WO2022119229A1 - Composition employing scirpus karuizawensis extract for alleviation of atopic dermatitis - Google Patents

Composition employing scirpus karuizawensis extract for alleviation of atopic dermatitis Download PDF

Info

Publication number
WO2022119229A1
WO2022119229A1 PCT/KR2021/017457 KR2021017457W WO2022119229A1 WO 2022119229 A1 WO2022119229 A1 WO 2022119229A1 KR 2021017457 W KR2021017457 W KR 2021017457W WO 2022119229 A1 WO2022119229 A1 WO 2022119229A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
atopic dermatitis
extract
food
present
Prior art date
Application number
PCT/KR2021/017457
Other languages
French (fr)
Korean (ko)
Inventor
안은경
홍성수
고혜진
황민희
정연우
Original Assignee
재단법인 경기도경제과학진흥원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 경기도경제과학진흥원 filed Critical 재단법인 경기도경제과학진흥원
Publication of WO2022119229A1 publication Critical patent/WO2022119229A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/89—Cyperaceae (Sedge family)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9794—Liliopsida [monocotyledons]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat

Definitions

  • the present invention relates to a composition for improving atopic dermatitis using an extract of Scirpus karuizawensis .
  • Atopic dermatitis is a recurrent chronic skin disease that occurs frequently in infancy, but it may persist into adulthood or may develop newly in adulthood, and its prevalence is increasing recently (Kor J Pharmacogn., 43:59-65, 2012). ). Atopic dermatitis is characterized by symptoms such as pruritus, dry skin, hyperfollicular hyperplasia, cheilitis, lichenification, and eczema-like lesions (Korean J Invest Dermatol., 14:67-72, 2007).
  • the immune system which is the body's defense mechanism against external invasion, is made mainly by the activation of T cells.
  • Cytokines such as IL-2, IFN- ⁇ , and TNF produced by Th1 cells induce the differentiation of Th1 cells and inhibit the proliferation and differentiation of Th2 cells, whereas IL-4, IL-5, and IL produced by Th2 cells Cytokines such as -6, IL-10, and IL-13 induce proliferation and differentiation of Th2 cells and inhibit Th1 cell differentiation (J Am Acad Dermatol., 44, S1-S12, 2001).
  • the immune response is maintained by balancing the interaction between Th1 cells and Th2 cells, but in atopic dermatitis, the conversion of T cells to Th2 cells is promoted and the increased Th2 secretes a large amount of cytokines to induce IgE production. and induces hypersensitivity reaction by inducing mast cell and eosinophil differentiation (J Clin Invest. 113(5):651-7, 2004; J Allergy Clin Immunol. 2003;112(2): 252-62; Kor J Pharmacogn, 43:59-65, 2012).
  • Chemokines are small-molecular proteins that exhibit chemoattractants and are divided into four types, C, CC, CXC and CX3C, depending on their structure and function. and migration, and Th1/Th2 balance regulation.
  • TARC Thymus & activation-regulated chemokine
  • MDC macrophage-derived chemokine
  • the present invention was completed by confirming that the pine cone extract inhibited the expression of MDC and TARC when treated with INF- ⁇ and TNF- ⁇ -treated human keratinocytes, HaCaT cells.
  • the present invention has been completed by confirming that the pine cone extract inhibits the expression of MDC and TARC when treated with HaCaT cells, a human keratinocyte line treated with INF- ⁇ and TNF- ⁇ .
  • the composition for improving atopic dermatitis of the present invention is characterized in that it contains the pine cone extract as an active ingredient.
  • the term "Pinaceae extract” refers to extracting stems, leaves, fruits, flowers, roots, etc. of Pine cones, water, lower alcohols having 1 to 4 carbon atoms (methanol, ethanol, butanol, etc.), methylene chloride, ethylene , acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or a mixed solvent thereof refers to an extract obtained by leaching, an extract obtained by using a supercritical extraction solvent such as carbon dioxide, pentane, or a fraction obtained by fractionating the extract, and the extraction method is cooling, refluxing, considering the polarity of the active material, the degree of extraction, and the degree of preservation.
  • a supercritical extraction solvent such as carbon dioxide, pentane, or a fraction obtained by fractionating the extract
  • the meaning of the extract includes a concentrated liquid extract or solid extract from which the extraction solvent has been removed by methods such as freeze drying, vacuum drying, hot air drying, spray drying, and the like.
  • it refers to an extract obtained by using water, ethanol, or a mixed solvent thereof as an extraction solvent, and more preferably an extract obtained by using a mixed solvent of water and ethanol as an extraction solvent.
  • atopic dermatitis is defined to include all diseases classified as atopic dermatitis in the art regardless of the direct or indirect cause of its occurrence.
  • atopic dermatitis is classified into infant type atopic dermatitis, juvenile type atopic dermatitis, adult type atopic dermatitis, and maternal type atopic dermatitis according to the onset time or subject of the invention, in the present specification, atopic dermatitis includes all types of atopic dermatitis .
  • improvement is meant to include treatment, prevention and improvement (relief of symptoms) of atopic dermatitis.
  • the composition for improving atopic dermatitis of the present invention may include the active ingredient in any amount (effective amount) as long as it can exhibit the intended improvement activity of atopic dermatitis, etc., depending on the use, formulation, purpose of formulation, etc.
  • An effective amount will be determined within the range of 0.001% to 15% by weight, based on the total weight of the composition.
  • the term "effective amount” refers to the intended medical and pharmacological effects, such as the improvement of atopic dermatitis, when the composition of the present invention is administered to a mammal, preferably a human, to which it is applied during the administration period as suggested by a medical professional. It refers to the amount of the active ingredient included in the composition of the present invention. Such an effective amount can be determined empirically within the ordinary ability of one of ordinary skill in the art.
  • composition for improving atopic dermatitis of the present invention may further include any compound or natural extract that has already been verified for safety and is known to have atopic dermatitis improving activity for increasing/reinforcing the activity of improving atopic dermatitis. .
  • Enterococcus faecalis heat-treated dry powder which has been individually recognized for the function of 'relieving hypersensitivity immune response' according to the ⁇ Health Functional Food Act ⁇ , complexes such as guava leaf extract, Actinidia extract, leaf extract, pica Complex of Ofreto powder, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), L. sakei Probio 65, which has been individually recognized for its 'improving sensitive skin condition' function, oil containing gamma-linolenic acid, and fruit and vegetable-derived lactic acid bacteria ( L. plantarum CJLP133 ), probiotics ATP, and the like.
  • complexes such as guava leaf extract, Actinidia extract, leaf extract, pica Complex of Ofreto powder, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), L. sakei Probio 65, which has been individually recognized for
  • compositions for improving atopic dermatitis of the present invention may be included in the composition for improving atopic dermatitis of the present invention together with the active ingredient.
  • composition for improving atopic dermatitis of the present invention can be identified as a food composition in a specific embodiment.
  • the composition of the present invention is identified as a food composition, its use may be understood to inhibit allergic skin hypersensitivity reaction.
  • the food composition of the present invention may be prepared in any form, for example, beverages such as tea, juice, carbonated beverages, and ionic beverages, processed oils such as milk and yogurt, gums, rice cakes, Korean sweets, breads, sweets, noodles, etc. Foods, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and health functional food preparations such as bars can be manufactured.
  • beverages such as tea, juice, carbonated beverages, and ionic beverages
  • processed oils such as milk and yogurt, gums, rice cakes, Korean sweets, breads, sweets, noodles, etc.
  • Foods, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and health functional food preparations such as bars can be manufactured.
  • the food composition of the present invention may have any product classification in terms of legal and functional classification as long as it conforms to the enforcement laws at the time of manufacture and distribution.
  • it is a health functional food according to the Korean ⁇ Health Functional Food Act ⁇ , or confectionery, beans, tea, and beverages according to each food type in the Food Ordinance of the Korea ⁇ Food Sanitation Act ⁇ (Ministry of Food and Drug Safety Notification ⁇ Food Standards and Specification ⁇ ) , special purpose food, and the like.
  • the food composition of the present invention may contain food additives in addition to the active ingredients thereof.
  • Food additives can be generally understood as substances that are added and mixed or infiltrated into food in manufacturing, processing, or preserving food.
  • Food additives with guaranteed safety are limited in terms of ingredients or functions in the Food Additives Ordinance in accordance with the laws of each country that regulates the manufacture and distribution of food (“Food Sanitation Act” in Korea).
  • Food Additives Code Food Additive Standards and Specifications” announced by the Ministry of Food and Drug Safety
  • food additives are classified into chemically synthetic products, natural additives, and mixed preparations in terms of ingredients. It is divided into agents, preservatives, emulsifiers, acidulants, thickeners, etc.
  • the sweetener is used to impart appropriate sweetness to food, and both natural and synthetic ones may be used in the composition of the present invention.
  • a natural sweetener is used, and examples of the natural sweetener include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.
  • Flavoring agents may be used to improve taste or aroma, and both natural and synthetic ones may be used. Preferably, it is a case where a natural thing is used. In the case of using a natural product, the purpose of nutritional enhancement in addition to flavor may be concurrently used.
  • the natural flavoring agent may be obtained from apples, lemons, tangerines, grapes, strawberries, peaches, or the like, or obtained from green tea leaves, horseradish leaves, bamboo leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, and ginkgo can be used.
  • the natural flavoring agent may be a liquid concentrate or a solid extract.
  • a synthetic flavoring agent may be used, and the synthetic flavoring agent may be an ester, an alcohol, an aldehyde, a terpene, or the like.
  • sodium calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), etc. can be used, and as an emulsifier, acacia gum, carboxymethylcellulose, xanthan gum, Pectin, etc. are mentioned, and acidulant, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, etc. can be used as an acidulant.
  • the acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing the taste.
  • a thickening agent As a thickening agent, a suspending agent, a settling agent, a gel former, a bulking agent, etc. can be used.
  • the food composition of the present invention may contain, in addition to the food additives described above, physiologically active substances or minerals known in the art for the purpose of supplementing and reinforcing functionality and nutrition and guaranteed stability as food additives.
  • physiologically active substances include catechins contained in green tea and the like, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoylthiamine, and the like.
  • Minerals include calcium preparations such as calcium citrate, magnesium stearate
  • Magnesium preparations, such as iron preparations, such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, etc. are mentioned.
  • the food additives as described above may be included in an appropriate amount to achieve the purpose of the addition according to the product type.
  • composition of the present invention may be regarded as a pharmaceutical composition in another specific embodiment.
  • the pharmaceutical composition of the present invention may be prepared as an oral dosage form or a parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient.
  • the route of administration may be any suitable route including topical route, oral route, intravenous route, intramuscular route, and direct absorption through mucosal tissue, and two or more routes may be used in combination.
  • An example of the combination of two or more routes is a case in which two or more formulations of drugs according to the route of administration are combined. For example, one drug is first administered by an intravenous route and the other drug is secondarily administered by a local route.
  • Pharmaceutically acceptable carriers are well known in the art depending on the route of administration or formulation, and specifically, reference may be made to the pharmacopoeia of each country including the "Korea Pharmacopoeia”.
  • suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Cellulose such as hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil, ethanol, glycerol and the like.
  • suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Cellulose such as hydroxypropylmethylcellulose, polyvinylpyr
  • binders include starch, magnesium aluminum silicate, starch ferrist, gelatin, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone, glucose, corn sweetener, sodium alginate, polyethylene glycol, wax, and the like, and oleic acid as lubricant.
  • the disintegrating agent is starch, methyl cellulose , agar, bentonite, xanthan gum, starch, alginic acid or its sodium salt.
  • the diluent include lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, and the like.
  • the pharmaceutical composition of the present invention When the pharmaceutical composition of the present invention is prepared for parenteral use, it may be formulated in the form of injections, transdermal administrations, nasal inhalants and suppositories together with suitable carriers according to methods known in the art.
  • suitable carriers for aqueous isotonic solution or suspension
  • PBS phosphate buffered saline
  • isotonic solution such as 5% dextrose
  • formulated for transdermal administration When formulated for transdermal administration, it can be formulated in the form of an ointment, a cream, a lotion, a gel, an external solution, a pasta agent, a liniment agent, an air roll, and the like.
  • a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, and the like.
  • tween 61 polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like can be used.
  • a preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, severity of the patient, and the route of administration. It can be in the range /kg. Administration may be performed once or divided into several times a day. These dosages should not be construed as limiting the scope of the invention in any respect.
  • the composition of the present invention can be identified as a cosmetic composition.
  • a cosmetic composition its use may be understood as a use for suppressing allergic skin troubles, alleviating allergic skin irritation, and the like.
  • the cosmetic composition can be classified into any product in terms of its use or by law, and specifically functional cosmetics, non-functional products having uses such as improvement of skin troubles and improvement of atopic dermatitis It may be general cosmetics and the like.
  • product form it may take any product form, and specifically, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax It can take the form of products such as foundation and spray.
  • it may be in the form of a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.
  • the cosmetic composition of the present invention may include components commonly used in cosmetic compositions in addition to the active ingredient, for example, conventional adjuvants such as stabilizers, solubilizers, surfactants, vitamins, pigments and fragrances, and carriers.
  • conventional adjuvants such as stabilizers, solubilizers, surfactants, vitamins, pigments and fragrances, and carriers.
  • the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.
  • lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component.
  • a solvent, solubilizer or emulsifier is used as a carrier component, specifically water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid ester of sorbitan, etc. may be used.
  • the formulation of the present invention is a suspension
  • a liquid diluent such as water, ethanol or propylene glycol
  • a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, polyoxyethylene sorbitan ester, microcrystals
  • cellulose aluminum metahydroxide, bentonite, agar, etc.
  • the formulation of the present invention is a surfactant-containing cleansing agent
  • Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative or ethoxylated glycerol fatty acid ester and the like may be used.
  • the cosmetic composition of the present invention can be prepared according to a method for preparing a cosmetic composition conventionally performed in the art, except that it contains an active ingredient that exhibits atopic dermatitis improving activity.
  • composition for improving atopic dermatitis of the present invention may be commercialized as food, cosmetics, drugs, etc. for the purpose of improving atopic dermatitis.
  • 1 is a result showing the inhibitory activity of MDC and TARC expression of pine cone extract in HaCaT cells, a human keratinocyte line treated with INF- ⁇ and TNF- ⁇ .
  • HaCaT cells were cultured in a 6-well plate at 1 ⁇ 10 6 cells/well, and then treated with IFN- ⁇ (10 ng/ml), TNF- ⁇ (10 ng/ml) and the samples of Examples at different concentrations and cultured for 18 hours. did. After washing twice with PBS, Trizol (Invitrogen) was added to dissolve the cells, chloroform was added, and centrifugation was performed at 13000 rpm for 15 minutes to obtain a supernatant. The supernatant and isopropanol were mixed and reacted to precipitate RNA, and then washed once with ethanol to isolate RNA.
  • IFN- ⁇ 10 ng/ml
  • TNF- ⁇ 10 ng/ml
  • cDNA was synthesized according to the manufacturer's protocol using the Superscript kit (Invitrogen), which is a reverse transcription chain polymerization reaction kit. Specifically, the reverse transcription reaction was performed using 3 ⁇ g of total RNA with oligo(dT)20 primer, dNTP (50 ng/ml), 1 unit RNase OUT and Superscript III reverse transcriptase (200 U/ml) at 65°C for 5 minutes, 40°C for 5 minutes. , 50 °C 50 min, and 85 °C for 15 min.
  • Superscript kit Invitrogen
  • PCR polymerase chain reaction
  • 10 pM 5' and 3' primers were mixed to amplify MDC, TARC, and GAPDH from the synthesized cDNA, and the whole was washed with distilled water.
  • 95 °C 45 sec, 55 °C 45 sec, 72 °C 2 min was set for 35 cycle reaction.
  • the primer sequences used are shown in [Table 1] below.
  • the expression level was compared on an agarose gel. The results are shown in [Fig. 1].
  • the results of [Fig. 1] show that the pine cone extract inhibited the expression of MDC and TARC in proportion to the treatment concentration.
  • dexamethasone 100 ⁇ M
  • primer MDC F GCATGGCTCGCCTACAGACT (SEQ ID NO: 1)
  • R GCAGGGAGGGAGGCAGAGGA
  • TARC F ATGGCCCCACTGAAGATGCT (SEQ ID NO: 3)
  • R TGAACACCAACGGTGGAGGT (SEQ ID NO: 4)
  • GAPDH F GAGTCAACGGATTTGGTCGT (SEQ ID NO: 5)
  • R GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 6)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Dermatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Medical Informatics (AREA)
  • Nutrition Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Birds (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

Disclosed is a composition for alleviation of atopic dermatitis, the composition employing a Scirpus karuizawensis extract which exhibits inhibitory activity against the expression of MDC and TARC when applied to the human keratinocyte cell line HaCat treated with INF-γ and TNF-α.

Description

솔방울고랭이 추출물을 이용한 아토피 피부염 개선용 조성물Composition for improving atopic dermatitis using pine cone extract
본 발명은 솔방울고랭이(Scirpus karuizawensis) 추출물을 이용한 아토피 피부염 개선용 조성물에 관한 것이다.The present invention relates to a composition for improving atopic dermatitis using an extract of Scirpus karuizawensis .
아토피 피부염은 재발성 만성 피부질환으로, 영유아기에서 흔히 발생하지만 성인까지도 지속되거나 성인이 되어서 새롭게 발병할 수도 있으며 최근 그 유병률이 증가하고 있는 추세이다(Kor J Pharmacogn., 43:59-65, 2012). 아토피 피부염은 소양감, 피부 건조증, 모낭 주위 항진, 구순염, 태선화, 습진 양병변 등의 증상을 특징적으로 나타낸다(Korean J Invest Dermatol., 14:67-72, 2007).Atopic dermatitis is a recurrent chronic skin disease that occurs frequently in infancy, but it may persist into adulthood or may develop newly in adulthood, and its prevalence is increasing recently (Kor J Pharmacogn., 43:59-65, 2012). ). Atopic dermatitis is characterized by symptoms such as pruritus, dry skin, hyperfollicular hyperplasia, cheilitis, lichenification, and eczema-like lesions (Korean J Invest Dermatol., 14:67-72, 2007).
아토피 피부염의 원인은 아직까지 명확히 규명되어 있지 않으나, IgE의 비정상적 증가, 세포 면역의 중추적 역할을 담당하는 T 세포의 수적 감소와 기능 저하, 단핵구와 대식세포의 침윤, 비만세포와 호산구의 수적 증가, CD4+ T 림프구 등의 수적 증가 등의 면역학적 요인이 보고되어 있으며(J Invest Dermatol., 96:523-526, 1991; J Invest Dermatol., 97:389-394, 1991; Immunol., 11:81-88, 1999; Curr Drug Targets Inflamm Allergy., 2:199-120, 2003; J Allergy Clin Immunol., 107:871-877, 2001; Adv Immunol., 78:57, 2001; International Immunology, 14(7):767-773, 2002; Pediatr Allergy Immunol., 19:605-613, 2008), 특히 Th1 세포에 비해 Th2 세포의 수적 증가로 인한 Th1/Th2 불균형이 중요한 요인으로 알려져 있다(Kor J Pharmacogn, 43:59-65, 2012). The cause of atopic dermatitis is not yet clearly defined, but an abnormal increase in IgE, a decrease in the number and function of T cells that play a central role in cellular immunity, infiltration of monocytes and macrophages, an increase in the number of mast cells and eosinophils, Immunological factors such as an increase in the number of CD4+ T lymphocytes have been reported (J Invest Dermatol., 96:523-526, 1991; J Invest Dermatol., 97:389-394, 1991; Immunol., 11:81- 88, 1999; Curr Drug Targets Inflamm Allergy., 2:199-120, 2003; J Allergy Clin Immunol., 107:871-877, 2001; Adv Immunol., 78:57, 2001; International Immunology, 14(7) :767-773, 2002; Pediatr Allergy Immunol., 19:605-613, 2008), in particular, Th1/Th2 imbalance due to an increase in the number of Th2 cells compared to Th1 cells is known as an important factor (Kor J Pharmacogn, 43: 59-65, 2012).
인체의 외부 침입에 대한 방어 기작인 면역 체계는 T 세포의 활성화를 중심으로 이루어진다. Th1 세포가 생산하는 IL-2, IFN-γ, TNF 등 사이토카인들은 Th1 세포의 분화를 유도하고 Th2 세포의 증식과 분화를 억제하는 반면, Th2 세포가 생산하는 IL-4, IL-5, IL-6, IL-10, IL-13 등 사이토카인들은 Th2 세포의 증식과 분화를 유도하고 Th1 세포의 분화를 억제한다(J Am Acad Dermatol., 44, S1-S12, 2001). 정상적인 상태에서는 Th1 세포와 Th2 세포 간의 상호작용으로 균형을 이루면서 면역반응을 유지하지만, 아토피 피부염에서는 T 세포의 Th2 세포로의 전환이 촉진되고 증가된 Th2가 많은 양의 사이토카인을 분비시켜 IgE 생성을 증가시키며 비만세포(mast cell)와 호산구 (eosinophil) 분화를 유도시킴으로써 과민반응을 유발한다(J Clin Invest. 113(5):651-7, 2004; J Allergy Clin Immunol. 2003;112(2):252-62; Kor J Pharmacogn, 43:59-65, 2012). The immune system, which is the body's defense mechanism against external invasion, is made mainly by the activation of T cells. Cytokines such as IL-2, IFN-γ, and TNF produced by Th1 cells induce the differentiation of Th1 cells and inhibit the proliferation and differentiation of Th2 cells, whereas IL-4, IL-5, and IL produced by Th2 cells Cytokines such as -6, IL-10, and IL-13 induce proliferation and differentiation of Th2 cells and inhibit Th1 cell differentiation (J Am Acad Dermatol., 44, S1-S12, 2001). In a normal state, the immune response is maintained by balancing the interaction between Th1 cells and Th2 cells, but in atopic dermatitis, the conversion of T cells to Th2 cells is promoted and the increased Th2 secretes a large amount of cytokines to induce IgE production. and induces hypersensitivity reaction by inducing mast cell and eosinophil differentiation (J Clin Invest. 113(5):651-7, 2004; J Allergy Clin Immunol. 2003;112(2): 252-62; Kor J Pharmacogn, 43:59-65, 2012).
케모카인(chemokine)은 저분자 단백질로 화학주성(chemoattractants)을 나타내며 그 구조와 기능에 따라 C, CC, CXC 및 CX3C 등 4 가지로 나누어지는데, 최근 이러한 케모카인들이 면역세포의 발생과 성숙, T 세포의 분화와 이주, Th1/Th2 균형 조절 등에 중요한 역할을 하는 것으로 보고 있다. Chemokines are small-molecular proteins that exhibit chemoattractants and are divided into four types, C, CC, CXC and CX3C, depending on their structure and function. and migration, and Th1/Th2 balance regulation.
다양한 케모카인들 중 TARC(Thymus & activation-regulated chemokine)와 MDC(macrophage-derived chemokine)은 Th2 세포에 작용하는 대표적인 CC 케모카인으로, Th2 세포의 CCR4(CC chemokine receptor 4)에 작용하여 염증 병변으로 Th2 세포의 이동과 침윤을 유도한다(J Clin Invest. 113(5):651-7, 2004; Curr Allergy Asthma Rep. 5(4):284-90, 2005)Among various chemokines, TARC (Thymus & activation-regulated chemokine) and MDC (macrophage-derived chemokine) are representative CC chemokines that act on Th2 cells. induces migration and infiltration of (J Clin Invest. 113(5):651-7, 2004; Curr Allergy Asthma Rep. 5(4):284-90, 2005)
최근 아토피 피부염 환자에서 TARC와 MDC의 혈청 농도가 현저히 증가한다는 보고가 있고(J Allergy Clin Immunol., 113(2):334-340), 아토피 피부염 동물모델에서 TARC와 MDC의 피부발현이 증가된다는 보고가 있으며, 아토피 피부염의 치료 물질로 사용되는 사이크로스포린 A나 코르티코스테로이드를 아토피 피부염 환자에게 투여하였을 때는 MDC 및 TARC의 혈청 농도가 감소한다는 보고가 있다(J Dermatol Sci., 34:201-208, 2004). 또한 시험관내 실험에서 인간각질형성세포주인 HaCaT 세포에 INF-γ나 TNF-α를 처리하였을 때 MDC 및 TARC가 다량 발현되는데 이러한 발현을 억제할 수 있는 물질은 아토피 피부염 치료제로 사용될 수 있음이 제시된 바 있다(Int Immunol., 14(7):767-773, 2002).Recently, it has been reported that the serum concentrations of TARC and MDC are significantly increased in patients with atopic dermatitis (J Allergy Clin Immunol., 113(2):334-340), and that the skin expression of TARC and MDC is increased in an animal model of atopic dermatitis. There is a report that the serum concentrations of MDC and TARC decrease when cyclosporin A or corticosteroids, which are used as therapeutic substances for atopic dermatitis, are administered to patients with atopic dermatitis (J Dermatol Sci., 34:201-208, 2004). Also, when INF-γ or TNF-α was treated in HaCaT cells, a human keratinocyte line, in an in vitro experiment, a large amount of MDC and TARC were expressed. (Int Immunol., 14(7):767-773, 2002).
본 발명은 솔방울고랭이 추출물이 INF-γ와 TNF-α로 처리된 인간각질형성세포주인 HaCaT 세포에 처리될 때 MDC 및 TARC의 발현을 억제함을 확인함으로써 완성된 것이다.The present invention was completed by confirming that the pine cone extract inhibited the expression of MDC and TARC when treated with INF-γ and TNF-α-treated human keratinocytes, HaCaT cells.
본 발명의 목적은 솔방울고랭이 추출물을 이용한 아토피 피부염 개선용 조성물을 제공하는 데 있다.It is an object of the present invention to provide a composition for improving atopic dermatitis using the pine cone extract.
본 발명의 다른 목적이나 구체적인 목적은 이하에서 제시될 것이다.Other objects or specific objects of the present invention will be set forth below.
본 발명은 전술한 바와 같이, 솔방울고랭이 추출물이 INF-γ와 TNF-α로 처리된 인간각질형성세포주인 HaCaT 세포에 처리될 때 MDC 및 TARC의 발현을 억제함을 확인함으로써 완성된 것으로, 본 발명의 아토피 피부염 개선용 조성물은 솔방울고랭이 추출물을 유효성분으로 포함함을 특징으로 한다.As described above, the present invention has been completed by confirming that the pine cone extract inhibits the expression of MDC and TARC when treated with HaCaT cells, a human keratinocyte line treated with INF-γ and TNF-α. The composition for improving atopic dermatitis of the present invention is characterized in that it contains the pine cone extract as an active ingredient.
본 명세서에서, "솔방울고랭이 추출물"이란 추출 대상인 솔방울고랭이의 줄기, 잎, 열매, 꽃, 뿌리 등을 물, 탄소수 1 내지 4의 저급 알콜(메탄올, 에탄올, 부탄올 등), 메틸렌클로라이드, 에틸렌, 아세톤, 헥산, 에테르, 클로로포름, 에틸아세테이트, 부틸아세테이트, N,N-디메틸포름아미드(DMF), 디메틸설폭사이드(DMSO), 1,3-부틸렌글리콜, 프로필렌글리콜 또는 이들의 혼합 용매를 사용하여 침출하여 얻어진 추출물, 이산화탄소, 펜탄 등 초임계 추출 용매를 사용하여 얻어진 추출물 또는 그 추출물을 분획하여 얻어진 분획물을 의미하며, 추출 방법은 활성물질의 극성, 추출 정도, 보존 정도를 고려하여 냉침, 환류, 가온, 초음파 방사, 초임계 추출 등 임의의 방법을 적용할 수 있다. 분획된 추출물의 경우 추출물을 특정 용매에 현탁시킨 후 극성이 다른 용매와 혼합·정치시켜 얻은 분획물, 상기 조추출물을 실리카겔 등이 충진된 칼럼에 흡착시킨 후 소수성 용매, 친수성 용매 또는 이들의 혼합 용매를 이동상으로 하여 얻은 분획물을 포함하는 의미이다. 또한 상기 추출물의 의미에는 동결건조, 진공건조, 열풍건조, 분무건조 등의 방식으로 추출 용매가 제거된 농축된 액상의 추출물 또는 고형상의 추출물이 포함된다. 바람직하게는 추출용매로서 물, 에탄올 또는 이들의 혼합 용매를 사용하여 얻어진 추출물, 더 바람직하게는 추출용매로서 물과 에탄올의 혼합 용매를 사용하여 얻어진 추출물을 의미한다.As used herein, the term "Pinaceae extract" refers to extracting stems, leaves, fruits, flowers, roots, etc. of Pine cones, water, lower alcohols having 1 to 4 carbon atoms (methanol, ethanol, butanol, etc.), methylene chloride, ethylene , acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or a mixed solvent thereof refers to an extract obtained by leaching, an extract obtained by using a supercritical extraction solvent such as carbon dioxide, pentane, or a fraction obtained by fractionating the extract, and the extraction method is cooling, refluxing, considering the polarity of the active material, the degree of extraction, and the degree of preservation. , heating, ultrasonic radiation, supercritical extraction, etc. arbitrary methods can be applied. In the case of the fractionated extract, a fraction obtained by suspending the extract in a specific solvent and mixing and standing still with a solvent having a different polarity, and adsorbing the crude extract to a column filled with silica gel, etc. It is meant to include the fraction obtained as a mobile phase. In addition, the meaning of the extract includes a concentrated liquid extract or solid extract from which the extraction solvent has been removed by methods such as freeze drying, vacuum drying, hot air drying, spray drying, and the like. Preferably, it refers to an extract obtained by using water, ethanol, or a mixed solvent thereof as an extraction solvent, and more preferably an extract obtained by using a mixed solvent of water and ethanol as an extraction solvent.
또 본 명세서에서 "유효성분"이란 단독으로 목적하는 활성을 나타내거나 또는 그 자체는 활성이 없는 담체와 함께 활성을 나타낼 수 있는 성분을 의미한다.In addition, as used herein, the term "active ingredient" refers to a component that alone exhibits the desired activity or can exhibit activity together with a carrier that has no activity by itself.
또 본 명세서에서, "아토피 피부염"은 그 발생의 직·간접적인 원인을 불문하고 당업계에서 아토피 피부염으로 분류되는 모든 질환을 포함하는 것으로 정의된다. 통상 아토피 피부염은 그 발병 시기 또는 그 발명 대상에 따라 유아형 아토피 피부염, 소아형 아토피 피부염, 성인형 아토피 피부염 그리고 임산부 아토피 피부염으로 분류되는데, 본 명세서에서 아토피 피부염은 이러한 모든 유형의 아토피 피부염을 포함한다.In addition, in the present specification, "atopic dermatitis" is defined to include all diseases classified as atopic dermatitis in the art regardless of the direct or indirect cause of its occurrence. In general, atopic dermatitis is classified into infant type atopic dermatitis, juvenile type atopic dermatitis, adult type atopic dermatitis, and maternal type atopic dermatitis according to the onset time or subject of the invention, in the present specification, atopic dermatitis includes all types of atopic dermatitis .
또 본 명세서에서, "개선"은 아토피 피부염 치료, 예방 및 개선(증상의 경감)을 포함하는 의미이다.Also in the present specification, "improvement" is meant to include treatment, prevention and improvement (relief of symptoms) of atopic dermatitis.
본 발명의 아토피 피부염 개선용 조성물은 그 유효성분을 용도, 제형, 배합 목적 등에 따라 치료를 의도하는 아토피 피부염의 개선 활성 등을 나타낼 수 있는 한 임의의 양(유효량)으로 포함할 수 있는데, 통상적인 유효량은 조성물 전체 중량을 기준으로 할 때 0.001 중량 % 내지 15 중량 % 범위 내에서 결정될 것이다. 여기서 "유효량"이란 그 적용 대상인 포유동물 바람직하게는 사람에게 의료 전문가 등의 제언에 의한 투여 기간 동안 본 발명의 조성물이 투여될 때, 아토피 피부염의 개선 효과 등 의도한 의료적·약리학적 효과를 나타낼 수 있는, 본 발명의 조성물에 포함되는 유효성분의 양을 말한다. 이러한 유효량은 당업자의 통상의 능력 범위 내에서 실험적으로 결정될 수 있다.The composition for improving atopic dermatitis of the present invention may include the active ingredient in any amount (effective amount) as long as it can exhibit the intended improvement activity of atopic dermatitis, etc., depending on the use, formulation, purpose of formulation, etc. An effective amount will be determined within the range of 0.001% to 15% by weight, based on the total weight of the composition. Here, the term "effective amount" refers to the intended medical and pharmacological effects, such as the improvement of atopic dermatitis, when the composition of the present invention is administered to a mammal, preferably a human, to which it is applied during the administration period as suggested by a medical professional. It refers to the amount of the active ingredient included in the composition of the present invention. Such an effective amount can be determined empirically within the ordinary ability of one of ordinary skill in the art.
본 발명의 아토피 피부염 개선용 조성물은 유효성분 이외에, 아토피 피부염 개선 활성의 상승·보강을 위하여 이미 안전성이 검증되고 아토피 피부염 개선 활성을 갖는 것으로 공지된 임의의 화합물이나 천연 추출물을 추가로 포함할 수 있다. In addition to the active ingredient, the composition for improving atopic dermatitis of the present invention may further include any compound or natural extract that has already been verified for safety and is known to have atopic dermatitis improving activity for increasing/reinforcing the activity of improving atopic dermatitis. .
구체적으로 그러한 화합물 또는 추출물로서는 「건강기능식품에 관한 법률」에 따라 '과민 면역반응 완화' 기능성으로 개별인정을 받은 Enterococcus faecalis 가열 처리 건조 분말, 구아바 잎 추출물 등의 복합물, 다래 추출물, 소엽 추출물, 피카오프레토 분말 등의 복합물, PLAG(1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol)와, '과민 피부상태 개선' 기능성으로 개별인정을 받은 L. sakei Probio 65, 감마리놀렌산 함유 유지, 과채 유래 유산균(L.plantarum CJLP133), 프로바이오틱스 ATP 등을 들 수 있다.Specifically, as such compounds or extracts, Enterococcus faecalis heat-treated dry powder, which has been individually recognized for the function of 'relieving hypersensitivity immune response' according to the 「Health Functional Food Act」, complexes such as guava leaf extract, Actinidia extract, leaf extract, pica Complex of Ofreto powder, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), L. sakei Probio 65, which has been individually recognized for its 'improving sensitive skin condition' function, oil containing gamma-linolenic acid, and fruit and vegetable-derived lactic acid bacteria ( L. plantarum CJLP133 ), probiotics ATP, and the like.
이러한 화합물 또는 천연 추출물은 본 발명의 아토피 피부염 개선용 조성물에 그 유효성분과 함께 하나 이상 포함될 수 있다.One or more of these compounds or natural extracts may be included in the composition for improving atopic dermatitis of the present invention together with the active ingredient.
본 발명의 아토피 피부염 개선용 조성물은 구체적인 양태에 있어서, 식품 조성물로서 파악할 수 있다. 본 발명의 조성물이 식품 조성물로 파악될 경우 그 용도는 알레르기성 피부 과민 반응 억제로 이해될 수 있다.The composition for improving atopic dermatitis of the present invention can be identified as a food composition in a specific embodiment. When the composition of the present invention is identified as a food composition, its use may be understood to inhibit allergic skin hypersensitivity reaction.
본 발명의 식품 조성물은 어떠한 형태로도 제조될 수 있으며, 예컨대 차, 쥬스, 탄산음료, 이온음료 등의 음료류, 우유, 요구르트 등의 가공 유류, 껌류, 떡, 한과, 빵, 과자, 면 등의 식품류, 정제, 캡슐, 환, 과립, 액상, 분말, 편상, 페이스트상, 시럽, 겔, 젤리, 바 등의 건강기능식품 제제류 등으로 제조될 수 있다. The food composition of the present invention may be prepared in any form, for example, beverages such as tea, juice, carbonated beverages, and ionic beverages, processed oils such as milk and yogurt, gums, rice cakes, Korean sweets, breads, sweets, noodles, etc. Foods, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and health functional food preparations such as bars can be manufactured.
또 본 발명의 식품 조성물은 법률상·기능상의 구분에 있어서 제조·유통 시점의 시행 법규에 부합하는 한 임의의 제품 구분을 띨 수 있다. 예컨대 한국 「건강기능식품에 관한 법률」에 따른 건강기능식품이거나, 한국 「식품위생법」의 식품공전(식약처 고시 「식품의 기준 및 규격」)상 각 식품유형에 따른 과자류, 두류, 다류, 음료류, 특수용도식품 등일 수 있다.In addition, the food composition of the present invention may have any product classification in terms of legal and functional classification as long as it conforms to the enforcement laws at the time of manufacture and distribution. For example, it is a health functional food according to the Korean 「Health Functional Food Act」, or confectionery, beans, tea, and beverages according to each food type in the Food Ordinance of the Korea 「Food Sanitation Act」 (Ministry of Food and Drug Safety Notification 「Food Standards and Specification」) , special purpose food, and the like.
본 발명의 식품 조성물에는 그 유효성분 이외에 식품첨가물이 포함될 수 있다. 식품첨가물은 일반적으로 식품을 제조, 가공 또는 보존함에 있어 식품에 첨가되어 혼합되거나 침윤되는 물질로서 이해될 수 있는데, 식품과 함께 매일 그리고 장기간 섭취되므로 그 안전성이 보장되어야 한다. 식품의 제조·유통을 규율하는 각국 법률(한국에서는 「식품위생법」임)에 따른 식품첨가물공전에는 안전성이 보장된 식품첨가물이 성분 면에서 또는 기능 면에서 한정적으로 규정되어 있다. 한국 식품첨가물공전(식약처 고시 「식품첨가물 기준 및 규격」)에서는 식품첨가물이 성분 면에서 화학적 합성품, 천연 첨가물 및 혼합 제제류로 구분되어 규정되어 있는데, 이러한 식품첨가물은 기능 면에 있어서는 감미제, 풍미제, 보존제, 유화제, 산미료, 점증제 등으로 구분된다. The food composition of the present invention may contain food additives in addition to the active ingredients thereof. Food additives can be generally understood as substances that are added and mixed or infiltrated into food in manufacturing, processing, or preserving food. Food additives with guaranteed safety are limited in terms of ingredients or functions in the Food Additives Ordinance in accordance with the laws of each country that regulates the manufacture and distribution of food (“Food Sanitation Act” in Korea). In the Korean Food Additives Code (“Food Additive Standards and Specifications” announced by the Ministry of Food and Drug Safety), food additives are classified into chemically synthetic products, natural additives, and mixed preparations in terms of ingredients. It is divided into agents, preservatives, emulsifiers, acidulants, thickeners, etc.
감미제는 식품에 적당한 단맛을 부여하기 위하여 사용되는 것으로, 천연의 것이거나 합성된 것 모두 본 발명의 조성물에 사용할 수 있다. 바람직하게는 천연 감미제를 사용하는 경우인데, 천연 감미제로서는 옥수수 시럽 고형물, 꿀, 수크로오스, 프룩토오스, 락토오스, 말토오스 등의 당 감미제를 들 수 있다. The sweetener is used to impart appropriate sweetness to food, and both natural and synthetic ones may be used in the composition of the present invention. Preferably, a natural sweetener is used, and examples of the natural sweetener include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.
풍미제는 맛이나 향을 좋게 하기 위하여 사용될 수 있는데, 천연의 것과 합성된 것 모두 사용될 수 있다. 바람직하게는 천연의 것을 사용하는 경우이다. 천연의 것을 사용할 경우에 풍미 이외에 영양 강화의 목적도 병행할 수 있다. 천연 풍미제로서는 사과, 레몬, 감귤, 포도, 딸기, 복숭아 등에서 얻어진 것이거나 녹차잎, 둥굴레, 대잎, 계피, 국화 잎, 자스민 등에서 얻어진 것일 수 있다. 또 인삼(홍삼), 죽순, 알로에 베라, 은행 등에서 얻어진 것을 사용할 수 있다. 천연 풍미제는 액상의 농축액이나 고형상의 추출물일 수 있다. 경우에 따라서 합성 풍미제가 사용될 수 있는데, 합성 풍미제는 에스테르, 알콜, 알데하이드, 테르펜 등이 이용될 수 있다. Flavoring agents may be used to improve taste or aroma, and both natural and synthetic ones may be used. Preferably, it is a case where a natural thing is used. In the case of using a natural product, the purpose of nutritional enhancement in addition to flavor may be concurrently used. The natural flavoring agent may be obtained from apples, lemons, tangerines, grapes, strawberries, peaches, or the like, or obtained from green tea leaves, horseradish leaves, bamboo leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, and ginkgo can be used. The natural flavoring agent may be a liquid concentrate or a solid extract. Optionally, a synthetic flavoring agent may be used, and the synthetic flavoring agent may be an ester, an alcohol, an aldehyde, a terpene, or the like.
보존제로서는 소듐 소르브산칼슘, 소르브산나트륨, 소르브산칼륨, 벤조산칼슘, 벤조산나트륨, 벤조산칼륨, EDTA(에틸렌디아민테트라아세트산) 등이 사용될 수 있고, 또 유화제로서는 아카시아검, 카르복시메틸셀룰로스, 잔탄검, 펙틴 등을 들 수 있으며, 산미료로서는 연산, 말산, 푸마르산, 아디프산, 인산, 글루콘산, 타르타르산, 아스코르브산, 아세트산, 인산 등이 사용될 수 있다. 산미료는 맛을 증진시키는 목적 이외에 미생물의 증식을 억제할 목적으로 식품 조성물이 적정 산도로 되도록 첨가될 수 있다.As a preservative, sodium calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), etc. can be used, and as an emulsifier, acacia gum, carboxymethylcellulose, xanthan gum, Pectin, etc. are mentioned, and acidulant, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, etc. can be used as an acidulant. The acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing the taste.
점증제로서는 현탁화 구현제, 침강제, 겔 형성제, 팽화제 등이 사용될 수 있다.As a thickening agent, a suspending agent, a settling agent, a gel former, a bulking agent, etc. can be used.
본 발명의 식품 조성물은 전술한 바의 식품첨가물 이외에, 기능성과 영양성을 보충, 보강할 목적으로 당업계에 공지되고 식품첨가물로서 안정성이 보장된 생리활성 물질이나 미네랄류를 포함할 수 있다.The food composition of the present invention may contain, in addition to the food additives described above, physiologically active substances or minerals known in the art for the purpose of supplementing and reinforcing functionality and nutrition and guaranteed stability as food additives.
그러한 생리활성 물질로서는 녹차 등에 포함된 카테킨류, 비타민 B1, 비타민 C, 비타민 E, 비타민 B12 등의 비타민류, 토코페롤, 디벤조일티아민 등을 들 수 있으며, 미네랄류로서는 구연산 칼슘 등의 칼슘 제제, 스테아린산마그네슘 등의 마그네슘 제제, 구연산철 등의 철 제제, 염화 크롬, 요오드칼륨, 셀레늄, 게르마늄, 바나듐, 아연 등을 들 수 있다. Examples of such physiologically active substances include catechins contained in green tea and the like, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoylthiamine, and the like. Minerals include calcium preparations such as calcium citrate, magnesium stearate Magnesium preparations, such as iron preparations, such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, etc. are mentioned.
본 발명의 식품 조성물에는 전술한 바의 식품첨가물이 제품 유형에 따라 그 첨가 목적을 달성할 수 있는 적량으로 포함될 수 있다.In the food composition of the present invention, the food additives as described above may be included in an appropriate amount to achieve the purpose of the addition according to the product type.
본 발명의 식품 조성물에 포함될 수 있는 기타의 식품첨가물과 관련하여서는 각국 식품공전이나 식품첨가물 공전을 참조할 수 있다.In relation to other food additives that may be included in the food composition of the present invention, reference may be made to the Food Ordinance of each country or the Food Additives Code.
본 발명의 조성물은 다른 구체적인 양태에 있어서는 약제학적 조성물로 파악될 수 있다.The composition of the present invention may be regarded as a pharmaceutical composition in another specific embodiment.
본 발명의 약제학적 조성물은 유효성분 이외에 약제학적으로 허용되는 담체를 포함하여 당업계에 공지된 통상의 방법으로 투여 경로에 따라 경구용 제형 또는 비경구용 제형으로 제조될 수 있다. 여기서 투여 경로는 국소 경로, 경구 경로, 정맥 내 경로, 근육 내 경로, 및 점막 조직을 통한 직접 흡수를 포함하는 임의의 적절한 경로일 수 있으며, 두 가지 이상의 경로를 조합하여 사용할 수도 있다. 두 가지 이상 경로의 조합의 예는 투여 경로에 따른 두 가지 이상의 제형의 약물이 조합된 경우로서 예컨대 1차로 어느 한 약물은 정맥 내 경로로 투여하고 2차로 다른 약물은 국소 경로로 투여하는 경우이다. The pharmaceutical composition of the present invention may be prepared as an oral dosage form or a parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. Here, the route of administration may be any suitable route including topical route, oral route, intravenous route, intramuscular route, and direct absorption through mucosal tissue, and two or more routes may be used in combination. An example of the combination of two or more routes is a case in which two or more formulations of drugs according to the route of administration are combined. For example, one drug is first administered by an intravenous route and the other drug is secondarily administered by a local route.
약학적으로 허용되는 담체는 투여 경로나 제형에 따라 당업계에 주지되어 있으며, 구체적으로는 "대한민국약전"을 포함한 각국의 약전을 참조할 수 있다. Pharmaceutically acceptable carriers are well known in the art depending on the route of administration or formulation, and specifically, reference may be made to the pharmacopoeia of each country including the "Korea Pharmacopoeia".
본 발명의 약제학적 조성물이 경구용 제형으로 제조될 경우, 적합한 담체와 함께 당업계에 공지된 방법에 따라 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 현탁액, 웨이퍼 등의 제형으로 제조될 수 있다. 이때 적합한 담체의 예로서는 락토스, 글루코스, 슈크로스, 덱스트로스, 솔비톨, 만니톨, 자일리톨 등의 당류, 옥수수 전분, 감자 전분, 밀 전분 등의 전분류, 셀룰로오스, 메틸셀룰로오스, 에틸셀룰로오스, 나트륨 카르복시메틸셀룰로오스, 하이드록시프로필메틸셀룰로오스 등의 셀룰로오스류, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 마그네슘 스테아레이트, 광물유, 맥아, 젤라틴, 탈크, 폴리올, 식물성유, 에탄올, 글리세롤 등을 들 수 있다. 제제화활 경우 필요에 따라 적절한 결합제, 윤활제, 붕해제, 착색제, 희석제 등을 포함시킬 수 있다. 적절한 결합제로서는 전분, 마그네슘 알루미늄 실리케이트, 전분페리스트, 젤라틴, 메틸셀룰로스, 소듐 카복시메틸셀룰로스, 폴리비닐피롤리돈, 글루코스, 옥수수 감미제, 소듐 알지네이트, 폴리에틸렌 글리콜, 왁스 등을 들 수 있고, 윤활제로서는 올레산나트륨, 스테아르산나트륨, 스테아르산마그네슘, 벤조산나트륨, 초산나트륨, 염화나트륨, 실리카, 탈쿰, 스테아르산, 그것의 마그네슘염과 칼슘염, 폴리데틸렌글리콜 등을 들 수 있으며, 붕해제로서는 전분, 메틸 셀룰로스, 아가(agar), 벤토나이트, 잔탄검, 전분, 알긴산 또는 그것의 소듐 염 등을 들 수 있다. 또 희석제로서는 락토즈, 덱스트로즈, 수크로즈, 만니톨, 소비톨, 셀룰로스, 글라이신 등을 들 수 있다. When the pharmaceutical composition of the present invention is prepared as an oral dosage form, powder, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers according to methods known in the art together with a suitable carrier It can be prepared in a formulation such as Examples of suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Cellulose such as hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil, ethanol, glycerol and the like. In the case of formulation activity, an appropriate binder, lubricant, disintegrant, colorant, diluent, etc. may be included as needed. Suitable binders include starch, magnesium aluminum silicate, starch ferrist, gelatin, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone, glucose, corn sweetener, sodium alginate, polyethylene glycol, wax, and the like, and oleic acid as lubricant. sodium, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, magnesium salts and calcium salts thereof, polyethylene glycol, etc., and the disintegrating agent is starch, methyl cellulose , agar, bentonite, xanthan gum, starch, alginic acid or its sodium salt. Examples of the diluent include lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, and the like.
본 발명의 약제학적 조성물이 비경구용 제형으로 제조될 경우, 적합한 담체와 함께 당업계에 공지된 방법에 따라 주사제, 경피 투여제, 비강 흡입제 및 좌제의 형태로 제제화될 수 있다. 주사제로 제제화할 경우 적합한 담체로서는 수성 등장 용액 또는 현탁액을 사용할 수 있으며, 구체적으로는 트리에탄올 아민이 함유된 PBS(phosphate buffered saline)나 주사용 멸균수, 5% 덱스트로스 같은 등장 용액 등을 사용할 수 있다. 경피 투여제로 제제화할 경우 연고제, 크림제, 로션제, 겔제, 외용액제, 파스타제, 리니멘트제, 에어롤제 등의 형태로 제제화할 수 있다. 비강 흡입제의 경우 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 등의 적합한 추진제를 사용하여 에어로졸 스프레이 형태로 제제화할 수 있으며, 좌제로 제제화할 경우 그 담체로는 위텝솔(witepsol), 트윈(tween) 61, 폴리에틸렌글리콜류, 카카오지, 라우린지, 폴리옥시에틸렌 소르비탄 지방산 에스테르류, 폴리옥시에틸렌 스테아레이트류, 소르비탄 지방산 에스테르류 등을 사용할 수 있다.When the pharmaceutical composition of the present invention is prepared for parenteral use, it may be formulated in the form of injections, transdermal administrations, nasal inhalants and suppositories together with suitable carriers according to methods known in the art. When formulated as an injection, an aqueous isotonic solution or suspension may be used as a suitable carrier, and specifically, PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, or isotonic solution such as 5% dextrose may be used. . When formulated for transdermal administration, it can be formulated in the form of an ointment, a cream, a lotion, a gel, an external solution, a pasta agent, a liniment agent, an air roll, and the like. In the case of nasal inhalants, it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, and the like. witepsol), tween 61, polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like can be used.
약제학적 조성물의 구체적인 제제화와 관련하여서는 당업계에 공지되어 있으며, 예컨대 문헌[Remington's Pharmaceutical Sciences(19th ed., 1995)] 등을 참조할 수 있다. 상기 문헌은 본 명세서의 일부로서 간주 된다.Specific formulations of pharmaceutical compositions are known in the art, and reference may be made to, for example, Remington's Pharmaceutical Sciences (19th ed., 1995). This document is considered a part of this specification.
본 발명의 약제학적 조성물의 바람직한 투여량은 환자의 상태, 체중, 성별, 연령, 환자의 중증도, 투여 경로에 따라 1일 0.001mg/kg ~ 10g/kg 범위, 바람직하게는 0.001mg/kg ~ 1g/kg 범위일 수 있다. 투여는 1일 1회 또는 수회로 나누어 이루어질 수 있다. 이러한 투여량은 어떠한 측면으로든 본 발명의 범위를 제한하는 것으로 해석되어서는 아니 된다. A preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, severity of the patient, and the route of administration. It can be in the range /kg. Administration may be performed once or divided into several times a day. These dosages should not be construed as limiting the scope of the invention in any respect.
본 발명의 조성물은 또 다른 구체적인 양태에 있어서, 화장료 조성물로 파악할 수 있다. 본 발명의 조성물이 화장품 조성물로 파악될 경우 그 용도는 알레르기성 피부 트러블 억제, 알레르기성 피부 자극 완화 등의 용도로 이해될 수 있다.In another specific embodiment, the composition of the present invention can be identified as a cosmetic composition. When the composition of the present invention is identified as a cosmetic composition, its use may be understood as a use for suppressing allergic skin troubles, alleviating allergic skin irritation, and the like.
본 발명의 조성물이 화장료 조성물로 파악될 경우에도 그 화장료 조성물은 그 용도상, 법률상 임의의 제품 구분을 띨 수 있으며, 구체적으로 피부 트러블 개선, 아토피 피부염 개선 등의 용도를 가진 기능성 화장품, 비기능성 일반 화장품 등일 수 있다. 제품 형태에 있어서도 임의의 제품 형태를 띨 수 있는데, 구체적으로 용액, 현탁액, 유탁액, 페이스트, 젤, 크림, 로션, 파우더, 비누, 계면활성제-함유 클렌징, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션, 스프레이 등의 제품 형태를 띨 수 있다. 구체적인 제품 형태에 있어서는 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스, 아이 크림, 클렌징 크림, 클렌징 폼, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형 등일 수 있다.Even when the composition of the present invention is identified as a cosmetic composition, the cosmetic composition can be classified into any product in terms of its use or by law, and specifically functional cosmetics, non-functional products having uses such as improvement of skin troubles and improvement of atopic dermatitis It may be general cosmetics and the like. In terms of product form, it may take any product form, and specifically, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax It can take the form of products such as foundation and spray. In the specific product form, it may be in the form of a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.
본 발명의 화장료 조성물은 그 유효성분 이외에 화장료 조성물에 통상적으로 이용되는 성분들, 예컨대, 안정화제, 용해화제, 계면활성제, 비타민, 색소 및 향료와 같은 통상적인 보조제, 및 담체를 포함할 수 있다. The cosmetic composition of the present invention may include components commonly used in cosmetic compositions in addition to the active ingredient, for example, conventional adjuvants such as stabilizers, solubilizers, surfactants, vitamins, pigments and fragrances, and carriers.
본 발명의 제형이 페이스트, 크림 또는 젤인 경우에는 담체 성분으로서 동물성유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되는데, 구체적으로 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜, 소르비탄의 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, specifically water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid ester of sorbitan, etc. may be used.
본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르, 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 등이 이용될 수 있다.When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, polyoxyethylene sorbitan ester, microcrystals Adult cellulose, aluminum metahydroxide, bentonite, agar, etc. can be used.
본 발명의 제형이 계면-활성제 함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative or ethoxylated glycerol fatty acid ester and the like may be used.
본 발명의 화장료 조성물은 아토피 피부염 개선 활성을 나타내는 그 유효성분을 포함하는 것을 제외하고는 당업계에 통상적으로 행하여지는 화장료 조성물의 제조방법에 따라 제조할 수 있다.The cosmetic composition of the present invention can be prepared according to a method for preparing a cosmetic composition conventionally performed in the art, except that it contains an active ingredient that exhibits atopic dermatitis improving activity.
전술한 바와 같이, 본 발명에 따르면 솔방울고랭이 추출물을 이용한 아토피 피부염 개선용 조성물을 제공할 수 있다. As described above, according to the present invention, it is possible to provide a composition for improving atopic dermatitis using the pine cone extract.
본 발명의 아토피 피부염 개선용 조성물은 아토피 피부염 개선 등의 용도로 식품, 화장품, 약품 등으로 제품화될 수 있다.The composition for improving atopic dermatitis of the present invention may be commercialized as food, cosmetics, drugs, etc. for the purpose of improving atopic dermatitis.
도 1은 INF-γ와 TNF-α로 처리된 인간각질형성세포주인 HaCaT 세포에서 솔방울고랭이 추출물의 MDC 및 TARC 발현 억제 활성을 보여주는 결과이다.1 is a result showing the inhibitory activity of MDC and TARC expression of pine cone extract in HaCaT cells, a human keratinocyte line treated with INF-γ and TNF-α.
이하 본 발명을 실시예 및 실험예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예 및 실험예에 한정되는 것은 아니다.Hereinafter, the present invention will be described with reference to Examples and Experimental Examples. However, the scope of the present invention is not limited to these Examples and Experimental Examples.
<< 실시예Example > 솔방울고랭이 추출물의 제조> Preparation of pine cone extract
건조된 솔방울고랭이 지상부 분말 1kg에 50% 에탄올 12 L를 가하여 상온에서 24 시간 침지 추출 후 여과지로 여과하였다. 얻어진 50% 에탄올 여액을 감압 농축 후 동결 건조하여 솔방울고랭이 추출물을 얻었다. 12 L of 50% ethanol was added to 1 kg of dried pine cone powder above ground, followed by immersion extraction at room temperature for 24 hours, followed by filtration with filter paper. The obtained 50% ethanol filtrate was concentrated under reduced pressure and then freeze-dried to obtain a pine cone extract.
<< 실험예Experimental example > 솔방울고랭이 추출물의 아토피 피부염 개선 활성 실험> Atopic dermatitis improvement activity experiment of pine cone extract
HaCaT 세포를 1×106cells/well로 6 well plate에 배양한 후, IFN-γ(10 ng/ml), TNF-α(10 ng/ml)와 실시예의 시료를 농도별로 처리하여 18시간 배양하였다. PBS로 2번 세척하고 Trizol(Invitrogen)을 넣어서 세포를 용해시킨 후 chloroform을 넣고 13000rpm에서 15분간 원심분리하여 상층액을 얻었다. 상층액과 isopropanol을 섞은 후 반응시켜 RNA를 침전시킨 후 에탄올로 1회 세척하여 RNA를 분리하였다. 분리한 RNA를 이용하여 정량 후 역전사 연쇄중합반응 키트인 Superscript kit(Invitrogen)를 사용하여 제조사의 프로토콜에 따라 cDNA를 합성하였다. 구체적으로 역전사 반응은 3 ㎍의 total RNA를 oligo(dT)20 primer, dNTP (50 ng/ml), 1 unit RNase OUT 그리고 SuperscriptⅢ 역전사 효소 (200 U/ml)로 65℃ 5분, 40℃ 5분, 50℃ 50분, 그리고 85℃에서 15분 동안 반응시켜 수행하였다. 중합효소 연쇄 반응(PCR)은 합성된 cDNA로부터 MDC, TARC, GAPDH를 증폭시키기 위하여 1 ㎕ cDNA, 10 pM의 5'과 3' primer, AccuPower Pfu PCR Premix (Bioneer, KOREA)를 섞고 증류수로 전체를 20 ㎕로 맞춘 다음, 95℃ 45초, 55℃ 45초, 72℃ 2분을 설정하여 35 cycle 반응시켰다. 사용된 프라이머 서열은 아래의 [표 1]과 같다. 반응 후 아가로오스 겔 상에서 발현량을 비교하였다. 결과를 [도 1]에 나타내었다. [도 1]의 결과는 솔방울고랭이 추출물이 처리 농도에 비례하여 MDC와 TARC의 발현을 억제함을 보여준다. 양성대조군으로 항알레르기 활성을 가지는 것으로 알려진 dexamethasone(100μM)을 사용하였다.HaCaT cells were cultured in a 6-well plate at 1×10 6 cells/well, and then treated with IFN-γ (10 ng/ml), TNF-α (10 ng/ml) and the samples of Examples at different concentrations and cultured for 18 hours. did. After washing twice with PBS, Trizol (Invitrogen) was added to dissolve the cells, chloroform was added, and centrifugation was performed at 13000 rpm for 15 minutes to obtain a supernatant. The supernatant and isopropanol were mixed and reacted to precipitate RNA, and then washed once with ethanol to isolate RNA. After quantification using the isolated RNA, cDNA was synthesized according to the manufacturer's protocol using the Superscript kit (Invitrogen), which is a reverse transcription chain polymerization reaction kit. Specifically, the reverse transcription reaction was performed using 3 μg of total RNA with oligo(dT)20 primer, dNTP (50 ng/ml), 1 unit RNase OUT and Superscript III reverse transcriptase (200 U/ml) at 65°C for 5 minutes, 40°C for 5 minutes. , 50 ℃ 50 min, and 85 ℃ for 15 min. For polymerase chain reaction (PCR), 1 μl cDNA, 10 pM 5' and 3' primers, AccuPower Pfu PCR Premix (Bioneer, KOREA) were mixed to amplify MDC, TARC, and GAPDH from the synthesized cDNA, and the whole was washed with distilled water. After adjusting to 20 μl, 95 ℃ 45 sec, 55 ℃ 45 sec, 72 ℃ 2 min was set for 35 cycle reaction. The primer sequences used are shown in [Table 1] below. After the reaction, the expression level was compared on an agarose gel. The results are shown in [Fig. 1]. The results of [Fig. 1] show that the pine cone extract inhibited the expression of MDC and TARC in proportion to the treatment concentration. As a positive control, dexamethasone (100 μM), which is known to have anti-allergic activity, was used.
프라이머primer
MDCMDC F: GCATGGCTCGCCTACAGACT(서열번호 1)F: GCATGGCTCGCCTACAGACT (SEQ ID NO: 1)
R: GCAGGGAGGGAGGCAGAGGA (서열번호 2)R: GCAGGGAGGGAGGCAGAGGA (SEQ ID NO: 2)
TARCTARC F: ATGGCCCCACTGAAGATGCT(서열번호 3)F: ATGGCCCCACTGAAGATGCT (SEQ ID NO: 3)
R: TGAACACCAACGGTGGAGGT(서열번호 4)R: TGAACACCAACGGTGGAGGT (SEQ ID NO: 4)
GAPDHGAPDH F: GAGTCAACGGATTTGGTCGT(서열번호 5)F : GAGTCAACGGATTTGGTCGT (SEQ ID NO: 5)
R: GACAAGCTTCCCGTTCTCAG(서열번호 6)R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 6)

Claims (5)

  1. 솔방울고랭이 추출물을 유효성분으로 포함하는 아토피 피부염 개선용 조성물.A composition for improving atopic dermatitis, comprising the pine cone extract as an active ingredient.
  2. 제1항에 있어서,According to claim 1,
    상기 솔방울고랭이 추출물은 솔방울고랭이 지상부의 물, 에탄올 또는 이들의 혼합용매에 의한 추출물인 것을 특징으로 하는 아토피 피부염 개선용 조성물.The pine cone extract is a composition for improving atopic dermatitis, characterized in that it is an extract by water, ethanol, or a mixed solvent thereof from above the pine cone extract.
  3. 제1항 또는 제2항에 있어서,3. The method of claim 1 or 2,
    상기 조성물은 약제학적 조성물인 것을 특징으로 하는 아토피 피부염 개선용 조성물.The composition is a composition for improving atopic dermatitis, characterized in that the pharmaceutical composition.
  4. 제1항 또는 제2항에 있어서,3. The method of claim 1 or 2,
    상기 조성물은 식품 조성물인 것을 특징으로 하는 아토피 피부염 개선용 조성물.The composition is a composition for improving atopic dermatitis, characterized in that the food composition.
  5. 제1항 또는 제2항에 있어서,3. The method of claim 1 or 2,
    상기 조성물은 화장품 조성물인 것을 특징으로 하는 아토피 피부염 개선용 조성물.The composition is a composition for improving atopic dermatitis, characterized in that it is a cosmetic composition.
PCT/KR2021/017457 2020-12-01 2021-11-25 Composition employing scirpus karuizawensis extract for alleviation of atopic dermatitis WO2022119229A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0166023 2020-12-01
KR1020200166023A KR102529774B1 (en) 2020-12-01 2020-12-01 Composition for Improving Atopy Dermatitis Using an Extract of Scirpus karuizawensis

Publications (1)

Publication Number Publication Date
WO2022119229A1 true WO2022119229A1 (en) 2022-06-09

Family

ID=81854137

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/017457 WO2022119229A1 (en) 2020-12-01 2021-11-25 Composition employing scirpus karuizawensis extract for alleviation of atopic dermatitis

Country Status (2)

Country Link
KR (1) KR102529774B1 (en)
WO (1) WO2022119229A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120000880A (en) * 2010-06-28 2012-01-04 (주)미현재 Cosmetic composition comprising naturalplant extract for alleviating atopic dermatitis
KR20160048254A (en) * 2014-10-23 2016-05-04 대한민국(환경부 국립생물자원관장) Cosmetic composition for skin whitening and anti-wrinkle effect comprising Scirpus wichurai extract as effective component
KR20160137040A (en) * 2015-05-22 2016-11-30 주식회사 더삼점영 A composition of plants extract for treating atopic dermatitis
US20170290804A1 (en) * 2015-04-09 2017-10-12 Galderma S.A. Treatment of atopic dermatitis with indigo naturalis or indigo producing plant extract
KR101925724B1 (en) * 2017-09-04 2018-12-05 국립낙동강생물자원관 Anti-inflammation Composition Using an Extract of Scirpus tabernaemontani

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120000880A (en) * 2010-06-28 2012-01-04 (주)미현재 Cosmetic composition comprising naturalplant extract for alleviating atopic dermatitis
KR20160048254A (en) * 2014-10-23 2016-05-04 대한민국(환경부 국립생물자원관장) Cosmetic composition for skin whitening and anti-wrinkle effect comprising Scirpus wichurai extract as effective component
US20170290804A1 (en) * 2015-04-09 2017-10-12 Galderma S.A. Treatment of atopic dermatitis with indigo naturalis or indigo producing plant extract
KR20160137040A (en) * 2015-05-22 2016-11-30 주식회사 더삼점영 A composition of plants extract for treating atopic dermatitis
KR101925724B1 (en) * 2017-09-04 2018-12-05 국립낙동강생물자원관 Anti-inflammation Composition Using an Extract of Scirpus tabernaemontani

Also Published As

Publication number Publication date
KR102529774B1 (en) 2023-05-09
KR20220076983A (en) 2022-06-08

Similar Documents

Publication Publication Date Title
KR102092024B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Combretum quadrangulare
WO2022119230A1 (en) Anti-allergic composition using extract from persicaria longiseta
WO2022119229A1 (en) Composition employing scirpus karuizawensis extract for alleviation of atopic dermatitis
KR102462914B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Aconogonum microcarpum
KR102513132B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Populus tomentiglandulosa
KR20190043317A (en) Composition for Improving Atopy Dermatitis Using an Extract of Ecklonia cava and an Extract of Sargassum horneri
KR102087651B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Careya arborea
KR102010654B1 (en) Composition for immunity stimulatory activity Using an Enzyme Digest of Sargassum horneri
KR20230085026A (en) Composition for Improving Atopy Dermatitis Using an Extract of Spodiopogon sibiricus
KR20230085027A (en) Composition for Improving Atopy Dermatitis Using an Extract of Matteuccia struthiopteris
KR20230085025A (en) Composition for Improving Atopy Dermatitis Using an Extract of Rudbeckia laciniata
KR101972076B1 (en) Composition for Improving Atopy Dermatitis Using Active Compounds Isolated from an Extract of Careya arborea
KR20220093580A (en) Composition for Improving Atopy Dermatitis Using an Extract of Crinum asiaticum
KR102408103B1 (en) Composition for preventing, improving or treating atopic dematitis disease
KR20230076670A (en) Composition for Improving Atopy Dermatitis Using Neochlororgenic acid
KR20200092532A (en) Anti-inflammatory composition using an extract of radish root, etc.
KR20190060631A (en) Composition for Improving Atopy Dermatitis Using an Extract of Ecklonia cava and an Extract of Sargassum horneri
KR102497941B1 (en) Compositions for anti-inflammation and anti-allergy using an extract of Artemisia stolonifera
KR102268761B1 (en) Composition for Hair Growth Stimulation or Hair Loss Prevention Using an Extract of Lonchocarpus eriocalyx
KR102202220B1 (en) Composition for Hair Growth Stimulation or Hair Loss Prevention Using an Extract of Albizia anthelmintica
KR20200093347A (en) Composition for Anti-inflammation and Atopy Dermatitis Using an Extract of Barly Nuruk
KR102062697B1 (en) Composition for immunity stimulatory activity Using a Fruit Extract of Litsea japonica
KR102088232B1 (en) Composition for Improving Atopy Dermatitis Using an Extract of Ecklonia cava and an Extract of Sargassum horneri
KR102171987B1 (en) Composition for Anti-allergic Using Extract of Fallopia ciliinervis
KR20180071010A (en) Antioxidant Composition Using an Extract of Polygonum amphibium

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21900917

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21900917

Country of ref document: EP

Kind code of ref document: A1