KR102462914B1 - Composition for Improving Atopy Dermatitis Using an Extract of Aconogonum microcarpum - Google Patents

Abstract

The present invention discloses a composition for alleviating atopic dermatitis using an extract showing MDC and TARC expression inhibitory activity when treated with HaCaT cells, a human keratinocyte line treated with INF-γ and TNF-α.

Description

Composition for Improving Atopy Dermatitis Using an Extract of Aconigonum microcarpum}

The present invention relates to a composition for improving atopic dermatitis using an extract of chamgaesinga ( Aconigonum microcarpum ).

Atopic dermatitis is a recurrent chronic skin disease that occurs frequently in infancy, but may persist into adulthood or may develop newly in adulthood, and its prevalence is increasing recently (Kor J Pharmacogn., 43:59-65, 2012). ). Atopic dermatitis is characterized by symptoms such as pruritus, dry skin, hyperfollicular hypertrophy, cheilitis, lichenification, and eczema-like lesions (Korean J Invest Dermatol., 14:67-72, 2007).

The cause of atopic dermatitis is not yet clearly defined, but an abnormal increase in IgE, a decrease in the number and function of T cells that play a central role in cellular immunity, infiltration of monocytes and macrophages, an increase in the number of mast cells and eosinophils, Immunological factors such as an increase in the number of CD4+ T lymphocytes have been reported (J Invest Dermatol., 96:523-526, 1991; J Invest Dermatol., 97:389-394, 1991; Immunol., 11:81- 88, 1999; Curr Drug Targets Inflamm Allergy., 2:199-120, 2003; J Allergy Clin Immunol., 107:871-877, 2001; Adv Immunol., 78:57, 2001; International Immunology, 14(7) :767-773, 2002; Pediatr Allergy Immunol., 19:605-613, 2008), in particular, Th1/Th2 imbalance due to an increase in the number of Th2 cells compared to Th1 cells is known as an important factor (Kor J Pharmacogn, 43: 59-65, 2012).

The immune system, which is a defense mechanism against external invasion of the human body, is centered on the activation of T cells. Cytokines such as IL-2, IFN-γ, and TNF produced by Th1 cells induce the differentiation of Th1 cells and inhibit the proliferation and differentiation of Th2 cells, while IL-4, IL-5, and IL produced by Th2 cells Cytokines such as -6, IL-10, and IL-13 induce proliferation and differentiation of Th2 cells and inhibit the differentiation of Th1 cells (J Am Acad Dermatol., 44, S1-S12, 2001). In a normal state, the immune response is maintained by balancing the interaction between Th1 cells and Th2 cells, but in atopic dermatitis, the conversion of T cells to Th2 cells is promoted and the increased Th2 secretes a large amount of cytokines to induce IgE production. and induces hypersensitivity reaction by inducing mast cell and eosinophil differentiation (J Clin Invest. 113(5):651-7, 2004; J Allergy Clin Immunol. 2003;112(2): 252-62; Kor J Pharmacogn, 43:59-65, 2012).

Chemokines are small-molecular proteins that exhibit chemoattractants and are divided into four types, C, CC, CXC, and CX3C, depending on their structure and function. and migration, and Th1/Th2 balance regulation.

Among various chemokines, TARC (Thymus & activation-regulated chemokine) and MDC (macrophage-derived chemokine) are representative CC chemokines that act on Th2 cells. induces migration and infiltration of (J Clin Invest. 113(5):651-7, 2004; Curr Allergy Asthma Rep. 5(4):284-90, 2005)

Recently, it has been reported that the serum concentrations of TARC and MDC are significantly increased in patients with atopic dermatitis (J Allergy Clin Immunol., 113(2):334-340), and that the skin expression of TARC and MDC is increased in an animal model of atopic dermatitis. There is a report that the serum concentrations of MDC and TARC decrease when cyclosporin A or corticosteroids, which are used as therapeutic substances for atopic dermatitis, are administered to patients with atopic dermatitis (J Dermatol Sci., 34:201-208, 2004). In addition, when INF-γ or TNF-α was treated in HaCaT cells, a human keratinocyte line, in an in vitro experiment, a large amount of MDC and TARC were expressed. (Int Immunol., 14(7):767-773, 2002).

The present invention has been completed by confirming that MDC and TARC expression is inhibited when the extract of chrysanthemum extract is treated with HaCaT cells, a human keratinocyte line treated with INF-γ and TNF-α.

It is an object of the present invention to provide a composition for improving atopic dermatitis using an extract of S.

Other objects or specific objects of the present invention will be set forth below.

As described above, the present invention has been completed by confirming that MDC and TARC expression is inhibited when the extract is treated with HaCaT cells, a human keratinocyte line treated with INF-γ and TNF-α, as described above. The composition for improving atopic dermatitis is characterized in that it contains an extract of chrysanthemum rhizomes as an active ingredient.

In the present specification, the term "steampotamus extract" refers to the stem, leaf, fruit, flower, root, etc. of the extract target, water, lower alcohols having 1 to 4 carbon atoms (methanol, ethanol, butanol, etc.), methylene chloride, ethylene, acetone , hexane, ether, chloroform, ethyl acetate, butyl acetate, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or a mixture thereof. means an extract obtained by using a supercritical extraction solvent such as carbon dioxide, pentane, or a fraction obtained by fractionating the extract. , ultrasonic radiation, supercritical extraction, and the like, any method can be applied. In the case of a fractionated extract, a fraction obtained by suspending the extract in a specific solvent and mixing and standing still with a solvent having a different polarity, and adsorbing the crude extract to a column filled with silica gel, etc. It is meant to include the fraction obtained as a mobile phase. In addition, the meaning of the extract includes a concentrated liquid extract or solid extract from which the extraction solvent is removed by freeze drying, vacuum drying, hot air drying, spray drying, or the like. Preferably, it means an extract obtained using water, ethanol, or a mixed solvent thereof as an extraction solvent, and more preferably an extract obtained using a mixed solvent of water and ethanol as an extraction solvent.

In addition, as used herein, the term "active ingredient" refers to a component that can exhibit a desired activity alone or can exhibit activity together with a carrier that has no activity by itself.

In addition, in the present specification, "atopic dermatitis" is defined to include all diseases classified as atopic dermatitis in the art regardless of the direct or indirect cause of its occurrence. In general, atopic dermatitis is classified into infant type atopic dermatitis, juvenile type atopic dermatitis, adult type atopic dermatitis, and maternal type atopic dermatitis according to the onset time or subject of the invention. .

Also, in the present specification, "improvement" is meant to include treatment, prevention and improvement (relief of symptoms) of atopic dermatitis.

The composition for improving atopic dermatitis of the present invention may contain the active ingredient in any amount (effective amount) as long as it can exhibit the intended improvement activity of atopic dermatitis, etc., depending on the use, formulation, purpose of formulation, etc. An effective amount will be determined within the range of 0.001% to 15% by weight, based on the total weight of the composition. Here, the term "effective amount" refers to the intended medical and pharmacological effects such as improvement of atopic dermatitis when the composition of the present invention is administered to a mammal, preferably a human, to which it is applied during the administration period as suggested by a medical professional. It refers to the amount of the active ingredient included in the composition of the present invention. Such effective amounts can be determined empirically within the ordinary ability of one of ordinary skill in the art.

In addition to the active ingredient, the composition for improving atopic dermatitis of the present invention may further include any compound or natural extract that has already been verified for safety and is known to have atopic dermatitis improving activity for increasing/reinforcing the activity of improving atopic dermatitis. .

Specifically, as such compounds or extracts, Enterococcus faecalis heat-treated dry powder, guava leaf extract, etc., which has been individually recognized for its 'alleviating hypersensitivity immune response' function according to the 「Health Functional Food Act」, complex such as guava leaf extract, Actinidia extract, leaf extract, pica Complex of Ofreto powder, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), L. sakei Probio 65, which has been individually recognized for its 'improving sensitive skin condition' function, oil containing gamma-linolenic acid, and fruit and vegetable-derived lactic acid bacteria ( L. plantarum CJLP133 ), probiotics ATP, and the like.

One or more of these compounds or natural extracts may be included in the composition for improving atopic dermatitis of the present invention together with the active ingredient.

In a specific aspect, the composition for improving atopic dermatitis of the present invention can be grasped as a food composition. When the composition of the present invention is identified as a food composition, its use may be understood to inhibit allergic skin hypersensitivity reaction.

The food composition of the present invention may be prepared in any form, for example, beverages such as tea, juice, carbonated drinks, and ion drinks, processed oils such as milk and yogurt, gums, rice cakes, Korean sweets, bread, confectionery, noodles, etc. Foods, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and health functional food preparations such as bars can be prepared.

In addition, the food composition of the present invention may have any product classification as long as it conforms to the enforcement regulations at the time of manufacture and distribution in legal and functional classification. For example, it is a health functional food in accordance with the Health Functional Food Act of Korea, or confectionery, beans, tea, and beverages according to each food type in the Food Ordinance of the Korea Food Sanitation Act (Ministry of Food and Drug Safety Notification “Food Standards and Specifications”). , special purpose food, and the like.

The food composition of the present invention may contain food additives in addition to the active ingredients thereof. Food additives can be generally understood as substances that are added to and mixed with or infiltrated into food in manufacturing, processing or preserving food. Food additives with guaranteed safety are limited in terms of ingredients or functions in the Food Additives Ordinance according to the laws of each country that regulates the manufacture and distribution of food (“Food Sanitation Act” in Korea). In the Korean Food Additives Code (“Food Additive Standards and Specifications” notified by the Ministry of Food and Drug Safety), food additives are classified into chemically synthetic products, natural additives, and mixed preparations in terms of ingredients. It is classified into an agent, a preservative, an emulsifier, an acidulant, and a thickener.

The sweetener is used to impart an appropriate sweetness to food, and both natural and synthetic ones may be used in the composition of the present invention. Preferably, a natural sweetener is used. Examples of the natural sweetener include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.

Flavoring agents may be used to improve taste or aroma, and both natural and synthetic ones may be used. Preferably, it is a case where a natural thing is used. In the case of using a natural one, the purpose of nutritional enhancement in addition to flavor may be concurrently used. As a natural flavoring agent, it may be obtained from apple, lemon, tangerine, grape, strawberry, peach, etc., or it may be obtained from green tea leaf, dandelion, bamboo leaf, cinnamon, chrysanthemum leaf, jasmine, etc. In addition, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, ginkgo biloba, etc. can be used. The natural flavoring agent may be a liquid concentrate or a solid extract. Optionally, a synthetic flavoring agent may be used, and the synthetic flavoring agent may be an ester, an alcohol, an aldehyde, a terpene, or the like.

As a preservative, sodium calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), etc. can be used, and as an emulsifier, acacia gum, carboxymethylcellulose, xanthan gum, Pectin etc. are mentioned, and acidulant, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, etc. can be used as an acidulant. The acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing the taste.

As a thickening agent, a suspending agent, a settling agent, a gel former, a bulking agent, etc. can be used.

The food composition of the present invention may contain, in addition to the food additives as described above, physiologically active substances or minerals known in the art for the purpose of supplementing and reinforcing functionality and nutrition and guaranteed stability as food additives.

Examples of such physiologically active substances include catechins contained in green tea and the like, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoylthiamine, and the like. Magnesium preparations, such as iron preparations, such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, zinc, etc. are mentioned.

In the food composition of the present invention, the food additives as described above may be included in an appropriate amount to achieve the purpose of the addition according to the product type.

In relation to other food additives that may be included in the food composition of the present invention, reference may be made to the Food Ordinance of each country or the Food Additives Code.

The composition of the present invention may be regarded as a pharmaceutical composition in another specific embodiment.

The pharmaceutical composition of the present invention may be prepared as an oral dosage form or parenteral dosage form according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. Here, the route of administration may be any suitable route including topical route, oral route, intravenous route, intramuscular route, and direct absorption through mucosal tissue, and two or more routes may be used in combination. An example of the combination of two or more routes is a case in which two or more formulations of drugs according to the route of administration are combined. For example, one drug is first administered by an intravenous route and the other drug is secondarily administered by a local route.

Pharmaceutically acceptable carriers are well known in the art depending on the route of administration or formulation, and specifically, reference may be made to the pharmacopoeia of each country including the "Korea Pharmacopoeia".

When the pharmaceutical composition of the present invention is prepared as an oral dosage form, powder, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers according to methods known in the art together with suitable carriers It can be prepared in a formulation such as Examples of suitable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Cellulose such as hydroxypropylmethylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil, ethanol, glycerol and the like. In the case of formulation activity, an appropriate binder, lubricant, disintegrant, colorant, diluent, etc. may be included as needed. Suitable binders include starch, magnesium aluminum silicate, starch ferrist, gelatin, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone, glucose, corn sweetener, sodium alginate, polyethylene glycol, wax, and the like, and oleic acid as lubricant. sodium, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, magnesium salts and calcium salts thereof, polyethylene glycol, etc., and the disintegrant include starch, methyl cellulose , agar, bentonite, xanthan gum, starch, alginic acid or its sodium salt. Examples of the diluent include lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, and the like.

When the pharmaceutical composition of the present invention is prepared for parenteral use, it may be formulated in the form of injections, transdermal administrations, nasal inhalants and suppositories together with suitable carriers according to methods known in the art. When formulated as an injection, an aqueous isotonic solution or suspension may be used as a suitable carrier, and specifically, an isotonic solution such as PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, or 5% dextrose may be used. . When formulated for transdermal administration, it can be formulated in the form of ointments, creams, lotions, gels, external solutions, pasta agents, liniment agents, air rolls, and the like. In the case of nasal inhalants, it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, and the like. witepsol), tween 61, polyethylene glycols, cacao fat, laurin fat, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, sorbitan fatty acid esters, and the like can be used.

Specific formulations of pharmaceutical compositions are known in the art, and reference may be made to, for example, Remington's Pharmaceutical Sciences (19th ed., 1995). This document is considered a part of this specification.

A preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, body weight, sex, age, patient's severity, and administration route. It can be in the range /kg. Administration may be performed once a day or divided into several times. Such dosages should not be construed as limiting the scope of the invention in any respect.

In another specific embodiment, the composition of the present invention can be identified as a cosmetic composition. When the composition of the present invention is identified as a cosmetic composition, its use may be understood as a use for suppressing allergic skin troubles, alleviating allergic skin irritation, and the like.

Even when the composition of the present invention is identified as a cosmetic composition, the cosmetic composition can be classified into any product in terms of its use or by law, and specifically functional cosmetics, non-functional products having uses such as improvement of skin troubles, improvement of atopic dermatitis, etc. It may be general cosmetics and the like. The product form may also take any product form, specifically solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax It can take the form of products such as foundation and spray. In the specific product form, it may be the formulation of a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

The cosmetic composition of the present invention may include components commonly used in cosmetic compositions in addition to the active ingredient, for example, conventional adjuvants such as stabilizers, solubilizers, surfactants, vitamins, pigments and fragrances, and carriers.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, specifically water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, fatty acid ester of sorbitan, and the like may be used.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, polyoxyethylene sorbitan ester, microcrystals Sex cellulose, aluminum metahydroxide, bentonite, agar, and the like can be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative or ethoxylated glycerol fatty acid ester and the like can be used.

The cosmetic composition of the present invention can be prepared according to a method for preparing a cosmetic composition conventionally performed in the art, except that it contains an active ingredient that exhibits atopic dermatitis improvement activity.

As described above, according to the present invention, it is possible to provide a composition for improving atopic dermatitis using an extract of S.

The composition for improving atopic dermatitis of the present invention may be commercialized as food, cosmetics, drugs, etc. for the purpose of improving atopic dermatitis.

1 is a result showing the inhibitory activity of MDC and TARC expression of the extract of chrysanthemum in HaCaT cells, a human keratinocyte line treated with INF-γ and TNF-α.

Hereinafter, the present invention will be described with reference to Examples and Experimental Examples. However, the scope of the present invention is not limited to these Examples and Experimental Examples.

< Example > Manufacture of ginseng extract

15 L of 50% ethanol was added to 1 kg of dried sagebrush powder, followed by immersion extraction at room temperature for 24 hours, followed by filtration with filter paper. The obtained 50% ethanol filtrate was concentrated under reduced pressure, and then freeze-dried to obtain an extract of S.

< Experimental example > Experiment on the improvement of atopic dermatitis of Atopic dermatitis extract

HaCaT cells were cultured in a 6-well plate at 1×10 ⁶ cells/well, and then treated with IFN-γ (10 ng/ml), TNF-α (10 ng/ml) and the sample of Example by concentration and cultured for 18 hours. did. After washing twice with PBS and lysing the cells by adding Trizol (Invitrogen), chloroform was added and centrifuged at 13000 rpm for 15 minutes to obtain a supernatant. The supernatant and isopropanol were mixed and reacted to precipitate RNA, and then washed once with ethanol to isolate RNA. After quantification using the isolated RNA, cDNA was synthesized according to the manufacturer's protocol using the Superscript kit (Invitrogen), a reverse transcription chain polymerization reaction kit. Specifically, the reverse transcription reaction was performed using 3 μg of total RNA with oligo(dT)20 primer, dNTP (50 ng/ml), 1 unit RNase OUT and Superscript III reverse transcriptase (200 U/ml) at 65°C for 5 minutes, 40°C for 5 minutes. , 50 °C for 50 minutes, and 85 °C for 15 minutes. For polymerase chain reaction (PCR), 1 μl cDNA, 10 pM 5' and 3' primers, AccuPower Pfu PCR Premix (Bioneer, KOREA) were mixed to amplify MDC, TARC, and GAPDH from the synthesized cDNA, and the whole was washed with distilled water. After adjusting to 20 μl, 95 ℃ 45 sec, 55 ℃ 45 sec, 72 ℃ 2 min were set for 35 cycle reaction. The primer sequences used are shown in [Table 1] below. After the reaction, the expression level was compared on an agarose gel. The results are shown in [Fig. 1]. The results of [Fig. 1] show that the extract of chrysanthemum extract inhibits the expression of MDC and TARC in proportion to the treatment concentration. As a positive control, dexamethasone (100 μM), which is known to have anti-allergic activity, was used.

primer MDC F: GCATGGCTCGCCTACAGACT (SEQ ID NO: 1) R: GCAGGGAGGGAGGCAGAGGA (SEQ ID NO: 2) TARC F: ATGGCCCCACTGAAGATGCT (SEQ ID NO: 3) R: TGAACACCAACGGTGGAGGT (SEQ ID NO: 4) GAPDH F : GAGTCAACGGATTTGGTCGT (SEQ ID NO: 5) R: GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 6)

Claims (5)

A composition for improving atopic dermatitis, comprising an extract of chamomile extract as an active ingredient.
The method of claim 1,
The composition for improving atopic dermatitis, characterized in that the extract is an extract by water, ethanol, or a mixed solvent thereof from above
3. The method of claim 1 or 2,
The composition is a composition for improving atopic dermatitis, characterized in that the pharmaceutical composition.
3. The method of claim 1 or 2,
The composition is a composition for improving atopic dermatitis, characterized in that the food composition.
3. The method of claim 1 or 2,
The composition is a cosmetic composition for improving atopic dermatitis.

Images