WO2022117024A1 - Gène d'induction haploïde parthénogénétique et son application - Google Patents

Gène d'induction haploïde parthénogénétique et son application Download PDF

Info

Publication number
WO2022117024A1
WO2022117024A1 PCT/CN2021/134982 CN2021134982W WO2022117024A1 WO 2022117024 A1 WO2022117024 A1 WO 2022117024A1 CN 2021134982 W CN2021134982 W CN 2021134982W WO 2022117024 A1 WO2022117024 A1 WO 2022117024A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
plant
haploid
seq
protein
Prior art date
Application number
PCT/CN2021/134982
Other languages
English (en)
Chinese (zh)
Inventor
陈绍江
钟裕
刘晨旭
王雨文
王冬
祁晓龙
Original Assignee
中国农业大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 中国农业大学 filed Critical 中国农业大学
Publication of WO2022117024A1 publication Critical patent/WO2022117024A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/08—Fruits
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/20—Brassicaceae, e.g. canola, broccoli or rucola
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/54—Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/60—Malvaceae, e.g. cotton or hibiscus
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the invention relates to the field of agricultural biotechnology and crop genetics and breeding mainly based on genome editing technology, in particular to a preparation method and application of a plant maternal haploid inductive line, and in particular to an orphan obtained by using gene editing technology Application of female haploid inducing gene DMP mutant as plant haploid inducing line in inducing plants to produce maternal haploid.
  • Field crop production is an important material basis for maintaining human survival. It can be divided into two major categories: monocotyledonous crops and dicotyledonous crops.
  • Monocotyledonous crops mainly include rice, wheat and corn, etc. Cotton and tomato, cucumber and other crops.
  • pure line creation is a key link in the breeding process.
  • Haploid breeding technology can accelerate the process of pure line selection, and when combined with gene editing technology, it can achieve rapid directional improvement of inbred lines, which can greatly improve breeding efficiency and is a common key technology in crop breeding.
  • haploid breeding technology has been applied on a large scale in maize breeding, and the key genes controlling maize haploid induction have been cloned.
  • the phospholipase gene ZmPLA1 has been successfully obtained haploid in rice and wheat.
  • this gene is only highly conserved in monocotyledonous crops, so the application in dicotyledonous crops has certain limitations.
  • the present invention first provides new uses of the proteins shown in B1) or B2) or B3) or B4);
  • amino acid sequence is sequence 2 or sequence 4 or sequence 6 or sequence 8 or sequence 10 or sequence 12 or sequence 14 or sequence 16 or sequence 18 or sequence 20 or sequence 22 or sequence 24 or sequence 26 or sequence 28 or sequence 30 or Sequence 32 or Sequence 34 or Sequence 36 or Sequence 38 or Sequence 40 or Sequence 42 or Sequence 44 or Sequence 46 or Sequence 48 or Sequence 50 or Sequence 52 or Sequence 54 or Sequence 56 or Sequence 58 or Sequence 60 or Sequence 62 or Sequence 64 or the protein of SEQ ID NO: 66 or SEQ ID NO: 68 or SEQ ID NO: 70;
  • the present invention provides the application of the protein represented by B1) or B2) or B3) or B4) in regulating the haploid-inducing ability or fruit number of plants.
  • the said regulation of plant haploid inducibility is embodied as: when the activity of the above-mentioned protein in the plant is inhibited, the plant becomes a plant haploid inducible line, and when the above-mentioned protein in the plant is expressed or the activity is improved, the said plant is Reduced or absent plant haploid-inducing ability.
  • the protein activity is inhibited such that the protein is not expressed or that the protein is inactive.
  • the reduced or absent haploid-inducing ability of the plant is embodied by an increase in the number of fruit (eg, siliques) of the plant.
  • the said regulation of the number of plant fruit is embodied as: when the activity of the above-mentioned protein in the plant is inhibited, the number of the fruit of the plant (such as silique) is reduced, and when the above-mentioned protein in the plant is expressed or the activity is increased, the fruit of the plant (such as siliques) increased in number.
  • the protein activity is inhibited such that the protein is not expressed or that the protein is inactive.
  • the tag refers to a polypeptide or protein that is fused and expressed with the target protein by using DNA recombination technology in vitro, so as to facilitate the expression, detection, tracing and/or purification of the target protein.
  • the protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag and/or SUMO tag and the like.
  • the substitution and/or deletion and/or addition of one or several amino acid residues is the substitution and/or deletion and/or addition of no more than 10 amino acid residues.
  • the 55% or more homology may be more than 60% or more than 70% or more than 80% or more than 90% or more than 91% or more than 92% or more than 93% or more than 94% Or more than 95% or more than 96% or more than 97% or more than 98% or more than 99% homology.
  • the following proteins can be used: DcDMP1 protein derived from carrot having 63.59% homology with the amino acid sequence shown in SEQ ID NO: 44, DcDMP2 protein derived from carrot having 63.35% homology with the amino acid sequence shown in SEQ ID NO: 44, The sunflower-derived HaDMP1 protein having 71.43% homology with the amino acid sequence shown in SEQ ID NO: 44, the sunflower-derived HaDMP2 protein having 63.85% homology with the amino acid sequence shown in SEQ ID NO: 44, and the A papaya-derived CpDMP protein having 63.23% homology in amino acid sequence, a sugar beet-derived BvDMP protein having 61.02% homology with the amino acid sequence shown in SEQ ID NO: 44, and 65.9% with the amino acid sequence shown in SEQ ID NO: 44
  • the present invention also provides new uses of the above-mentioned protein-related biological materials
  • the biological material is any one of the following A1) to A12):
  • A1 a nucleic acid molecule encoding the above-mentioned protein
  • A2) an expression cassette containing the nucleic acid molecule of A1);
  • A3 a recombinant vector containing the nucleic acid molecule of A1);
  • A5 a recombinant microorganism containing the nucleic acid molecule of A1);
  • A9 a transgenic plant cell line containing the nucleic acid molecule of A1);
  • A10 a transgenic plant cell line containing the expression cassette of A2)
  • A11 a transgenic plant cell line containing the recombinant vector described in A3);
  • a transgenic plant cell line containing the recombinant vector described in A4) A transgenic plant cell line containing the recombinant vector described in A4).
  • the present invention provides the application of the biological material related to the above-mentioned protein in regulating the haploid-inducing ability or fruit number of plants.
  • the nucleic acid molecule is the gene shown in the following C1) or C2) or C3) or C4):
  • C2 a cDNA molecule or a genomic DNA molecule having 70% or more identity with the nucleotide sequence defined in C1);
  • C3 a cDNA molecule or a genomic DNA molecule derived from a dicotyledonous plant and having 70% or more identity to the nucleotide sequence defined in C1);
  • C4) A cDNA molecule or a genomic DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined by C1) or C2) or C3).
  • the above-mentioned gene has the following functions: when the above-mentioned gene in the plant is suppressed or knocked out, the plant becomes a plant haploid inducible line; when the above-mentioned gene in the plant is expressed, the haploid inducibility of the plant is decreased and the number of fruits increased. The inhibition is complete inhibition.
  • identity refers to sequence similarity to a native nucleic acid sequence. “Identity” includes coding sequence 2 or sequence 4 or sequence 6 or sequence 8 or sequence 10 or sequence 12 or sequence 14 or sequence 16 or sequence 18 or sequence 20 or sequence 22 or sequence 24 or sequence 26 or sequence of the invention 28 or Sequence 30 or Sequence 32 or Sequence 34 or Sequence 36 or Sequence 38 or Sequence 40 or Sequence 42 or Sequence 44 or Sequence 46 or Sequence 48 or Sequence 50 or Sequence 52 or Sequence 54 or Sequence 56 or Sequence 58 or Sequence 60 or The nucleotide sequence of the protein consisting of the amino acid sequence shown in SEQ ID NO: 62 or SEQ ID NO: 64 or SEQ ID NO: 66 or SEQ ID NO: 68 or SEQ ID NO: 70 has 75% or higher, or 85% or higher, or 90% or higher, or 95% % or higher nucleotide sequence identity. Identity can be assessed with the naked eye or with computer software. Using computer software, the identity between two or more
  • the present invention also provides new uses of the substances represented by m1 or m2:
  • the present invention provides the application of the substance represented by m1 or m2 in cultivating a plant haploid induction line or cultivating a plant haploid or improving the inductive ability of a plant haploid.
  • the substance that inhibits the activity of the above-mentioned protein in plants can be any material that can cause the above-mentioned protein activity to be lost in the plant, such as a protein, a polypeptide or a small molecule that inhibits the above-mentioned protein synthesis or promotes the above-mentioned protein degradation or inhibits the above-mentioned protein function.
  • Compounds eg, inhibitors of protein activity
  • the material that suppresses the expression of the gene encoding the above-mentioned protein in the plant can be any material that can make the gene encoding the above-mentioned protein in the plant unable to express, such as the material (such as miRNA, siRNA, dsRNA, shRNA) that silences the gene encoding the above-mentioned protein in the plant. Wait);
  • the knockout means that the host cell carrying the knockout substance does not produce the functional protein product of the gene, and the knockout substance can be a substance that achieves that the host cell does not produce the functional protein product of the gene in any way, such as removing the functional protein product of the gene. All or part of the coding gene sequence, introducing frameshift mutations so that a functional protein is not produced, removing or altering regulatory components (eg, promoter editing) so that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Typically, the knockout is done at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout.
  • the substance for knocking out the gene encoding the above-mentioned protein in the plant can be any that can mutate the gene encoding the above-mentioned protein in the plant (the mutant form can be deletion mutation and/or insertion mutation and/or base substitution). ) to inactive substances, such as zinc finger protein ZFN gene editing system or TALENs gene editing system or CRISPR/Cas9 gene editing system, etc. Further, the substance for knocking out the gene encoding the above protein in the plant is the CRISPR/Cas9 gene editing system.
  • the present invention also provides a method for preparing a plant haploid inductive line.
  • the preparation method of the plant haploid induction line provided by the present invention is as follows D1) or D2):
  • the present invention also provides a method for preparing a plant haploid inductive line.
  • the preparation method of the plant haploid inducible line provided by the present invention includes the step of selfing the plant haploid inducible line prepared according to the above-mentioned preparation method of the plant haploid inducible line.
  • the present invention also provides a method for improving the haploid induction ability of plants.
  • the method for improving the haploid inducibility of plants comprises the following steps: inhibiting the activity of the above-mentioned protein in the recipient plant, or inhibiting the expression of the gene encoding the above-mentioned protein in the recipient plant, or knocking out the above-mentioned protein in the recipient plant.
  • the number of times of selfing is at least one time, specifically one time.
  • the preparation method of the above-mentioned plant haploid inducible line also includes the step of screening for homozygous mutants.
  • the homozygous mutant is a plant individual in which the two homologous chromosomes of the gene encoding the above protein have the same mutation.
  • the gene is BnDMP1A gene and/or BnDMP2A gene and/or BnDMP1C gene and/or BnDMP2C gene; the method is to inhibit BnDMP1A gene and/or BnDMP2A gene and/or BnDMP2A gene in rape. / or expression of BnDMP1C gene and/or BnDMP2C gene or knockout of BnDMP1A gene and/or BnDMP2A gene and/or BnDMP1C gene and/or BnDMP2C gene in rape, to obtain transgenic rape, that is, rape leuploid induction line;
  • the gene is NtDMP1 gene and/or NtDMP2 gene and/or NtDMP3 gene; the method is to inhibit the expression or knockout of NtDMP1 gene and/or NtDMP2 gene and/or NtDMP3 gene in tobacco Remove NtDMP1 gene and/or NtDMP2 gene and/or NtDMP3 gene in tobacco to obtain transgenic tobacco, namely tobacco haploid induction line;
  • the gene is GhDMP1 gene and/or GhDMP2 gene; the method is to inhibit the expression of GhDMP1 gene and/or GhDMP2 gene in cotton or knock out GhDMP1 gene and/or GhDMP2 gene in cotton , the transgenic cotton is obtained, which is the cotton haploid induction line.
  • the gene is GmDMP1 gene and/or GmDMP2 gene; the method is to inhibit the expression of GmDMP1 gene and/or GmDMP2 gene in soybean or knock out GmDMP1 gene and/or GmDMP2 gene in soybean , the transgenic soybean is obtained, which is the soybean haploid induction line.
  • the methods of knocking out the gene encoding the above protein in the recipient plant are all CRISPR/Cas9.
  • the method for knocking out the gene encoding the above-mentioned protein in the recipient plant includes the following steps: introducing a CRISPR/Cas9 vector containing the target sequence into the recipient plant to obtain a transgenic plant.
  • the target sequence targets the target gene (gene encoding the above-mentioned protein) in the recipient plant.
  • the gene encoding the above protein is sequence 1 or sequence 3 or sequence 5 or sequence 7 or sequence 9 or sequence 11 or sequence 13 or sequence 15 or sequence 17 or sequence 19 or sequence 21 or sequence 23 or sequence 25 or sequence 27 or Sequence 29 or Sequence 31 or Sequence 33 or Sequence 35 or Sequence 37 or Sequence 39 or Sequence 41 or Sequence 43 or Sequence 45 or Sequence 47 or Sequence 49 or Sequence 51 or Sequence 53 or Sequence 55 or Sequence 57 or Sequence 59 or Sequence 61 or SEQ ID NO: 63 or SEQ ID NO: 65 or SEQ ID NO: 67, positions 33-767, or SEQ ID NO: 69, positions 32-434.
  • the target sequence of the CRISPR/Cas9 is the 26th-45th position of SEQ ID NO:67, the 4th-23rd position of SEQ ID NO:63, the 56th-23rd position of SEQ ID NO:67 75 bits and sequence 63 bits 159-178.
  • the CRISPR/Cas9 vector containing the target sequence is specifically a vector obtained by inserting the DNA molecule shown in sequence 71 into the pDIRECT-22C vector.
  • the plant haploid-inducing line may specifically be a BnDMP gene mutation homozygous line bndmp-1 or a BnDMP gene mutation homozygous line bndmp-2.
  • the difference between the genomic DNA of the BnDMP gene mutation homozygous strain bndmp-1 and the wild-type rapeseed Westar is that the insertion of the base G occurs on both homologous chromosomes of the gene encoding BnDMP1A.
  • the base G The insertion position is between positions 162-163 of SEQ ID NO: 63, and the insertion of base G and base A occurs on both homologous chromosomes of the gene encoding BnDMP2A, and the inserted base G is located at position 42- of SEQ ID NO: 67 Between position 43, the inserted base A is located between positions 72-73 of sequence 67, and the insertion of base A has occurred on both homologous chromosomes of the gene encoding BnDMP2C, and the inserted base A is located in the sequence. 69 between positions 42-43 and sequence 69 between positions 72-73.
  • the insertion position is located between positions 162-163 of SEQ ID NO: 63, and a base substitution and an insertion of a base T have occurred on both homologous chromosomes of the gene encoding BnDMP2A, and the base substitution is SEQ ID NO: 43-
  • the DNA molecule shown at position 53 is replaced by the following sequence: TATAACA, the base T insertion is located between positions 72-73 of sequence 67, and the base A occurs on both homologous chromosomes of the gene encoding BnDMP2C
  • the insertion of base A is located between positions 42-43 of SEQ ID NO: 69 and between positions 72-73 of SEQ ID NO: 69.
  • the target sequence of the CRISPR/Cas9 is the 111-130th position of SEQ ID NO:59, the 278th-297th position of SEQ ID NO:59, and the 88th position of SEQ ID NO:57 -107 bits and sequence 57 bits 383-402.
  • the CRISPR/Cas9 vector containing the target sequence is specifically a vector obtained by inserting the DNA molecule shown in sequence 72 into the pDIRECT-22C vector.
  • the plant haploid-inducing line may specifically be a NtDMP gene mutation homozygous line ntdmp-1 or an NtDMP gene mutation homozygous line ntdmp-2.
  • the difference between the genomic DNA of the NtDMP gene mutation homozygous strain ntdmp-1 and the wild-type tobacco K326 is only that the base G deletion and fragment deletion have occurred on the two homologous chromosomes of the gene encoding NtDMP1.
  • the deletion Base G is located at position 91 of SEQ ID NO: 57, and the deletion fragment is located at position 115-399 of SEQ ID NO: 57, and a fragment deletion occurs on both homologous chromosomes of the gene encoding NtDMP2, and the deletion fragment is located at position 116- of SEQ ID NO: 59 281, and both base G deletion and fragment deletion occurred on the two homologous chromosomes of the gene encoding NtDMP3, the deleted base G is located at the 91st position of SEQ ID NO: 61, and the deletion fragment is located at the 115-399 position of SEQ ID NO: 61 .
  • the difference between the genomic DNA of the NtDMP gene mutation homozygous strain ntdmp-2 and the wild-type tobacco K326 is only that the base G deletion and the base A deletion occur on the two homologous chromosomes of the gene encoding NtDMP1,
  • the deleted base G is located at the 91st position of the sequence 57
  • the deleted base A is located at the 114th position of the sequence 57
  • a base substitution has occurred on both homologous chromosomes of the gene encoding NtDMP2
  • the base substitution is
  • the DNA molecule shown at positions 111-280 of SEQ ID NO: 59 is replaced with a base T, and a base A insertion has occurred on both homologous chromosomes of the gene encoding NtDMP3, and the inserted base A is located at positions 400- of SEQ ID NO: 61 between 401 bits.
  • the target sequence of the CRISPR/Cas9 is the 42-61st position of SEQ ID NO:53, the 79th-98th position of SEQ ID NO:53, and the 316th position of SEQ ID NO:53 -335 bits and sequence 53 bits 326-345.
  • the CRISPR/Cas9 vector containing the target sequence is specifically a vector obtained by inserting the DNA molecule shown in sequence 73 into the pDIRECT-22C vector.
  • the plant haploid-inducing line may specifically be a GhDMP gene mutation homozygous line ghdmp-1 or a GhDMP gene mutation homozygous line ghdmp-2.
  • the difference between the genomic DNA of the GhDMP gene mutation homozygous strain ghdmp-1 and the wild type Huamian No. 1 is only that the base C deletion occurs on the two homologous chromosomes of the gene encoding GhDMP1, and the deletion base Base C is located at position 342 of SEQ ID NO: 53, and a fragment deletion has occurred on both homologous chromosomes of the gene encoding GhDMP2, and the deleted fragment is located at positions 54-58 of SEQ ID NO: 55.
  • the base replacement is to replace the base T at position 345 of sequence 53 with base A, the deletion fragment is located at position 358-359 of sequence 53, and fragment deletions have occurred on both homologous chromosomes of the gene encoding GhDMP2, The deletion fragment is located at positions 59-83 of sequence 55.
  • the target sequence of the CRISPR/Cas9 is the 96th-115th position of sequence 43, the 112th-131th position of sequence 43 (the 112th position of sequence 45) -131), Sequence 45 168-187 and Sequence 43 350-369 (Sequence 45 350-369).
  • the nucleotide sequence of the CRISPR/Cas9 vector containing the target sequence is specifically shown in sequence 74 in the sequence listing.
  • the plant haploid-inducing line may specifically be a GmDMP gene mutation homozygous line gmdmp-1 or a GmDMP gene mutation homozygous line gmdmp-2.
  • the difference between the genomic DNA of the GmDMP gene mutation homozygous line gmdmp-1 and the wild-type soybean Williams 82 is only that a 226bp fragment deletion and 2 bases have occurred on both homologous chromosomes of the gene encoding GmDMP1.
  • Base deletion, the deletion fragment and the deleted base are located at positions 85-310 and 367-368 of sequence 43, respectively, and a 192-bp fragment deletion occurred on both homologous chromosomes of the gene encoding GmDMP2, and the deletion fragment is located in the sequence 45 Nos. 175-366.
  • the difference between the genomic DNA of the GmDMP gene mutation homozygous strain gmdmp-2 and the wild-type Williams 82 is only that a 267 bp fragment has been deleted on both homologous chromosomes of the gene encoding GmDMP1, and the deletion fragment is located in Sequence 43, positions 101-367, and a 195 bp fragment deletion occurred on both homologous chromosomes of the gene encoding GmDMP2, and the deletion fragment was located at positions 171-365 of sequence 45.
  • the plant haploid inducible line prepared according to the above-mentioned preparation method of the plant haploid inducible line also belongs to the protection scope of the present invention.
  • the above-mentioned plant haploid inducible line includes not only cells, tissues and organs (such as seeds, leaves, fruits, flowers, stems and roots) derived from the plant haploid inducible line, but also includes derived from the plant haploid Propagation material of inducible lines (e.g. pollen, ovary, ovule, germ, endosperm, egg cell, root, root tip, hypocotyl, cotyledon, stem, leaf, flower, anther, seed, meristem, protoplast and cell tissue cultivating groups).
  • inducible lines e.g. pollen, ovary, ovule, germ, endosperm, egg cell, root, root tip, hypocotyl, cotyledon, stem, leaf, flower, anther, seed, meristem, protoplast and cell tissue cultivating groups.
  • the preparation method of the above-mentioned plant haploid inducible line or the application of the above-mentioned plant haploid inducible line in the preparation of plant haploid also belong to the protection scope of the present invention.
  • the present invention also provides a method for preparing a plant haploid.
  • the preparation method of the plant haploid provided by the present invention comprises the following steps: self-crossing the plant haploid inducible line prepared according to the above-mentioned preparation method of the plant haploid inducible line or its progeny, or as a male parent with other plant materials Crossbreeding is carried out to obtain self-bred progeny or hybrid progeny, which are the plant haploids.
  • the preparation method of the above-mentioned plant haploid also comprises the steps of: carrying out fluorescent labeling identification and/or haploid trait identification and/or leaf ploidy identification and/or identification of the self-inbred progeny or the individual plant of the hybrid progeny. Or molecular marker identification, selecting at least one method to identify the progeny individual plant as a haploid is a plant haploid.
  • the fluorescent labeling identification method can be carried out according to the following method: the above-mentioned plant haploid induction line carrying the fluorescent protein expression element is used as the male parent to cross with the female parent to obtain hybrid progeny, and by detecting whether the hybrid progeny seeds are not. It has a fluorescent signal to judge whether the tested seed is haploid or tetraploid (diploid): if the tested seed has no fluorescence or weak fluorescence, the seed is or can be a haploid; if the tested seed shows strong fluorescence , the seed is or is candidate for tetraploid (diploid). Further, whether the seeds to be tested have fluorescence is detected by a fluorescent lamp.
  • the male parent carries the TagRFP fluorescent protein expression element driven by the promoter AtOLEO1, and it can be judged whether it is a haploid or a tetraploid (diploid) according to whether the hybrid progeny seed has red fluorescence.
  • the haploid trait identification method can be carried out according to the following method: if the plant to be tested has the characteristics of short plant, narrow leaves, overshoot, compact plant shape, male sterility, etc., then the plant is or is a candidate for haploid. ; If the plant to be tested has the characteristics of tall plant, broad leaves, scattered, normal fertility, etc., the plant is or is a candidate for tetraploid (diploid).
  • the leaf ploidy identification method can be carried out according to the following method: extract the nucleus of the young leaves of the plant to be tested, and use the tetraploid (diploid) plant leaves as a control; and then use a flow cytometer to detect the signal, and first detect four times.
  • the tetraploid (diploid) cell nuclear signal, and the tetraploid (diploid) cell nuclear signal peak position is set to 100 (because the genetic material in the tetraploid (diploid) cell is the same as the genetic material in the haploid cell) twice, so the haploid nuclear signal peaks around 50).
  • the plant is or can be considered as a haploid; if the signal peak of the plant to be tested appears near 100, it is enriched with the signal intensity of tetraploid (diploid) nucleus. If the positions are the same, the plant is or is a candidate for tetraploid (diploid).
  • the molecular marker identification can be carried out according to the following method: PCR amplification is carried out by using the male parent (maternal haploid inductive line) and the polymorphism primers between the maternal parents, and according to the PCR amplification product, it is judged whether the plant to be tested is haploid or not.
  • Tetraploid (diploid) if the amplified product of the plant to be tested only has the banding pattern of the female parent and no banding pattern of the male parent, the plant is or is a candidate for haploid; If the multiplication product has the heterozygous band type of the male parent and the female parent, the plant is or can be considered as a tetraploid (diploid).
  • the plant haploids prepared according to the above-mentioned method for preparing plant haploids also belong to the protection scope of the present invention.
  • the above-mentioned plant haploids include not only cells, tissues and organs (such as seeds, leaves, fruits, flowers, stems and roots) derived from the plant haploids, but also propagation materials derived from the plant haploids (such as pollen, ovary, ovule, germ, endosperm, egg cell, root, root tip, hypocotyl, cotyledon, stem, leaf, flower, anther, seed, meristem, protoplast and cell tissue culture composition).
  • the plant is a dicotyledonous plant; further, the dicotyledonous plant can be carrot, sunflower, papaya, sugar beet, melon , alfalfa, walnut, sesame, rubber tree, cassava, lotus, sweet cherry, Chinese rose, potato, grape, soybean, tomato, cucumber, pepper, cotton, tobacco or rape; further, the rape can specifically be wild type rape Westar Or hau-A; the tobacco can be wild-type tobacco K326; the cotton can be wild-type cotton Huamian No. 1; the soybean can be wild-type soybean Williams 82.
  • the present invention finally provides a method for preparing a transgenic plant with reduced haploid induction ability or increased fruit number.
  • the method for preparing a transgenic plant with reduced haploid inducibility or increased fruit number comprises the following steps: increasing the expression and/or activity of the above-mentioned proteins in a plant haploid inducing line to obtain a transgenic plant; the transgenic plant The haploid induction ability of the transgenic plant is lower than that of the plant haploid induction line, and the number of fruits of the transgenic plant is higher than that of the plant haploid induction line.
  • the method for increasing the expression level and/or activity of the above-mentioned protein in the plant haploid inducible line is to overexpress the above-mentioned protein in the plant haploid inducible line.
  • the overexpression method is to introduce the gene encoding the above-mentioned protein into a plant haploid inducible line.
  • the gene encoding the above-mentioned protein is Sequence 1 or Sequence 3 or Sequence 5 or Sequence 7 or Sequence 9 or Sequence 11 or Sequence 13 or Sequence 15 or Sequence 17 or Sequence 19 or Sequence 21 or Sequence 23 or Sequence 25 or sequence 27 or sequence 29 or sequence 31 or sequence 33 or sequence 35 or sequence 37 or sequence 39 or sequence 41 or sequence 43 or sequence 45 or sequence 47 or sequence 49 or sequence 51 or sequence 53 or sequence 55 or sequence 57 or sequence 59 or SEQ ID NO: 61 or SEQ ID NO: 63 or SEQ ID NO: 65 or SEQ ID NO: 67, positions 33-767, or SEQ ID NO: 69, positions 32-434.
  • the plant haploid inductive line is the knockout gene AtDMP8 (the AtDMP8 gene sequence is shown in the 95th-826th position of the sequence 75 in the sequence table) and AtDMP9 (the AtDMP9 gene sequence is shown in the 141st-875th position of the sequence 76 in the sequence table.
  • Arabidopsis thaliana mutants such as the Arabidopsis DMP gene mutant dmp8dmp9(T2-19-1), compared with the genomic DNA of wild-type Arabidopsis Col-0, the Arabidopsis DMP gene mutant dmp8dmp9(T2 -19-1)
  • fragment deletion occurs on both homologous chromosomes of the gene encoding the AtDMP8 protein, and the deleted fragment is located at positions 115-511 of sequence 75, and is located in the two homologous chromosomes of the gene encoding the AtDMP9 protein.
  • a fragment deletion occurred on all homologous chromosomes, and the deleted fragment was located at positions 161-564 of SEQ ID NO:76.
  • Figure 1 is a schematic diagram of the construction process of DMP gene complementary vectors of different crops.
  • Figure 2 is a comparison diagram of leuploid and tetraploid in oil.
  • Figure a is the seedling stage of oil lenoploid
  • Figure b is the flow test result
  • Figure c is the haploid mature stage.
  • panels a-c the left is the haploid and the right is the tetraploid.
  • Figure 3 is a comparison diagram of tobacco haploid and tetraploid.
  • Figure a is the seedling stage of tobacco haploid
  • Figure b is the result of flow test
  • Figure c is the flourishing period of tobacco haploid.
  • panels a-c the left is the haploid and the right is the tetraploid.
  • Figure 4 is a comparison diagram of soybean mutant seeds and fruit pods.
  • the left side of Figure a is the normally developed soybean seed, and the right side is the aborted seed of the mutant.
  • Figure b shows the comparison of soybean haploid and diploid pods, the left is the haploid, and the right is the diploid.
  • the following examples facilitate a better understanding of the present invention, but do not limit the present invention.
  • the experimental methods in the following examples are conventional methods unless otherwise specified.
  • the test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.
  • the quantitative tests in the following examples are all set to repeat the experiments three times, and the results are averaged.
  • the vectors pICH41295, pICH41308, pICH41276, pICH47742, pL1-F1-FastR, pICH41744 and pICSL4723 in the following examples are all described in the document "Engler C, Youles M, Gruetzner R, Ehnert T, Werner S, Jones J D G, Patron N J,Marillonnet S.A Golden Gate Modular Cloning Toolbox for Plants[J].ACS Synthetic Biology,2014,3(11):839-843.”, the public can obtain from the applicant, the test material is only for repeating the present invention It is used for related experiments and cannot be used for other purposes.
  • the Arabidopsis thaliana DMP gene mutants dmp8dmp9 (T2-19-1) and Col-0 in the following examples are all described in the document "Zhong Y, Chen B, Li M, Wang D, Jiao Y, Qi X, Wang M. , Liu Z,Chen C,Wang Y,Chen M,Li J,Xiao Z,Cheng D,Liu W,Boutilier K,Liu C,Chen S.A DMP-triggered in vivo maternal haploid induction system in the dicotyledonous Arabidopsis[J]. Nature Plants, 2020, 6(5): 466-472.”, the public can obtain from the applicant, the biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.
  • Wild-type cotton Huamian No. 1 in the following examples is described in the document “Wang, P. and J. Zhang, et al. (2016).” High efficient multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR/Cas9system .”Plant Biotechnology Journal 16(1):137-150.”, the public can obtain from the applicant, the biological material is only used for repeating the relevant experiments of the present invention, and cannot be used for other purposes.
  • the genes and proteins involved in the present invention and their sequences are shown in Table 1.
  • the DNA sequences in Table 1 are the CDS sequences of the corresponding genes except for the sequence 67 and the sequence 69, which encode the corresponding protein sequences.
  • Positions 33-767 of SEQ ID NO: 67 are the CDS sequences of the protein shown in SEQ ID NO: 68, and positions 32-434 of SEQ ID NO: 69 are the CDS sequences of the protein shown in SEQ ID NO: 70.
  • Example 1 Conservation verification of the haploid induction function of DMP homologous genes in different dicotyledonous crops
  • DMP homologous genes in carrot, sunflower, papaya, sugar beet, melon, alfalfa, walnut, sesame, rubber tree, cassava, lotus, sweet cherry, Chinese rose, potato and grape were handed over to GenScript Biotechnology Co., Ltd. company to synthesize.
  • the DMP homologous gene sequences in soybean, tomato, cucumber, pepper, cotton, tobacco and rape were cloned by PCR amplification.
  • Soybean GmDMP1 and GmDMP2 genes are highly homologous, and the amplification primers used are the same.
  • the amplification primers are designed for PCR amplification and cloned into the vector, and then single clones are selected and sequenced and compared with the GmDMP1 and GmDMP2 gene sequences respectively to obtain GmDMP1 and GmDMP2 gene sequence.
  • GmDMP1 and GmDMP2 gene amplification primers are as follows:
  • GmDMP1/2-CDS1F1 tttgaagacaaaatgGATCTAAACGAACAACAAATCGG (sequence 77);
  • GmDMP1/2-CDS1R1 tttgaagacaaCGAGGCCCCTCGGGGTGACG (SEQ ID NO: 78);
  • GmDMP1/2-CDS1F2-Annealing CTCGCCGTGTTCAAGCCCGCCGTGGCCGTCCCGGAGGACGA (sequence 79);
  • GmDMP1/2-CDS1R2-Annealing CCTGTCGTCCTCCGGACGGCCACGGCGGGCTTGAACACGG (sequence 80);
  • GmDMP1/2-CDS1F3 tttgaagacaaCAGGTTTAAGGTCGGGTTCAC (SEQ ID NO: 81);
  • GmDMP1/2-CDS1R3 tttgaagacaaAAGCCTAGGCAGACATGCAACCAA (sequence 82).
  • sequences of tomato SlDMP gene amplification primers are as follows:
  • SlDMP-CDS1F1 tttgaagacaaaatgGAGCAAACTAGTGAAGGA (sequence 83);
  • SlDMP-CDS1R1 tttgaagacaaACCTTTCATCTTTTGGCACATC (SEQ ID NO: 84);
  • SlDMP-CDS1F2 tttgaagacaaAGGTACATTGTGGGAGTGACA (sequence 85);
  • SlDMP-CDS1R2 tttgaagacaaAAGCCTAAGCAGACATACATCCAAC (SEQ ID NO: 86).
  • sequences of the amplification primers for the cucumber CsDMP gene are as follows:
  • CsDMP-CDS1F1 tttgaagacaaaatgGACGAACACACAGTAACC (sequence 87);
  • CsDMP-CDS1R1 tttgaagacaaCACCGACGGCAGAAGCATTTC (sequence 88);
  • CsDMP-CDS1F2 tttgaagacaaGGTGTCCGGGAAGGGGGAGTG (sequence 89);
  • CsDMP-CDS1R2 tttgaagacaaAAGCTCAATTAGCCATACAACCAATACCAT (SEQ ID NO: 90).
  • sequences of the amplification primers for the pepper CaDMP gene are as follows:
  • CaDMP-CDS1F1 tttgaagacaaaatgGAGCAAAGTAGTGAGGGA (sequence 91);
  • CaDMP-CDS1R1 tttgaagacaaGATGAAGAATTATCGACGCGCTTTG (sequence 92);
  • CaDMP-CDS1F2 tttgaagacaaCATCTTCAATGTACCCTACTAGTTTAC (SEQ ID NO: 93);
  • CaDMP-CDS1R2 tttgaagacaaACCTTTCATCTTTTGGGATTTCG (sequence 94);
  • CaDMP-CDS1F3 tttgaagacaaAGGTACATTGTGGGATTGACAGA (sequence 95);
  • CaDMP-CDS1R3 tttgaagacaaAAGCTTAAGCAGACATACATCCAACACC (SEQ ID NO: 96).
  • Cotton GhDMP1 and GhDMP2 genes are highly homologous, and the amplification primers used are the same.
  • the amplification primers are designed for PCR amplification and cloned into the vector. Then, single clones are selected and sequenced, respectively, and compared with the GhDMP1 and GhDMP2 gene sequences to obtain GhDMP1 and GhDMP2 gene sequence.
  • GhDMP1 and GhDMP2 gene amplification primers are as follows:
  • GhDMP1/2-CDS1F tttgaagacaaaatgGAGCAAACCCACCATGG (sequence 97);
  • GhDMP1/2-CDS1R tttgaagacaaAAGCTCAAGCAGCCATGCAACC (sequence 98).
  • NtDMP1, NtDMP2 and NtDMP3 genes are highly homologous, and the amplification primers used are the same.
  • the amplification primers were designed for PCR amplification and cloned into the vector. After picking single clones for sequencing, they were compared with the NtDMP1, NtDMP2 and NtDMP3 gene sequences respectively. Thus, the NtDMP1, NtDMP2 and NtDMP3 gene sequences were obtained.
  • the primers for the amplification of NtDMP1, NtDMP2 and NtDMP3 genes are as follows:
  • NtDMP-CDS1F1 tttgaagacaaaatgGAGCAAAGTACTGAGGGAATTG (sequence 99);
  • NtDMP1-CDS1R1 tttgaagacaaACCTCTTATCTTTTGGCACATCCA (sequence 100);
  • NtDMP2/3-CDS1R1 tttgaagacaaACCTCTCATCTTTTGGCACATCCA (SEQ ID NO: 101);
  • NtDMP-CDS1F2 tttgaagacaaAGGTACGTCGTGGGATTTAC (sequence 102);
  • NtDMP-CDS1R2 tttgaagacaaAAGCTTAAGCAGACATACATCCAATACCAT (SEQ ID NO: 103).
  • the BnDMP1A, BnDMP1C, BnDMP2A and BnDMP2C genes of rapeseed are highly homologous, and the amplification primers used are the same.
  • the amplification primers were designed for PCR amplification and cloned into the vector, and the single clones were picked and sequenced, respectively. Alignment was performed to obtain BnDMP1A, BnDMP1C, BnDMP2A and BnDMP2C gene sequences.
  • BnDMP1A, BnDMP1C, BnDMP2A and BnDMP2C gene amplification primers are as follows:
  • BnDMP1A/1C-CDS1F tttgaagacaaaatgGAGAAAACAGAGGAAAGT (sequence 104);
  • BnDMP1A/1C-CDS1R tttgaagacaaAAGCTCAAGCAGACATGCATCCAAC (sequence 105);
  • BnDMP2A/C-CDS1F tttgaagacaaaatgGAGAAAACAGAGGAAAGC (sequence 106);
  • BnDMP2A/C-CDS1R tttgaagacaaAAGCTCAAGCGGACATGCATCCAAC (SEQ ID NO: 107);
  • BnDMP2C-CDS1F2 tttgaagacaaAGAGATTCCGGTAAGTGATGATA (sequence 109).
  • the sequences of the Arabidopsis AtDMP9 gene promoter amplification primers are as follows:
  • DMP9-proF tttgaagacaaGGAGccttccaagactcgga (sequence 110);
  • DMP9-proR tttgaagacaaCATTTTTCGTGTGTTTCTCTCTGTTTTT (sequence 111).
  • the primer pair TerAtuNosF/R was used to amplify the AtuNos terminator sequence, and cloned into the level 0 vector pICH41276 to obtain the vector pL0-terAtuNos ( Figure 1c);
  • the sequences of the AtuNos terminator amplification primers are as follows:
  • TerAtuNosR tttgaagacaaAGCGTCGATCTAGTAACATAG (sequence 113).
  • the fragment between the BsaI enzyme cleavage sites in the vector pL0-DMP-CDS1 of different crop DMP homologous genes (DMP gene CDS sequence), and the vector pL0-AtDMP9-pro.
  • the fragment between the BsaI restriction sites (the promoter of the AtDMP9 gene gene) and the fragment between the BsaI restriction sites in the vector pL0-terAtuNos (AtuNos terminator sequence) were connected to the level 1 vector pICH47742 to obtain DMPs with different crops.
  • the Level 1 vector of the source gene pL1-F2-pDMP9::DMP-TerAtuNos (Fig. 1d).
  • the DMP homologous gene complementary vectors of different crops were respectively transformed into Agrobacterium GV3101, and then transformed into the Arabidopsis DMP gene mutant dmp8dmp9 (T2-19-1) by the dipping method, and then transformed by RFP fluorescence pair. Seeds were screened and positive transgenic seeds were finally obtained.
  • a indicates that the number of seeds is significantly different from that of dmp8dmp9; more than 3 independent transgenic plants were taken for each genotype material.
  • BnDMP represents four genes BnDMP1A, BnDMP2A, BnDMP1C and BnDMP2C
  • BnDMP knockout mutant was obtained. Because there are only three DMP homologous genes in rapeseed Westar, BnDMP1A, BnDMP2A and BnDMP2C. Therefore, only these three genes are knocked out, and the specific steps are as follows:
  • the target site sequences were designed on the BnDMP1A, BnDMP2A and BnDMP2C genes, respectively, with a length of 20 bp.
  • Target site 1 is located at positions 26-45 of sequence 67 and 26-45 of sequence 69, and the sequence of target site 1 is CACGAAAATGGAGAAAACAG (sequence 114).
  • Target site 2 is located at positions 4-23 of sequence 63, and the sequence of target site 2 is GAGAAAACAGAGGAAAGTGT (sequence 115).
  • Target site 3 is located at positions 56-75 of sequence 67, and positions 56-75 of sequence 69, and the sequence of target site 3 is TGGGATCAGGTTTACACGA (sequence 116).
  • Target site 4 is located at positions 159-178 of sequence 63, and the sequence of target site 4 is GAACTCCTTGAGCGACCATG (sequence 117).
  • the CRISPR/Cas9 vector is a vector obtained by inserting the DNA molecule shown in sequence 71 into the pDIRECT-22C vector.
  • the CRISPR/Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cell GV3101 by heat shock (Agrobacterium GV3101 competent cell was purchased from Beijing Orsen Dingxin Biotechnology Co., Ltd., which can be obtained by the public) to obtain recombinant strain GV3101 /CRISPR/Cas9.
  • the recombinant strain GV3101/CRISPR/Cas9 was transformed into wild-type rape Westar by Agrobacterium infection method (recombinant Agrobacterium was propagated at 28°C, and the amplified bacterial liquid was used to infect rape Westar), and after kana-resistant Transgenic rape plants of T0 generation were obtained after sexual screening.
  • the leaves of the T0 generation transgenic rape plant obtained in step 3 were collected, and genomic DNA was extracted as a template, and the following primers were used for PCR amplification to obtain PCR amplification products of different lines.
  • the sequences of BnDMP1A gene mutation sequence detection primers are as follows:
  • BnDMP1AF1 CTTCTTGATTCCAGAGATCAC (sequence 118);
  • BnDMP1AR1 GAAGAAGAAGCAGGAGGTTG (sequence 119).
  • the sequences of BnDMP2A gene mutation sequence detection primers are as follows:
  • BnDMP2AF1 CCACCACTGGTTAAGCGATACT (SEQ ID NO: 120);
  • BnDMP2AR1 CATGCGACGTTTTCGACCTC (SEQ ID NO: 121).
  • the sequences of BnDMP2C gene mutation sequence detection primers are as follows:
  • BnDMP2CF2 CCCTTAGGACTAACGAACTCGC (sequence 122);
  • BnDMP2CR1 CACTTACCGGAATCTCTGCCTC (sequence 123).
  • the PCR amplification products of different strains were subjected to Sanger sequencing, and the corresponding BnDMP genes of wild-type rape Westar were compared according to the sequencing results.
  • the genotypes of each BnDMP were identified according to the following principles.
  • the genotype of the line is a heterozygous genotype (BnDMP gene mutation on one of the two homologous chromosomes, and BnDMP on the other chromosome The gene is not mutated), the strain is a heterozygous mutant strain of T0 generation transgenic rapeseed;
  • the genotype of the line is wild-type, that is, the BnDMP gene sequence has no mutation; If the BnDMP gene sequences of Westar are different, the genotype of the line is homozygous genotype (the BnDMP gene on two homologous chromosomes is mutated), and the line is a homozygous mutant line of T0 generation transgenic rapeseed.
  • the T0 generation transgenic rapeseed BnDMP gene mutant line obtained in step 4 is selfed, and the seeds are harvested and then sown to obtain the T1 generation transgenic rapeseed.
  • the specific method is as follows: using the genomic DNA of the T1 generation transgenic rapeseed as a template, using the mutant sequence detection primers of the BnDMP1A, BnDMP2A and BnDMP2C genes respectively, according to the method in step 4 to identify the T1 generation transgene Genotypes of the three BnDMP genes in rapeseed.
  • T1 generation transgenic rapeseed BnDMP gene mutation homozygous lines bndmp-1 and bndmp-2 were obtained.
  • the specific changes are as follows:
  • the difference between the genomic DNA of bndmp-1 homozygous line bndmp-1 and wild-type rape Westar for three BnDMP gene mutations in T1 generation transgenic rapeseed is that the insertion of the base G has occurred on the two homologous chromosomes of the gene encoding BnDMP1A.
  • the base G insertion position is located between positions 162-163 of sequence 63, and the insertion of base G and base A has occurred on both homologous chromosomes of the gene encoding BnDMP2A, and the inserted base G is located in the sequence.
  • the inserted base A is located between positions 72-73 of sequence 67, and the insertion of base A has occurred on both homologous chromosomes of the gene encoding BnDMP2C, and the inserted base Base A is located between positions 42-43 of sequence 69 and between positions 72-73 of sequence 69.
  • the base G insertion position is located between positions 162-163 of sequence 63, and base substitution and base T insertion have occurred on both homologous chromosomes of the gene encoding BnDMP2A, and the base substitution is to replace the sequence
  • the DNA molecule shown at positions 43-53 of 67 is replaced by the following sequence: TATAACA, the base T insertion is located between positions 72-73 of sequence 67 and occurs on both homologous chromosomes to the gene encoding BnDMP2C
  • An insertion of base A between positions 42-43 of SEQ ID NO: 69 and between positions 72-73 of SEQ ID NO: 69 was performed.
  • T1 generation transgenic rape mutant lines were used for the following haploid induction ability analysis experiments.
  • the inbred progeny of the mutant obtained by knocking out the BnDMP gene cannot be identified by molecular markers. Therefore, seeds obtained by selfing of mutants of different types of combinations obtained by the BnDMP gene were planted, and the selfed progeny were haploidized by the following method.
  • the haploid has the characteristics of short plant, narrow leaves, and updraft, compact plant type, and male sterility.
  • the tetraploid is characterized by tall plants and wide leaves. Scattered, fertility was normal (Fig. 2a, c).
  • the plants with haploid traits obtained in the above step 1 are subjected to flow cytometry detection, and the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the tetraploid rape leaves as a control; then use flow cytometry to detect Signal, first detect the tetraploid nuclear signal, and set the peak position of the tetraploid nuclear signal to 100 (since the genetic material in the tetraploid cell is twice the genetic material in its haploid cell, therefore, the haploid The nuclear signal peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enriched position of the signal intensity of the tetraploid nucleus, and the plant to be tested is a tetraploid (Fig. 2b).
  • the plant is a haploid plant; if the identification results of any of the above methods are not haploid ploidy, the plant is not a haploid plant.
  • WT is the rape wild-type material Westar.
  • the mutants of different combinations obtained by the BnDMP gene were crossed with rapeseed hau-A material to obtain progeny, and the haploids in the progeny were identified by the following method.
  • the CRISPR/Cas9 vector carries the promoter AtOLEO1 to drive the expression element of TagRFP (Entacmaea quadricolor). Since the promoter AtOLEO1 is specifically expressed in mature seed embryos, the fluorescent signal of TagRFP can be observed by fluorescent light. Therefore, using the mutant carrying the expression element as the male parent to cross with other non-fluorescent female parent materials, among the resulting seeds, the embryos of the tetraploid seeds showed red fluorescence due to the genome of the male parent, while the single Embryos of ploidy seeds exhibited weak fluorescence due to their maternal origin.
  • TagRFP Entacmaea quadricolor
  • the weakly fluorescent seeds identified in the above step 1 were further planted, their genomic DNA was extracted, and the polymorphism primers (A07F+A07R) between the rapeseed hau-A material and the transgenic rapeseed mutant lines were used for PCR amplification, and the amplification was carried out.
  • the product is detected by agarose band type. If the amplified product of the individual plant to be tested shows one band, it is considered that the band of the individual plant is the band type of rapeseed hau-A material, and there is no band type of the male parent material, then the single The strain is haploid. If the amplified product of the individual plant to be tested shows two bands, it is considered that the individual plant band is a heterozygous band type between the rapeseed hau-A material and the transgenic rapeseed mutant line. ploidy.
  • A07F CGGGGCCATAAAAACAGTGAAG (SEQ ID NO: 124);
  • A07R GCCTTCAGCGACTTGAACATC (sequence 125).
  • the phenotypes of the haploid plants identified in the above step 2 were further observed.
  • the haploids have the characteristics of short plants, narrow leaves, and upshoots, compact plant types, and male sterility, while tetraploids show tall plants. , the leaves were broad and scattered, and the fertility was normal (Fig. 2a, c).
  • the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the tetraploid rape leaves as a control; and then use a flow cytometer to detect the signal. , firstly detect the tetraploid nuclear signal, and set the peak position of the tetraploid nuclear signal to 100 (because the genetic material in the tetraploid cell is twice that of the haploid cell, therefore, the haploid nucleus The signal peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enriched position of the signal intensity of the tetraploid nucleus, and the plant to be tested is a tetraploid (Fig. 2b).
  • the plant is a haploid plant; if any of the above methods is used. If the identification result is not haploid, the plant is not a haploid plant.
  • WT is the rape wild-type material Westar.
  • the CRISPR/Cas9 system was used to knock out the NtDMP gene in tobacco (NtDMP represents three genes, NtDMP1, NtDMP2 and NtDMP3), and the NtDMP gene knockout tobacco mutant was obtained. Specific steps are as follows:
  • the target site sequences were designed on the NtDMP1, NtDMP2 and NtDMP3 genes, respectively, with a length of 20 bp.
  • Target site 1 is located at positions 111-130 of sequence 59, and the sequence of target site 1 is TTGCTGGTTGAGGCAATTCG (sequence 126).
  • Target site 2 is located at positions 278-297 of sequence 59, and the sequence of target site 2 is AATCATTAGTGTAGTGACAG (sequence 127).
  • Target site 3 is located at positions 88-107 of sequence 57 and 88-107 of sequence 61, and the sequence of target site 3 is ATCGGAACATCGTTATCTGG (sequence 128).
  • Target site 4 is located at positions 383-402 of sequence 57, positions 383-402 of sequence 59, and positions 383-402 of sequence 61, and the sequence of target site 4 is ATGGATTTGTGACACCAAGA (sequence 129).
  • the CRISPR/Cas9 vector is a vector obtained by inserting the DNA molecule shown in sequence 72 into the pDIRECT-22C vector.
  • the CRISPR/Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cell GV3101 by heat shock (Agrobacterium GV3101 competent cell was purchased from Beijing Orsen Dingxin Biotechnology Co., Ltd., which can be obtained by the public) to obtain recombinant strain GV3101 /CRISPR/Cas9.
  • the recombinant bacteria GV3101/CRISPR/Cas9 was transformed into wild-type tobacco K326 by Agrobacterium infection method (recombinant Agrobacterium was propagated at 28°C, and the propagated bacterial solution was used for tobacco K326 infection), and after kana-resistant T0 generation transgenic tobacco plants were obtained after sexual screening.
  • the leaves of the T0 generation transgenic tobacco plants obtained in step 3 were collected, and genomic DNA was extracted as a template, and the following primers were used for PCR amplification to obtain PCR amplification products of different lines.
  • sequences of primers for NtDMP1 gene mutation sequence detection are as follows:
  • NtDMP1+3F2 ACTGAAAACTTCATTCGTGATCATT (sequence 130);
  • NtDMP1R1 TCGCCACAAATATTAATCCACATGA (SEQ ID NO: 131).
  • sequences of primers for NtDMP2 gene mutation sequence detection are as follows:
  • NtDMP3F GCAAAGTACTGAGGGAATTGGG (sequence 132);
  • NtDMP2R AGACGATCGGTCTGGTGATA (sequence 133).
  • NtDMP3 gene mutation sequence detection primers are as follows:
  • NtDMP1+3F2 ACTGAAAACTTCATTCGTGATCATT (sequence 134);
  • NtDMP3R2 TCAACCCACATGGATGAATTCTG (sequence 135).
  • the PCR amplification products of different strains were subjected to Sanger sequencing, and the corresponding NtDMP genes of wild-type tobacco K326 were compared according to the sequencing results.
  • the genotypes of each NtDMP were identified according to the following principles.
  • the genotype of the line is a heterozygous genotype (the NtDMP gene mutation on one of the two homologous chromosomes, and the NtDMP gene on the other chromosome The gene is not mutated), the strain is a T0 generation transgenic tobacco heterozygous mutant strain;
  • the genotype of the line is wild-type, that is, the NtDMP gene sequence has no mutation; If the NtDMP gene sequence of K326 is different, the genotype of the line is homozygous genotype (the NtDMP gene on two homologous chromosomes is mutated), and the line is a T0 generation transgenic tobacco homozygous mutant line.
  • the T0 generation transgenic tobacco NtDMP gene mutant line obtained in step 4 is selfed, and the seeds are harvested and then sown to obtain the T1 generation transgenic tobacco.
  • the specific method is as follows: using the genomic DNA of the T1 generation transgenic tobacco as a template, using the mutant sequence detection primers of the NtDMP1, NtDMP2 and NtDMP3 genes respectively, according to the method in step 4 to identify the T1 generation transgenic Genotypes of tobacco NtDMP1, NtDMP2 and NtDMP3 genes.
  • T1 generation transgenic tobacco NtDMP gene mutation homozygous lines ntdmp-1 and ntdmp-2 were obtained.
  • the specific mutations are as follows:
  • the difference between the genomic DNA of ntdmp-1 line ntdmp-1 homozygous for three NtDMP gene mutations in T1 generation transgenic tobacco and wild-type tobacco K326 is only that the base G deletion and fragment have occurred on the two homologous chromosomes of the gene encoding NtDMP1. Deletion, the deletion base G is located at position 91 of sequence 57, the deletion fragment is located at position 115-399 of sequence 57, and fragment deletion occurs on both homologous chromosomes of the gene encoding NtDMP2, and the deletion fragment is located in sequence 57. 59 Nos.
  • the deleted base G is located at the 91st position of SEQ ID NO: 61
  • the deleted fragment is located at the SEQ ID NO: 61 115-399 bits.
  • ntdmp-2 line ntdmp-2 homozygous for three NtDMP gene mutations in T1 generation transgenic tobacco and wild-type tobacco K326 is only that the base G deletion and base G deletion occurred on the two homologous chromosomes of the gene encoding NtDMP1.
  • the base A is deleted, the deleted base G is located at the 91st position of SEQ ID NO: 57, the deleted base A is located at the 114th position of the sequence 57, and base substitutions have occurred on both homologous chromosomes of the gene encoding NtDMP2, the base The base was replaced by replacing the DNA molecule shown at positions 111-280 of SEQ ID NO: 59 with the base T, and a base A insertion occurred on both homologous chromosomes of the gene encoding NtDMP3, and the inserted base A was located in the sequence 61 between the 400th and 401st.
  • T1 generation transgenic tobacco mutant lines were used for the following haploid induction ability analysis experiments.
  • the haploid has the characteristics of short plant, narrow leaves, and updraft, compact plant type, and male sterility.
  • the tetraploid is characterized by tall plants and wide leaves. Scattered, fertility was normal (Fig. 3a).
  • the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the tetraploid tobacco leaves as a control; and then use a flow cytometer to detect the signal. , first detect the tetraploid nuclear signal, and set the peak position of the tetraploid nuclear signal to 100 (because the genetic material in the tetraploid cell is twice that of the haploid cell, therefore, the haploid nuclear signal The peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enriched position of the signal intensity of the tetraploid nucleus, and the plant to be tested is a tetraploid (Fig. 3b).
  • the plant is a haploid plant; if the identification results of any of the above methods are not haploid The plant is not a haploid plant.
  • genotype Total number of plants haploid number Haploid induction rate (%) WT 329 0 0 ntdmp-1 1111 8 0.72 ntdmp-2 291 3 1.03
  • WT is tobacco wild-type material K326.
  • mutants of different combinations obtained by the NtDMP gene were crossed with the wild-type tobacco K326 material to obtain progeny, and the haploids in the progeny were identified by the following method.
  • the CRISPR/Cas9 vector carries the promoter AtOLEO1 to drive the expression element of TagRFP (Entacmaea quadricolor). Since the promoter AtOLEO1 is specifically expressed in mature seed embryos, the fluorescent signal of TagRFP can be observed by fluorescent light. Therefore, using the mutant carrying the expression element as the male parent to cross with other non-fluorescent female parent materials, among the obtained seeds, the embryos of the tetraploid seeds showed red fluorescence due to the genome of the male parent, while the single embryos showed red fluorescence. Embryos of ploidy seeds exhibited weak fluorescence due to their maternal origin.
  • the weakly fluorescent seeds identified in the above step 1 were further planted, their genomic DNA was extracted, and the polymorphism primers (NtDMP3F+NtDMP2R) between wild-type tobacco K326 materials and transgenic tobacco mutant lines were used for PCR amplification, and the amplification was carried out.
  • the product is tested for the agarose band pattern. If the amplified product of the individual plant to be tested shows one band, it is considered that the band of the single plant is the band pattern of the wild-type tobacco K326 material, and there is no band pattern of the male parent material.
  • the strain is haploid.
  • the single plant band is a heterozygous band type between the wild-type tobacco K326 material and the transgenic tobacco mutant line, then the single plant is the offspring of normal hybridization, and it is four ploidy.
  • the phenotypes of the plants identified in the above step 2 were further observed.
  • the haploids have the characteristics of short plants, narrow leaves, and updraft, compact plant types, and male sterility, while tetraploids show tall plants and wide leaves. , scattered, and the fertility was normal (Fig. 3a, c).
  • the plants obtained in the above step 3 showing haploid traits are subjected to flow cytometry detection, and the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the tetraploid tobacco leaves as a control; and then use a flow cytometer to detect the signal , first detect the tetraploid nuclear signal, and set the peak position of the tetraploid nuclear signal to 100 (because the genetic material in the tetraploid cell is twice that of the haploid cell, therefore, the haploid nuclear signal The peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enriched position of the signal intensity of the tetraploid nucleus, and the plant to be tested is a tetraploid (Fig. 3b).
  • the plant is a haploid plant; if the identification result of any of the above methods is haploid If not haploid, the plant is not a haploid plant.
  • WT is tobacco wild-type material K326.
  • the CRISPR/Cas9 system was used to knock out the GhDMP gene in cotton (GhDMP gene represents two genes, GhDMP1 and GhDMP2), and a cotton mutant with GhDMP gene knockout was obtained. Specific steps are as follows:
  • the target site sequences were designed on the GhDMP1 and GhDMP2 genes, respectively, with a length of 20 bp.
  • Target site 1 is located at positions 42-61 of sequence 53, and positions 42-61 of sequence 55, and the sequence of target site 1 is TACTGCAACACCACCCCCAG (sequence 136).
  • Target site 2 is located at positions 79-98 of sequence 53 and 79-98 of sequence 55, and the sequence of target site 2 is AGTCGAGGGAGGGAAGAGAG (sequence 137).
  • Target site 3 is located at positions 316-335 of sequence 53 and 316-335 of sequence 55, and the sequence of target site 3 is CATTTCACCGATAGTTTCCG (sequence 138).
  • Target site 4 is located at positions 326-345 of sequence 53, and the sequence of target site 4 is ATAGTTTCCGAGGCCCCGAT (sequence 139).
  • the CRISPR/Cas9 vector is a vector obtained by inserting the DNA molecule shown in sequence 73 into the pDIRECT-22C vector.
  • the CRISPR/Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cell GV3101 by heat shock (Agrobacterium GV3101 competent cell was purchased from Beijing Orsen Dingxin Biotechnology Co., Ltd., which can be obtained by the public) to obtain recombinant strain GV3101 /CRISPR/Cas9.
  • the recombinant strain GV3101/CRISPR/Cas9 was transformed into wild-type cotton Huamian No. 1 by Agrobacterium infection method (recombinant Agrobacterium was propagated at 28°C, and the amplified bacterial solution was used for wild-type cotton Huamian No. 1 infection. ), the T0 generation transgenic cotton plants were obtained after kana resistance screening.
  • the leaves of the T0 generation transgenic cotton plants obtained in step 3 were collected, and genomic DNA was extracted as a template.
  • PCR amplification was performed using the following primers to obtain PCR amplification products of different strains.
  • sequences of primers for the detection of GhDMP1 gene mutation sequences are as follows:
  • GhDMP1F ACATTAACACCAAGAATGGCTCAA (sequence 140);
  • GhDMP1R CAACACCGACATCACGGCAT (sequence 141).
  • sequences of primers for detection of GhDMP2 gene mutation sequences are as follows:
  • GhDMP2F TGGCTGCTTCATTCATACTTATCG (sequence 142);
  • GhDMP2R GACGCGAATCTAGTCTTTGGA (sequence 143).
  • the PCR amplification products of different lines were sequenced by Sanger, and the corresponding GhDMP genes of wild-type cotton Huamian 1 were compared according to the sequencing results.
  • the genotypes of each GhDMP were identified according to the following principles.
  • the genotype of the line is a heterozygous genotype (GhDMP gene mutation on one of the two homologous chromosomes, and GhDMP on the other chromosome The gene is not mutated), the line is a T0 generation transgenic cotton heterozygous mutant line;
  • the genotype of the line is wild-type, that is, the GhDMP gene sequence has not been mutated; If the GhDMP gene sequence of Huamian 1 is different, the genotype of the line is a homozygous genotype (the GhDMP gene on two homologous chromosomes is mutated), and the line is a homozygous mutant strain of T0 transgenic cotton Tie.
  • the T0 generation transgenic cotton GhDMP gene mutant line obtained in step 4 is selfed, and the seeds are harvested and then sown to obtain T1 generation transgenic cotton.
  • the specific method is as follows: using the genomic DNA of the T1 generation transgenic cotton as a template, using the mutant sequence detection primers of the GhDMP1 and GhDMP2 genes respectively, according to the method in step 4 to identify the T1 generation transgenic cotton GhDMP1 and the genotype of the GhDMP2 gene.
  • T1 generation transgenic cotton GhDMP gene mutation homozygous lines ghdmp-1 and ghdmp-2 were obtained.
  • the specific mutations are as follows:
  • the difference between the genomic DNA of the T1-generation transgenic cotton GhDMP gene mutation homozygous line ghdmp-1 and the wild-type Huamian No. 1 is that the deletion of base C occurs on the two homologous chromosomes of the gene encoding GhDMP1.
  • the deleted base C is located at position 342 of SEQ ID NO: 53, and a fragment deletion occurs on both homologous chromosomes of the gene encoding GhDMP2, and the deleted fragment is located at positions 54-58 of SEQ ID NO: 55.
  • the difference between the genomic DNA of the T1-generation transgenic cotton GhDMP gene mutation homozygous line ghdmp-2 and the wild-type Huamian No. 1 is that the base substitution and fragment deletion occurred on both homologous chromosomes of the gene encoding GhDMP1.
  • the base is replaced by the base T at position 345 of sequence 53 is replaced by base A
  • the deletion fragment is located at position 358-359 of sequence 53
  • fragments have occurred on both homologous chromosomes of the gene encoding GhDMP2 Deletion
  • the deletion fragment is located at positions 59-83 of sequence 55.
  • T1 generation transgenic cotton mutant lines were used for the following haploid induction ability analysis experiments.
  • the inbred progeny of the mutant obtained by knocking out the GhDMP gene on this background cannot be identified by molecular markers. Therefore, seeds obtained by selfing of mutants of different combinations of GhDMP gene were planted, and the selfed progeny were haploid identified by the following method.
  • the haploid After planting the selfed seeds, observe the phenotype of a single plant.
  • the haploid has the characteristics of short plant, narrow leaves, and updraft, compact plant type, and male sterility.
  • the tetraploid is characterized by tall plants and wide leaves. Scattered, fertility normal.
  • the plants with haploid traits obtained in the above step 1 are subjected to flow cytometry detection, and the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the tetraploid cotton leaves as a control; then use flow cytometry to detect Signal, first detect the tetraploid nuclear signal, and set the peak position of the tetraploid nuclear signal to 100 (because the genetic material in the tetraploid cell is twice the genetic material in the haploid cell, therefore, the haploid cell nucleus The signal peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enrichment position of the signal intensity of the tetraploid nucleus, and the plant to be tested is a tetraploid.
  • the plant is a haploid plant; if the identification results of any of the above methods are not haploid ploidy, the plant is not a haploid plant.
  • WT cotton wild-type material Huamian No. 1.
  • the mutants of different combinations obtained by GhDMP gene were crossed with wild-type Huamian No. 1 to obtain offspring, and the haploids in the offspring were identified by the following methods.
  • the CRISPR/Cas9 vector carries the promoter AtOLEO1 to drive the expression element of TagRFP (Entacmaea quadricolor). Since the promoter AtOLEO1 is specifically expressed in mature seed embryos, the fluorescent signal of TagRFP can be observed by fluorescent light. Therefore, using the mutant carrying the expression element as the male parent to cross with other non-fluorescent female parent materials, among the resulting seeds, the embryos of the tetraploid seeds showed red fluorescence due to the genome of the male parent, while the single Embryos of ploidy seeds exhibited weak fluorescence due to their maternal origin.
  • TagRFP Entacmaea quadricolor
  • the weakly fluorescent seeds identified in the above step 1 were further planted, their genomic DNA was extracted, and the polymorphism primers (GhDMP1F+GhDMP1R) between wild-type Huamian No. 1 and transgenic cotton mutant lines were used for PCR amplification, and the amplification was carried out.
  • the amplified product is detected by agarose band type and then sequenced. If the sequence peak of the amplified product of the individual plant to be tested shows a single peak and is consistent with the sequence of wild-type Huamian No. 1, the individual plant is considered to be wild-type Huamian No. 1. If there is no band pattern of the male parent material, the individual plant is haploid.
  • the sequencing peak of the amplified product of the single plant to be tested is a heterozygous peak, it is considered that the single plant is the heterozygous band type of the wild-type Huamian No. 1 and the transgenic cotton mutant line, and the single plant is the offspring of normal hybridization. is tetraploid.
  • the phenotypes of the plants identified in the above step 2 were further observed.
  • the haploids have the characteristics of short plants, narrow leaves, and updraft, compact plant types, and male sterility, while tetraploids show tall plants and wide leaves. , Phi scattered, normal fertility.
  • the plants with haploid traits obtained in the above step 3 are subjected to flow cytometry detection, and the specific method is as follows: extract the cell nucleus of the young leaves of the plants to be tested, and use the tetraploid cotton leaves as a control; then use flow cytometry to detect Signal, first detect the tetraploid nuclear signal, and set the peak position of the tetraploid nuclear signal to 100 (because the genetic material in the tetraploid cell is twice the genetic material in the haploid cell, therefore, the haploid cell nucleus The signal peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enrichment position of the signal intensity of the tetraploid nucleus, and the plant to be tested is a tetraploid.
  • the plant is a haploid plant; if any of the above If the method identification result is not haploid, the plant is not a haploid plant.
  • WT cotton wild-type material Huamian No. 1.
  • the target site sequences were designed on the GmDMP1 and GmDMP2 genes, respectively, with a length of 20 bp.
  • Target site 1 is located at positions 96-115 of sequence 43, and the sequence of target site 1 is GATGTTTCTTGGGTTGTGGA (sequence 144).
  • Target site 2 is located at positions 112-131 of sequence 43 and 112-131 of sequence 45, and the sequence of target site 2 is CATCGTGCCCTAATGGCAAA (sequence 145).
  • Target site 3 is located at positions 168-187 of sequence 45, and the sequence of target site 3 is CTGTGGGGAGGAAGTTACCG (sequence 146).
  • Target site 4 is located at positions 350-369 of sequence 43 and 350-369 of sequence 45, and the sequence of target site 4 is ACTATGGCTTCGTCACCCCG (sequence 147).
  • sequence 74 The nucleotide sequence of the CRISPR/Cas9 vector is shown in sequence 74 in the sequence listing. Wherein, positions 227-1826 of sequence 74 are the Bar resistance selection marker expression element p35s:Bar, positions 1851-7084 are the Cas9 expression element p35s:Cas9, and positions 7143-9456 are the expression elements for the promoter AtOLEO1 to drive TagRFP, Positions 9481-10882 are gRNA expression elements of GmDMP1 and GmDMP2 genes.
  • the CRISPR/Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cell EHA105 by heat shock (Agrobacterium EHA105 competent cell was purchased from Beijing Orsen Dingxin Biotechnology Co., Ltd., and the public can purchase it) to obtain recombinant strain EHA105 /CRISPR/Cas9.
  • the recombinant strain EHA105/CRISPR/Cas9 was transformed into wild-type soybean Williams 82 by Agrobacterium infection method (recombinant Agrobacterium was propagated at 28°C, and the amplified bacterial solution was used for wild-type soybean Williams 82 infection. ), the TO generation transgenic soybean plants were obtained after Bar resistance screening.
  • the leaves of the T0 generation transgenic soybean plants obtained in step 3 were collected, and genomic DNA was extracted as a template. Since GmDMP1 and GmDMP2 genes are highly homologous, primers for specific amplification of each cannot be designed. Therefore, the primer pair (GmDMPF/R) was used for PCR amplification first, and the PCR amplification products of different strains were obtained and connected to the T vector, and then transformed into E. coli competent cells (T vector and E. coli competent cells were purchased from Beijing Quanzhijin Biotechnology , the public can be purchased), pick and identify single clones.
  • sequences of primers for detection of GmDMP1 gene and GmDMP2 gene mutation sequences are as follows:
  • GmDMPF TCTAAACGAACAACAAATCGGCA (sequence 148);
  • GmDMPR CGACCTTAAAACCTGTCGTCT (sequence 149).
  • At least 10 correct single clones were selected from the leaves of each T0 generation transgenic soybean plant for Sanger sequencing, and the sequencing results were compared with the GmDMP1 gene and GmDMP2 gene of wild-type soybean Williams 82 respectively.
  • the genotypes of each GmDMP were identified according to the following principles.
  • SNPs between the sequences outside the GmDMP1 and GmDMP2 gene targets of wild-type soybean Williams 82 (Table 9). Specifically, according to the SNP, it is possible to distinguish whether the monoclonal sequence is derived from the GmDMP1 gene or the GmDMP2 gene.
  • the GmDMP gene mutation was determined according to the following principles.
  • the genotype of the line is wild-type, that is, there is no mutation in the GmDMP gene sequence; If the gene sequences are different, the genotype of the line is a heterozygous genotype (the GhDMP gene on one of the two homologous chromosomes is mutated, and the GhDMP gene on the other chromosome is not mutated), and the line is T0 generation transgenic soybean heterozygous mutant line; if all single clones have different GmDMP gene sequences from wild-type Williams 82, the genotype of the line is homozygous genotype (GmDMP gene on 2 homologous chromosomes) mutation), this line is a homozygous mutant line of TO generation transgenic soybean.
  • the T0 generation transgenic soybean GmDMP gene mutant line obtained in step 4 is selfed, and the seeds are harvested and then sown to obtain the T1 generation transgenic soybean.
  • the specific method is as follows: using the genomic DNA of the T1 generation transgenic soybean as a template, using the mutation sequence detection primers of the GmDMP1 and GmDMP2 genes respectively, according to the method in step 4 to identify the T1 generation transgenic soybean GmDMP1 and the genotype of the GmDMP2 gene.
  • the deletion fragment is located in Sequence 45 bits 175-366.
  • the difference between the genomic DNA of the GmDMP gene mutation homozygous line gmdmp-2 in T1 generation transgenic soybean and the wild-type Williams 82 is only the deletion of a 267 bp fragment on both homologous chromosomes of the gene encoding GmDMP1.
  • the fragment is located at positions 101-367 of SEQ ID NO: 43, and a 195 bp fragment is deleted on both homologous chromosomes of the gene encoding GmDMP2, and the deleted fragment is located at positions 171-365 of SEQ ID NO: 45.
  • T1 generation transgenic soybean mutant lines were used for the following haploid induction ability analysis experiments.
  • the haploid has the characteristics of short plant, narrow leaves, and updraft, compact plant type, and male sterility.
  • the diploid is characterized by tall plants and wide leaves. Scattered, fertility was normal (Fig. 4b).
  • the plants with haploid traits obtained in the above step 1 are subjected to flow cytometry detection, and the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the diploid soybean leaves as a control; and then use flow cytometry to detect Signal, first detect the diploid nucleus signal, and set the peak position of the diploid nucleus signal to 100 (because the genetic material in the diploid cell is twice the genetic material in the haploid cell, therefore, the haploid nucleus The signal peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enrichment position of the signal intensity of the diploid nucleus, and the plant to be tested is diploid.
  • the plant is a haploid plant; if the identification results of any of the above methods are not haploid ploidy, the plant is not a haploid plant.
  • WT is the soybean wild-type material Williams 82.
  • the mutants of different combinations obtained by GmDMP gene were crossed with wild-type Williams 82 to obtain progeny, and the haploids in the progeny were identified by the following method.
  • the CRISPR/Cas9 vector carries the promoter AtOLEO1 to drive the expression element of TagRFP (Entacmaea quadricolor). Since the promoter AtOLEO1 is specifically expressed in mature seed embryos, the fluorescent signal of TagRFP can be observed by fluorescent light. Therefore, using the mutant carrying the expression element as the male parent to cross with other non-fluorescent female parent materials, among the resulting seeds, the embryos of the diploid seeds showed red fluorescence due to the genome of the male parent, while the single Embryos of ploidy seeds exhibited weak fluorescence due to their origin from the female parent.
  • TagRFP Entacmaea quadricolor
  • the weakly fluorescent seeds identified in the above step 1 were further planted, their genomic DNA was extracted, and the polymorphism primers (GmDMPF+GmDMPR) between wild-type Williams 82 and transgenic soybean mutant lines were used for PCR amplification, and the amplification was carried out.
  • the amplified product was detected by agarose band pattern. If the amplified product of the individual plant to be tested showed one band, it was considered that the band of the individual plant was the band pattern of the wild-type Williams 82 material, and there was no band pattern of the male parent material. The individual plant is then haploid.
  • the amplified product of the individual plant to be tested shows 2 bands, it is considered that the individual plant band is a heterozygous band type of the wild-type Williams 82 and the transgenic soybean mutant line, then the individual plant is the offspring of normal hybridization, and it is Diploid.
  • the phenotypes of the plants identified in the above step 2 were further observed.
  • the haploids have the characteristics of short plants, narrow leaves, and updraft, compact plant types, and male sterility, while diploids show tall plants and wide leaves. , scattered, and normal fertility (Fig. 4b).
  • the plants with haploid traits obtained in the above step 3 are subjected to flow cytometry detection, and the specific method is as follows: extract the nucleus of the young leaves of the plants to be tested, and use the diploid soybean leaves as a control; then use flow cytometry to detect Signal, first detect the diploid nucleus signal, and set the peak position of the diploid nucleus signal to 100 (because the genetic material in the diploid cell is twice the genetic material in the haploid cell, therefore, the haploid nucleus The signal peak appears around 50). If the nuclear signal peak of the plant to be tested appears near 50, the plant to be tested is considered to be haploid. If the signal peak of the plant to be tested appears near 100, it is considered to be the same as the enrichment position of the signal intensity of the diploid nucleus, and the plant to be tested is diploid.
  • the plant is a haploid plant; if any of the above If the method identification result is not haploid, the plant is not a haploid plant.
  • WT is the soybean wild-type material Williams 82.
  • the present invention verifies the conservation of the haploid inducing function of DMP homologous genes in different dicotyledonous crops by means of genetic complementation.
  • the specific method is as follows: The DMP homologous genes in different dicotyledonous crops were cloned by synthesis or PCR amplification, and the promoters of the AtDMP9 gene in Arabidopsis thaliana were constructed to drive the expression vectors of the DMP homologous genes in these dicotyledonous crops respectively, and the constructed expression vectors were used. The vector was transformed into Arabidopsis dmp8dmp9 mutants.
  • the present invention utilizes gene editing technology to edit DMP homologous genes in important dicotyledonous crops (rapeseed, tobacco, cotton and soybean), and obtains a parthenogenetic haploid inducible line, again proving that DMP genes in dicotyledonous crops are Both have the function of regulating the haploid-inducing ability of plants.
  • the method for inducing the haploid of dicotyledonous crops established by the invention shows broad prospects for the innovation and application of the common core technology of crop breeding.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Gène d'induction haploïde parthénogénétique et son application. Sur la base du clonage d'un gène clé de l'induction haploïde parthénogénétique DMP, le conservatisme des fonctions d'induction haploïde des gènes homologues DMP dans différentes cultures dicotylédones est validé au moyen de la complémentation génétique. En outre, des gènes homologues de DMP dans des cultures dicotylédones importantes telles que le colza, le tabac, le coton et le soja sont génétiquement modifiés pour obtenir un inducteur haploïde parthénogénétique. Le procédé d'induction haploïde établi pour les cultures dicotylédones présente de larges perspectives d'innovation et d'application de technologies génériques de base dans la sélection des cultures.
PCT/CN2021/134982 2020-12-03 2021-12-02 Gène d'induction haploïde parthénogénétique et son application WO2022117024A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202011405532 2020-12-03
CN202011405532.5 2020-12-03

Publications (1)

Publication Number Publication Date
WO2022117024A1 true WO2022117024A1 (fr) 2022-06-09

Family

ID=81852957

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2021/134982 WO2022117024A1 (fr) 2020-12-03 2021-12-02 Gène d'induction haploïde parthénogénétique et son application

Country Status (2)

Country Link
CN (4) CN114656546B (fr)
WO (1) WO2022117024A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114656546B (zh) * 2020-12-03 2023-09-19 中国农业大学 孤雌生殖单倍体诱导基因及其应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107223155A (zh) * 2014-11-12 2017-09-29 Kws种子欧洲股份公司 单倍体诱导系
CN109628480A (zh) * 2018-02-08 2019-04-16 中国农业大学 玉米孤雌生殖单倍体诱导基因ZmPLA1E及其应用
CN110546266A (zh) * 2017-02-28 2019-12-06 科沃施种子欧洲股份两合公司 高粱的单倍体化
CN111073875A (zh) * 2019-01-31 2020-04-28 中国农业大学 小麦单倍体诱导基因及其应用
CN111996209A (zh) * 2019-05-27 2020-11-27 中国农业大学 孤雌生殖单倍体诱导基因dmp及其应用

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009099580A2 (fr) * 2008-02-05 2009-08-13 Monsanto Technology, Llc Nouvelles molécules d’acide nucléique et de protéine isolées à partir du soja et procédés d’utilisation de telles molécules pour la génération de plantes transgéniques avec des caractéristiques agronomiques améliorées
US10448588B2 (en) * 2013-03-15 2019-10-22 Syngenta Participations Ag Haploid induction compositions and methods for use therefor
CA2959566A1 (fr) * 2014-08-28 2016-03-03 Kws Saat Se Plantes presentant une activite induisant l'haploide et utilisation pourproduire des plants d'haploide
BR112017028460A2 (pt) * 2015-06-30 2018-09-11 Univ Minnesota linhagem indutora haploide para edição de genoma acelerada
CN107434824B (zh) * 2016-05-25 2019-08-20 北京大学 OsTGA10蛋白及其编码基因在调控植物育性中的应用
UY37335A (es) * 2016-07-21 2018-02-28 Kaiima Bio Agritech Ltd Composiciones y métodos para generar un haploide de una planta objeto
US20190376075A1 (en) * 2016-12-02 2019-12-12 Syngenta Participations Ag Simultaneous gene editing and haploid induction
US10519456B2 (en) * 2016-12-02 2019-12-31 Syngenta Participations Ag Simultaneous gene editing and haploid induction
CN106701803B (zh) * 2017-01-13 2019-03-08 中国农业大学 玉米母本单倍体主效诱导基因及应用
US20190352652A1 (en) * 2017-10-04 2019-11-21 The Broad Institute, Inc. Crispr-systems for modifying a trait of interest in a plant
CN111763687B (zh) * 2019-03-12 2021-12-07 中国农业大学 一种基于基因编辑技术快速培育玉米单倍体诱导系的方法
CN111165350B (zh) * 2020-03-18 2021-10-22 中国农业大学 一种高效鉴别玉米单倍体幼胚的诱导系的选育方法
CN112005878B (zh) * 2020-08-24 2022-06-21 中国农业大学 一种快速选育玉米单倍体诱导系的方法及其应用
CN114656546B (zh) * 2020-12-03 2023-09-19 中国农业大学 孤雌生殖单倍体诱导基因及其应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107223155A (zh) * 2014-11-12 2017-09-29 Kws种子欧洲股份公司 单倍体诱导系
CN110546266A (zh) * 2017-02-28 2019-12-06 科沃施种子欧洲股份两合公司 高粱的单倍体化
CN109628480A (zh) * 2018-02-08 2019-04-16 中国农业大学 玉米孤雌生殖单倍体诱导基因ZmPLA1E及其应用
CN111073875A (zh) * 2019-01-31 2020-04-28 中国农业大学 小麦单倍体诱导基因及其应用
CN111996209A (zh) * 2019-05-27 2020-11-27 中国农业大学 孤雌生殖单倍体诱导基因dmp及其应用

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ZHONG YU; CHEN BAOJIAN; LI MENGRAN; WANG DONG; JIAO YANYAN; QI XIAOLONG; WANG MIN; LIU ZONGKAI; CHEN CHEN; WANG YUWEN; CHEN MING; : "A-triggered in vivo maternal haploid induction system in the dicotyledonous", NATURE PLANTS, vol. 6, no. 5, 1 May 2020 (2020-05-01), London , pages 466 - 472, XP037126015, DOI: 10.1038/s41477-020-0658-7 *

Also Published As

Publication number Publication date
CN114656546A (zh) 2022-06-24
CN117285610A (zh) 2023-12-26
CN114656546B (zh) 2023-09-19
CN117069814A (zh) 2023-11-17
CN117069814B (zh) 2024-04-19
CN117069813A (zh) 2023-11-17

Similar Documents

Publication Publication Date Title
US20210163972A1 (en) Plants Producing 2N Gametes or Apomeiotic Gametes
US10557146B2 (en) Modified plants
US20230227836A1 (en) Simultaneous gene editing and haploid induction
WO2020239137A1 (fr) Gène d'induction haploïde parthénogénétique dmp et application de ce dernier
US20220106607A1 (en) Gene for parthenogenesis
CN111988988A (zh) 鉴定、选择和产生抗白叶枯病水稻的方法
US20220396804A1 (en) Methods of improving seed size and quality
US20230383308A1 (en) Modified promoter of a parthenogenesis gene
CN113544290A (zh) 同时基因编辑和单倍体诱导
WO2019129145A1 (fr) Gène cmp1 de régulation de l'époque de floraison et constructions associées et applications correspondantes
WO2022117024A1 (fr) Gène d'induction haploïde parthénogénétique et son application
WO2021003592A1 (fr) Gènes stériles et constructions associées et leurs applications
US11466287B2 (en) Compositions and methods to increase resistance to phytophthora in soybean
US20220195445A1 (en) Methods and compositions for generating dominant short stature alleles using genome editing
WO2018228348A1 (fr) Procédés pour améliorer un caractère agronomique de plante à l'aide d'un gène bcs1l et de systèmes arn guide/endonucléase cas
JP2023526035A (ja) 標的突然変異生成によって変異体植物を得るための方法
CN113939189A (zh) 用于使用基因组编辑产生显性矮株型等位基因的方法和组合物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21900050

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21900050

Country of ref document: EP

Kind code of ref document: A1