KR102092024B1 - Composition for Improving Atopy Dermatitis Using an Extract of Combretum quadrangulare - Google Patents

Abstract

The present invention discloses a composition for improving atopic dermatitis using a Combretum quadrangulae extract showing MDC and TARC expression inhibitory activity when treated with HaCaT cells, which are human keratinocyte cell lines treated with INF-γ and TNF-α. .

Description

Composition for Improving Atopy Dermatitis Using an Extract of Combretum quadrangulare}

The present invention is a Combretum quadrangulare ( Combretum quadrangulare ) relates to a composition for improving atopic dermatitis using an extract.

Atopic dermatitis is a recurrent chronic skin disease, which is common in infants and toddlers, but persists even in adults or may become newly developed as adults, and the prevalence is increasing recently (Kor J Pharmacogn., 43: 59-65, 2012 ). Atopic dermatitis is characterized by symptoms such as pruritus, dryness of the skin, hyperactivity around the hair follicles, stomatitis, eczema, and eczema bile lesions (Korean J Invest Dermatol., 14: 67-72, 2007).

The cause of atopic dermatitis has not been clearly identified, but abnormal increase in IgE, decrease in the number and function of T cells that play a central role in cellular immunity, infiltration of monocytes and macrophages, increase in the number of mast cells and eosinophils, Immunological factors such as increased numbers of CD4 + T lymphocytes have been reported (J Invest Dermatol., 96: 523-526, 1991; J Invest Dermatol., 97: 389-394, 1991; Immunol., 11: 81- 88, 1999; Curr Drug Targets Inflamm Allergy., 2: 199-120, 2003; J Allergy Clin Immunol., 107: 871-877, 2001; Adv Immunol., 78:57, 2001; International Immunology, 14 (7) : 767-773, 2002; Pediatr Allergy Immunol., 19: 605-613, 2008), especially the Th1 / Th2 imbalance due to the increased number of Th2 cells compared to Th1 cells is known as an important factor (Kor J Pharmacogn, 43: 59-65, 2012).

The immune system, which is a defense mechanism against external invasion of the human body, is mainly focused on the activation of T cells. Cytokines such as IL-2, IFN-γ, and TNF produced by Th1 cells induce differentiation of Th1 cells and inhibit proliferation and differentiation of Th2 cells, whereas IL-4, IL-5, IL produced by Th2 cells Cytokines such as -6, IL-10, IL-13 induce the proliferation and differentiation of Th2 cells and inhibit the differentiation of Th1 cells (J Am Acad Dermatol., 44, S1-S12, 2001). Under normal conditions, the immune response is maintained by balancing the interaction between Th1 cells and Th2 cells, but in atopic dermatitis, the conversion of T cells to Th2 cells is promoted, and increased Th2 secretes a large amount of cytokines to produce IgE. Increases and induces hypersensitivity reactions by inducing mast cell and eosinophil differentiation (J Clin Invest. 113 (5): 651-7, 2004; J Allergy Clin Immunol. 2003; 112 (2): 252-62; Kor J Pharmacogn, 43: 59-65, 2012).

Chemokine (chemokine) is a low-molecular protein that represents chemoattractants and is divided into four types, C, CC, CXC, and CX3C, depending on its structure and function. Recently, these chemokines are immune cells, mature, and differentiate T cells. And migration, and Th1 / Th2 balance control.

Among various chemokines, THRC (Thymus & activation-regulated chemokine) and MDC (macrophage-derived chemokine) are representative CC chemokines acting on Th2 cells, acting on CCR4 (CC chemokine receptor 4) of Th2 cells as inflammatory lesions, Th2 cells Induces migration and infiltration (J Clin Invest. 113 (5): 651-7, 2004; Curr Allergy Asthma Rep. 5 (4): 284-90, 2005)

Recently, there have been reports of significant increases in serum concentrations of TARC and MDC in patients with atopic dermatitis (J Allergy Clin Immunol., 113 (2): 334-340), and reports of increased skin expression of TARC and MDC in animal models of atopic dermatitis. There is a report that serum concentrations of MDC and TARC decrease when Cyclosporin A or corticosteroid used as a therapeutic agent for atopic dermatitis is administered to patients with atopic dermatitis (J Dermatol Sci., 34: 201-208, 2004). In addition, in the in vitro experiment, when INF-γ or TNF-α was treated with human keratinocyte cell line HaCaT cells, MDC and TARC were expressed in large quantities, and it was suggested that a substance capable of inhibiting this expression could be used as a therapeutic agent for atopic dermatitis. Yes (Int Immunol., 14 (7): 767-773, 2002).

The present invention was completed by confirming that the Combretum quadrangulare extract inhibits the expression of MDC and TARC when treated with HaCaT cells, a human keratinocyte cell line treated with INF-γ and TNF-α.

An object of the present invention is to provide a composition for improving atopic dermatitis using the extract of Combretum quadrangulare.

Other or specific objects of the present invention will be presented below.

As described above, the present invention was completed by confirming that the Combretum quadrangulare extract inhibits the expression of MDC and TARC when treated with HaCaT cells, a human keratinocyte cell line treated with INF-γ and TNF-α. As described above, the composition for improving atopic dermatitis of the present invention is characterized in that it includes the Combretum quadrangulae extract as an active ingredient.

In the present specification, the term "combretum quadrangulare extract" refers to the stem, leaf, fruit, flower, root, etc. of the combretum quadrangulare, which is the target of extraction, and lower alcohols having 1 to 4 carbon atoms (methanol, ethanol, Butanol, etc.), methylene chloride, ethylene, acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, N, N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene The extract obtained by leaching using glycol or a mixed solvent thereof, carbon dioxide, extract obtained using a supercritical extraction solvent such as pentane, or a fraction obtained by fractionating the extract, the extraction method is the polarity of the active substance, the degree of extraction, Any method such as cold acupuncture, reflux, warming, ultrasonic radiation, and supercritical extraction can be applied in consideration of the degree of storage. In the case of fractionated extracts, the fractions obtained by suspending the extracts in a specific solvent and mixing and policing with a solvent of different polarity, adsorb the crude extract on a column filled with silica gel, etc., and then use a hydrophobic solvent, a hydrophilic solvent or a mixed solvent thereof. It means that it contains the fraction obtained as a mobile phase. In addition, the meaning of the extract includes a concentrated liquid extract or a solid extract in which the extraction solvent is removed by a method such as freeze drying, vacuum drying, hot air drying, spray drying, and the like. Preferably, it is an extract obtained by using water, ethanol or a mixed solvent thereof as an extraction solvent, and more preferably an extract obtained by using a mixed solvent of water and ethanol as an extraction solvent.

In addition, in the present specification, "active ingredient" refers to a component that can exhibit the desired activity alone or itself can exhibit activity with an inactive carrier.

In addition, in this specification, "atopic dermatitis" is defined to include all diseases classified as atopic dermatitis in the art regardless of the direct or indirect cause of the occurrence. Atopic dermatitis is generally classified into infantile atopic dermatitis, pediatric atopic dermatitis, adult atopic dermatitis, and pregnant atopic dermatitis depending on the time of its onset or the subject of the invention, wherein atopic dermatitis includes all these types of atopic dermatitis. .

In addition, in this specification, "improvement" is meant to include treatment, prevention and improvement (reduction of symptoms) of atopic dermatitis.

The composition for improving atopic dermatitis of the present invention may include the active ingredient in any amount (effective amount) as long as it can exhibit the improving activity of atopic dermatitis intended to be treated according to use, formulation, blending purpose, etc. The effective amount will be determined within the range of 0.001% to 15% by weight based on the total weight of the composition. Here, the "effective amount" refers to intended medical and pharmacological effects, such as the improvement effect of atopic dermatitis, when the composition of the present invention is administered to a mammal, preferably a person, to which the subject is applied, by the recommendation of a medical expert or the like. Refers to the amount of the active ingredient contained in the composition of the present invention. Such an effective amount can be determined empirically within the ordinary skill in the art.

The composition for improving atopic dermatitis of the present invention may further include, in addition to the active ingredient, any compound or natural extract that has already been verified for safety and has atopic dermatitis-improving activity in order to enhance and enhance atopic dermatitis-improving activity. .

Specifically, as such a compound or extract, a complex such as Enterococcus faecalis heat-treated dry powder, guava leaf extract, sage extract, lobule extract, and picopreto, which have been individually recognized for their 'sensitization of hypersensitivity reactions' function according to the Act on Health Functional Foods Complexes such as powders, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), L. sakei Probio 65, which has been individually recognized for its 'sensitized skin condition improvement' function, retains gamma-linolenic acid, derived from fruits and vegetables And lactic acid bacteria ( L.plantarum CJLP133), probiotic ATP, and the like.

These compounds or natural extracts may be included in the composition for improving atopic dermatitis of the present invention together with one or more of its active ingredients.

In the specific aspect, the composition for improving atopic dermatitis of the present invention can be grasped as a food composition. When the composition of the present invention is identified as a food composition, its use may be understood as suppressing an allergic skin hypersensitivity reaction.

The food composition of the present invention can be produced in any form, such as tea, juice, carbonated beverages, beverages such as ionic beverages, processed oils such as milk, yogurt, gums, rice cakes, Chinese medicines, breads, cookies, noodles, etc. Food, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jelly, bars, etc. can be prepared as health functional food formulations.

In addition, the food composition of the present invention can be classified into any product as long as it complies with the enforcement regulations at the time of manufacturing and distribution in the legal and functional classification. For example, it is a health functional food pursuant to the Korean Act on Health Functional Food, or a confectionary, soybean, tea, or beverage according to each food type in the Food Fair of the Korean Food Sanitation Act (「Food Standards and Standards」) , Special purpose foods, and the like.

Food composition of the present invention may include a food additive in addition to the active ingredient. Food additives can be generally understood as substances added to foods, mixed or infiltrated in the manufacture, processing, or preservation of foods, and their safety must be ensured because they are consumed daily and for a long time with foods. Food additives in accordance with national laws governing the manufacture and distribution of food ("Food Sanitation Act" in Korea) are limited in terms of ingredients or functions in terms of food additives with guaranteed safety. In the Korean Food Additives Fair (Korea Food and Drug Administration's notice, `` Food Additive Standards and Standards ''), food additives are classified into chemical synthetic products, natural additives, and mixed preparations in terms of ingredients, and these food additives are sweeteners and flavors in terms of functionality. It is divided into agents, preservatives, emulsifiers, acidulants, and thickeners.

Sweeteners are used to impart a moderate sweetness to food, and both natural and synthetic can be used in the composition of the present invention. Preferably, a natural sweetener is used, and examples of the natural sweetener include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.

Flavoring agents can be used to enhance the taste or aroma, and both natural and synthetic can be used. Preferably, it is the case of using a natural thing. In addition to flavor, when using natural ones, the purpose of enhancing nutrition can also be combined. As a natural flavoring agent, it may be obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, etc., or may be obtained from green tea leaves, perilla, large leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, and ginkgo can be used. Natural flavoring agents may be liquid concentrates or solid extracts. In some cases, synthetic flavoring agents may be used, and synthetic flavoring agents may include esters, alcohols, aldehydes, terpenes, and the like.

As a preservative, sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid) and the like can be used, and as an emulsifier, acacia gum, carboxymethylcellulose, xanthan gum, Pectin and the like, and as the acidulant, arithmetic, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid and the like can be used. The acidulant may be added so that the food composition has an appropriate acidity for the purpose of suppressing the growth of microorganisms in addition to the purpose of enhancing taste.

As a thickener, a suspending agent, sedimentation agent, gel forming agent, swelling agent, etc. may be used.

The food composition of the present invention may include bioactive substances or minerals known in the art for the purpose of supplementing and reinforcing functional and nutritional properties in addition to the food additives described above, and guaranteed stability as food additives.

Examples of such bioactive substances include catechins contained in green tea, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoyl thiamine, and the like, and calcium preparations such as calcium citrate and magnesium stearate as minerals Magnesium preparations such as iron, iron preparations such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, and the like.

The food composition of the present invention may include the food additives as described above in an appropriate amount to achieve the purpose of addition according to the product type.

With regard to other food additives that may be included in the food composition of the present invention, it is possible to refer to national foods or food additives.

The composition of the present invention can be identified as a pharmaceutical composition in other specific embodiments.

The pharmaceutical composition of the present invention may be prepared in an oral dosage form or a parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. Here, the route of administration may be any suitable route including a local route, an oral route, an intravenous route, an intramuscular route, and direct absorption through mucosal tissue, and two or more routes may be used in combination. An example of a combination of two or more routes is when two or more formulations of the drug are combined according to the route of administration, for example, when one drug is administered by intravenous route and the second drug is administered by topical route.

Pharmaceutically acceptable carriers are well known in the art depending on the route of administration or formulation, and specifically refer to the pharmacopeia of each country, including "Korea Pharmacopoeia".

When the pharmaceutical composition of the present invention is prepared in an oral dosage form, powders, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers according to methods known in the art with suitable carriers And the like. At this time, examples of suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Celluloses such as hydroxypropyl methylcellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil, ethanol, green Serol, etc. are mentioned. In the case of formulation, if necessary, suitable binders, lubricants, disintegrants, colorants, diluents, etc. may be included. Suitable binders include starch, magnesium aluminum silicate, starch ferist, gelatin, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone, glucose, corn sweetener, sodium alginate, polyethylene glycol, wax, etc., and lubricants include oleic acid Sodium, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, magnesium salts and calcium salts thereof, polydetylene glycol, and the like, and starch and methyl cellulose as disintegrants , Agar, bentonite, xanthan gum, starch, alginic acid or its sodium salt. Moreover, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine etc. are mentioned as a diluent.

When the pharmaceutical composition of the present invention is prepared in a parenteral dosage form, it may be formulated in the form of injections, transdermal administrations, nasal inhalants and suppositories according to methods known in the art with suitable carriers. When formulated as an injectable agent, an aqueous isotonic solution or suspension may be used as a suitable carrier. Specifically, PBS (phosphate buffered saline) containing triethanol amine, sterile water for injection, isotonic solution such as 5% dextrose, etc. may be used. . When formulated as a transdermal dosage form, it can be formulated in the form of ointments, creams, lotions, gels, external solutions, pasta, linen agents, aerosols, and the like. In the case of nasal inhalants, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, etc. can be formulated in the form of an aerosol spray using a suitable propellant. witepsol), tween 61, polyethylene glycols, cacao butter, laurin, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like.

Regarding the specific formulation of the pharmaceutical composition, it is known in the art, and for example, see Remington's Pharmaceutical Sciences (19th ed., 1995) and the like. The above documents are regarded as part of this specification.

Preferred dosages of the pharmaceutical compositions of the present invention range from 0.001 mg / kg to 10 g / kg per day, preferably 0.001 mg / kg to 1 g per day, depending on the patient's condition, weight, sex, age, patient severity, and route of administration. / kg range. Administration can be made once a day or divided into several times. Such dosages should not be construed as limiting the scope of the invention in any aspect.

In another specific aspect, the composition of the present invention can be identified as a cosmetic composition. When the composition of the present invention is identified as a cosmetic composition, its use may be understood as use for suppressing allergic skin troubles, allergic skin irritation, and the like.

Even if the composition of the present invention is identified as a cosmetic composition, the cosmetic composition can be classified into any product in accordance with its use, and in particular, functional cosmetics having non-functionality such as improvement of skin trouble, atopic dermatitis, etc. It may be a general cosmetic. As for the product form, any product form can be taken, specifically, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing, oils, powder foundations, emulsion foundations, waxes It can take the form of products such as foundations and sprays. In a specific product form, it may be flexible lotion, nutrition lotion, nutrition cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder formulation.

The cosmetic composition of the present invention may include, in addition to its active ingredients, ingredients commonly used in cosmetic compositions, such as stabilizers, solubilizers, surfactants, vitamins, pigments and conventional auxiliary agents such as colorants and carriers.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. may be used as a carrier component. You can.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder can be used as a carrier component, and in the case of a spray, additionally chlorofluorohydrocarbon, propane / Propellant such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, specifically water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid ester of sorbitan, and the like can be used.

When the formulation of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol as carrier components, ethoxylated isostearyl alcohol, suspending agents such as polyoxyethylene sorbitol esters, polyoxyethylene sorbitan esters, and microcrystals Sex cellulose, aluminum metahydroxide, bentonite, agar and the like can be used.

When the formulation of the present invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide as a carrier component Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

The cosmetic composition of the present invention can be prepared according to the manufacturing method of a cosmetic composition that is conventionally performed in the art, except that the active ingredient exhibiting atopic dermatitis improving activity is included.

As described above, according to the present invention, it is possible to provide a composition for improving atopic dermatitis using a Combretum quadrangulare extract.

The composition for improving atopic dermatitis of the present invention may be commercialized as food, cosmetics, and drugs for the purpose of improving atopic dermatitis.

1 is a result showing the inhibitory activity of MDC and TARC expression of Combretum quadrangulare extract in HaCaT cells, a human keratinocyte cell line treated with INF-γ and TNF-α.

Hereinafter, the present invention will be described with reference to Examples and Experimental Examples. However, the scope of the present invention is not limited to these examples and experimental examples.

< Example > Combretum Quadranolare  Preparation of extract

2 L of 70% ethanol was added to 200 g of the dried Combretum quadrangulare leaf, followed by repeated immersion extraction for 24 hours at room temperature, followed by filtration with filter paper. The obtained 70% ethanol filtrate was concentrated under reduced pressure and freeze-dried to obtain a Combretum quadrangulare extract.

< Experimental example > Combretum Quadranolare  Experiment for improving atopic dermatitis of extract

After culturing HaCaT cells in a 6 well plate with 1 × 10 ⁶ cells / well, IFN-γ (10 ng / ml), TNF-α (10 ng / ml) and the samples of Examples were treated by concentration for 18 hours. Did. After washing twice with PBS and adding Trizol (Invitrogen) to lyse the cells, chloroform was added and centrifuged at 13000 rpm for 15 minutes to obtain a supernatant. The supernatant was mixed with isopropanol and reacted to precipitate RNA, and then washed once with ethanol to separate RNA. After quantitation using the isolated RNA, cDNA was synthesized according to the manufacturer's protocol using a superscript kit (Invitrogen), a reverse transcription chain polymerization kit. Specifically, for the reverse transcription reaction, 3 μg of total RNA was added to oligo (dT) 20 primer, dNTP (50 ng / ml), 1 unit RNase OUT, and Superscript III reverse transcriptase (200 U / ml) at 65 ° C for 5 minutes and 40 ° C for 5 minutes. , 50 ℃ 50 minutes, and reacted at 85 ℃ for 15 minutes. For polymerase chain reaction (PCR), 1 µl cDNA, 10 pM of 5 'and 3' primers, AccuPower Pfu PCR Premix (Bioneer, KOREA) are mixed with distilled water to amplify MDC, TARC, and GAPDH from the synthesized cDNA. After setting to 20 μl, 95 ° C 45 seconds, 55 ° C 45 seconds, and 72 ° C 2 minutes were set for 35 cycle reaction. The primer sequences used are shown in [Table 1] below. After the reaction, expression levels were compared on an agarose gel. The results are shown in [Figure 1]. The results of [Figure 1] show that the Combretum quadrangulare extract inhibits the expression of MDC and TARC in proportion to the treatment concentration. As a positive control, dexamethasone (100 μM), which is known to have anti-allergic activity, was used.

primer MDC F: GCATGGCTCGCCTACAGACT (SEQ ID NO: 1) R: GCAGGGAGGGAGGCAGAGGA (SEQ ID NO: 2) TARC F: ATGGCCCCACTGAAGATGCT (SEQ ID NO: 3) R: TGAACACCAACGGTGGAGGT (SEQ ID NO: 4) GAPDH F : GAGTCAACGGATTTGGTCGT (SEQ ID NO: 5) R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 6)

Claims (5)

Combretum quadrangulare extract as an active ingredient,
The Combretum quadrangulare extract is a composition for improving atopic dermatitis, characterized in that the Combretum quadrangulare leaf is obtained by water, ethanol or a mixed solvent thereof.
According to claim 1,
The mixed solvent is 70% ethanol, characterized in that the composition for improving atopic dermatitis.
The method according to claim 1 or 2,
The composition is a composition for improving atopic dermatitis, characterized in that the pharmaceutical composition.
The method according to claim 1 or 2,
The composition is a composition for improving atopic dermatitis, characterized in that the food composition.
The method according to claim 1 or 2,
The composition is a cosmetic composition for improving atopic dermatitis, characterized in that.

Images