail below.
  • the gRNA together with an RNA-guided DNA binding agent is called a ribonucleoprotein complex (RNP).
  • the RNA-guided DNA binding agent is a Cas nuclease.
  • the gRNA together with a Cas nuclease is called a Cas RNP.
  • the RNP comprises Type-I, Type-II, or Type-III components.
  • the Cas nuclease is the Cas9 protein from the Type-II CRISPR/Cas system.
  • the gRNA together with Cas9 is called a Cas9 RNP.
  • Wild type Cas9 has two nuclease domains: RuvC and HNH.
  • the RuvC domain cleaves the non-target DNA strand
  • the HNH domain cleaves the target strand of DNA.
  • the Cas9 protein comprises more than one RuvC domain and/or more than one HNH domain.
  • the Cas9 protein is a wild type Cas9. In each of the composition, use, and method embodiments, the Cas induces a double strand break in target DNA.
  • chimeric Cas nucleases are used, where one domain or region of the protein is replaced by a portion of a different protein.
  • a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fok1.
  • a Cas nuclease may be a modified nuclease.
  • the Cas nuclease or Cas nickase may be from a Type-I CRISPR/Cas system.
  • the Cas nuclease may be a component of the Cascade complex of a Type-I CRISPR/Cas system.
  • the Cas nuclease may be a Cas3 protein.
  • the Cas nuclease may be from a Type-III CRISPR/Cas system. In some embodiments, the Cas nuclease may have an RNA cleavage activity.
  • the RNA-guided DNA-binding agent has single-strand nickase activity, i.e., can cut one DNA strand to produce a single-strand break, also known as a “nick.” In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nickase.
  • a nickase is an enzyme that creates a nick in dsDNA, i.e., cuts one strand but not the other of the DNA double helix.
  • a Cas nickase is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which an endonucleolytic active site is inactivated, e.g., by one or more alterations (e.g., point mutations) in a catalytic domain. See e.g., US Pat. No. 8,889,356 for discussion of Cas nickases and exemplary catalytic domain alterations.
  • a Cas nickase such as a Cas9 nickase has an inactivated RuvC or HNH domain.
  • the RNA-guided DNA-binding agent is modified to contain only one functional nuclease domain.
  • the agent protein may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity.
  • a nickase is used having a RuvC domain with reduced activity.
  • a nickase is used having an inactive RuvC domain.
  • a nickase is used having an HNH domain with reduced activity.
  • a nickase is used having an inactive HNH domain.
  • a conserved amino acid within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity.
  • a Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain.
  • Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3): 759-771.
  • the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain.
  • Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB - A0Q7Q2 (CPF1_FRATN)).
  • an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively.
  • the guide RNAs direct the nickase to a target sequence and introduce a DSB by generating a nick on opposite strands of the target sequence (i.e., double nicking).
  • double nicking may improve specificity and reduce off- target effects.
  • a nickase is used together with two separate guide RNAs targeting opposite strands of DNA to produce a double nick in the target DNA.
  • a nickase is used together with two separate guide RNAs that are selected to be in close proximity to produce a double nick in the target DNA.
  • the RNA-guided DNA-binding agent lacks cleavase and nickase activity.
  • the RNA-guided DNA-binding agent comprises a dCas DNA- binding polypeptide.
  • a dCas polypeptide has DNA-binding activity while essentially lacking catalytic (cleavase/nickase) activity.
  • the dCas polypeptide is a dCas9 polypeptide.
  • the RNA-guided DNA-binding agent lacking cleavase and nickase activity or the dCas DNA-binding polypeptide is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active sites are inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domains. See, e.g., US 2014/0186958 A1; US 2015/0166980 A1.
  • the RNA-guided DNA binding agent comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).
  • the RNA-guided DNA binding agent comprises a APOBEC3 deaminase.
  • a APOBEC3 deaminase is a APOBEC3A (A3A).
  • the A3A is a human A3A.
  • the A3A is a wild-type A3A.
  • the RNA-guided DNA binding agent comprises a deaminase and an RNA-guided nickase.
  • the mRNA further comprises a linker to link the sequencing encoding A3A to the sequence sequencing encoding RNA-guided nickase.
  • the linker is an organic molecule, group, polymer, or chemical moiety.
  • the linker is a peptide linker.
  • the peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids.
  • the peptide linker is the 16 residue "XTEN" linker, or a variant thereof (See, e.g., the Examples; and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)).
  • the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902).
  • the peptide linker comprises one or more sequences selected from SEQ ID NOs: 903-913.
  • the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell.
  • the heterologous functional domain may be a nuclear localization signal (NLS).
  • the RNA- guided DNA-binding agent may be fused with 1-10 NLS(s).
  • the RNA- guided DNA-binding agent may be fused with 1-5 NLS(s).
  • the RNA- guided DNA-binding agent may be fused with one NLS.
  • the NLS may be fused at the N-terminus or the C-terminus of the RNA-guided DNA-binding agent sequence. It may also be inserted within the RNA-guided DNA binding agent sequence. In other embodiments, the RNA-guided DNA-binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA-binding agent may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different.
  • the RNA-guided DNA-binding agent is fused to two NLS sequences (e.g., SV40) fused at the carboxy terminus.
  • the RNA-guided DNA-binding agent may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus.
  • the RNA-guided DNA-binding agent may be fused with 3 NLSs.
  • the RNA-guided DNA-binding agent may be fused with no NLS.
  • the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 600) or PKKKRRV (SEQ ID NO: 601).
  • the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 602).
  • a single PKKKRKV (SEQ ID NO: 600) NLS may be fused at the C-terminus of the RNA-guided DNA-binding agent.
  • One or more linkers are optionally included at the fusion site.
  • the RNA-guided DNA binding agent comprises an editor.
  • An exemplary editor is BC22n which includes a H. sapiens APOBEC3A fused to S. pyogenes-D10A Cas9 nickase by an XTEN linker, and mRNA encoding BC22n.
  • An mRNA encoding BC22n is provided (SEQ ID NO:804).
  • the heterologous functional domain may be capable of modifying the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half-life of the RNA-guided DNA binding agent may be increased.
  • the half-life of the RNA-guided DNA-binding agent may be reduced.
  • the heterologous functional domain may be capable of increasing the stability of the RNA-guided DNA-binding agent.
  • the heterologous functional domain may be capable of reducing the stability of the RNA-guided DNA-binding agent.
  • the heterologous functional domain may act as a signal peptide for protein degradation.
  • the protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases.
  • the heterologous functional domain may comprise a PEST sequence.
  • the RNA-guided DNA-binding agent may be modified by addition of ubiquitin or a polyubiquitin chain.
  • the ubiquitin may be a ubiquitin-like protein (UBL).
  • ULB ubiquitin-like protein
  • Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neuronal-precursor-cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S.
  • the heterologous functional domain may be a marker domain.
  • marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences.
  • the marker domain may be a fluorescent protein.
  • Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1 ), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire,), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, H
  • the marker domain may be a purification tag and/or an epitope tag.
  • Non-limiting exemplary tags include glutathione- S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin.
  • GST glutathione- S-transferase
  • CBP chitin binding protein
  • MBP maltose binding protein
  • TRX thioredoxin
  • poly(NANP) tandem affinity purification
  • TAP tandem affinity pur
  • Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, or fluorescent proteins.
  • GST glutathione-S-transferase
  • HRP horseradish peroxidase
  • CAT chloramphenicol acetyltransferase
  • beta-galactosidase beta-glucuronidase
  • luciferase or fluorescent proteins.
  • the heterologous functional domain may target the RNA- guided DNA-binding agent to a specific organelle, cell type, tissue, or organ.
  • the heterologous functional domain may target the RNA-guided DNA-binding agent to mitochondria.
  • the heterologous functional domain may be an effector domain such as an editor domain.
  • the effector such as an editor domain may modify or affect the target sequence.
  • the effector such as an editor domain may be chosen from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain.
  • the heterologous functional domain is a nuclease, such as a FokI nuclease. See, e.g., US Pat. No.
  • the heterologous functional domain is a transcriptional activator or repressor.
  • a transcriptional activator or repressor See, e.g., Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression,” Cell 152:1173-83 (2013); Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors,” Nat. Methods 10:973-6 (2013); Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering,” Nat. Biotechnol.
  • the RNA-guided DNA-binding agent essentially becomes a transcription factor that can be directed to bind a desired target sequence using a guide RNA.
  • the efficacy of a guide RNA is determined when delivered or expressed together with other components (e.g., an RNA-guided DNA binding agent) forming an RNP.
  • the guide RNA is expressed together with an RNA-guided DNA binding agent, such as a Cas protein, e.g., Cas9.
  • the guide RNA is delivered to or expressed in a cell line that already stably expresses an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.
  • an RNA-guided DNA nuclease such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.
  • the guide RNA is delivered to a cell as part of a RNP.
  • the guide RNA is delivered to a cell along with a mRNA encoding an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., Cas9 nuclease or nickase.
  • RNA-guided DNA nuclease and a guide RNA disclosed herein can lead to DSBs, SSBs, and/or site-specific binding that results in nucleic acid modification in the DNA or pre-mRNA which can produce errors in the form of insertion/deletion (indel) mutations upon repair by cellular machinery.
  • indel insertion/deletion
  • Many mutations due to indels alter the reading frame, introduce premature stop codons, or induce exon skipping and, therefore, produce a non-functional protein.
  • the efficacy of particular guide RNAs is determined based on in vitro models.
  • the in vitro model is T cell line.
  • the in vitro model is HEK293 T cells. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is a lymphoblastoid cell line. In some embodiments, the in vitro model is primary human T cells. In some embodiments, the in vitro model is primary human B cells. In some embodiments, the in vitro model is primary human peripheral blood lymphocytes. In some embodiments, the in vitro model is primary human peripheral blood mononuclear cells.
  • the number of off-target sites at which a deletion or insertion occurs in an in vitro model is determined, e.g., by analyzing genomic DNA from the cells transfected in vitro with Cas9 mRNA and the guide RNA. In some embodiments, such a determination comprises analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, the guide RNA, and a donor oligonucleotide. Exemplary procedures for such determinations are provided in the working examples below. [00374] In some embodiments, the efficacy of particular gRNAs is determined across multiple in vitro cell models for a guide RNA selection process. In some embodiments, a cell line comparison of data with selected guide RNAs is performed.
  • the efficacy of particular guide RNAs is determined based on in vivo models.
  • the in vivo model is a rodent model.
  • the rodent model is a mouse which expresses the target gene.
  • the rodent model is a mouse which expresses a CIITA gene.
  • the rodent model is a mouse which expresses a human CIITA gene.
  • the rodent model is a mouse which expresses a B2M gene.
  • the rodent model is a mouse which expresses a human B2M gene.
  • the in vivo model is a non-human primate, for example cynomolgus monkey.
  • the efficacy of a guide RNA is evaluated by on target cleavage efficiency.
  • the efficacy of a guide RNA is measured by percent editing at the target location, e.g., CIITA, or B2M.
  • deep sequencing may be utilized to identify the presence of modifications (e.g., insertions, deletions) introduced by gene editing.
  • the efficacy of a guide RNA is measured by the number and/or frequency of indels at off-target sequences within the genome of the target cell type.
  • efficacious guide RNAs are provided which produce indels at off target sites at very low frequencies (e.g., ⁇ 5%) in a cell population and/or relative to the frequency of indel creation at the target site.
  • the disclosure provides for guide RNAs which do not exhibit off-target indel formation in the target cell type (e.g., T cells or B cells), or which produce a frequency of off-target indel formation of ⁇ 5% in a cell population and/or relative to the frequency of indel creation at the target site.
  • the disclosure provides guide RNAs which do not exhibit any off target indel formation in the target cell type (e.g., T cells or B cells).
  • guide RNAs are provided which produce indels at less than 5 off-target sites, e.g., as evaluated by one or more methods described herein.
  • guide RNAs are provided which produce indels at less than or equal to 4, 3, 2, or 1 off-target site(s) e.g., as evaluated by one or more methods described herein.
  • the off-target site(s) does not occur in a protein coding region in the target cell (e.g., T cells or B cells) genome.
  • linear amplification is used to detect gene editing events, such as the formation of insertion/deletion (“indel”) mutations, translocations, and homology directed repair (HDR) events in target DNA.
  • the efficacy of a guide RNA is measured by the number of chromosomal rearrangements within the target cell type.
  • Kromatid dGH assay may be used to detect chromosomal rearrangements, including e.g., translocations, reciprocal translocations, translocations to off-target chromosomes, deletions (i.e., chromosomal rearrangements where fragments were lost during the cell replication cycle due to the editing event).
  • the target cell type has less than 10, less than 8, less than 5, less than 4, less than 3, less than 2, or less than 1 chromosomal rearrangement. In some embodiments, the target cell type has no chromosomal rearrangements.
  • LNPs Lipid nanoparticles
  • the LNPs deliver nucleic acid, protein, or nucleic acid together with protein.
  • the invention comprises a method for delivering any one of the gRNAs disclosed herein to a subject, wherein the gRNA is formulated as an LNP.
  • the LNP comprises the gRNA and a Cas9 or an mRNA encoding Cas9.
  • the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP.
  • the composition further comprises a Cas9 or an mRNA encoding Cas9.
  • the LNPs comprise cationic lipids.
  • the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate) or another ionizable lipid.
  • the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5, 5.0, 5.5, 6.0, or 6.5.
  • N:P RNA phosphate
  • the term cationic and ionizable in the context of LNP lipids is interchangeable, e.g., wherein ionizable lipids are cationic depending on the pH.
  • the gRNAs disclosed herein are formulated as LNPs for use in preparing a medicament for treating a disease or disorder.
  • Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and Cas9 or an mRNA encoding Cas9. [00386] In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is formulated as an LNP or not formulated as an LNP. In some embodiments, the LNP comprises the gRNA and a Cas9 or an mRNA encoding Cas9.
  • the guide RNA compositions described herein, alone or encoded on one or more vectors are formulated in or administered via a lipid nanoparticle; see e.g., WO/2017/173054 and WO 2019/067992, the contents of which are hereby incorporated by reference in their entirety.
  • the invention comprises DNA or RNA vectors encoding any of the guide RNAs comprising any one or more of the guide sequences described herein.
  • the vectors in addition to guide RNA sequences, the vectors further comprise nucleic acids that do not encode guide RNAs.
  • Nucleic acids that do not encode guide RNA include, but are not limited to, promoters, enhancers, regulatory sequences, and nucleic acids encoding an RNA- guided DNA nuclease, which can be a nuclease such as Cas9.
  • the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and trRNA.
  • the vector comprises one or more nucleotide sequence(s) encoding a sgRNA and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas nuclease, such as Cas9 or Cpf1.
  • the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas protein, such as, Cas9.
  • the Cas9 is from Streptococcus pyogenes (i.e., Spy Cas9).
  • the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may be a sgRNA) comprises or consists of a guide sequence flanked by all or a portion of a repeat sequence from a naturally-occurring CRISPR/Cas system.
  • the nucleic acid comprising or consisting of the crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence wherein the vector sequence comprises or consists of nucleic acids that are not naturally found together with the crRNA, trRNA, or crRNA and trRNA.
  • Any of the engineered cells and compositions described herein can be used in a method of treating a variety of diseases and disorders, as described herein.
  • the genetically modified cell (engineered cell) and/or population of genetically modified cells (engineered cells) and compositions may be used in methods of treating a variety of diseases and disorders.
  • a method of treating any one of the diseases or disorders described herein comprising administering any one or more composition described herein.
  • the methods and compositions described herein may be used to treat diseases or disorders in need of delivery of a therapeutic agent.
  • the invention provides a method of providing an immunotherapy in a subject, the method including administering to the subject an effective amount of an engineered cell (or population of engineered cells) as described herein, for example, a cell of any of the aforementioned cell aspects and embodiments.
  • the methods comprise administering to a subject a composition comprising an engineered cell described herein as an adoptive cell transfer therapy.
  • the engineered cell is an allogeneic cell.
  • the methods comprise administering to a subject a composition comprising an engineered cell described herein, wherein the cell produces, secretes, and/or expresses a polypeptide (e.g., a targeting receptor) useful for treatment of a disease or disorder in a subject.
  • the cell acts as a cell factory to produce a soluble polypeptide.
  • the cell acts as a cell factory to produce an antibody.
  • the cell continuously secretes the polypeptide in vivo.
  • the cell continuously secretes the polypeptide following transplantation in vivo for at least 1, 2, 3, 4, 5, or 6 weeks.
  • the cell continuously secretes the polypeptide following transplantation in vivo for more than 6 weeks.
  • the soluble polypeptide e.g., an antibody
  • the polypeptide is produced by the cell at a concentration of at least 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , or 10 8 copies per day.
  • the polypeptide is an antibody and is produced by the cell at a concentration of at least 10 8 copies per day.
  • the method includes administering a lymphodepleting agent or immunosuppressant prior to administering to the subject an effective amount of the engineered cell (or engineered cells) as described herein, for example, a cell of any of the aforementioned cell aspects and embodiments.
  • the invention provides a method of preparing engineered cells (e.g., a population of engineered cells).
  • Immunotherapy is the treatment of disease by activating or suppressing the immune system. Immunotherapies designed to elicit or amplify an immune response are classified as activation immunotherapies. Cell-based immunotherapies have been demonstrated to be effective in the treatment of some cancers.
  • Immune effector cells such as lymphocytes, macrophages, dendritic cells, natural killer cells, cytotoxic T lymphocytes (CTLs), T helper cells, B cells, or their progenitors such as hematopoietic stem cells (HSC) or induced pluripotent stem cells (iPSC) can be programmed to act in response to abnormal antigens expressed on the surface of tumor cells.
  • CTLs cytotoxic T lymphocytes
  • T helper cells B cells
  • progenitors such as hematopoietic stem cells (HSC) or induced pluripotent stem cells (iPSC)
  • HSC hematopoietic stem cells
  • iPSC induced pluripotent stem cells
  • Immune effector cells such as regulatory T cells (Tregs) or mesenchymal stem cells can be programmed to act in response to autoantigens or transplant antigens expressed on the surface of normal tissues.
  • the invention provides a method of preparing engineered cells (e.g., a population of engineered cells). The population of engineered cells may be used for immunotherapy.
  • the invention provides a method of treating a subject in need thereof that includes administering engineered cells prepared by a method of preparing cells described herein, for example, a method of any of the aforementioned aspects and embodiments of methods of preparing cells.
  • the engineered cells can be used to treat cancer, infectious diseases, inflammatory diseases, autoimmune diseases, cardiovascular diseases, neurological diseases, ophthalmologic diseases, renal diseases, liver diseases, musculoskeletal diseases, red blood cell diseases, or transplant rejections.
  • the engineered cells can be used in cell transplant, e.g., to the heart, liver, lung, kidney, pancreas, skin, or brain. (See e.g., Deuse et al., Nature Biotechnology 37:252-258 (2019).)
  • the engineered cells can be used as a cell therapy comprising an allogeneic stem cell therapy.
  • the cell therapy comprises induced pluripotent stem cells (iPSCs). iPSCs may be induced to differentiate into other cell types including e.g., beta islet cells, neurons, and blood cells.
  • the cell therapy comprises hematopoietic stem cells.
  • the stem cells comprise mesenchymal stem cells that can develop into bone, cartilage, muscle, and fat cells.
  • the stem cells comprise ocular stem cells.
  • the allogeneic stem cell transplant comprises allogeneic bone marrow transplant.
  • the stem cells comprise pluripotent stem cells (PSCs).
  • the stem cells comprise induced embryonic stem cells (ESCs).
  • the engineered cells disclosed herein are suitable for further engineering, e.g., by introduction of further edited, or modified genes or alleles.
  • the polypeptide is a wild-type or variant TCR.
  • Cells of the invention may also be suitable for further engineering by introduction of an exogenous nucleic acid encoding e.g., a targeting receptor, e.g., a TCR, CAR, UniCAR.
  • CARs are also known as chimeric immunoreceptors, chimeric T cell receptors or artificial T cell receptors.
  • the cell therapy is a transgenic T cell therapy.
  • the cell therapy comprises a Wilms’ Tumor 1 (WT1) targeting transgenic T cell.
  • the cell therapy comprises a targeting receptor or a donor nucleic acid encoding a targeting receptor of a commercially available T cell therapy, such as a CAR T cell therapy.
  • a targeting receptor for use as cell therapy.
  • the cells and methods provided herein can be used with these known constructs.
  • Commercially approved cell products that include targeting receptor constructs for use as cell therapies include e.g., Kymriah® (tisagenlecleucel); Yescarta® (axicabtagene ciloleucel); TecartusTM (brexucabtagene autoleucel); Tabelecleucel (Tab-cel®); Viralym-M (ALVR105); and Viralym-C.
  • the methods provide for administering the engineered cells to a subject, wherein the administration is an injection. In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is an intravascular injection or infusion. In some embodiments, the methods provide for administering the engineered cells to a subject, wherein the administration is a single dose. [00402] In some embodiments, the methods provide for reducing a sign or symptom associated of a subject’s disease treated with a composition disclosed herein. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than one week. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than two weeks.
  • the subject has a response to treatment with a composition disclosed herein that lasts more than three weeks. In some embodiments, the subject has a response to treatment with a composition disclosed herein that lasts more than one month.
  • the methods provide for administering the engineered cells to a subject, and wherein the subject has a response to the administered cell that comprises a reduction in a sign or symptom associated with the disease treated by the cell therapy. In some embodiments, the subject has a response that lasts more than one week. In some embodiments, the subject has a response that lasts more than one month. In some embodiments, the subject has a response that lasts for at least 1-6 weeks.
  • Example 1 General Methods 1.1. Next-generation sequencing (“NGS”) and analysis for on-target cleavage efficiency.
  • NGS Next-generation sequencing
  • Genomic DNA was extracted using QuickExtractTM DNA Extraction Solution (Lucigen, Cat. No. QE09050) according to manufacturer's protocol.
  • To quantitatively determine the efficiency of editing at the target location in the genome deep sequencing was utilized to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around the target site within the gene of interest (e.g., CIITA) and the genomic area of interest was amplified.
  • Primer sequence design was done as is standard in the field. [00407] Additional PCR was performed according to the manufacturer's protocols (Illumina) to add chemistry for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. The reads were aligned to the human reference genome (e.g., hg38) after eliminating those having low quality scores. Reads that overlapped the target region of interest were re- aligned to the local genome sequence to improve the alignment. Then the number of wild type reads versus the number of reads which contain C-to-T mutations, C-to-A/G mutations or indels was calculated. Insertions and deletions were scored in a 20 bp region centered on the predicted Cas9 cleavage site.
  • Indel percentage is defined as the total number of sequencing reads with one or more base inserted or deleted within the 20 bp scoring region divided by the total number of sequencing reads, including wild type.
  • C-to-T mutations or C-to-A/G mutations were scored in a 40 bp region including 10 bp upstream and 10 bp downstream of the 20 bp sgRNA target sequence.
  • the C-to-T editing percentage is defined as the total number of sequencing reads with either one or more C-to-T mutations within the 40 bp region divided by the total number of sequencing reads, including wild type. The percentage of C-to-A/G mutations are calculated similarly. 1.2. T cell culture media preparation.
  • T cell culture media compositions used below are described here and in Table 3.
  • “X- VIVO Base Media” consists of X-VIVOTM 15 Media, 1% Penstrep, 50 ⁇ M Beta-Mercaptoethanol, 10 mM NAC.
  • other variable media components used were: 1. Serum (Fetal Bovine Serum (FBS)); and 2. Cytokines (IL-2, IL-7, IL-15), also described in Table 3.
  • T cell media components are described in Table 3 below. [00409] Table 3. T cell media.
  • RNA cargos e.g., Cas9 mRNA and sgRNA
  • the RNA cargos were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg/mL.
  • the lipid nucleic acid assemblies contained ionizable Lipid A ((9Z,12Z)-3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-(((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG in a 50:38:9:3 molar ratio, respectively.
  • the lipid nucleic acid assemblies were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6, and a ratio of gRNA to mRNA of 1:1 by weight.
  • N:P lipid amine to RNA phosphate
  • Lipid nanoparticles were prepared using a cross-flow technique utilizing impinging jet mixing of the lipid in ethanol with two volumes of RNA solutions and one volume of water. The lipids in ethanol were mixed through a mixing cross with the two volumes of RNA solution.
  • a fourth stream of water was mixed with the outlet stream of the cross through an inline tee (See WO2016010840 Figure 2)
  • the LNPs were held for 1 hour at room temperature (RT) and further diluted with water (approximately 1:1 v/v).
  • LNPs were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100kD MWCO) and buffer exchanged using PD- 10 desalting columns (GE) into 50 mM Tris, 45 mM NaCl, 5% (w/v) sucrose, pH 7.5 (TSS).
  • the LNP’s were optionally concentrated using 100 kDa Amicon spin filter and buffer exchanged using PD-10 desalting columns (GE) into TSS.
  • IVTT In vitro transcription
  • Plasmid DNA containing a T7 promoter, a sequence for transcription, and a polyadenylation region region was linearized by incubating at 37°C for 2 hours with XbaI with the following conditions: 200 ng/ ⁇ L plasmid, 2 U/ ⁇ L XbaI (NEB), and 1x reaction buffer.
  • the XbaI was inactivated by heating the reaction at 65°C for 20 min.
  • the linearized plasmid was purified from enzyme and buffer salts.
  • the IVT reaction to generate modified mRNA was performed by incubating at 37°C for 1.5-4 hours in the following conditions: 50 ng/ ⁇ L linearized plasmid; 2-5 mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink); 10-25 mM ARCA (Trilink); 5 U/ ⁇ L T7 RNA polymerase (NEB); 1 U/ ⁇ L Murine RNase inhibitor (NEB); 0.004 U/ ⁇ L Inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer.
  • TURBO DNase ThermoFisher
  • the mRNA was purified using a MegaClear Transcription Clean-up kit (ThermoFisher) or a RNeasy Maxi kit (Qiagen) per the manufacturers’ protocols. Alternatively, the mRNA was purified through a precipitation protocol, which in some cases was followed by HPLC-based purification. Briefly, after the DNase digestion, mRNA is purified using LiCl precipitation, ammonium acetate precipitation and sodium acetate precipitation. For HPLC purified mRNA, after the LiCl precipitation and reconstitution, the mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 e142).
  • RNA concentrations were determined by measuring the light absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis by Bioanlayzer (Agilent).
  • Spy Streptococcus pyogenes
  • BC22n mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID Nos: 804-805.
  • BC22 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID No: 806.
  • UGI mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID Nos: 807-808.
  • RNAs used in the Examples include a 5’ cap and a 3’ polyadenylation region, e.g., up to 100 nts, and are identified by SEQ ID NOs: 801- 808 in Table 19 below.
  • RNP Cas9 editing activity was assessed using electroporation of Cas9 ribonucleoprotein
  • Pan CD3+ T cells (StemCell, HLA-A*02.01/ A*03.01) were plated at a density of 0.5 x 10 6 cells/mL in T cell RPMI media composed of RPMI 1640 (Invitrogen, Cat.
  • CIITA targeting sgRNAs were removed from their storage plates and denatured for 2 minutes at 95 o C before cooling at room temperature for 10 minutes.
  • RNP mixture of 20 uM sgRNA and 10 uM recombinant Cas9-NLS protein (SEQ ID NO: 800) is prepared and incubated at 25 o C for 10 minutes.
  • Five ⁇ L of RNP mixture was combined with 100,000 cells in 20 ⁇ L P3 electroporation Buffer (Lonza). 22 ⁇ L of RNP/cell mix was transferred to the corresponding wells of a Lonza shuttle 96-well electroporation plate. Cells were electroporated in duplicate with the manufacturer’s pulse code.
  • T cell RPMI media was added to the cells immediately post electroporation. Electroporated T cells were subsequently cultured and collected for NGS sequencing as described in Example 1 at 2 days post edit. 2.2. Flow cytometry. [00418] On day 10 post-edit, T cells were phenotyped by flow cytometry to determine MHC class II protein expression. Briefly, T cells were incubated in cocktails of antibodies targeting HLA-DR, DQ, DP-PE (BioLegend® Cat. No.361704) and Isotype Control-AF647 (BioLegend® Cat. No. 400234).
  • T cells were subsequently washed, processed on a Cytoflex flow cytometer (Beckman Coulter) and analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, and MHC class II expression. DNA samples were subjected to PCR and subsequent NGS analysis, as described in Example 1. 2.3. Results of CIITA guide RNA screening. [00419] Table 4A shows the mean percentage of T cells negative for cell surface expression of MHC class II. Control 1 and Control 2 target B2M and TRAC respectively for comparative expression of MHC class I.
  • the genomic coordinate of the cut site with spCas9 is shown, as well as the distance (# of nucleotides) between the acceptor splice site boundary nucleotide or the donor splice site boundary nucleotide and the cut site (referred to in Table 4A as Distance from Cut Site).
  • Numerical values without parentheses show the number of nucleotides in the 5’directed between a splice site boundary nucleotide and cut site, whereas the numerical values in parentheses show the number of nucleotides in the 3’ direction between a splice site boundary nucleotide and cut site.
  • Table 4B shows the results of the NGS analysis. T C P 0 0 - 4 3 0 0 - 5 5 1 1 0. o N t e k c o D y e n r o tt A 7 0 2
  • CIITA guide RNAs were screened using BC22, a base conversion editor nuclease that includes a fusion of Cas9D10A nickase, human APOBEC3A deaminase and uracil glycosylase inhibitor.
  • the characteristic edit of this construct is a cytosine to thymine conversion, rather than the indel typical of Cas9 cleavase.
  • the efficacy in T cells was assessed by loss of MHC class II cell surface expression. The percentage of T cells negative for MHC class II protein was assayed following CIITA editing by electroporation with mRNA and guide.
  • T cells Upon thaw, Pan CD3+ T cells isolated from a commercially obtained leukopak (StemCell) were plated at a density of 0.5 x 10 6 cells/mL in Media 20 from Table 3. T cells were activated with Dynabeads® Human T-Activator CD3/CD28 (ThermoFisher). Cells were expanded in T cell for 72 hours prior to mRNA transfection.
  • CIITA sgRNAs (Table 4A) were removed from their storage plates and denatured for 2 minutes at 95 o C before cooling at room temperature for 10 minutes.
  • Fifty microliter of the electroporation mix was prepared with 100,00 T cells in P3 buffer (Lonza) and 10 ng/uL mRNA encoding UGI (SEQ ID No.807), 10 ng/uL mRNA encoding BC22 (SEQ ID No.806) and 2 ⁇ M sgRNA. This mix was transferred to the corresponding wells of a Lonza shuttle 96- well electroporation plate. Cells were electroporated in duplicate wells using Lonza shuttle 96w using manufacturer’s pulse code. Media 20 was added to the cells immediately post electroporation. Electroporated T cells were subsequently cultured and collected for NGS sequencing and flow cytometry 10 days post edit. Flow cytometry was performed as described in Example 2.
  • Table 5 shows the mean percentage of T cells negative for cell surface expression of MHC class II as well as the mean percent editing. [00425] Table 5: CIITA guide screen using BC22.
  • Table 6 and Figure 2 show the percent knockout of MHC class II using Cas9 and BC22 in relation to the distance from the cut site to the splice site boundary nucleotide.
  • Table 6 and Figure 2 show the percent knockout of MHC class II using Cas9 and BC22 in relation to the distance from the cut site to the splice site boundary nucleotide.
  • the genomic coordinate of the cut site with spCas9 is shown, as well as the distance (# of nucleotides) between the acceptor splice site boundary nucleotide or the donor splice site boundary nucleotide and the cut site.
  • BC22n is a base conversion editor nuclease that includes a fusion of Cas9D10A nickase, human APOBEC3A deaminase.
  • the characteristic edit of this construct is a cytosine to thymine conversion, rather than the indel typical of Cas9 cleavase.
  • Healthy human donor apheresis was obtained commercially (Hemacare), and cells were washed and re-suspended in CliniMACS® PBS/EDTA buffer (Miltenyi Biotec Cat. No. 130-070-525) on the LOVO device. T cells were isolated via positive selection using CD4 and CD8 magnetic beads (Miltenyi Biotec Cat. No.
  • T cells were aliquoted into vials and cryopreserved in a 1:1 formulation of Cryostor® CS10 (StemCell Technologies Cat. No. 07930) and Plasmalyte A (Baxter Cat. No. 2B2522X) for future use.
  • Cryostor® CS10 StemCell Technologies Cat. No. 07930
  • Plasmalyte A Biller Cat. No. 2B2522X
  • T cells Upon thaw, T cells were plated at a density of 1.0 x 10 6 cells/mL in T cell basal media composed of X-VIVO 15TM serum-free hematopoietic cell medium (Lonza Bioscience) containing 5% (v/v) of fetal bovine serum, 50 ⁇ M of 2-Mercaptoethanol, 10 mM of N-Acetyl-L-(+)-cysteine, 10 U/mL of Penicillin-Streptomycin, in addition to 1X cytokines (200 U/mL of recombinant human interleukin-2, 5 ⁇ g/mL of recombinant human interleukin-7 and 5 ⁇ g/mL of recombinant human interleukin-15).
  • 1X cytokines 200 U/mL of recombinant human interleukin-2, 5 ⁇ g/mL of recombinant human interleukin-7 and 5 ⁇ g/mL of recombin
  • T-cells were activated with TransActTM (1:100 dilution, Miltenyi Biotec). Cells were expanded in T cell basal media containing TransActTM for 72 hours prior to electroporation.
  • 4.2. Electroporation of T cells [00431] Solutions containing mRNAs encoding Cas9 , BC22n (SEQ ID NO:804) or UGI (SEQ ID NO: 807) were prepared in sterile water. 50 ⁇ M CIITA sgRNAs (G018076 and G018117) (SEQ ID NOs: 56 and 97, respectively) were removed from their storage plates and denatured for 2 minutes at 95°C before cooling on ice.
  • T cells were harvested, centrifuged, and resuspended at a concentration of 12.5 x 10 6 T cells/mL in P3 electroporation buffer (Lonza).
  • P3 electroporation buffer Lionza
  • 1 x 10 5 T cells were mixed with 200 ng of editor mRNA, 200 ng of UGI mRNA and 20 pmols of sgRNA in a final volume of 20 uL of P3 electroporation buffer. This mix was transferred in triplicate to a 96- well NucleofectorTM plate and electroporated using the manufacturer’s pulse code.
  • Electroporated T cells were immediately rested in 80 ⁇ L of T cell basal media without cytokines for 10 minutes before being transferred to a new flat-bottom 96-well plate containing an additional 100 ⁇ L of T cell basal media supplemented with 2X cytokines. The resulting plate was incubated at 37°C for 4 days. After 96 hours, T cells were diluted 1:3 into fresh T cell basal media with 1X cytokines. Electroporated T cells were subsequently cultured for 3 additional days and were collected for flow cytometry analysis, NGS sequencing and transcriptomics. NGS analysis was performed as described in Example 1. 4.3. Flow cytometry and NGS sequencing.
  • T cells were phenotyped by flow cytometry to determine MHC class II protein expression. Briefly, T cells were incubated in a cocktail of antibodies targeting HLA-DR, DQ, DP-PE (BioLegend® Cat. No. 361704) and Isotype Control-PE (BioLegend® Cat. No. 400234). Cells were subsequently washed, processed on a Cytoflex flow cytometer (Beckman Coulter) and analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, and MHC class II expression. DNA samples were subjected to PCR and subsequent NGS analysis, as described in Example 1.
  • Table 7 and Figures 1A, 1B, and 6A show CIITA gene editing. For both Cas9 and BC22n conditions, total editing went to near completion, above 95%.
  • Table 7 and Figures 1C, 1D, and 6B show mean percentage of MHC class II negative cells following electroporation with UGI mRNA combined with Cas9 or BC22n mRNA.
  • Table 7 CIITA editing in T cells presented at a percentage of total NGS reads; Flow cytometry assessment of the mean percentage of MHC class II negative.
  • Example 5 Gene expression analysis in T cells. 5.1. Whole transcriptome sequencing.
  • RNA samples treated with G018117 (SEQ ID NO: 97) and G018078 (SEQ ID NO: 58) in Example 4 were harvested and preserved at -80C for future processing.
  • Total RNA was extracted from samples in TRIzolTM reagent using the Direct-zol RNA microprep kit (Zymo Research, Cat No. R2062) following the manufacturer’s protocol. Purified RNA samples were quantified in a NanoDropTM 8000 spectrophotometer (Thermo Fisher Scientific) and diluted to 41.67 ng/uL using nuclease-free water.
  • RNA ribosomal RNA
  • NEBNext® rRNA Depletion Kit New England Biolabs, Cat. No. E6350L
  • rRNA-depleted samples were converted into double-stranded DNA libraries using NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Cat No. E7765S) following the manufacturer’s protocol.
  • Amplified libraries were quantified in a Qubit 4 fluorometer and the average fragment size of each library was obtained by capillary electrophoresis.
  • Ribosomal RNA reads were identified by aligning all reads to human rRNA sequences (GenBank U13369.1) with Bowtie2 (v2.3.5.1) (Langmead, B. and Salzberg, S.L. Nat. Methods 9, 357–359).
  • Transcriptome quantification was performed using Salmon (v0.14.1) (Patro R., et al. Nat. Methods 14, 417-419) with non- ribosomal RNA reads.
  • Differential gene expression analysis was carried out using DESeq2 (v1.26.0) (Love, M.I., et al. Genome Biol.
  • Table 11 Transcript quantification of the expression of class I HLA genes in T cells. Each square contains the average number of transcripts from a given gene per one million of mRNA molecules. For statistical significance, please refer to Table 12.
  • T cell preparation [00441] Using LNP delivery to activated human T cells, the potency of single-target and multi-target editing was assessed with either Cas9 or BC22n. 6.1. T cell preparation. [00442] Healthy human donor apheresis was obtained commercially (Hemacare), and cells were washed and re-suspended in CliniMACS® PBS/EDTA buffer (Miltenyi Biotec Cat. No. 130-070-525) on the LOVO device. T cells were isolated via positive selection using CD4 and CD8 magnetic beads (Miltenyi Biotec Cat. No. 130-030-401/130-030-801) using the CliniMACS® Plus and CliniMACS® LS disposable kit.
  • T cells were aliquoted into vials and cryopreserved in a 1:1 formulation of Cryostor® CS10 (StemCell Technologies Cat. No. 07930) and Plasmalyte A (Baxter Cat. No.2B2522X) for future use.
  • Cryostor® CS10 StemCell Technologies Cat. No. 07930
  • Plasmalyte A Biller Cat. No.2B2522X
  • T cells Upon thaw, T cells were plated at a density of 1.0 x 10 6 cells/mL in T cell basal media composed of X-VIVO 15TM serum-free hematopoietic cell medium (Lonza Bioscience) containing 5% (v/v) of fetal bovine serum, 50 ⁇ M of 2-Mercaptoethanol, 10 mM of N-Acetyl-L-(+)-cysteine, 10 U/mL of Penicillin-Streptomycin, in addition to 1X cytokines (200 U/mL of recombinant human interleukin-2, 5 ng/mL of recombinant human interleukin-7 and 5 ng/mL of recombinant human interleukin-15).
  • 1X cytokines 200 U/mL of recombinant human interleukin-2, 5 ng/mL of recombinant human interleukin-7 and 5 ng/mL of recombinant human interle
  • T cells were activated with TransActTM (1:100 dilution, Miltenyi Biotec). Cells were expanded in T cell basal media for 72 hours prior to LNP transfection. 6.2. T cell editing.
  • Each RNA species i.e. UGI mRNA, sgRNA or editor mRNA, was formulated separately in an LNP as described in Example 1. Editor mRNAs encoded either BC22n (SEQ ID NO: 805) or Cas9.
  • T cell media was changed 6 days and 8 days after activation and on tenth day post activation, cells were harvested for analysis by NGS and flow cytometry. NGS was performed as in Example 1.
  • Table 12 and Figures 3A-D describe the editing profile of T cells when an individual guide was used for editing.
  • Total editing and C to T editing showed direct, dose responsive relationships to increasing amounts of BC22n mRNA, UGI mRNA and guide across all guides tested. Indel and C conversions to A or G are in an inverse relationship with dose where lower doses resulted in a higher percentage of these mutations. In samples edited with Cas9, total editing and indel activity increase with the total RNA dose.
  • Table 13 and Figures 4A-D describe the editing profile for T cells in percent of total reads when four guides were used simultaneously for editing. In this arm of the experiment, each guide is used at 25% the concentration compared to the single guide editing experiment. In total, T cells were exposed to 6 different LNPs simultaneously (editor mRNA, UGI mRNA, 4 guides). Editing with BC22n and trans UGI lead to higher percentages of maximum total editing for each locus compared to editing with Cas9. [00448] Table 13. Editing as a percentage of total reads – multiple guide delivery. [00449] On day 10 post-activation, T cells were phenotyped by flow cytometry to determine if editing resulted in loss of cell surface proteins.
  • T cells were incubated in a mix of the following antibodies: B2M-FITC (BioLegend, Cat. 316304), CD3-AF700 (BioLegend, Cat. 317322), HLA DR DQ DP-PE (BioLegend, Cat 361704) and DAPI (BioLegend, Cat 422801).
  • B2M-FITC BioLegend, Cat. 316304
  • CD3-AF700 BioLegend, Cat. 317322
  • HLA DR DQ DP-PE BioLegend, Cat 361704
  • DAPI BioLegend, Cat 422801
  • a subset of unedited cells was incubated with Isotype Control-PE (BioLegend® Cat. No. 400234). Cells were subsequently washed, processed on a Cytoflex instrument (Beckman Coulter) and analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, and antigen expression.
  • Table 14 and Figures 5A-H report phenotyping results as percent of cells negative for antibody binding.
  • the percentage of antigen negative cells increased in a dose responsive manner with increasing total RNA for both BC22n and Cas9 samples.
  • Cells edited with BC22n showed comparable or higher protein knockout compared to cells edited with Cas9 for all guides tested.
  • BC22n with trans UGI showed substantially higher percentages of antigen negative cells than Cas9 with trans UGI.
  • BC22n edited samples at the highest total RNA dose of 550 ng showed 84.2% of cells lacking all three antigens, while Cas9 editing led to only 46.8% such triple knockout cells.
  • the correlation between DNA editing and antigen reduction was robust.
  • BC22n had an R square measurement of 0.93 when comparing C to T conversions to antigen knockout.
  • Cas9 had an R square measurement of 0.95 when comparing indels to antigen knockout.
  • Example 7 HLA-E Protection of B2M Knockout T Cells in an NK Cell In Vivo Killing Mouse Model.
  • Female NOG-hIL-15 mice were engrafted with 1.5x10 6 primary NK cells followed by the injection of either wild-type T cells or B2M knockout T cells containing luciferase +/- HLA-E to test for HLA-E protection from in vivo NK cell killing of injected T cells. 7.1.
  • Luciferase infection was performed by infecting 1x10 6 cells in 150ul of luciferase lentivirus supplemented with 350ul of Media Number 18 and centrifuged at 1000XG for 60 mins at 37 ⁇ C. Prior to second round of infection with HLA-E lentivirus for B2M -/- HLA-E, cells were rested in Media Number 2 for 2 hours after which 1x10 6 cells were infected with 60ul of HLA-E virus in 440ul of Media Number 18. WT luciferase + T cells and B2M -/- luciferase + cells group did not receive any virus but were spun in Media Number 18 only to keep conditions similar across different groups.
  • PBMC count was determined post lysis and T cell isolation was performed using EasySep Human T cell isolation kit (Stemcell Technologies, Cat#17951) according to manufacturer’s protocol. Isolated CD3+ T cells were re-suspended in Cryostor CS10 media (Stemcell Technologies, Cat#07930) and frozen down in liquid nitrogen until further use. 7.3. sgRNA electroporation in T cells. [00455] RNP’s were formulated for performing B2M knockout using guide G000193 (100 ⁇ M), recombinant Cas9-NLS protein (50 ⁇ M) and Reaction Buffer(1X).
  • Single guide G000193 was first denatured at 95 ⁇ C for 2 mins followed by cooling down on ice for 10 mins. 6 ⁇ l of 50 ⁇ M Cas9 was mixed with 18 ⁇ l of 1X Reaction buffer and 6 ⁇ l of denatured G000193 guide in a PCR tube to make final volume of 30 ⁇ l. RNP’s were formulated by incubating at 25 ⁇ C for 10 mins followed by leaving on ice until further use.
  • CD3+T-cells were plated at a density of 0.5x10 6 cells/ml in Media Number 19 containing IL-2 (100U/ml)(Peprotech;Cat#200-02), IL-7 (2.5ng/ml) (Stemcell;Cat#78053.1) and IL-15 (2.5ng/ml)(Stemcell;Cat#78031.1).
  • Cells were stimulated with Transact (1:100 Dilution, Miltenyi Biotec; Cat#130-111-160) for 48 hours.
  • Post stimulation 10x10 6 cells were centrifuged and re-suspended in 80 ul P3 electroporation buffer (Lonza; Cat#V4XP-3024) followed by adding 25 ⁇ l of RNP and electroporated in cuvettes using Lonza electroporator with pulse code EO-115. Wild type T cells went through a similar process for mock electroporation in P3 buffer only. 7.4. Preparation of purified luciferase+, HLA-E+, MHC class I- T cells.
  • Cells were sorted using BD FACS Aria by gating on GFP + only, GFP + /MHC-I-, GFP + /MHC-I-/HLA-E + for WT luciferase + T cells, B2M -/- luciferase + T cells, and B2M -/- HLA-E + luciferase + T cells respectively. Collected cells were washed and resuspended in Media Number 19 and transferred to a 6-well G-Rex. Cells were stimulated with another round of Transact at 1:100 dilution for 48 hours.
  • Transact was washed out of stimulated T cells post 48 hours of stimulation and resuspended in Media Number 19 and cultured in G-Rex plate with fresh cytokines added every 2 days 7.5. Preparation of T cells for injection. [00457] T cells were injected 10 days post second stimulation after washing in PBS and resuspending in HBSS solution for injection into NOG-IL15 mice. 7.6. Protective effect of HLA-E on B2M knockout T cells in vivo. [00458] NK cells were washed with HBSS (Gibco, Cat. No. 14025-092) and resuspended at 10x10 6 cells/mL for injection in 150 ⁇ L.
  • HBSS Gibco, Cat. No. 14025-092
  • NK cell solution was injected via the tail vein with a 27-gauge needle.
  • mice were inoculated with wild-type, B2M -/- , or B2M -/- + HLA-E T cells 28 days post NK cell injection. Cells were prepared at a concentration of 6x10 6 cells/150 ⁇ L volume.
  • IVIS imaging was performed to identify luciferase-positive T cells by IVIS spectrum. IVIS imagine was done at 6 hours, 24 hours, 48 hours, 4 days, 6 days, 8 days, 11 days, 18 days, 25 days, 29 days, 33 days, 50 days, 55 days, 61 days, 74 days, and 90 days after T cell injection. Mice were prepared for imaging with an injection of D-luciferin i.p.
  • Figure 9A shows the HLA-E protection of B2M KO T cells from NK cell lysis 90 days post T cell injection.
  • Figure 9B shows the HLA-E protection of B2M KO T cells from NK cells over the 90-day time course post T cell injection.
  • Figure 9C shows the protective effect of HLA-E over the 30-day time course of a replicate study.
  • Example 8 CIITA Editing in Lymphoblastoid Cell Lines.
  • LNPs lymphoblastoid cell lines
  • LCLs are developed by infecting peripheral blood lymphocytes (PBLs) from human donors with Epstein Barr Virus (EBV). This process has been demonstrated to immortalize human resting B cells in vitro giving rise to an actively proliferating B cell population positive for B cell marker CD19 and negative for T cell marker CD3 as well as for NK cell marker CD56 (Neitzel H. A routine method for the establishment of permanent growing lymphoblastoid cell lines. Hum Genet.1986;73(4):320–6).
  • Lymphoblastoid cell lines GM26200 and GM20340 are obtained from the Coriell Institute for Medical Research (Camden, NJ, USA). LCLs are grown in RPMI-1640 with L- glutamine and 15% FBS. At the time of LNP contact, cells are activated with 4 ng/ml IL-4 (R&D System Cat. No.204-IL-010), 1 ng/mL IL-40 (R&D System Cat. No.6245-CL-050), 25 ng/ml BAFF (R&D System Cat. No. 2149-BF-010).
  • the LNPs targeting B2M are formulated at a ratio of 50/10/38.5/1.5 ionizable Lipid B, cholesterol, DSPC, and PEG2k-DMG as described in Example 1.3.
  • LNPs targeting ATTR were formulated with lipid A, cholesterol, DSPC, and PEG2k-DMG in a 50:38.5:9:3 molar ratio, respectively.
  • the lipid nucleic acid assemblies were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6, and a ratio of gRNA to mRNA of 1:2 by weight.
  • LNPs formulated with Cas9 mRNA and a CIITA gRNA are pre-incubated at 37°C for about 5 minutes with M.
  • fascicularis cynomolgus monkey serum (BioReclamationIVT, Cat. No. CYN197452) at 6% (v/v) are delivered to lymphoblastoid cells.
  • NGS analysis is performed according to the following using genomic DNA that was extracted using QuickExtractTM DNA Extraction Solution (Lucigen, Cat. No. QE09050) according to manufacturer's protocol. [00464] NGS analysis is performed as in Example 1.1.
  • Flow cytometry is performed.
  • cells are washed in FACS buffer (PBS + 2% FBS + 2 mM EDTA). Then the cells are blocked with Human TruStain FcX (Biolegend® Cat. No. 422302) at room temperature (RT) for 5 minutes and incubated with APC- or PE-conjugated antibody at 1:200 dilution for 30 mins at 4°C. After the incubation, the cells are washed and resuspended buffer containing live-dead marker 7AAD (1:1000 dilution; Biolegend ® Cat. No.420404).
  • FACS buffer PBS + 2% FBS + 2 mM EDTA
  • the cells are processed by flow cytometry, for example using a Beckman Coulter CytoflexSTM, and are analyzed using the FlowJoTM software package.
  • Example 9. Directional Genomic Hybridization Analysis for Chromosomal Translocation Following Gene Editing of CIITA, B2M, and TRAC [00466] T cells treated with electroporation or lipid nanoparticles (LNPs) to deliver Cas9 mRNA and sgRNAs were analyzed for chromosomal structural variations including translocations by directional Genomic Hybridization (dGH ) by KromaTiD (Longmont, CO). 9.1. Electroporation treatments.
  • LNPs lipid nanoparticles
  • T cells were isolated and cryopreserved as follows: T cells were either obtained commercially (e.g. Human Peripheral Blood CD4 + CD45RA + T Cells, Frozen, Stem Cell Technology, Cat. 70029) or prepared internally from a leukopak. For internal preparation, T cells were isolated by negative selection using the EasySep Human T cell Isolation Kit (Stem Cell Technology, Cat. 17951) following the manufacturers protocol. T cells were cryopreserved in Cryostor® CS10 freezing media (Cat. No.07930) for future use. Cryopreserved T cells were thawed and rested overnight in Media Number 1, as described in Table 3.
  • Rested T cells were electroporated to deliver ribonucleoprotein (RNP) complexes containing guides G013674 (SEQ ID NO: 702) or G000529 (SEQ ID NO: 701), targeting CIITA and B2M genes respectively.
  • RNP ribonucleoprotein
  • Briefly stock RNPs were prepared by incubating recombinant Cas9-NLS protein (50 ⁇ M stock) with sgRNA (100 uM) to a final concentration of 20 ⁇ M Cas9 with 40 ⁇ M sgRNA (1:2 Cas9 protein to guide ratio).
  • Cultured T cells were harvested at 1x10 6 cells resuspended in 100 ⁇ L Buffer P3 (Lonza, Cat. No.
  • T cells were subsequently electroporated using the Lonza 4D-NucleofectorTM5. Electroporated cells were collected and rested for 48 hours in Media Number 1, as described in Table 3. Subsequently, T cells were harvested, resuspended to a density of 1x10 6 cells/mL in Media Number 1, as described in Table 3 and activated with T cell TransActTM reagent (Miltenyi Biotec, Cat. No. 130-111-160) at a 1/100 dilution.
  • T cell TransActTM reagent Miltenyi Biotec, Cat. No. 130-111-160
  • T cells Forty-eight hours after T cell activation, T cells were electroporated as described above with Cas9-RNPs including G012086 (SEQ ID NO: 703) targeting TRAC. Triple edited T cells was transferred back to Media Number 1, as described in Table 3 and expanded for future analysis. [00469] After expansion, the cells were passed through the Magnetic-Activated Cell Sorting (MACS) depletion process for selecting the triple knockout cells using the Anti-Biotin microbeads (Miltenyi Biotec, Cat. No. 130-090-485) protocol for MHC Class I (Miltenyi Biotec, Cat. No.
  • MCS Magnetic-Activated Cell Sorting
  • T cells were treated 72 hours post activation with three LNPs delivering mRNA encoding Cas9 (SEQ ID NO: 809) and sgRNAs G000529 (SEQ ID NO: 701), G012086 (SEQ ID NO: 703), and G013674 (SEQ ID NO: 702), targeting B2M, TRAC and CIITA respectively.
  • LNPs were pre-incubated with cyno serum at 37°C for 5 mins and dosed at 100 ng of total RNA cargo per 100,000 T cells. After 24 hours LNP exposure, the cells were washed and resuspended in Media Number 11, as described in Table 3, and cultured at 37°C for 5 days.
  • T cells were treated 24 hours post activation with a single LNP delivering mRNA encoding Cas9 (SEQ ID NO: 809) and G000529 (SEQ ID NO: 701) targeting B2M as described for simultaneous LNP treatment above.
  • a single LNP delivering mRNA encoding Cas9 (SEQ ID NO: 809) and G013674 (SEQ ID NO: 702) targeting CIITA was added at 48 hours post activation.
  • LNP treated T cells were passed through the MACS triple negative selection process and further flow cytometry analysis (as described in Example 3.2) and NGS analysis (as described in Example 1.1) were performed on these samples as described for electroporated cells.
  • Treated and non-treated cells were assayed for percent editing by NGS (as described in Example 1.1) and protein expression by flow cytometry (as described in Example 3.3) both before and after MACS processing.
  • the following flow cytometry reagents were used as phenotypic readouts of gene editing for B2M, CIITA and TRAC, respectively: FITC anti- human ⁇ 2-microglobulin Antibody (Biolegend®, Cat. No. 316304), APC anti-human CD3 Antibody (Biolegend®, Cat. No. 300412), PE anti-human HLA-DR, DP, DQ Antibody (Biolegend®, Cat. No. 361716).
  • NGS editing results are shown in Table 15 and Figure 10A (before MACs), Figure 10B (after MACs).
  • Flow cytometry results are shown in Table 16 and Figure 11A (before MACs), Figure 11B (after MACs).
  • Table 15 Editing analysis by NGS.
  • Table 16 Flow cytometry analysis. 9.3. Kromatid dGHTM analysis for chromosomal structural rearrangements.
  • Engineered T cells were prepared for the dGH procedure according to the KromaTiD’s protocol. Briefly, T cells were cultured for 17 hours with the addition of 5 ⁇ M BrdU and 1 ⁇ M BrdC as provided by KromaTiD.
  • Colcemid was added at a concentration of 10 ⁇ l/ml for an additional 4 hours.
  • Cells were harvested by centrifugation, incubated in 75 mM KCl hypotonic solution for 30 minutes at room temperature, and fixed in a 3:1 methanol to acetic acid solution.
  • FISH fluorescence in situ hybridization
  • “Deletions” were scored when zero FISH signals for a target site were identified in the cell, indicating chromosomal rearrangement where fragments were lost during the cell replication cycle due to the editing event occurring. “Reciprocal translocations” were scored for each pair of adjacent, color- mismatched FISH signals, indicating a translocation between two Cas9 targeted cleavages (e.g. between B2M and TRAC target sites). “Translocations to off-target chromosomes” showed a single FISH signal, indicating a fusion between a Cas9- targeted cleavage site and unlabeled chromosomal site.
  • “Complex translocations” denote FISH signals not included in reciprocal translocations and translocations to off-target sites. Total translocations were calculated as a sum total of the reciprocal translocations, translocations to off-target chromosomes/sites in the genome and complex translocations. Table 17 and Figure 12 show the chromosomal rearrangements identified by this method for each condition. [00480] Table 17. Translocations analysis by Kromatid dGH assay. Example 10: Off Target Analysis 10.1. Biochemical Off-Target Analysis. [00481] A biochemical method (See, e.g., Cameron et al., Nature Methods.
  • Potential off-target sites predicted by detection assays such as the biochemical method used above may be assessed using targeted sequencing of the identified potential off-target sites to determine whether off-target cleavage at that site is detected.
  • Cas9 and a sgRNA of interest e.g., a sgRNA having potential off- target sites for evaluation
  • the T cells are then lysed and primers flanking the potential off-target site(s) are used to generate an amplicon for NGS analysis. Identification of indels at a certain level may validate potential off-target site, whereas the lack of indels found at the potential off-target site may indicate a false positive from the off-target predictive assay that was utilized.
  • Example 11 CIITA Guide RNA screening in T cells with BC22n
  • Different sgRNAs were screened for their potency in knocking out the CIITA gene in human T cells using C to T base editing. The percentage of T cells negative for MHC class II and/or CD74 protein expression was assayed following CIITA editing following electroporation with mRNA and different sgRNAs.
  • 11.1 T cell Preparation [00486] Healthy human donor apheresis was obtained commercially (Hemacare), and cells were washed and resuspended in CliniMACS® PBS/EDTA buffer (Miltenyi Biotec Cat.
  • T cells were isolated via positive selection using a Straight from Leukopak® CD4/CD8 MicroBead kit, human (Miltenyi Biotec Cat.130-122-352). T cells were aliquoted and cryopreserved for future use in Cryostor® CS10 (StemCell Technologies Cat.07930). [00487] Upon thaw, T cells were plated at a density of 1.0 x 10 ⁇ 6 cells/mL in T cell growth media (TCGM) composed of CTS OpTimizer T Cell Expansion SFM and T Cell Expansion Supplement (ThermoFisher Cat.
  • TCGM T cell growth media
  • T cells were rested in this media for 24 hours, at which time they were activated with T Cell TransActTM, human reagent (Miltenyi, Cat.130-111- 160) added at a 1:100 ratio by volume.
  • T cells were activated for 48 hours prior to electroporation.
  • 11.2 T cell editing with RNA electroporation [00488] Solutions containing mRNA encoding BC22n (SEQ ID NO: 804 or 805) and UGI (SEQ ID NO: 807 or 808) were prepared in P3 buffer. One hundred ⁇ M of CIITA- targeting sgRNAs were removed from their storage plates and denatured for 2 minutes at 95 °C and incubated at room temperature for 5 minutes. Forty-eight hours post activation, T cells were harvested, centrifuged, and resuspended at a concentration of 12.5 x 10 ⁇ 6 T cells/mL in P3 electroporation buffer (Lonza).
  • 1 x 10 ⁇ 5 T cells were mixed with 20 ng/ ⁇ L of BC22n mRNAs, 20 ng/ ⁇ L of UGI mRNA, and 20 pmols of sgRNA as described in Table 1in a final volume of 20 ⁇ L of P3 electroporation buffer. This mix was transferred in duplicate to a 96 well NucleofectorTM plate and electroporated using the manufacturer s pulse code. Electroporated T cells were immediately rested in 80 ⁇ L of CTS Optimizer T cell growth media without cytokines for 15 minutes before being transferred to new flat-bottom 96-well plates containing an additional 80 ⁇ L of CTS Optimizer T cell growth media supplemented with 2X cytokines.
  • T cells were assayed by flow cytometry to determine the surface expression of CD74 and HLA-DR, DP, DQ. Briefly, T cells were incubated for 30 minutes at 4 °C with a mixture of antibodies diluted in cell staining buffer (BioLegend, Cat. No.420201).
  • Antibodies against CD3 (BioLegend, Cat. No.317336), CD4 (BioLegend, Cat. No.317434), CD8 (BioLegend, Cat. No.301046), and Viakrome (Beckman Coulter, Cat. No. C36628) were diluted at 1:100, and antibodies against HLA II-DR (BioLegend, Cat. No. 327018), HLA II-DP (BD Biosciences Cat No.750872), HLA II-DQ (BioLegend, Cat. No. 561504), and CD74 (BioLegend, Cat. No.326808) were diluted at 1:50.
  • T cells were subsequently washed, resuspended in 100 ⁇ L of cell staining buffer and processed on a Cytoflex flow cytometer (Beckman Coulter). Flow cytometry data was analyzed using the FlowJo software package. T cells were gated based on size, shape, viability, CD8, HLA II- DP, HLA II-DQ, HLA II-DR, and CD74 expression.
  • Example 12 Screening CIITA sgRNAs in dose-response with BC22n in T cells [00491] Select CIITA sgRNAs identified in Example 11 were further assayed for base editing efficacy at multiple guide concentrations in T cells. The potency of each was assayed for genome editing efficacy by NGS or by disruption of surface protein expression of HLA- DR, DP, DQ by flow cytometry.
  • T cell Preparation [00492] Healthy human donor apheresis was obtained commercially (Hemacare), and cells were washed and resuspended in in CliniMACS® PBS/EDTA buffer (Miltenyi Biotec Cat.130-070-525) and processed in a MultiMACS Cell 24 Separator Plus device (Miltenyi Biotec). T cells were isolated via positive selection using a Straight from Leukopak® CD4/CD8 MicroBead kit, human (Miltenyi Biotec Cat.130-122-352). T cells were aliquoted and cryopreserved for future use in Cryostor® CS10 (StemCell Technologies Cat.07930).
  • T cells were plated at a density of 1.0 x 10 ⁇ 6 cells/mL in T cell growth media (TCGM) composed of CTS OpTmizer T Cell Expansion SFM and T Cell Expansion Supplement (ThermoFisher Cat.
  • TCGM T cell growth media
  • T cells were rested in this media for 24 hours, at which time they were activated with T Cell TransActTM human reagent (Miltenyi, Cat.130-111- 160) added at a 1:100 ratio by volume.
  • T cells were activated for 48 hours prior to electroporation.
  • 12.2 T cell editing with RNA electroporation [00494] Solutions containing mRNAs encoding BC22n (SEQ ID NO: 804 or 805) and UGI (SEQ ID NO: 807 or 808) were prepared in P3 buffer.100 ⁇ M CIITA targeting sgRNAs were removed from their storage plates and denatured for 2 minutes at 95 °C and incubated at room temperature for 5 minutes. Forty-eight hours post activation, T cells were harvested, centrifuged, and resuspended at a concentration of 12.5 x 10 ⁇ 6 T cells/mL in P3 electroporation buffer (Lonza).
  • Each sgRNA was serially diluted in ratio of 1:2 in P3 electroporation buffer starting from 60 pmols in a 96-well PCR plate in duplicate. Following dilution, 1 x 10 ⁇ 5 T cells, 20 ng/ ⁇ L of BC22n mRNAs, and 20 ng/ ⁇ L of UGI mRNA were mixed with sgRNA plate to make the final volume of 20 ⁇ L of P3 electroporation buffer. This mix was transferred to 4 corresponding 96-well NucleofectorTM plates and electroporated using the manufacturer’s pulse code.
  • Electroporated T cells were immediately rested in 80 ⁇ L of CTS Optimizer T cell growth media without cytokines for 15 minutes before being transferred to new flat-bottom 96-well plates containing an additional 80 ⁇ L of CTS OpTmizer T cell growth media supplemented with 2X cytokines. The resulting plates were incubated at 37 oC for 7 days. On day 4 post-electroporation, cells were split 1:2 in two U-bottom plates, and one plate was collected for NGS sequencing, while the other plate was replenished with CTS Optimizer fresh media with 1X cytokines. This plate was used for flow cytometry on Day 7.
  • T cells were assayed by flow cytometry to determine surface expression of HLA-DR, DP, DQ. Briefly, T cells were incubated for 30 minutes at 4 °C with a mixture of antibodies diluted in cell staining buffer (BioLegend, Cat. No. 420201). Antibodies against CD3 (BioLegend, Cat. No.317336), CD4 (BioLegend, Cat. No. 317434), CD8 (BioLegend, Cat. No.301046), and Viakrome (Beckman Coulter, Cat. No.
  • Example 13 Off-target analysis of CIITA Splice Guides [00497] T Cells from Example 10 were screened for validation of off-target genomic sites targeting CIITA and was performed according to the Integrated DNA Technologies, IDT rhAmpSeq rhPCR Protocol. In this experiment, 3 sgRNA targeting CIITA were screened for validation of off-target profiles. The number of validated off-target sites for sgRNAs targeting CIITA guides (G018082, G018081, and G018034) were shown in Table 22. Off-target sites were validated if the p value was less than 0.05 percent indel. Of the 108 off-target sites identified for the sgRNA targeting G018082, 0 sites were validated.
  • Embodiment 1 is an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10902171-10923242.
  • Embodiment 2 is the engineered cell of embodiment 1, wherein the genetic modification comprises a modification of at least one nucleotide of a splice acceptor site.
  • Embodiment 3 is the engineered cell of embodiment 2, wherein the one nucleotide is A.
  • Embodiment 4 is the engineered cell of embodiment 2, wherein the one nucleotide is G.
  • Embodiment 5 is the engineered cell of embodiment 1, wherein the genetic modification comprises a modification of at least one nucleotide of a splice donor site.
  • Embodiment 6 is the engineered cell of embodiment 5, wherein the one nucleotide is G.
  • Embodiment 7 is the engineered cell of embodiment 5, wherein the one nucleotide is T
  • Embodiment 8 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises a modification of a splice site boundary nucleotide.
  • Embodiment 9 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • Embodiment 10 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates chr16:10902171-10923242.
  • Embodiment 11 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates chr16:10902171-10923242.
  • Embodiment 12 is the engineered cell of embodiment 1, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10903873-10923242.
  • Embodiment 13 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr:16:10906485-10923242.
  • Embodiment 14 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908130-10923242.
  • Embodiment 15 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747-10895767,
  • Embodiment 16 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152 chr16:10908131-10908151 chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492-10906512, chr16:10909006-10909026, and chr16:10922478-10922498.
  • the genetic modification comprises at least one nucleotide of a splic
  • Embodiment 17 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456-10916476, and chr16:10918504-10918524.
  • Embodiment 18 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908132-10908152.
  • Embodiment 19 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10908131-10908151.
  • Embodiment 20 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10916456-10916476.
  • Embodiment 21 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524.
  • Embodiment 22 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742-10895762, chrr16:10
  • Embodiment 23 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219-10923239 chr16:10923221-10923241 chr16:10906486-10906506 chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450-10916470, and chr16:10922153-10922173.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:
  • Embodiment 24 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219-10923239.
  • Embodiment 25 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10918504-10918524.
  • Embodiment 26 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10923218-10923238.
  • Embodiment 27 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chr16:10923219-10923239.
  • Embodiment 28 is an engineered cell, which has reduced or eliminated surface expression of MHC class II relative to an unmodified cell, comprising a genetic modification in the CIITA gene, wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr16:10895410- 10895430, chr16:10898649-10898669, chr16:10898658-10898678, chr16:10902171- 10902191, chr16:10902173-10902193, chr16:10902174-10902194, chr16:10902179- 10902199, chr16:10902183-10902203, chr16:10902184-10902204, chr16:10902644- 10902664, chr16:10902779-10902799, chr16:10902788-10902808, chr16:109027
  • Embodiment 29 is the engineered cell of embodiment 28, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456- 10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512- 10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362- 10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492- 10906512, chr16:10909006-10909026, chr16:10922478-10922498, chr16:10895747- 10895767, chr
  • Embodiment 30 is the engineered cell of embodiment 28, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456- 10916476, chr16:10918504-10918524, chr16:10909022-10909042, chr16:10918512- 10918532, chr16:10918511-10918531, chr16:10895742-10895762, chr16:10916362- 10916382, chr16:10916455-10916475, chr16:10909172-10909192, chr16:10906492- 10906512, chr16:10909006-10909026, and chr16:10922478-10922498.
  • the genetic modification comprises at least one nucleotide of a splice
  • Embodiment 31 is the engineered cell of embodiment 28, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131-10908151, chr16:10916456- 10916476, and chr16:10918504-10918524.
  • Embodiment 32 is the engineered cell of embodiment 28, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219- 10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485- 10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423- 10918443, chr16:10916362-10916382, chr16:10916450-10916470, chr16:10922153- 10922173, chr16:10923222-10923242, chr16:10910176-10910196, chr16:10895742- 10895762, chr16:109
  • Embodiment 33 is the engineered cell of embodiment 28, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, chr16:10923219- 10923239, chr16:10923221-10923241, chr16:10906486-10906506, chr16:10906485- 10906505, chr16:10903873-10903893, chr16:10909172-10909192, chr16:10918423- 10918443, chr16:10916362-10916382, chr16:10916450-10916470, and chr16:10922153- 10922173.
  • the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:109
  • Embodiment 34 is the engineered cell of embodiment 28, wherein the genetic modification comprises at least one nucleotide of a splice site within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218-10923238, and chr16:10923219- 10923239.
  • Embodiment 35 is the engineered cell of any one of embodiments 28-34, wherein the genetic modification comprises at least 5 contiguous nucleotides within the genomic coordinates.
  • Embodiment 36 is the engineered cell of any one of embodiments 28-35, wherein the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within the genomic coordinates.
  • Embodiment 37 is the engineered cell of any one of embodiments 28-36, wherein the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates.
  • Embodiment 38 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10895410-10895430, chr16:10898649- 10898669, chr16:10898658-10898678, chr16:10902171-10902191, chr16:10902173- 10902193, chr16:10902174-10902194, chr16:10902179-10902199, chr16:10902183- 10902203, chr16:10902184-10902204, chr16:10902179-
  • Embodiment 39 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10903873-10903893, chr16:10903878- 10903898 chr16:10903905-10903925 chr16:10903906-10903926 chr16:10904736- 10904756, chr16:10904790-10904810, chr16:10904811-10904831, chr16:10906481- 10906501, chr16:10906485-10906505, chr16:10906486-10906506, chr16:10906487- 10906507, chr16:10906492-10906512, chr16:10908127-10908147
  • Embodiment 40 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10906485-10906505, chr16:10906486- 10906506, chr16:10906487-10906507, chr16:10906492-10906512, chr16:10908127- 10908147, chr16:10908130-10908150, chr16:10908131-10908151, chr16:10908132- 10908152, chr16:10908137-10908157, chr16:10908138-10908158, chr16:10908139- 10908159, chr16:10909006-10909026, chr16:10909007-10909027, chr16:10
  • Embodiment 41 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908130-10908150, chr16:10908131- 10908151, chr16:10908132-10908152, chr16:10908137-10908157, chr16:10908138- 10908158, chr16:10908139-10908159, chr16:10909006-10909026, chr16:10909007- 10909027, chr16:10909018-10909038, chr16:10909021-10909041, chr16:10909022- 10909042, chr16:10909172-10909192, chr16:10910165-10910185, chr16:
  • Embodiment 42 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131- 10908151, chr16:10916456-10916476, chr16:10918504-10918524, chr16:10909022- 10909042, chr16:10918512-10918532, chr16:10918511-10918531, chr16:10895742- 10895762, chr16:10916362-10916382, chr16:10916455-10916475, chr16:10909172- 10909192, chr16:10906492-10906512, chr16:10909006-10909026, chr16:1090900
  • Embodiment 44 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10908132-10908152, chr16:10908131- 10908151, chr16:10916456-10916476, and chr16:10918504-10918524.
  • Embodiment 45 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10908132-10908152.
  • Embodiment 46 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10908131-10908151.
  • Embodiment 47 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10916456-10916476.
  • Embodiment 48 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10918504-10918524.
  • Embodiment 49 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218- 10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486- 10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172- 10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450- 10916470, chr16:10922153-10922173, chr16:10923222-10923242, chr16
  • Embodiment 50 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218- 10923238, chr16:10923219-10923239, chr16:10923221-10923241, chr16:10906486- 10906506, chr16:10906485-10906505, chr16:10903873-10903893, chr16:10909172- 10909192, chr16:10918423-10918443, chr16:10916362-10916382, chr16:10916450- 10916470, and chr16:10922153-10922173.
  • a gene editing system that binds to a CIITA genomic target sequence
  • Embodiment 51 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr16:10918504-10918524, chr16:10923218- 10923238, and chr16:10923219-10923239.
  • Embodiment 52 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10918504-10918524.
  • Embodiment 53 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10923218-10923238.
  • Embodiment 54 is the engineered cell of any one of the preceding embodiments, wherein the MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chr16:10923219-10923239.
  • Embodiment 55 is the engineered cell of any one of embodiments 38-54, wherein the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates.
  • Embodiment 56 is the engineered cell of any one of embodiments 38-55, wherein the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates.
  • Embodiment 57 is the engineered cell of any one of embodiments 38-56, wherein the gene editing system comprises an RNA-guided DNA-binding agent.
  • Embodiment 58 is the engineered cell of embodiment 57, wherein the RNA-guided DNA-binding agent comprises a Cas9 protein, such as an S. pyogenes Cas9.
  • Embodiment 59 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification inactivates a splice site.
  • Embodiment 60 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises a deletion at a splice site nucleotide.
  • Embodiment 61 is the engineered cell of any one of the preceding embodiments, wherein the genetic modification comprises a substitution at a splice site nucleotide.
  • Embodiment 62 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell further has reduced or eliminated surface expression of MHC class I.
  • Embodiment 63 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell comprises a genetic modification in the beta-2-microglobulin (B2M) gene.
  • Embodiment 64 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell comprises a genetic modification in an HLA-A gene.
  • Embodiment 65 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell further comprises an exogenous nucleic acid.
  • Embodiment 66 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell comprises an exogenous nucleic acid encoding a targeting receptor that is expressed on the surface of the engineered cell.
  • Embodiment 67 is the engineered cell of embodiment 66, wherein the targeting receptor is a CAR.
  • Embodiment 68 is the engineered cell of embodiment 66, wherein the targeting receptor is a TCR
  • Embodiment 69 is the engineered cell of embodiment 66, wherein the targeting receptor is a WT1 TCR.
  • Embodiment 70 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell further comprises an exogenous nucleic acid encoding a polypeptide that is secreted by the engineered cell.
  • Embodiment 71 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell is a human cell.
  • Embodiment 72 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell is an immune cell.
  • Embodiment 73 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell is a monocyte, macrophage, mast cell, dendritic cell, or granulocyte.
  • Embodiment 74 is the engineered cell of any one of the preceding embodiments, wherein the engineered cell is a lymphocyte.
  • Embodiment 75 is the engineered cell of embodiment 74, wherein the engineered cell is a T cell.
  • Embodiment 76 is the engineered cell of embodiment 75, wherein the engineered cell further has reduced or eliminated expression of an endogenous T-cell receptor (TCR) protein relative to an unmodified cell.
  • Embodiment 77 is the engineered cell of embodiment 76, wherein the cell has reduced or eliminated expression of a TRAC protein relative to an unmodified cell.
  • Embodiment 78 is the engineered cell of any one of embodiments 76-77, wherein the cell has reduced expression of a TRBC protein relative to an unmodified cell.
  • Embodiment 79 is a pharmaceutical composition comprising the engineered cell of any one of the preceding embodiments.
  • Embodiment 80 is a population of cells comprising the engineered cell of any one of the preceding embodiments.
  • Embodiment 81 is a pharmaceutical composition comprising a population of cells, wherein the population of cells comprises an engineered cell of any one of the preceding embodiments.
  • Embodiment 82 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 65% MHC class II negative as measured by flow cytometry
  • Embodiment 83 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 70% MHC class II negative as measured by flow cytometry.
  • Embodiment 84 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 80% MHC class II negative as measured by flow cytometry.
  • Embodiment 85 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 90% MHC class II negative as measured by flow cytometry.
  • Embodiment 86 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 92% MHC class II negative as measured by flow cytometry.
  • Embodiment 87 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 93% MHC class II negative as measured by flow cytometry.
  • Embodiment 88 is the population of cells of embodiment 80 or pharmaceutical composition of embodiment 81, wherein the population of cells is at least 94% MHC class II negative as measured by flow cytometry.
  • Embodiment 89 is the population of cells or pharmaceutical composition of any of embodiment 80-88, wherein the population of cells is at least 95% endogenous TCR protein negative as measured by flow cytometry.
  • Embodiment 90 is the population of cells or pharmaceutical composition of any of embodiment 80-89, wherein the population of cells is at least 97% endogenous TCR protein negative as measured by flow cytometry.
  • Embodiment 91 is the population of cells or pharmaceutical composition of any of embodiment 80-90, wherein the population of cells is at least 98% endogenous TCR protein negative as measured by flow cytometry.
  • Embodiment 92 is the population of cells or pharmaceutical composition of any of embodiment 80-91, wherein the population of cells is at least 99% endogenous TCR protein negative as measured by flow cytometry.
  • Embodiment 93 is a method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of the preceding embodiments to a subject in need thereof
  • Embodiment 94 is a method of administering the engineered cell, population of cells, or pharmaceutical composition of any one of the preceding embodiments to a subject as an adoptive cell transfer (ACT) therapy.
  • ACT adoptive cell transfer
  • Embodiment 95 is a composition comprising: a) a CIITA guide RNA comprising a guide sequence that i) targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice site, or ii) directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 5 nucleotides or less from a splice site boundary nucleotide; wherein the CIITA guide RNA targets a CIITA genomic target sequence comprising at least 10 contiguous nucleotides within the genomic coordinates chr16:10902171- 10923242.
  • Embodiment 96 is a composition comprising: a) a CIITA guide RNA (gRNA) comprising i) a guide sequence selected from SEQ ID NOs: 1-101; or ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-101; or iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1- 101; or iv) a sequence that comprises 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1; or v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v).
  • gRNA CIITA guide RNA
  • Embodiment 97 is a composition comprising: a) a CIITA guide RNA that is a single-guide RNA (sgRNA) comprising i) a guide sequence selected from SEQ ID NOs: 1- 101; or ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-101; or iii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-101; or iv) a sequence that comprises 10 contiguous nucleotides ⁇ 10 nucleotides of a genomic coordinate listed in Table 1; or v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v).
  • sgRNA single-guide RNA
  • Embodiment 98 is the composition of any one of embodiments 95-97, wherein the CIITA guide RNA is an S. pyogenes Cas9 guide RNA.
  • Embodiment 99 is the composition of any one of embodiments 95-98, further comprising an RNA-guided DNA binding agent or nucleic acid encoding an RNA-guided DNA binding agent.
  • Embodiment 100 is the composition of embodiment 99, wherein the nucleic acid encoding an RNA-guided DNA binding agent is an mRNA that encoding the RNA-guided DNA binding agent.
  • Embodiment 101 is the composition of any one of embodiments 99-100, wherein the RNA-guided DNA binding agent comprises an S. pyogenes Cas9.
  • Embodiment 102 is the composition of any one of embodiments 99-101, wherein the RNA-guided DNA binding agent comprises a deaminase region.
  • Embodiment 103 is the composition of any one of embodiments 99-101, wherein the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.
  • A3A APOBEC3A deaminase
  • Embodiment 104 is the composition of embodiment 103, wherein the RNA-guided nickase is an S. pyogenes Cas9 nickase.
  • Embodiment 105 is the composition of any one of embodiments 102-104, further comprising a uracil glycosylase inhibitor (UGI).
  • Embodiment 106 is the composition of any one of embodiments 102-105, wherein the RNA-guided DNA binding agent generates a cytosine (C) to thymine (T) conversion with the CIITA genomic target sequence.
  • C cytosine
  • T thymine
  • Embodiment 107 is the composition of any one of embodiments 102-105, wherein the RNA-guided DNA binding agent generates an adenine (A) to guanine (G) conversion with the CIITA genomic target sequence.
  • Embodiment 108 is the composition of any one of embodiments 99-107, wherein the CIITA guide RNA targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice acceptor site.
  • Embodiment 109 is the composition of embodiment 108, wherein the one nucleotide is A.
  • Embodiment 110 is the composition of embodiment 108, wherein the one nucleotide is G.
  • Embodiment 111 is the composition embodiment 108, wherein the one nucleotide is the splice site boundary nucleotide at the splice acceptor site.
  • Embodiment 112 is the composition of any one of embodiments 99-107, wherein the CIITA guide RNA targets a CIITA genomic target sequence that comprises at least one nucleotide of a splice donor site.
  • Embodiment 113 is the composition of embodiment 112, wherein the one nucleotide is G.
  • Embodiment 114 is the composition of embodiment 112, wherein the one nucleotide is T.
  • Embodiment 115 is the composition of embodiment 112, wherein the one nucleotide is the splice site boundary nucleotide at the splice donor site.
  • Embodiment 116 is the composition of any one of embodiments 99-115, wherein the CIITA guide RNA comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 4 nucleotides or less from a splice site boundary nucleotide.
  • Embodiment 117 is the composition of any one of embodiments 99-115, wherein the CIITA guide RNA comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 3 nucleotides or less from a splice site boundary nucleotide.
  • Embodiment 118 is the composition of any one of embodiments 99-117, wherein the CIITA guide RNA comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 2 nucleotides or less from a splice site boundary nucleotide.
  • Embodiment 119 is the composition of any one of embodiments 99-118, wherein the CIITA guide RNA comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence that is 1 nucleotide or less from a splice site boundary nucleotide.
  • Embodiment 120 is the composition of any one of embodiments 99-119, wherein the CIITA guide RNA comprises a guide sequence that directs an RNA-guided DNA binding agent to make a cut in a CIITA genomic target sequence at a splice site boundary nucleotide.
  • Embodiment 121 is a method of making an engineered cell, which has reduced or eliminated surface expression of MHC class II protein relative to an unmodified cell, comprising contacting a cell with a composition of any of embodiments 99-120.
  • Embodiment 122 is a method of reducing surface expression of MHC class II protein in an engineered cell relative to an unmodified cell, comprising contacting a cell with a composition of any of embodiments 99-120.
  • Embodiment 123 is the method of any one of embodiments 121-122, further comprising reducing or eliminating the surface expression of MHC class I protein in the cell relative to an unmodified cell.
  • Embodiment 124 is the method of any one of embodiments 121-122, further comprising reducing or eliminating the surface expression of B2M protein in the cell relative to an unmodified cell.
  • Embodiment 125 is the method of any one of embodiments 121-122, further comprising reducing or eliminating the surface expression of HLA-A protein in the cell relative to an unmodified cell.
  • Embodiment 126 is the method of any one of embodiments 122-125, further comprising reducing or eliminating the surface expression of a TCR protein in the cell relative to an unmodified cell.
  • Embodiment 127 is the method of any one of embodiments 122-126, further comprising contacting the cell with an exogenous nucleic acid.
  • Embodiment 128 is the method of embodiment 127, further comprising contacting the cell with an exogenous nucleic acid encoding a targeting receptor.
  • Embodiment 129 is the method of embodiment 127, further comprising contacting the cell with an exogenous nucleic acid encoding a polypeptide that is secreted by the cell.
  • Embodiment 130 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is an allogeneic cell.
  • Embodiment 131 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a primary cell.
  • Embodiment 132 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a CD4+ T cell.
  • Embodiment 133 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a CD8+ T cell.
  • Embodiment 134 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a memory T cell
  • Embodiment 135 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a B cell.
  • Embodiment 136 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a plasma B cell.
  • Embodiment 137 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is memory B cell.
  • Embodiment 138 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a hematopoietic stem cell (HSC).
  • Embodiment 139 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is an activated cell.
  • Embodiment 140 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is a non- activated cell.
  • Embodiment 141 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule.
  • Embodiment 142 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule, wherein the NK cell inhibitor molecule binds to an inhibitory receptor on an NK cell.
  • Embodiment 143 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule, wherein the NK cell inhibitor molecule binds to NKG2A on an NK cell.
  • Embodiment 144 is the engineered cell, population of cells, pharmaceutical composition or method of any one of the preceding embodiments comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule, wherein the NK cell inhibitor molecule is a non-classical MHC class I molecule.
  • Embodiment 145 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule, wherein the NK cell inhibitor molecule is HLA-E.
  • Embodiment 146 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule, wherein the NK cell inhibitor molecule is a fusion protein.
  • Embodiment 147 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid or contacting the cell with an exogenous nucleic acid, wherein the exogenous nucleic acid encodes an NK cell inhibitor molecule, wherein the NK cell inhibitor molecule is a fusion protein comprising HLA-E and B2M.
  • Embodiment 148 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is an antibody or antibody fragment.
  • Embodiment 149 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a full-length IgG antibody.
  • Embodiment 150 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a single chain antibody.
  • Embodiment 151 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a neutralizing antibody.
  • Embodiment 152 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a therapeutic polypeptide.
  • Embodiment 153 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is an enzyme.
  • Embodiment 154 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a cytokine.
  • Embodiment 155 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a chemokine.
  • Embodiment 156 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a polypeptide that is secreted by the cell or contacting the cell with said exogenous nucleic acid, wherein the secreted polypeptide is a fusion protein.
  • Embodiment 157 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a targeting receptor or contacting the cell with an exogenous nucleic acid encoding a targeting receptor, wherein the targeting receptor is a T cell receptor (TCR).
  • TCR T cell receptor
  • Embodiment 158 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a targeting receptor or contacting the cell with an exogenous nucleic acid encoding a targeting receptor, wherein the targeting receptor is a genetically modified TCR.
  • Embodiment 159 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a targeting receptor or contacting the cell with an exogenous nucleic acid encoding a targeting receptor, wherein the targeting receptor is the WT1 TCR.
  • Embodiment 160 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, comprising an exogenous nucleic acid encoding a targeting receptor or contacting the cell with an exogenous nucleic acid encoding a targeting receptor, wherein the targeting receptor is a CAR.
  • Embodiment 161 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA is provided to the cell in a vector.
  • Embodiment 162 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA RNA- guided DNA binding agent is provided to the cell in a vector, optionally in the same vector as the CIITA guide RNA.
  • Embodiment 163 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the exogenous nucleic acid is provided to the cell in a vector.
  • Embodiment 164 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 163, wherein the vector is a viral vector.
  • Embodiment 165 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 163, wherein the vector is a non-viral vector.
  • Embodiment 166 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 164, wherein the vector is a lentiviral vector.
  • Embodiment 167 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of embodiment 164, wherein the vector is an AAV.
  • Embodiment 168 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the guide RNA is provided to the cell in a lipid nucleic acid assembly composition, optionally in the same lipid nucleic acid assembly composition as an RNA-guided DNA binding agent.
  • Embodiment 169 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the exogenous nucleic acid is provided to the cell in a lipid nucleic acid assembly composition.
  • Embodiment 170 is the engineered cell, population of cells, pharmaceutical composition, or method of embodiment 168 or 169, wherein the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP).
  • Embodiment 171 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the exogenous nucleic acid is integrated into the genome of the cell.
  • Embodiment 172 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the exogenous nucleic acid is integrated into the genome of the cell by homologous recombination (HR).
  • HR homologous recombination
  • Embodiment 173 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the exogenous nucleic acid is integrated into a safe harbor locus in the genome of the cell.
  • Embodiment 174 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 1.
  • Embodiment 175 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 2.
  • Embodiment 176 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 3.
  • Embodiment 177 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 4.
  • Embodiment 178 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 5.
  • Embodiment 179 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 6
  • Embodiment 180 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 7.
  • Embodiment 181 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 8.
  • Embodiment 182 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 9.
  • Embodiment 183 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 10.
  • Embodiment 184 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 11.
  • Embodiment 185 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 12.
  • Embodiment 186 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 13.
  • Embodiment 187 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 14.
  • Embodiment 188 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 15.
  • Embodiment 189 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 16.
  • Embodiment 190 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 17
  • Embodiment 191 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 18.
  • Embodiment 192 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 19.
  • Embodiment 193 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 20.
  • Embodiment 194 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 21.
  • Embodiment 195 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 22.
  • Embodiment 196 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 23.
  • Embodiment 197 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 24.
  • Embodiment 198 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 25.
  • Embodiment 199 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 26.
  • Embodiment 200 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 27.
  • Embodiment 201 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 28
  • Embodiment 202 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 29.
  • Embodiment 203 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 30.
  • Embodiment 204 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 31.
  • Embodiment 205 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 32.
  • Embodiment 206 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 33.
  • Embodiment 207 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 34.
  • Embodiment 208 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 35.
  • Embodiment 209 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 36.
  • Embodiment 210 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 37.
  • Embodiment 211 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 38.
  • Embodiment 212 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 39
  • Embodiment 213 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 40.
  • Embodiment 214 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 41.
  • Embodiment 215 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 42.
  • Embodiment 216 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 43.
  • Embodiment 217 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 44.
  • Embodiment 218 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 45.
  • Embodiment 219 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 46.
  • Embodiment 220 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 47.
  • Embodiment 221 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 48.
  • Embodiment 222 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 49.
  • Embodiment 223 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 50
  • Embodiment 224 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 51.
  • Embodiment 225 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 52.
  • Embodiment 226 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 53.
  • Embodiment 227 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 54.
  • Embodiment 228 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 55.
  • Embodiment 229 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 56.
  • Embodiment 230 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 57.
  • Embodiment 231 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 58.
  • Embodiment 232 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 59.
  • Embodiment 233 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 60.
  • Embodiment 234 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 61
  • Embodiment 235 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 62.
  • Embodiment 236 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 63.
  • Embodiment 237 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 64.
  • Embodiment 238 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 65.
  • Embodiment 239 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 66.
  • Embodiment 240 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 67.
  • Embodiment 241 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 68.
  • Embodiment 242 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 69.
  • Embodiment 243 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 70.
  • Embodiment 244 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 71.
  • Embodiment 245 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 72
  • Embodiment 246 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 73.
  • Embodiment 247 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 74.
  • Embodiment 248 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 75.
  • Embodiment 249 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 76.
  • Embodiment 250 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 77.
  • Embodiment 251 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 78.
  • Embodiment 252 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 79.
  • Embodiment 253 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 80.
  • Embodiment 254 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 81.
  • Embodiment 255 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 82.
  • Embodiment 256 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 83
  • Embodiment 257 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 84.
  • Embodiment 258 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 85.
  • Embodiment 259 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 86.
  • Embodiment 260 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 87.
  • Embodiment 261 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 88.
  • Embodiment 262 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 89.
  • Embodiment 263 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 90.
  • Embodiment 264 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 91.
  • Embodiment 265 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 92.
  • Embodiment 266 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 93.
  • Embodiment 267 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 94
  • Embodiment 268 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 95.
  • Embodiment 269 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 96.
  • Embodiment 270 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 97.
  • Embodiment 271 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 98.
  • Embodiment 272 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 99.
  • Embodiment 273 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 100.
  • Embodiment 274 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises SEQ ID NO: 101.
  • Embodiment 275 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification.
  • Embodiment 276 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, wherein the at least one modification includes a 2’-O-methyl (2’-O-Me) modified nucleotide.
  • Embodiment 277 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a phosphorothioate (PS) bond between nucleotides.
  • PS phosphorothioate
  • Embodiment 278 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a 2’-fluoro (2’-F) modified nucleotide.
  • Embodiment 279 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a modification at one or more of the first five nucleotides at the 5’ end of the guide RNA.
  • Embodiment 280 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a modification at one or more of the last five nucleotides at the 3’ end of the guide RNA.
  • Embodiment 281 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a PS bond between the first four nucleotides of the guide RNA.
  • Embodiment 282 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a PS bond between the last four nucleotides of the guide RNA.
  • Embodiment 283 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a 2’-O-Me modified nucleotide at the first three nucleotides at the 5’ end of the guide RNA.
  • Embodiment 284 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the CIITA guide RNA comprises at least one modification, comprising a 2’-O-Me modified nucleotide at the last three nucleotides at the 3’ end of the guide RNA.
  • Embodiment 285 is an engineered cell or population of cells comprising a genetic modification that includes an indel within the genomic region targeted by the CIITA guide RNA of any of the preceding embodiments.
  • Embodiment 286 is an engineered cell or population of cells comprising a genetic modification that includes a C to T substitution or an A to G substitution within the genomic region targeted by the CIITA guide RNA of any of the preceding embodiments.
  • Embodiment 287 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, for use to express a TCR with specificity for a polypeptide expressed by cancer cells.
  • Embodiment 288 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, for use in administering to a subject as an adoptive cell transfer (ACT) therapy.
  • ACT adoptive cell transfer
  • Embodiment 289 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, for use in treating a subject with cancer.
  • Embodiment 290 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, for use in treating a subject with an infectious disease.
  • Embodiment 291 is the engineered cell, population of cells, composition, pharmaceutical composition, or method of any one of the preceding embodiments, for use in treating a subject with an autoimmune disease.
  • Embodiment 292 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification comprises an indel.
  • Embodiment 293 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification comprises a C to T substitution.
  • Embodiment 294 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the genetic modification comprises an A to G substitution.
  • Embodiment 295 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell is homozygous for HLA-B and homozygous for HLA-C.
  • Embodiment 296 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell further comprises a genetic modification in an HLA-A gene wherein the cell is homozygous for HLA- B and homozygous for HLA-C, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: a) chr6:29942854 to chr6:29942913 and b) chr6:29943518 to chr6: 29943619.
  • Embodiment 297 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864 to chr6: 29942903.
  • Embodiment 298 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29943528 to chr6:29943609.
  • Embodiment 299 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:29943589
  • Embodiment 300 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the cell further comprises a genetic modification in an HLA-A gene, and wherein the genetic modification in the HLA-A gene comprises an indel, a C to T substitution, or an A to G substitution within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569;
  • Embodiment 301 is the engineered cell, population of cells, pharmaceutical composition or method of any one of the preceding embodiments wherein the HLA-A expression of the cell is reduced or eliminated by a gene editing system that binds to an HLA- A genomic target sequence comprising at least 5 contiguous nucleotides within the genomic coordinates chosen from: chr6:29942864-29942884; chr6:29942868-29942888; chr6:29942876-29942896; chr6:29942877-29942897; chr6:29942883-29942903; chr6:29943126-29943146; chr6:29943528-29943548; chr6:29943529-29943549; chr6:29943530-29943550; chr6:29943537-29943557; chr6:29943549-29943569; chr6:
  • Embodiment 302 is a method of making an engineered cell, which has reduced or eliminated surface expression of MHC class II protein and HLA-A protein relative to an unmodified cell, comprising: a) contacting the cell with a CIITA guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-101; b) contacting the cell with an HLA-A guide RNA, wherein the HLA-A guide RNA comprises a guide sequence selected from any one of SEQ ID NOs: 2001-2095; and c) optionally contacting the cell with an RNA-guided DNA binding agent or nucleic acid encoding an RNA-guided DNA binding agent; thereby reducing or eliminating the surface expression of MHC class II protein and HLA-A protein in the cell relative to an unmodified cell.
  • Embodiment 303 is the method of the immediately preceding embodiment, comprising contacting the cell with an RNA-guided DNA binding agent or nucleic acid encoding an RNA-guided DNA binding agent, optionally wherein the RNA-guided DNA binding agent comprises an S. pyogenes Cas9.
  • Embodiment 304 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B is selected from any one of the following HLA-B alleles: HLA-B*07:02; HLA-B*08:01; HLA- B*44:02; HLA-B*35:01; HLA-B*40:01; HLA-B*57:01; HLA-B*14:02; HLA-B*15:01; HLA-B*13:02; HLA-B*44:03; HLA-B*38:01; HLA-B*18:01; HLA-B*44:03; HLA-B*51:01; HLA-B*49:01; HLA-B*15:01; HLA-B*18:01; HLA-B*27:05; HLA-B*35:03; HLA-B*18:01; HLA-B*52:01; HLA-B*51:
  • Embodiment 305 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-C is selected from any one of the following HLA-C alleles: HLA-C*07:02; HLA-C*07:01; HLA- C*05:01; HLA-C*04:01 HLA-C*03:04; HLA-C*06:02; HLA-C*08:02; HLA-C*03:03; HLA- C*06:02; HLA-C*16:01; HLA-C*12:03; HLA-C*07:01; HLA-C*04:01; HLA-C*15:02; HLA-C 07:01; HLA-C 03:04; HLA-C 12:03; HLA-C 02:02; HLA-C 04:01; HLA-C 05:01; HLA-C*12:02; HLA-C*14:02; HLA-C
  • Embodiment 306 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B allele is selected from any one of the following HLA-B alleles: HLA-B*07:02; HLA-B*08:01; HLA- B*44:02; HLA-B*35:01; HLA-B*40:01; HLA-B*57:01; HLA-B*14:02; HLA-B*15:01; HLA-B*13:02; HLA-B*44:03; HLA-B*38:01; HLA-B*18:01; HLA-B*44:03; HLA-B*51:01; HLA-B*49:01; HLA-B*15:01; HLA-B*18:01; HLA-B*27:05; HLA-B*35:03; HLA-B*18:01; HLA-B*52:01; HLA-B*
  • Embodiment 307 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B and HLA-C alleles are selected from any one of the following HLA-B and HLA-C alleles: HLA- B*07:02 and HLA-C*07:02; HLA-B*08:01 and HLA-C*07:01; HLA-B*44:02 and HLA- C*05:01; HLA-B*35:01 and HLA-C*04:01; HLA-B*40:01 and HLA-C*03:04; HLA- B*57:01 and HLA-C*06:02; HLA-B*14:02 and HLA-C*08:02; HLA-B*15:01 and HLA- C*03:03; HLA-B*13:02 and HLA-C*06:02; HLA-B*44:03 and HLA-C*16:01; HLA-B and HLA
  • Embodiment 308 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02.
  • Embodiment 309 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01.
  • Embodiment 310 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01.
  • Embodiment 311 is the engineered cell, population of cells, pharmaceutical composition, or method of any one of the preceding embodiments, wherein the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01. [00811] Table 23.
  • mA nucleotide that has been modified with 2’-O-Me.
  • mU nucleotide that has been modified with 2’-O-Me.
  • a “*” is used to depict a PS modification.
  • A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a PS bond.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US2021/062946 2020-12-11 2021-12-10 Compositions and methods for reducing mhc class ii in a cell Ceased WO2022125982A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
CN202180090184.3A CN116802274A (zh) 2020-12-11 2021-12-10 用于减少细胞中ii类mhc的组合物和方法
CA3204997A CA3204997A1 (en) 2020-12-11 2021-12-10 Compositions and methods for reducing mhc class ii in a cell
AU2021396403A AU2021396403A1 (en) 2020-12-11 2021-12-10 Compositions and methods for reducing mhc class ii in a cell
EP21852082.3A EP4259783A1 (en) 2020-12-11 2021-12-10 Compositions and methods for reducing mhc class ii in a cell
CR20230303A CR20230303A (es) 2020-12-11 2021-12-10 Composiciones y métodos para reducir el mhc de clase ii en una célula
KR1020237022783A KR20230130635A (ko) 2020-12-11 2021-12-10 세포에서 mhc 클래스 ii를 감소시키기 위한 조성물및 방법
IL303505A IL303505A (en) 2020-12-11 2021-12-10 Compositions and methods for reducing mhc class ii in a cell
JP2023534899A JP2023552816A (ja) 2020-12-11 2021-12-10 細胞内のmhcクラスiiを低減する組成物及び方法
MX2023006878A MX2023006878A (es) 2020-12-11 2021-12-10 Composiciones y métodos para reducir el mhc de clase ii en una célula.
US18/332,390 US20240016934A1 (en) 2020-12-11 2023-06-09 Compositions and Methods for Reducing MHC Class II in a Cell
CONC2023/0008922A CO2023008922A2 (es) 2020-12-11 2023-07-05 Composiciones y métodos para reducir el mhc de clase ii en una célula

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202063124064P 2020-12-11 2020-12-11
US63/124,064 2020-12-11
US202063130106P 2020-12-23 2020-12-23
US63/130,106 2020-12-23

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/332,390 Continuation US20240016934A1 (en) 2020-12-11 2023-06-09 Compositions and Methods for Reducing MHC Class II in a Cell

Publications (1)

Publication Number Publication Date
WO2022125982A1 true WO2022125982A1 (en) 2022-06-16

Family

ID=80168106

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/062946 Ceased WO2022125982A1 (en) 2020-12-11 2021-12-10 Compositions and methods for reducing mhc class ii in a cell

Country Status (13)

Country Link
US (1) US20240016934A1 (cg-RX-API-DMAC7.html)
EP (1) EP4259783A1 (cg-RX-API-DMAC7.html)
JP (1) JP2023552816A (cg-RX-API-DMAC7.html)
KR (1) KR20230130635A (cg-RX-API-DMAC7.html)
AU (1) AU2021396403A1 (cg-RX-API-DMAC7.html)
CA (1) CA3204997A1 (cg-RX-API-DMAC7.html)
CL (2) CL2023001688A1 (cg-RX-API-DMAC7.html)
CO (1) CO2023008922A2 (cg-RX-API-DMAC7.html)
CR (1) CR20230303A (cg-RX-API-DMAC7.html)
IL (1) IL303505A (cg-RX-API-DMAC7.html)
MX (1) MX2023006878A (cg-RX-API-DMAC7.html)
TW (1) TW202235617A (cg-RX-API-DMAC7.html)
WO (1) WO2022125982A1 (cg-RX-API-DMAC7.html)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023250512A1 (en) * 2022-06-23 2023-12-28 Chroma Medicine, Inc. Compositions and methods for epigenetic regulation of ciita expression
WO2024107742A1 (en) * 2022-11-14 2024-05-23 WUGEN, Inc. Hypoimmunogenic cells having targeted modifications in mhc class-i genes and methods of use
WO2024159713A1 (zh) * 2023-01-30 2024-08-08 南京北恒生物科技有限公司 用于CRISPR-Cas基因编辑系统的方法及组合物
WO2025038637A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying transforming growth factor beta receptor type 2 (tgfβr2)
WO2025038646A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Cd70 car-t compositions and methods for cell-based therapy
WO2025038642A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying cd70
WO2025038648A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying transforming growth factor beta receptor type 2 (tgfβr2)
WO2025049481A1 (en) * 2023-08-28 2025-03-06 Intellia Therapeutics, Inc. Methods of editing an hla-a gene in vitro
WO2025049432A1 (en) * 2023-08-28 2025-03-06 Intellia Therapeutics, Inc. Methods for editing hla-a in cells pre-screened for the absence of one or both alleles of hla-h*01
WO2025128871A2 (en) 2023-12-13 2025-06-19 Renagade Therapeutics Management Inc. Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents
WO2025255308A1 (en) 2024-06-07 2025-12-11 Intellia Therapeutics, Inc. Cd8 co-receptor chimeric polypeptides in tcr cell therapy

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102740042B1 (ko) 2023-07-12 2024-12-06 ㈜바이오솔빅스 인간 전분화능 줄기세포로 유래된 심장 오가노이드 제조방법, 효능 및 독성 평가 기술

Citations (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993013121A1 (en) 1991-12-24 1993-07-08 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
WO1995032305A1 (en) 1994-05-19 1995-11-30 Dako A/S Pna probes for detection of neisseria gonorrhoeae and chlamydia trachomatis
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
WO2014040370A1 (en) 2012-09-12 2014-03-20 Shanghai Sidansai Biotechnology Co., Ltd Transcription Activator-Like Effector Assembly
US20140186958A1 (en) 2012-12-12 2014-07-03 Feng Zhang Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US8889356B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US9023649B2 (en) 2012-12-17 2015-05-05 President And Fellows Of Harvard College RNA-guided human genome engineering
US20150166980A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Fusions of cas9 domains and nucleic acid-editing domains
WO2016010840A1 (en) 2014-07-16 2016-01-21 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
EP2990416A1 (en) 2014-08-29 2016-03-02 GEMoaB Monoclonals GmbH Universal chimeric antigen receptor expressing immune cells for targeting of diverse multiple antigens and method of manufacturing the same and use of the same for treatment of cancer, infections and autoimmune disorders
US20160312198A1 (en) 2015-03-03 2016-10-27 The General Hospital Corporation Engineered CRISPR-CAS9 NUCLEASES WITH ALTERED PAM SPECIFICITY
WO2017093969A1 (en) * 2015-12-04 2017-06-08 Novartis Ag Compositions and methods for immunooncology
WO2017173054A1 (en) 2016-03-30 2017-10-05 Intellia Therapeutics, Inc. Lipid nanoparticle formulations for crispr/cas components
WO2018073393A2 (en) 2016-10-19 2018-04-26 Cellectis Tal-effector nuclease (talen) -modified allogenic cells suitable for therapy
WO2018107028A1 (en) 2016-12-08 2018-06-14 Intellia Therapeutics, Inc. Modified guide rnas
WO2018208837A1 (en) 2017-05-08 2018-11-15 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
WO2019067992A1 (en) 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. Formulations
WO2019118516A1 (en) * 2017-12-11 2019-06-20 Editas Medicine, Inc. Cpf1-related methods and compositions for gene editing
WO2019147805A2 (en) 2018-01-26 2019-08-01 The Board Of Trustees Of The Leland Stanford Junior University Regulatory t cells targeted with chimeric antigen receptors
WO2019191114A1 (en) 2018-03-27 2019-10-03 The Trustees Of The University Of Pennsylvania Modified immune cells having enhanced function and methods for screening for same
US20190314413A1 (en) * 2017-05-12 2019-10-17 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
WO2019237069A1 (en) 2018-06-08 2019-12-12 Intellia Therapeutics, Inc. Modified guide rnas for gene editing
WO2019237035A1 (en) * 2018-06-08 2019-12-12 Intellia Therapeutics, Inc. Compositions and methods for immunooncology
WO2019238722A1 (en) 2018-06-13 2019-12-19 Gemoab Monoclonals Gmbh Reversed universal chimeric antigen receptor expressing immune cells for targeting of diverse multiple antigens and method of manufacturing the same and use of the same for treatment of cancer, infections and autoimmune disorders
WO2020081568A1 (en) 2018-10-15 2020-04-23 University Of Massachusetts Programmable dna base editing by nme2cas9-deaminase fusion proteins
WO2020081613A1 (en) 2018-10-16 2020-04-23 Intellia Therapeutics, Inc. Compositions and methods for immunotherapy
WO2020092057A1 (en) 2018-10-30 2020-05-07 Yale University Compositions and methods for rapid and modular generation of chimeric antigen receptor t cells
WO2020168317A2 (en) * 2019-02-15 2020-08-20 President And Fellows Of Harvard College Universal donor stem cells and related methods

Patent Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
WO1993013121A1 (en) 1991-12-24 1993-07-08 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
WO1995032305A1 (en) 1994-05-19 1995-11-30 Dako A/S Pna probes for detection of neisseria gonorrhoeae and chlamydia trachomatis
WO2014040370A1 (en) 2012-09-12 2014-03-20 Shanghai Sidansai Biotechnology Co., Ltd Transcription Activator-Like Effector Assembly
US8889356B2 (en) 2012-12-12 2014-11-18 The Broad Institute Inc. CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes
US20140186958A1 (en) 2012-12-12 2014-07-03 Feng Zhang Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US9023649B2 (en) 2012-12-17 2015-05-05 President And Fellows Of Harvard College RNA-guided human genome engineering
US20150166980A1 (en) 2013-12-12 2015-06-18 President And Fellows Of Harvard College Fusions of cas9 domains and nucleic acid-editing domains
WO2016010840A1 (en) 2014-07-16 2016-01-21 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
EP2990416A1 (en) 2014-08-29 2016-03-02 GEMoaB Monoclonals GmbH Universal chimeric antigen receptor expressing immune cells for targeting of diverse multiple antigens and method of manufacturing the same and use of the same for treatment of cancer, infections and autoimmune disorders
US20160312198A1 (en) 2015-03-03 2016-10-27 The General Hospital Corporation Engineered CRISPR-CAS9 NUCLEASES WITH ALTERED PAM SPECIFICITY
US20160312199A1 (en) 2015-03-03 2016-10-27 The General Hospital Corporation Engineered CRISPR-CAS9 Nucleases with Altered PAM Specificity
WO2017093969A1 (en) * 2015-12-04 2017-06-08 Novartis Ag Compositions and methods for immunooncology
WO2017173054A1 (en) 2016-03-30 2017-10-05 Intellia Therapeutics, Inc. Lipid nanoparticle formulations for crispr/cas components
WO2018073393A2 (en) 2016-10-19 2018-04-26 Cellectis Tal-effector nuclease (talen) -modified allogenic cells suitable for therapy
WO2018107028A1 (en) 2016-12-08 2018-06-14 Intellia Therapeutics, Inc. Modified guide rnas
WO2018208837A1 (en) 2017-05-08 2018-11-15 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
US20190314413A1 (en) * 2017-05-12 2019-10-17 Crispr Therapeutics Ag Materials and methods for engineering cells and uses thereof in immuno-oncology
WO2019067992A1 (en) 2017-09-29 2019-04-04 Intellia Therapeutics, Inc. Formulations
WO2019118516A1 (en) * 2017-12-11 2019-06-20 Editas Medicine, Inc. Cpf1-related methods and compositions for gene editing
WO2019147805A2 (en) 2018-01-26 2019-08-01 The Board Of Trustees Of The Leland Stanford Junior University Regulatory t cells targeted with chimeric antigen receptors
WO2019191114A1 (en) 2018-03-27 2019-10-03 The Trustees Of The University Of Pennsylvania Modified immune cells having enhanced function and methods for screening for same
WO2019237069A1 (en) 2018-06-08 2019-12-12 Intellia Therapeutics, Inc. Modified guide rnas for gene editing
WO2019237035A1 (en) * 2018-06-08 2019-12-12 Intellia Therapeutics, Inc. Compositions and methods for immunooncology
WO2019238722A1 (en) 2018-06-13 2019-12-19 Gemoab Monoclonals Gmbh Reversed universal chimeric antigen receptor expressing immune cells for targeting of diverse multiple antigens and method of manufacturing the same and use of the same for treatment of cancer, infections and autoimmune disorders
WO2020081568A1 (en) 2018-10-15 2020-04-23 University Of Massachusetts Programmable dna base editing by nme2cas9-deaminase fusion proteins
WO2020081613A1 (en) 2018-10-16 2020-04-23 Intellia Therapeutics, Inc. Compositions and methods for immunotherapy
WO2020092057A1 (en) 2018-10-30 2020-05-07 Yale University Compositions and methods for rapid and modular generation of chimeric antigen receptor t cells
WO2020168317A2 (en) * 2019-02-15 2020-08-20 President And Fellows Of Harvard College Universal donor stem cells and related methods

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
BADER, G.D. ET AL., BMC BIOINFORMATICS, vol. 4, pages 1 - 27
BAEUERLE ET AL., NATURE COMMUNICATIONS, 2019, pages 2087
BURSET ET AL., NUCLEIC ACIDS RESEARCH, vol. 28, no. 21, 2000, pages 4364 - 4375
CARRINGTON ET AL., CELLS, vol. 9, 2020, pages 1690
CONTICELLO ET AL., MOL. BIOL. EVOL., vol. 22, 2005, pages 367 - 77
CONTICELLO, GENOME BIOL, vol. 9, 2008, pages 229
DEUSE ET AL., NATURE BIOTECHNOLOGY, vol. 37, 2019, pages 252 - 258
GILBERT ET AL.: "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes", CELL, vol. 154, 2013, pages 442 - 51, XP055115843, DOI: 10.1016/j.cell.2013.06.044
GREENSAMBROOK: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS
HAMMING, R.W., BELL SYST. TECH. J., vol. 29, pages 147 - 160
KARIKO ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, no. 21, pages e142
LANGMEAD, B.SALZBERG, S.L., NAT. METHODS, vol. 13, pages 966 - 967
MAKAROVA ET AL., NAT REV MICROBIOL, vol. 13, no. 11, 2015, pages 722 - 36
MAKAROVA ET AL., NAT REVMICROBIOL, vol. 13, no. 11, 2015, pages 722 - 36
MAKAROVA ET AL., NAT. REV. MICROBIOL, vol. 13, 2015, pages 722 - 36
MAKAROVA ET AL., NAT. REV. MICROBIOL., vol. 9, 2011, pages 467 - 477
MALI ET AL.: "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering", NAT. BIOTECHNOL., vol. 31, 2013, pages 833 - 8, XP055693153, DOI: 10.1038/nbt.2675
MURAMATSU ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 18470 - 6
NEITZEL H: "A routine method for the establishment of permanent growing lymphoblastoid cell lines", HUM GENET, vol. 73, no. 4, 1986, pages 320 - 6
PEREZ-PINERA ET AL.: "RNA-guided gene activation by CRISPR-Cas9-based transcription factors", NAT. METHODS, vol. 10, 2013, pages 973 - 6, XP055181249, DOI: 10.1038/nmeth.2600
QI ET AL.: "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression", CELL, vol. 152, 2013, pages 1173 - 83, XP055346792, DOI: 10.1016/j.cell.2013.02.022
SCHELLENBERGER ET AL.: "A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner", NAT. BIOTECHNOL., vol. 27, 2009, pages 1186 - 1190
SHIINA ET AL., NATURE, vol. 54, 2009, pages 15 - 39
SHMAKOV ET AL., MOLECULAR CELL, vol. 60, 2015, pages 385 - 397
STARK, C. ET AL., NUCLEIC ACIDS RES., vol. 34, pages 535 - 539
SWARTS ET AL., NATURE, vol. 507, no. 7491, 2014, pages 258 - 261
VESTERWENGEL, BIOCHEMISTRY, vol. 43, no. 42, 2004, pages 13233 - 41
ZETSCHE ET AL., CELL, vol. 163, 2015, pages 1 - 13
ZHOU, Y. ET AL., NAT. COMM., vol. 10, pages 1523

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023250512A1 (en) * 2022-06-23 2023-12-28 Chroma Medicine, Inc. Compositions and methods for epigenetic regulation of ciita expression
WO2024107742A1 (en) * 2022-11-14 2024-05-23 WUGEN, Inc. Hypoimmunogenic cells having targeted modifications in mhc class-i genes and methods of use
WO2024159713A1 (zh) * 2023-01-30 2024-08-08 南京北恒生物科技有限公司 用于CRISPR-Cas基因编辑系统的方法及组合物
WO2025038637A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying transforming growth factor beta receptor type 2 (tgfβr2)
WO2025038646A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Cd70 car-t compositions and methods for cell-based therapy
WO2025038642A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying cd70
WO2025038648A1 (en) 2023-08-14 2025-02-20 Intellia Therapeutics, Inc. Compositions and methods for genetically modifying transforming growth factor beta receptor type 2 (tgfβr2)
WO2025049481A1 (en) * 2023-08-28 2025-03-06 Intellia Therapeutics, Inc. Methods of editing an hla-a gene in vitro
WO2025049432A1 (en) * 2023-08-28 2025-03-06 Intellia Therapeutics, Inc. Methods for editing hla-a in cells pre-screened for the absence of one or both alleles of hla-h*01
WO2025128871A2 (en) 2023-12-13 2025-06-19 Renagade Therapeutics Management Inc. Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents
WO2025255308A1 (en) 2024-06-07 2025-12-11 Intellia Therapeutics, Inc. Cd8 co-receptor chimeric polypeptides in tcr cell therapy

Also Published As

Publication number Publication date
KR20230130635A (ko) 2023-09-12
CL2023003085A1 (es) 2024-05-03
CA3204997A1 (en) 2022-06-16
AU2021396403A1 (en) 2023-06-29
CL2023001688A1 (es) 2024-01-05
US20240016934A1 (en) 2024-01-18
EP4259783A1 (en) 2023-10-18
CR20230303A (es) 2023-09-01
CO2023008922A2 (es) 2023-08-18
JP2023552816A (ja) 2023-12-19
TW202235617A (zh) 2022-09-16
IL303505A (en) 2023-08-01
MX2023006878A (es) 2023-07-31

Similar Documents

Publication Publication Date Title
US20240016934A1 (en) Compositions and Methods for Reducing MHC Class II in a Cell
US20240139323A1 (en) Compositions and Methods for Genetically Modifying CIITA in a Cell
US20240024478A1 (en) Compositions and Methods for Reducing HLA-A in a Cell
US20250262302A1 (en) Compositions and Methods for Reducing MHC Class I in a Cell
US20250276017A1 (en) Compositions and Methods for Genomic Editing
CN116802274A (zh) 用于减少细胞中ii类mhc的组合物和方法
HK40096627A (zh) 用於减少细胞中ii类mhc的组合物和方法
WO2025038642A1 (en) Compositions and methods for genetically modifying cd70
HK40126949A (zh) 用於减少细胞中的mhc i类的组合物和方法
HK40094124A (zh) 用於细胞中基因修饰ciita的组合物和方法
CN116783285A (zh) 用于细胞中基因修饰ciita的组合物和方法
CN121986166A (en) Compositions and methods for genetic modification of CD70
HK40099255A (zh) 用於减少细胞中hla-a的组合物和方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21852082

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023534899

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 3204997

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/006878

Country of ref document: MX

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023011401

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2021396403

Country of ref document: AU

Date of ref document: 20211210

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202317044116

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: NC2023/0008922

Country of ref document: CO

WWE Wipo information: entry into national phase

Ref document number: 202180090184.3

Country of ref document: CN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021852082

Country of ref document: EP

Effective date: 20230711

WWP Wipo information: published in national office

Ref document number: NC2023/0008922

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112023011401

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230609

WWE Wipo information: entry into national phase

Ref document number: 523441239

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523441239

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523441239

Country of ref document: SA

WWW Wipo information: withdrawn in national office

Ref document number: 1020237022783

Country of ref document: KR

WWW Wipo information: withdrawn in national office

Ref document number: 202391711

Country of ref document: EA