WO2022115486A1 - Antibodies that bind to multiple betacoronaviruses - Google Patents

Antibodies that bind to multiple betacoronaviruses Download PDF

Info

Publication number
WO2022115486A1
WO2022115486A1 PCT/US2021/060631 US2021060631W WO2022115486A1 WO 2022115486 A1 WO2022115486 A1 WO 2022115486A1 US 2021060631 W US2021060631 W US 2021060631W WO 2022115486 A1 WO2022115486 A1 WO 2022115486A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
seq
antigen binding
binding fragment
amino acid
Prior art date
Application number
PCT/US2021/060631
Other languages
English (en)
French (fr)
Inventor
Davide Corti
Dora PINTO
Martina BELTRAMELLO
Florian A. Lempp
Original Assignee
Vir Biotechnology, Inc.
Humabs Biomed Sa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vir Biotechnology, Inc., Humabs Biomed Sa filed Critical Vir Biotechnology, Inc.
Priority to EP21827340.7A priority Critical patent/EP4251279A1/en
Priority to JP2023531541A priority patent/JP2023550785A/ja
Publication of WO2022115486A1 publication Critical patent/WO2022115486A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • betacoronavirus emerged in Wuhan, China, in late 2019. As of May 8, 2021, approximately 157 million cases of infection by this virus (termed, among other names, SARS-CoV-2), were confirmed worldwide, and had resulted in approximately 3.275 million deaths. Other betacoronaviruses, such as SARS-CoV, MERS, OC43, and HKU1 have also posed health risks to humans and other species. Therapies for preventing or treating betacoronavirus infections, and diagnostic reagents for diagnosing betacoronavirus infections, are needed.
  • Figures 1A and IB show binding of monoclonal antibodies
  • Antibody 420 1 2 also referred to herein as antibody S2S8
  • Antibody 420 1 2 also referred to herein as antibody S2S8
  • VH of SEQ ID NO:36 CDRHl, CDRH2, and CDRH3 of SEQ ID NOs:37-39, respectively
  • VL of SEQ ID NO:40 CDRLl, CDRL2, and CDRL3 of SEQ ID NOs:41-43, respectively
  • Figure 1 A and Antibody 420 1 1 (also referred to herein as antibody S2P6), which comprises a VH of SEQ ID NO:26 (CDRHl, CDRH2, and CDRH3 of SEQ ID NOs:27-29, respectively) and a VL of SEQ ID NO:30 (CDRLl, CDRL2, and CDRL3 of SEQ ID NOs:31-33, respectively)
  • Figure IB to the spike (S) protein of different human beta-coronaviruses as
  • Pre-fusion stabilized S proteins from SARS-CoV (Urbani strain, AAP13441), SARS-CoV-2 (BetaCoV/Wuhan- Hu-1/2019), MERS (Londonl/2012), OC43, and HKU1 were coated at 1 pg/ml.
  • PBS-only was used as a negative control.
  • Half maximal effective concentration (EC50) is reported in ng/ml. Unless stated otherwise, all antibodies tested in the present Examples were recombinantly expressed as human IgGl .
  • Figures 2A-2D show binding of monoclonal antibodies Antibody 420 1 2 and Antibody 420 1 1 to the S protein of different human beta-coronaviruses expressed in Expi-CHO cells. Antibodies were expressed as recombinant IgGl bearing M428L/N434S Fc mutations ("MLNS"). Binding to S proteins from SARS-CoV-2 (BetaCoV/Wuhan-Hu- 1/2019; Figure 2A), SARS-CoV (Urbani strain, AAP 13441; Figure 2B), OC43 ( Figure 2C), and MERS-CoV (Londonl/2012; Figure 2D) was measured by flow cytometry.
  • SARS-CoV-2 BetaCoV/Wuhan-Hu- 1/2019; Figure 2A
  • SARS-CoV Urbani strain, AAP 13441; Figure 2B
  • OC43 Figure 2C
  • MERS-CoV Londonl/2012; Figure 2D
  • Figures 3A and 3B show binding of monoclonal antibodies Antibody 420 1 1 ( Figure 3 A) and Antibody 420 1 2 ( Figure 3B) to SI subunit, S2 subunit, and Receptor Binding Domain (RBD) from SARS-CoV-2 (BetaCoV/Wuhan-Hu-1/2019) S, as measured ELISA. Proteins were coated at 1 pg/ml.
  • Figure 4 shows neutralizing activity of Antibody 420_1_1 against live SARS-CoV- 2, reported as IC50 in ng/ml in VeroE6 cells using a SARS-CoV-2-luciferase reporter virus assay.
  • Neutralization by antibody “S309” ⁇ See Pinto etal. , Cross-neutralizaiton ofSARS- CoV-2 by a human monoclonal SARS-CoV antibody , Nature 583:290-295 (July 2020) was also tested. Data are from triplicate wells.
  • Figures 5A and 5B show in vitro neutralization of MERS-CoV pseudotyped virus infection in Huh7 cells (Figure 5A) and SARS-CoV-2 pseudotyped virus in Vero E6 cells ( Figure 5B) by Antibody 420_1_1 (reported as pg/ml). Neutralization by comparator antibodies LCA60 (anti-MERS; Corti etal., PNAS 722(33):10473-10478 (2015)) and S309 was also tested.
  • Figures 6A and 6B show in vitro neutralization of MERS-CoV pseudotyped virus infection in Huh7 cells (Figure 6A) and SARS-CoV-2 pseudotyped virus in Vero E6 cells ( Figure 6B) by Antibody 420 1 2. Neutralization by comparator antibodies LCA60 and S309 was also tested.
  • Figure 7 shows an alignment of partial S2 segments from human beta-coronavirus spike proteins.
  • the linker region in the C-terminal portion of the prefusion ectodomain is indicated with a red square.
  • Figures 8A-8C illustrate a partially conserved linker region in the C-terminal portion of the pre-fusion ectodomain of human betacoronavirus spike proteins.
  • Figure 8A shows an alignment of partial spike protein amino acid sequences from different human beta-coronaviruses.
  • Figure 8B shows SARS-CoV-2 spike protein and identifies the linker region (region inside square, containing N1158 glycan).
  • Figure 8C shows a detailed view of the linker region shown in Figure 8B, and indicates certain amino acid residues (numbering is in accordance with pre-fusion conformation).
  • Figures 9A-9C show structure of the SARS-CoV-2 S protein (Figure 9A), and a detailed view ( Figure 9B) of the conserved linker region and certain amino acid residues and N1158 glycan.
  • Figure 9C residues in the pre-fusion (bottom) and post-fusion (top) conformations is shown. Numbering of the residues in post-fusion images does not account for the signal peptide.
  • Figure 10 shows infection of HEK293T cells transfected to over-express ACE2 or one of a panel of selected lectins and receptor candidates by VSV-SARS-CoV-2 pseudovirus.
  • Figure 11 shows micrographs of stable HEK293T cell lines overexpressing DC- SIGN, L-SIGN, SIGLEC1, or ACE2 infected with authentic SARS-CoV-2 (MOI of 0.1), then fixed and immunostained for 24 hours for SARS-CoV-2 nucleoprotein (red).
  • Figure 12 shows quantification of luciferase levels in stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2, as measured 24 hours after infection with SARS-CoV-2 -Nluc.
  • Figure 13 shows quantification of luciferase levels in stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2 after incubation with different concentrations of anti-SIGLECl monoclonal antibody (clone 7-239) and infection with SARS-CoV-2-Nluc.
  • Figure 14 shows infection of cells transiently transduced to overexpress DC-SIGN, L-SIGN, SIGLEC1, or ACE2 by VSV-SARS-CoV-2 pseudovirus. Results for HEK293T cells (left panel), HeLa cells (center panel), and MRC5 cells (right panel) are shown.
  • Figure 15 shows infection of stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2 after treatment with ACE2 siRNA followed by infection with VSV-SARS-CoV-2 pseudovirus.
  • Figure 16 shows infection of stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2 after treatment with different concentrations of anti-ACE2 antibody (polyclonal serum) followed by infection with VSV-SARS-CoV-2 pseudovirus.
  • Figure 17A shows the distribution and expression of ACE2, DC-SIGN (CD209), L-SIGN (CLEC4M), and SIGLEC1 in the human lung cell atlas.
  • Figure 17B shows analysis of major cell types with detectable SARS-CoV-2 genome in bronchoalveolar lavage fluid or sputum of severe COVID-19 patients.
  • the single cell gene expression profiles are shown as a t-SNE (t-distributed stochastic neighbor embedding) plot, colored by cell type and sized by viral load.
  • t-SNE t-distributed stochastic neighbor embedding
  • Figure 18 shows analysis of major cell types with detectable SARS-CoV-2 genome in bronchoalveolar lavage fluid or sputum of severe COVID-19 patients.
  • the cumulative fraction of cells (y-axis) with detected viral RNA per cell up to the corresponding logCPM (log(counts per million); x-axis) is shown for each of the indicated cell types.
  • Figure 20 shows the correlation of receptor transcript counts (y-axis of each plot) with SARS-CoV-2 RNA counts (x-axis of each plot) in macrophages and in secretory cells. Correlation is based on counts before log transformation from Ren et al.
  • Figure 21 shows the results of trans-infection with VSV-SARS-CoV-2. A schematic of the trans-infection process is shown in the left panel. HeLa cells transduced with DC-SIGN, L-SIGN, or SIGLEC1 were incubated with VSV-SARS-CoV-2, extensively washed, and co-cultured with Vero-E6-TMPRSS2 susceptible target cells. Results in the presence or absence of target cells are shown in the right panel.
  • Figure 22 shows the results of trans-infection, where VSV-SARS-CoV-2 viral adsorption was performed in the presence or absence of an anti-SIGLECl blocking antibody.
  • Figure 23 shows quantification of binding of purified, fluorescently-labeled SARS- CoV-2 spike protein or RBD to the indicated cell lines, as measured by flow cytometry.
  • A indicates cell line overexpressing ACE2; “T” indicates cell line overexpressing TMPRSS2.
  • Figure 24 shows quantification of cellular ACE2 and TMPRSS2 transcripts in the indicated cell lines, as measured by RT-qPCR. “A” indicates cell line overexpressing ACE2; “T” indicates cell line overexpressing TMPRSS2.
  • Figure 25 shows inhibition of antibody S2E12-induced cell-cell fusion of CHO-S cells by 15 pg/ml of the indicated antibodies.
  • Figure 26 shows antibody S2E12-induced uni-directional fusion (also referred to as trans-fusion) of S-positive CHO-S cells with fluorescently-labelled S-negative CHO cells in the absence of ACE2. Nuclei were stained with Hoechst dye; cytoplasm was stained with CellTracker Green.
  • Figure 27 shows analysis of binding of antibodies targeting DC/L-SIGN, DC- SIGN, SIGLEC1, or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor, as measured by flow cytometry.
  • Figure 28 shows analysis of binding of antibodies targeting DC/L-SIGN, DC- SIGN, SIGLEC1, or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor, as measured by immunofluorescence.
  • Figure 29 shows infection of HEK293T cells stably over-expressing the indicated attachment receptor by VSV-SARS-CoV-2 pseudotyped with wild type spike protein (grey bars), or VSV-SARS-CoV-2 pseudotyped with spike protein bearing the mutations of the B 1.1.7 lineage (red bars). Luminescence was analyzed one day post infection.
  • Figure 30 shows quantification of binding of purified, fluorescently labelled SARS-CoV-2 spike protein (left panels) or RBD (right panels) to the indicated cell lines, as measured by flow cytometry.
  • Figure 31 shows quantification of binding of purified, fluorescently labelled SARS-CoV-2 spike protein (left panels) or RBD (right panels) to the indicated cell lines, as measured by flow cytometry.
  • Figure 32 shows binding of immunocomplexes to hamster splenocytes.
  • Alexa-488 fluorescent immunocomplexes (IC) were titrated (0-200 nM range) and incubated with total naive hamster splenocytes. Binding was revealed with a cytometer upon exclusion of dead/apoptotic cells and physical gating on bona fide monocyte population.
  • Left panel shows the fluorescent intensity associated to hamster cells of IC made with either hamster or human Fc antibodies (Human S309 shown in green; GH-S309 shown in dark grey; GH- S309-N297A shown in blue). A single replicate of two is shown.
  • Right panel shows the relative Alexa-488 mean fluorescent intensity of the replicates measured on the entire monocyte population.
  • Figure 33 shows analysis of the role of host effector function in SARS-CoV-2 challenge.
  • Syrian hamsters were injected with the indicated amount (mg/kg) of hamster IgG2a S309, either wt or Fc silenced (S309-N297A).
  • Top panel shows quantification of viral RNA in the lung 4 days post infection.
  • Center panel shows quantification of replicating virus in the lung 4 days post infection.
  • Bottom panel shows histopathological score in the lung 4 days post infection.
  • Control animals (white symbols) were injected with 4 mg/kg unrelated control isotype antibody.
  • Figure 34 shows binding of antibody S2S43 to spike proteins from betacoronaviruses SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • the calculated EC50 values are shown to the right of the graph.
  • Antibody S2S43 comprises a VH of SEQ ID NO:47 (CDRH1, CDRH2, and CDRH3 of SEQ ID NOs:48-50, respectively) and a VL of SEQ ID NO: 51 (CDRL1, CDRL2, and CDRL3 of SEQ ID NOs:52-54, respectively).
  • Figure 35 shows neutralization of infection by MLV pseudotyped with SARS- CoV-2 spike protein for antibodies S2S43 and S2P6. Calculated IC50 values are shown to the right of the graph.
  • Figures 36A and 36B show binding of antibodies S2P6 (Figure 36A) and S2S8 ( Figure 36B) to pre-fusion spike protein of betacoronaviruses MERS, HKU1, OC43, SARS-CoV, and SARS-CoV-2. Calculated EC50 values are shown to the right of each graph.
  • Figure 37 shows binding of antibodies S2S8 and S2P6 to spike protein of alphacoronaviruses NL63-CoV (left panel) and ss9E-CoV (right panel). Calculated EC50 values for S2S8 binding are shown.
  • Figures 38A-38E show binding of antibody S2P6 to pre-fusion spike protein of betacoronaviruses SARS-CoV-2 (Figure 37 A), SARS (Figure 37B), OC43 (Figure 37C), HKU1 (Figure 37D) and MERS (Figure 37E), as measured by BLI.
  • S2P6 bound SARS- CoV-2 spike with a KD of ⁇ 1.0E-12 M, a Ron of 4.53E+05 1/Ms, and a Kdis of ⁇ 1.0E-07 1/s.
  • S2P6 bound SARS-CoV spike with a KD of ⁇ 1.0E-12 M, a Ron of 2.32E+05 1/Ms, and a Kdis of ⁇ 1.0E-07 1/s.
  • Figures 39A-39D show neutralization of infection by four different betacoronaviruses using antibody S2P6.
  • Figure 39A shows neutralization of SARS-CoV-2 pseudovirus infection of Vero E6 cells.
  • Antibody S309 was included as a reference.
  • S309 comprises the VH amino acid sequence set forth in SEQ ID NO: 85 and the VL amino acid sequence set forth in SEQ ID NO: 89 (CDRH1-H3 and L1-L3 as set forth in SEQ ID NOs:86-88 and 90-92, respectively), and was antibody isolated from a patient who recovered from SARS-CoV-1 infection.
  • Figure 39B shows neutralization of SARS-CoV pseudovirus infection of Vero E6 cells.
  • Figure 39C shows neutralization of MERS pseudovirus infection of Huh 7 cells.
  • Antibody LCA60 was included as a reference.
  • Figure 39D shows neutralization of PangGD19 pseudovirus infection of Vero E6 cells. Calculated IC50 values are shown to the right of the graph for Figures 39A, 39C, and 39D.
  • Figure 40 shows neutralization of infection by MERS pseudovirus (left panel) and SARS-CoV-2 pseudovirus (right panel) using antibody S2S8. Comparator antibody LCA60 is shown for neutralization of MERS pseudovirus and comparator antibody S309 is shown for neutralization of SARS-CoV-2.
  • Figures 41A and 41B show neutralization of infection by authentic SARS-CoV-2 virus using antibody S2P6 and comparator antibody S309.
  • Figure 41A shows neutralization of infection of VeroE6 cells by SARS-CoV-2-luc at a MOI of 0.01 at 24 hours. Results from triplicate wells shown. Calculated EC50 for S2P6 is 3.4 pg/ml.
  • Figure 41B shows neutralization of infection of VeroE6-TMPRSS2 cells by SARS-CoV-2 at a MOI of 0.01 at 24 hours. Calculated EC50 for S2P6 is 1.9 pg/ml.
  • Figures 42A and 42B show activation of FcyRIIa (H131 allele) ( Figure 42A) and FcyRIIIa (VI 58 allele) ( Figure 42B) by antibodies S2P6 and S2S8, along with comparator antibody S309.
  • Figure 43 shows results of peptide scanning to identify coronavirus spike protein motifs bound by antibody S2P6 (expressed as recombinant IgGl with M428L and N434S Fc mutations) within each of seven coronavirus spike proteins using a PEPperCHIP ® Pan- Corona Spike Protein Microarray.
  • the microarray includes spike protein of SARS-CoV-2 (UniProt ID P0DTC2), SARS-CoV (UniProt ID P59594), MERS-CoV (UniProt ID A0A140AYZ5), HCoV-OC43 (UniProt ID P36334), HCoV-HKUl (UniProt ID U3NAI2), HCoV-NL63 (UniProt ID Q6Q1S2), and HCoV-229E (UniProt ID P15423).
  • Each spike protein sequence is converted into 15-amino acid peptides with a peptide-peptide overlap of 13 amino acids.
  • the array contains 4,564 different peptides printed in duplicate.
  • Antibody S2P6 expressed as recombinant IgGl with M428L and N434S (“MLNS”) Fc mutations, was incubated with the array at a concentration of 10 pg/ml.
  • a response was observed for adjacent peptides with the consensus motif FKEELDKYF (found in SARS- CoV-2 and SARS-CoV; SEQ ID NO:57) and with similar motifs GIDF ODELDEFFK (found in MERS-CoV; SEQ ID NO: 58) and DFKEELDOWFK (found in HCoV-OC43; SEQ ID NO:59).
  • FKEELDKYF consensus motif
  • GIDF ODELDEFFK found in MERS-CoV; SEQ ID NO: 58
  • DFKEELDOWFK found in HCoV-OC43; SEQ ID NO:59.
  • Figure 44 shows results of peptide scanning to identify coronavirus spike protein motifs bound by antibody S2S8 (expressed as recombinant IgGl with MLNS Fc mutation) for each of seven coronavirus spike proteins using the PEPperCHIP ® Pan-Corona Spike Protein Microarray described above.
  • Figure 45 shows the results of prophylactic administration of antibody S2P6 (expressed as hamster IgG2a) to Syrian hamsters before intranasal challenge with SARS- CoV-2 Wuhan Hu-1. Viral RNA in the lung (left panel) and viral titer (right panel) following infection were measured.
  • Figure 46 shows binding of antibody S2X529 to spike protein from SARS-CoV-2, SARS-CoV, HKU1, OC43, and MERS.
  • Figure 47 shows binding avidity (EC50) of antibody S2P6 and antibody S2S43 to prefusion SARS-CoV-2 spike protein as determined by ELISA.
  • Figure 48 shows representative antibody S2P6 binding in the assay for which data are summarized in Figure 47.
  • Figure 49 shows a cladogram of representative a- and b-coronavirus S glycoprotein amino acid sequences inferred via maximum likelihood analysis b-coronaviruses are highlighted in red.
  • Figure 50 shows results of flow cytometry analysis of antibody S2P6 binding (from 10 to 0.22 pg/ml) to a panel of 26 S glycoproteins representative of all sarbecovirus clades (left) and 8 SARS-CoV-2 variants (right) displayed as a heat map of log geo-MFI (geometric mean fluorescent intensity).
  • Figure 51 shows neutralization of authentic SARS-CoV-2 by S2P6 determined using VeroE6 cells positive for the S-activating protease TMPRSS2 (VeroE6-TMPRSS2) or negative for TMPRSS2 (Vero E6).
  • Monoclonal antibody S309 that binds RBD site IV (Pinto et al. 2020) is included for comparison. Mean ⁇ s.d. of quadruplicates from one experiment is shown. One representative experiment out of 3 is shown.
  • IC50 of antibody S2P6 for VeroE6-TMPRSS2 was 1.87 pg/ml.
  • IC50 of antibody S309 for VeroE6- TMPRSS2 was 0.09 pg/ml.
  • IC50 of antibody S2P6 for VeroE6 was 3.68 pg/ml.
  • IC50 of antibody S309 for VeroE6 was 0.02 pg/ml.
  • Figure 52 shows antibody S2P6-mediated neutralization of SARS-CoV-2 B.l.1.7 S, B.1.351 S and P.l S vesicular stomatitis virus (VSV) pseudotypes and the wildtype (D614G) S VSV pseudotype in the upper graph.
  • the lower graph shows neutralization of the Bl.1.7, B. 1.351, and P.l pseudotypes represented as IC50 fold change relative to wildtype (D614G) S VSV pseudotype.
  • the red, upper line represents the cutoff used for reduced potency.
  • Figure 53 shows binding of antibody S2P6 to linear peptides (15-mer peptides overlapping by 13 residues) spanning the SARS-CoV/SARS-CoV-2 S, OC43 S and MERS-CoV S sequences.
  • Figure 54 shows an alignment of the b-coronavirus stem helix region for multiple b-coronaviruses with the antibody S2P6 epitope region boxed. Residue numbering is shown according to SARS-CoV-2 S. N-linked glycosylation sequons are highlighted in blue.
  • Figure 56 shows an analysis of memory B-cell binding to b-coronavirus stem helix peptides from 21 COVID-19 convalescent individuals. Each dot represents an individual culture containing oligo-clonal B cells screened against stem helix peptides in ELISA (left panel). The cut-off value (0.4) is indicated by a dotted line. Pairwise reactivity comparison is shown for SARS-CoV/-2 and OC43 (middle panel) and SARS-CoV/-2 and HKU1 (right panel).
  • Figure 57 shows an analysis of memory B-cell binding to b-coronavirus stem helix peptides from 16 vaccinees. Each dot represents an individual culture containing oligo- clonal B cells screened against stem helix peptides in ELISA (left panel). The cut-off value (0.4) is indicated by a dotted line. Pairwise reactivity comparison is shown for SARS- CoV/-2 and OC43 (middle panel) and SARS-CoV/-2 and HKU1 (right panel).
  • Figure 58 shows a longitudinal analysis of vaccinees plasma antibody binding to b- coronavirus stem helix peptides.
  • Figure 59 shows stem helix peptide binding of the S2P6 antibodies shown in Figure 76 to stem helix peptides (mutated SH/SK), fully germline reverted (UCA/UCA), germline reverted heavy chain paired with mature light chain (UCA/SK), mature heavy chain paired with germline reverted light chain (SH/UCA).
  • Figure 60 shows SARS-CoV-2 S binding to ACE2 in the presence of antibody S2P6 as analyzed by ELISA.
  • S2E12 Teortorici etal. , Science 370(6519):950-957 (2020) was included as a positive control.
  • Figure 61 shows antibody S2P6 inhibition of cell-cell fusion using Vero-E6 cells transfected with SARS-CoV-2 S.
  • S2M11 Teortorici et al, Science 370(6519):950-957 (2020) was included as a positive control. Inhibition of fusion values were normalized to the percentage of fusion without mAb (100%) and to that of fusion of non-transfected cells (0%).
  • Figure 62 shows NFAT-driven luciferase signal induced in Jurkat cells stably expressing FcyRIIIa (VI 58, left) or FcyRIIa (VI 31, right) upon antibody S2P6 binding to full-length wild-type SARS-CoV-2 S expressed at the surface of ExpiCHO target cells.
  • S309 is included as positive control.
  • RLU designates relative luminescence unit.
  • Figure 63 shows antibody S2P6 activation of cellular effector functions.
  • Assay results for an antibody-mediated ADCC (antibody-dependent cell cytotoxicity) assay using SARS-CoV-2 CHO-K1 cells (genetically engineered to stably express aHaloTag-HiBit- tagged) as target cells and PBMC as effector cells are presented in the left graph.
  • the magnitude of NK cell-mediated killing is expressed as percentage of specific lysis.
  • ADCP antibody-dependent cellular phagocytosis
  • PBMCs Cell-Trace-Violet-labelled PBMCs as a source of phagocytic cells (monocytes) and PKH67-fluorescently labeled S-expressing CHO cells as target cells
  • the y axis indicates percentage of monocytes double-positive for anti-CD14 (monocyte) marker and PKH67.
  • Assay results for lysis of SARS-CoV-2 S stably transfected CHO cells by mAbs in the presence of complement are presented in the right graph.
  • Antibody plots are as in Figure 62.
  • Figure 64 shows test results in Syrian hamsters administered the indicated amount of antibody S2P6 harboring either a hamster (Hm) or a human (Hu) constant region before intranasal challenge with prototypic SARS-CoV-2 (Wuhan- 1 related). Viral RNA loads are shown in the left graph and replicating virus titers are show in the right graph. * P ⁇ 0.05, Mann-Whitney test.
  • Figure 65 shows results in Syrian hamsters after prophylactic administration of 20 mg/kg of human antibody S2P6. Hamsters were challenged after antibody administration with SARS-CoV-2 B.1.351 VOC. Viral RNA loads are shown in the left graph and replicating virus titers are show in the right graph.
  • Figure 66 shows binding of antibody S2P6 (left graph) and antibody S2S43 (right graph) to prefusion b-coronavirus S ectodomain trimers by ELISA.
  • Figures 67A-67C shows the geo-mean fluorescence intensity as measured in flow cytometry for antibody S2P6 binding to a panel of 26 S glycoproteins representative of all sarbecovirus clades and 8 SARS-CoV-2 variants.
  • Figure 68 shows a phylogenetic tree of sarbecoviruses as inferred via maximum likelihood analysis of spike amino acid sequences.
  • Figure 69 shows SPR (surface plasmon resonance) analysis of the antibody S2P6 Fab binding to immobilized prefusion b-coronavirus S turners.
  • Figure 70 shows SPR analysis of the antibody S2P6 Fab and IgG binding to an immobilized prefusion SARS-CoV-2 S ectodomain trimer at pH 7.4 and pH 5.4
  • Figure 71 shows a heat map of binding (fluorescence intensity) of antibody S2P6 to stem helix peptides (amino acid sequence at bottom of heat map) harboring each possible amino acid substitution (along left-hand side of heat map) at the indicated stem helix peptide amino acid position.
  • the gradient in the scale at right indicates the degree of loss of binding as compared to the native residue (defining the white) shown as a crossed square.
  • Green/dotted squares indicate substitutions enhancing binding as compared to the native residue.
  • Asterisks highlight substitutions found in antibody S2P6 viral escapes.
  • Figure 72 shows epitope conservation among b-coronavirus sequences with human and animal hosts as retrieved from GISAID.
  • the consensus sequence for SARS-CoV-2 is reported on the x axis and predominant substitutions are indicated by a bold letter.
  • Figure 75 shows binding to b-coronavirus stem helix peptide of IgG memory B- cells from an immune individual after first vaccine dose showing high response to SARS- CoV2 (top left graph) and of two pre-pandemic individuals (top right and lower graphs).
  • Figure 76 shows an alignment of the variable region amino acid sequences of antibody S2P6 unmutated common ancestor (UCA) (top), S2P6 wild-type, and S2P6 fully germline-reverted variants. The CDR regions are highlighted in gray.
  • Figure 77 shows binding of the S2P6 antibodies of Figure 76 to stem helix peptides of various b-coronaviruses.
  • Figure 78 shows an alignment of the VH and VL amino acid sequences of antibody S2S43 UCA and wild-type S2S43.
  • Figure 79 provides a table showing gene usage and othe properties of antibodies S2P6 and S2S43.
  • an antibody or antigen binding fragment that are capable of binding to a betacoronavirus (e.g, a surface glycoprotein, as described herein, of a SARS- CoV-2, SARS-CoV, MERS-CoV, OC43, or HKU).
  • a betacoronavirus e.g, a surface glycoprotein, as described herein, of a SARS- CoV-2, SARS-CoV, MERS-CoV, OC43, or HKU.
  • an antibody or antigen binding fragment is capable of binding to a surface glycoprotein of two or more (e.g, two, three, four, five, or more) betacoronaviruses.
  • an antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus virion and/or a surface glycoprotein expressed on the surface of a cell infected by a betacoronavirus).
  • antibodies and antigen binding fragments can neutralize infection by two, three, four, or five betacoronaviruses in an in vitro model of infection and/or in a human subject.
  • an antibody or antigen binding fragment is capable of binding to an alphacoronavirus surface glycoprotein.
  • polynucleotides that encode the antibodies and antigen binding fragments, vectors, host cells, and related compositions, as well as methods of using the antibodies, nucleic acids, vectors, host cells, and related compositions to treat (e.g, reduce, delay, eliminate, or prevent) infection by any two, three, four, or five betacoronaviruses in a subject and/or in the manufacture of a medicament for treating infection in a subject by any two, three, four, or five betacoronaviruses.
  • SARS-CoV-2 also referred to herein as "Wuhan seafood market phenomia virus”, or “Wuhan coronavirus” or “Wuhan CoV”, or “novel CoV”, or “nCoV”, or “2019 nCoV”, or “Wuhan nCoV” is a betacoronavirus believed to be of lineage B (sarbecovirus).
  • SARS-CoV-2 was first identified in Wuhan, Hubei province, China, in late 2019 and spread within China and to other parts of the world by early 2020. Symptoms of SARS-CoV-2 infection include fever, dry cough, and dyspnea.
  • SARS-CoV-2 comprises a "spike” or surface (“S") type I transmembrane glycoprotein containing a receptor binding domain (RBD).
  • SARS-CoV-2 comprises a "spike” or surface (“S") type I transmembrane glycoprotein containing a receptor binding domain (RBD).
  • RBD is believed to mediate entry of the lineage B SARS coronavirus to respiratory epithelial cells by binding to the cell surface receptor angiotensin-converting enzyme 2 (ACE2).
  • ACE2 cell surface receptor angiotensin-converting enzyme 2
  • RBM receptor binding motif
  • the amino acid sequence of the Wuhan-Hu-1 surface glycoprotein is provided in SEQ ID NO:3.
  • the amino acid sequence of Wuhan-Hu-1 RBD is provided in SEQ ID NO:4.
  • Wuhan-Hu-1 S protein has approximately 73% amino acid sequence identity with SARS-CoV S protein.
  • the amino acid sequence of Wuhan-Hu-1 RBM is provided in SEQ ID NO:5.
  • Wuhan-Hu-1 RBD has approximately 75% to 77% amino acid sequence similarity to SARS-CoV RBD
  • SARS-CoV-2 RBM has approximately 50% amino acid sequence similarity to SARS-CoV RBM.
  • Wuhan- Hu-1 refers to a virus comprising the amino acid sequence set forth in any one or more of SEQ ID NOs: 2, 3, 4, and 5 optionally with the genomic sequence set forth in SEQ ID NO:l.
  • SARS-CoV-2 variants There have been a number of emerging SARS-CoV-2 variants. Some SARS-CoV- 2 variants contain an N439K mutation, which has enhanced binding affinity to the human ACE2 receptor (Thomson, E.C., et ah, The circulating SARS-CoV-2 spike variant N439K maintains fitness while evading antibody-mediated immunity. bioRxiv, 2020).
  • SARS-CoV-2 variants contain an N501 Y mutation, which is associated with increased transmissibility, including the lineages B.l.1.7 (also known as 20I/501Y.V1 and VOC 202012/01; (del69-70, del 144, N501Y, A570D, D614G, P681H, T716I, S982A, and D1118H mutations)) and B.1.351 (also known as 20H/501Y.V2; L18F, D80A, D215G, R246I, K417N, E484K, N501 Y, D614G, and A701 V mutations), which were discovered in the United Kingdom and South Africa, respectively (legally, H., et ah, Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS- CoV-2) lineage with multiple spike mutations in South Africa. medRxiv, 2020: p.
  • B.1.351 also include two other mutations in the RBD domain of SARS-CoV2 spike protein, K417N and E484K (legally, H., et al., Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) lineage with multiple spike mutations in South Africa. medRxiv, 2020: p. 2020.12.21.20248640).
  • SARS-CoV-2 variants include the Lineage B.1.1.28, which was first reported in Brazil; the Variant P.1 (also known as 20J/501 Y.V3), which was first reported in Japan; Variant L452R, which was first reported in California in the United States (Pan American Health Organization, Epidemiological update: Occurrence of variants of SARS-CoV-2 in the Americas, January 20, 2021, available at reliefweb.int/sites/reliefweb.int/files/resources/2021-jan-20-phe-epi-update-SARS-CoV- 2.pdf).
  • SARS-CoV-2 variants include a SARS CoV-2 of clade 19A; SARS CoV-2 of clade 19B; a SARS CoV-2 of clade 20 A; a SARS CoV-2 of clade 20B; a SARS CoV-2 of clade 20C; a SARS CoV-2 of clade 20D; a SARS CoV-2 of clade 20E (EU1); a SARS CoV-2 of clade 20F; a SARS CoV-2 of clade 20G; and SARS CoV-2 Bl.1.207; and other SARS CoV-2 lineages described in Rambaut, A., et al., A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology. Nat Microbiol 5, 1403-1407 (2020).
  • Variants including the D614G mutation include A23.1, B.1.429, B.1.258,
  • SARS-CoV-2 includes Wuhan Hu-1 and variants thereof, including presently disclosed variants.
  • SARS-CoV is another betacoronavirus that causes respiratory symptoms in infected individuals.
  • the genomic sequence of SARS-CoV Urbani strain has GenBank accession number AAP13441.1.
  • the amino acid sequence of the SARS-CoV surface glycoprotein (“S protein”) is provided in SEQ ID NO: 22.
  • Human coronavirus OC43 is also a betacoronavirus.
  • the amino acid sequence of the OC43 surface glycoprotein (“S protein”) is provided in SEQ ID NO:23 (see also GenBank AY585229.1).
  • MERS-CoV is yet another betacoronavirus.
  • the amino acid sequence of MERS- CoV strain London 1/2012 surface glycoprotein (“S protein”) is provided in SEQ ID NO:24 (see also GenBank KC164505).
  • Human coronavirus HKU1 is another betacoronavirus.
  • S protein The amino acid sequence of HKU1 surface glycoprotein (“S protein”) is provided in SEQ ID NO:25 (see also GenBank YP_173238). While SARS-CoV and SARS-CoV-2 bind ACE2, other betacoronaviruses are believed to enter cells by binding to other receptors. For example, MERS-CoV is believed to bind dipeptidyl peptidase-4 (DPP4), and OC43 and HKU1 are believed to bind 9-0- acetylated sialic acid (9-O-Ac-Sia) receptor.
  • DPP4 dipeptidyl peptidase-4
  • OC43 and HKU1 are believed to bind 9-0- acetylated sialic acid (9-O-Ac-Sia) receptor.
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
  • any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness are to be understood to include any integer within the recited range, unless otherwise indicated.
  • the term “about” means ⁇ 20% of the indicated range, value, or structure, unless otherwise indicated. It should be understood that the terms “a” and “an” as used herein refer to “one or more" of the enumerated components.
  • a protein domain, region, or module e.g., a binding domain
  • a protein "consists essentially of a particular amino acid sequence when the amino acid sequence of a domain, region, module, or protein includes extensions, deletions, mutations, or a combination thereof (e.g., amino acids at the amino- or carboxy -terminus or between domains) that, in combination, contribute to at most 20% (e.g., at most 15%, 10%, 8%, 6%, 5%, 4%, 3%, 2% or 1%) of the length of a domain, region, module, or protein and do not substantially affect (i.e., do not reduce the activity by more than 50%, such as no more than 40%, 30%, 25%, 20%, 15%, 10%, 5%, or 1%) the activity of the domain(s), region(s
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, g-carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a-carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g, norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • mutation refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule as compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively.
  • a mutation can result in several different types of change in sequence, including substitution, insertion or deletion of nucleotide(s) or amino acid(s).
  • a “conservative substitution” refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain. Conservative substitutions include a substitution found in one of the following groups: Group 1: Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3 : Asparagine (Asn or N), Glutamine (Gin or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (lie or I), Leucine (Leu or L), Methionine (Met or M), Valine (Val or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y
  • amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing).
  • an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Val, Leu, and lie.
  • substitutions groups include: sulfur-containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gin; small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, lie, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.
  • protein or “polypeptide” refers to a polymer of amino acid residues. Proteins apply to naturally occurring amino acid polymers, as well as to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, and non-naturally occurring amino acid polymers. Variants of proteins, peptides, and polypeptides of this disclosure are also contemplated.
  • variant proteins, peptides, and polypeptides comprise or consist of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical to an amino acid sequence of a defined or reference amino acid sequence as described herein.
  • Nucleic acid molecule or “polynucleotide” or “polynucleic acid” refers to a polymeric compound including covalently linked nucleotides, which can be made up of natural subunits (e.g ., purine or pyrimidine bases) or non-natural subunits (e.g, morpholine ring).
  • Purine bases include adenine, guanine, hypoxanthine, and xanthine
  • pyrimidine bases include uracil, thymine, and cytosine.
  • Nucleic acid molecules include polyribonucleic acid (RNA), which includes mRNA, microRNA, siRNA, viral genomic RNA, and synthetic RNA, and polydeoxyribonucleic acid (DNA), which includes cDNA, genomic DNA, and synthetic DNA, either of which may be single or double stranded. If single-stranded, the nucleic acid molecule may be the coding strand or non-coding (anti- sense) strand.
  • a nucleic acid molecule encoding an amino acid sequence includes all nucleotide sequences that encode the same amino acid sequence. Some versions of the nucleotide sequences may also include intron(s) to the extent that the intron(s) would be removed through co- or post-transcriptional mechanisms. In other words, different nucleotide sequences may encode the same amino acid sequence as the result of the redundancy or degeneracy of the genetic code, or by splicing.
  • the polynucleotide comprises a modified nucleoside, a cap-1 structure, a cap-2 structure, or any combination thereof.
  • the polynucleotide comprises a pseudouridine, a N6-methyladenonsine, a 5-methylcytidine, a 2-thiouridine, or any combination thereof.
  • the pseudouridine comprises Nl-methylpseudouri dine.
  • Variants of nucleic acid molecules of this disclosure are also contemplated. Variant nucleic acid molecules are at least 70%, 75%, 80%, 85%, 90%, and are preferably 95%, 96%, 97%, 98%, 99%, or 99.9% identical a nucleic acid molecule of a defined or reference polynucleotide as described herein, or that hybridize to a polynucleotide under stringent hybridization conditions of 0.015M sodium chloride, 0.0015M sodium citrate at about 65- 68°C or 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide at about 42°C. Nucleic acid molecule variants retain the capacity to encode a binding domain thereof having a functionality described herein, such as binding a target molecule.
  • Percent sequence identity refers to a relationship between two or more sequences, as determined by comparing the sequences. Preferred methods to determine sequence identity are designed to give the best match between the sequences being compared. For example, the sequences are aligned for optimal comparison purposes (e.g ., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment). Further, non-homologous sequences may be disregarded for comparison purposes. The percent sequence identity referenced herein is calculated over the length of the reference sequence, unless indicated otherwise. Methods to determine sequence identity and similarity can be found in publicly available computer programs.
  • Sequence alignments and percent identity calculations may be performed using a BLAST program (e.g., BLAST 2.0, BLASTP, BLASTN, or BLASTX).
  • BLAST program e.g., BLAST 2.0, BLASTP, BLASTN, or BLASTX.
  • the mathematical algorithm used in the BLAST programs can be found in Altschul et al., Nucleic Acids Res. 25: 3389-3402, 1997.
  • sequence analysis software is used for analysis, the results of the analysis are based on the "default values" of the program referenced. "Default values" mean any set of values or parameters which originally load with the software when first initialized.
  • isolated means that the material is removed from its original environment (e.g ., the natural environment if it is naturally occurring).
  • a naturally occurring nucleic acid or polypeptide present in a living animal is not isolated, but the same nucleic acid or polypeptide, separated from some or all of the co-existing materials in the natural system, is isolated.
  • nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide.
  • isolated can, in some embodiments, also describe an antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition that is outside of a human body.
  • gene means the segment of DNA or RNA involved in producing a polypeptide chain; in certain contexts, it includes regions preceding and following the coding region (e.g, 5’ untranslated region (UTR) and 3’ UTR) as well as intervening sequences (introns) between individual coding segments (exons).
  • regions preceding and following the coding region e.g, 5’ untranslated region (UTR) and 3’ UTR
  • intervening sequences introns between individual coding segments (exons).
  • a “functional variant” refers to a polypeptide or polynucleotide that is structurally similar or substantially structurally similar to a parent or reference compound of this disclosure, but differs slightly in composition (e.g., one base, atom or functional group is different, added, or removed), such that the polypeptide or encoded polypeptide is capable of performing at least one function of the parent polypeptide with at least 50% efficiency, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% level of activity of the parent polypeptide.
  • a functional variant of a polypeptide or encoded polypeptide of this disclosure has "similar binding,” “similar affinity” or “similar activity” when the functional variant displays no more than a 50% reduction in performance in a selected assay as compared to the parent or reference polypeptide, such as an assay for measuring binding affinity (e.g., Biacore® or tetramer staining measuring an association (Ka) or a dissociation (KD) constant).
  • binding affinity e.g., Biacore® or tetramer staining measuring an association (Ka) or a dissociation (KD) constant.
  • a “functional portion” or “functional fragment” refers to a polypeptide or polynucleotide that comprises only a domain, portion or fragment of a parent or reference compound, and the polypeptide or encoded polypeptide retains at least 50% activity associated with the domain, portion or fragment of the parent or reference compound, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% level of activity of the parent polypeptide, or provides a biological benefit (e.g., effector function).
  • a biological benefit e.g., effector function
  • a “functional portion” or “functional fragment” of a polypeptide or encoded polypeptide of this disclosure has “similar binding” or “similar activity” when the functional portion or fragment displays no more than a 50% reduction in performance in a selected assay as compared to the parent or reference polypeptide (preferably no more than 20% or 10%, or no more than a log difference as compared to the parent or reference with regard to affinity).
  • the term "engineered,” “recombinant,” or “non-natural” refers to an organism, microorganism, cell, nucleic acid molecule, or vector that includes at least one genetic alteration or has been modified by introduction of an exogenous or heterologous nucleic acid molecule, wherein such alterations or modifications are introduced by genetic engineering (i.e., human intervention).
  • Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding functional RNA, proteins, fusion proteins or enzymes, or other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of a cell’s genetic material. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a polynucleotide, gene, or operon.
  • heterologous or non-endogenous or exogenous refers to any gene, protein, compound, nucleic acid molecule, or activity that is not native to a host cell or a subject, or any gene, protein, compound, nucleic acid molecule, or activity native to a host cell or a subject that has been altered.
  • Heterologous, non-endogenous, or exogenous includes genes, proteins, compounds, or nucleic acid molecules that have been mutated or otherwise altered such that the structure, activity, or both is different as between the native and altered genes, proteins, compounds, or nucleic acid molecules.
  • heterologous, non-endogenous, or exogenous genes, proteins, or nucleic acid molecules may not be endogenous to a host cell or a subject, but instead nucleic acids encoding such genes, proteins, or nucleic acid molecules may have been added to a host cell by conjugation, transformation, transfection, electroporation, or the like, wherein the added nucleic acid molecule may integrate into a host cell genome or can exist as extra-chromosomal genetic material (e.g., as a plasmid or other self- replicating vector).
  • homologous or homolog refers to a gene, protein, compound, nucleic acid molecule, or activity found in or derived from a host cell, species, or strain.
  • a heterologous or exogenous polynucleotide or gene encoding a polypeptide may be homologous to a native polynucleotide or gene and encode a homologous polypeptide or activity, but the polynucleotide or polypeptide may have an altered structure, sequence, expression level, or any combination thereof.
  • a non- endogenous polynucleotide or gene, as well as the encoded polypeptide or activity may be from the same species, a different species, or a combination thereof.
  • a nucleic acid molecule or portion thereof native to a host cell will be considered heterologous to the host cell if it has been altered or mutated, or a nucleic acid molecule native to a host cell may be considered heterologous if it has been altered with a heterologous expression control sequence or has been altered with an endogenous expression control sequence not normally associated with the nucleic acid molecule native to a host cell.
  • heterologous can refer to a biological activity that is different, altered, or not endogenous to a host cell.
  • heterologous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as a plurality of individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof.
  • the term “endogenous” or “native” refers to a polynucleotide, gene, protein, compound, molecule, or activity that is normally present in a host cell or a subject.
  • expression refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene.
  • the process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof.
  • An expressed nucleic acid molecule is typically operably linked to an expression control sequence (e.g., a promoter).
  • operably linked refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other.
  • a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
  • Unlinked means that the associated genetic elements are not closely associated with one another and the function of one does not affect the other.
  • more than one heterologous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as a plurality of individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a protein (e.g., a heavy chain of an antibody), or any combination thereof.
  • a protein e.g., a heavy chain of an antibody
  • two or more heterologous nucleic acid molecules can be introduced as a single nucleic acid molecule (e.g., on a single vector), on separate vectors, integrated into the host chromosome at a single site or multiple sites, or any combination thereof.
  • the number of referenced heterologous nucleic acid molecules or protein activities refers to the number of encoding nucleic acid molecules or the number of protein activities, not the number of separate nucleic acid molecules introduced into a host cell.
  • construct refers to any polynucleotide that contains a recombinant nucleic acid molecule.
  • a (polynucleotide) construct may be present in a vector (e.g., a bacterial vector, a viral vector) or may be integrated into a genome.
  • a "vector” is a nucleic acid molecule that is capable of transporting another nucleic acid molecule.
  • Vectors may be, for example, plasmids, cosmids, viruses, a RNA vector or a linear or circular DNA or RNA molecule that may include chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acid molecules.
  • Vectors of the present disclosure also include transposon systems (e.g ., Sleeping Beauty, see, e.g., Geurts et ah, Mol. Ther. 5:108, 2003: Mates et ah, Nat. Genet. ⁇ 7:753, 2009).
  • Exemplary vectors are those capable of autonomous replication (episomal vector), capable of delivering a polynucleotide to a cell genome (e.g., viral vector), or capable of expressing nucleic acid molecules to which they are linked (expression vectors).
  • expression vector refers to a DNA construct containing a nucleic acid molecule that is operably linked to a suitable control sequence capable of effecting the expression of the nucleic acid molecule in a suitable host.
  • control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control termination of transcription and translation.
  • the vector may be a plasmid, a phage particle, a virus, or simply a potential genomic insert.
  • the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself or deliver the polynucleotide contained in the vector into the genome without the vector sequence.
  • plasmid "expression plasmid,” “virus,” and “vector” are often used interchangeably.
  • the term "introduced” in the context of inserting a nucleic acid molecule into a cell means “transfection", “transformation,” or “transduction” and includes reference to the incorporation of a nucleic acid molecule into a eukaryotic or prokaryotic cell wherein the nucleic acid molecule may be incorporated into the genome of a cell (e.g, chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
  • a cell e.g, chromosome, plasmid, plastid, or mitochondrial DNA
  • transiently expressed e.g., transfected mRNA
  • polynucleotides of the present disclosure may be operatively linked to certain elements of a vector.
  • polynucleotide sequences that are needed to effect the expression and processing of coding sequences to which they are ligated may be operatively linked.
  • Expression control sequences may include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e.,
  • Expression control sequences may be operatively linked if they are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • the vector comprises a plasmid vector or a viral vector e.g ., a lentiviral vector or a g-retroviral vector.
  • Viral vectors include retrovirus, adenovirus, parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as ortho-myxovirus (e.g, influenza virus), rhabdovirus (e.g, rabies and vesicular stomatitis virus), paramyxovirus (e.g, measles and Sendai), positive strand RNA viruses such as picomavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e.g, Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g, vaccinia, fowlpox, and canarypox).
  • herpesvirus e.g, Herpe
  • viruses include, for example, Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus.
  • retroviruses include avian leukosis- sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields et ak, Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
  • “Retroviruses” are viruses having an RNA genome, which is reverse-transcribed into DNA using a reverse transcriptase enzyme, the reverse-transcribed DNA is then incorporated into the host cell genome.
  • “Gammaretrovirus” refers to a genus of the retroviridae family. Examples of gammaretroviruses include mouse stem cell virus, murine leukemia virus, feline leukemia virus, feline sarcoma virus, and avian reticuloendotheliosis viruses.
  • Lentiviral vectors include HIV-based lentiviral vectors for gene delivery, which can be integrative or non-integrative, have relatively large packaging capacity, and can transduce a range of different cell types. Lentiviral vectors are usually generated following transient transfection of three (packaging, envelope, and transfer) or more plasmids into producer cells. Like HIV, lentiviral vectors enter the target cell through the interaction of viral surface glycoproteins with receptors on the cell surface. On entry, the viral RNA undergoes reverse transcription, which is mediated by the viral reverse transcriptase complex. The product of reverse transcription is a double-stranded linear viral DNA, which is the substrate for viral integration into the DNA of infected cells.
  • the viral vector can be a gammaretrovirus, e.g, Moloney murine leukemia virus (MLV)-derived vectors.
  • the viral vector can be a more complex retrovirus-derived vector, e.g. , a lentivirus-derived vector. HIV-1- derived vectors belong to this category.
  • Other examples include lentivirus vectors derived from HIV-2, FIV, equine infectious anemia virus, SIV, and Maedi-Visna virus (ovine lentivirus).
  • Retroviral and lentiviral vector constructs and expression systems are also commercially available.
  • Other viral vectors also can be used for polynucleotide delivery including DNA viral vectors, including, for example adenovirus-based vectors and adeno-associated virus (AAV)-based vectors; vectors derived from herpes simplex viruses (HSVs), including amplicon vectors, replication-defective HSV and attenuated HSV (Krisky et al., Gene Ther. 5:1517, 1998).
  • HSVs herpes simplex viruses
  • plasmid vectors such as sleeping beauty or other transposon vectors.
  • a viral vector genome comprises a plurality of polynucleotides to be expressed in a host cell as separate transcripts
  • the viral vector may also comprise additional sequences between the two (or more) transcripts allowing for bicistronic or multi cistronic expression. Examples of such sequences used in viral vectors include internal ribosome entry sites (IRES), furin cleavage sites, viral 2A peptide, or any combination thereof.
  • IRES internal ribosome entry sites
  • furin cleavage sites viral 2
  • Plasmid vectors including DNA-based antibody or antigen binding fragment- encoding plasmid vectors for direct administration to a subject, are described further herein.
  • the term "host” refers to a cell or microorganism targeted for genetic modification with a heterologous nucleic acid molecule to produce a polypeptide of interest (e.g ., an antibody of the present disclosure).
  • a host cell may include any individual cell or cell culture which may receive a vector or the incorporation of nucleic acids or express proteins.
  • the term also encompasses progeny of the host cell, whether genetically or phenotypically the same or different.
  • Suitable host cells may depend on the vector and may include mammalian cells, animal cells, human cells, simian cells, insect cells, yeast cells, and bacterial cells. These cells may be induced to incorporate the vector or other material by use of a viral vector, transformation via calcium phosphate precipitation, DEAE-dextran, electroporation, microinjection, or other methods. See, for example, Sambrook et al., Molecular Cloning:
  • a "host” refers to a cell or a subject infected with a betacoronavirus.
  • Antigen refers to an immunogenic molecule that provokes an immune response. This immune response may involve antibody production, activation of specific immunologically-competent cells, activation of complement, antibody dependent cytotoxicicity, or any combination thereof.
  • An antigen immunogenic molecule
  • An antigen may be, for example, a peptide, glycopeptide, polypeptide, glycopolypeptide, polynucleotide, polysaccharide, lipid, or the like. It is readily apparent that an antigen can be synthesized, produced recombinantly, or derived from a biological sample. Exemplary biological samples that can contain one or more antigens include tissue samples, stool samples, cells, biological fluids, or combinations thereof.
  • Antigens can be produced by cells that have been modified or genetically engineered to express an antigen. Antigens can also be present in a betacoronavirus (e.g, a surface glycoprotein or portion thereof), such as present in a virion, or expressed or presented on the surface of a cell infected by a betacoronavirus.
  • a betacoronavirus e.g, a surface glycoprotein or portion thereof
  • epitope includes any molecule, structure, amino acid sequence, or protein determinant that is recognized and specifically bound by a cognate binding molecule, such as an immunoglobulin, or other binding molecule, domain, or protein.
  • Epitopic determinants generally contain chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three- dimensional structural characteristics, as well as specific charge characteristics.
  • the epitope can be comprised of consecutive amino acids (e.g, a linear epitope), or can be comprised of amino acids from different parts or regions of the protein that are brought into proximity by protein folding (e.g, a discontinuous or conformational epitope), or non-contiguous amino acids that are in close proximity irrespective of protein folding.
  • the present disclosure provides an isolated antibody, or an antigen binding fragment thereof, that comprises a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, and is capable of binding to a surface glycoprotein of a betacoronavirus.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • the antibody or antigen binding fragment thereof is capable of binding to a surface glycoprotein of two or more betacoronaviruses.
  • the antibody or antigen binding fragment thereof is capable of binding to a surface glycoprotein of any two, three, four, or five betacoronaviruses.
  • the antibosy or antigen-bindig fragment thereof is capable of binding to a surface glycoprotein of a SARS-CoV, SARS-CoV-2, MERS-CoV, OC43, and HKU.
  • an antibody or antigen binding fragment of the present disclosure associates with or unites with a betacoronavirus surface glycoprotein epitope or antigen comprising the epitope, while not significantly associating or uniting with any other molecules or components in a sample.
  • the epitope is comprised in a S2 subunit of a spike (S) protein.
  • the epitope is not comprised in a SI subunit or a receptor binding domain (RBD) of a S protein.
  • the epitope is a conformational epitope or a linear epitope. In some embodiments, the epitope is present in a post-fusion conformation of the S protein, a pre fusion conformation of the S protein, or both. In some embodiments, the epitope is comprised in a connection domain or linker domain disposed between a HR2 region and a central helix (CH) region of the S protein.
  • a connection domain or linker domain disposed between a HR2 region and a central helix (CH) region of the S protein.
  • the epitope is comprised in, or comprises one or more of the S protein amino acids of, the S protein amino acid sequence FX1X2ELX3X4 XsFKNXeXvXsXgXioXi 1X12X13X14 (SEQ ID NO:46), wherein: Xi is K, E, or Q; X2 is E, S, or D; X3 is D or S; X4 is K, Q, H, or E; X5 is Y, W, or F; X6 is H, Q, or V; X7 is T or S; Xs is S, L, or T; X9 is P, V, L, or S; X10 is D, A, P, or I; X11 is V or P; X12 is D or N; X13 is L or F; and X14 is G, S, or T.
  • the N at position 11 of SEQ ID NO:46 is glycosylated.
  • an antibody or antigen binding fragment of the present disclosure associates with or unites (e.g ., binds) to a first betacoronavirus surface glycoprotein epitope, and can also associate with or unite with an epitope from another betacoronavirus present in the sample, but not significantly associating or uniting with any other molecules or components in the sample.
  • an antibody or antigen binding fragment of the present disclosure is cross-reactive against and specific for two, three, four, or more betacoronaviruses.
  • an antibody or antigen binding fragment does not bind to an alphacoronavirus, as measured by ELISA (e.g., at 1 pg/mL antigen).
  • an antibody or antigen binding fragment of the present disclosure specifically binds to a betacoronavirus surface glycoprotein.
  • “specifically binds” refers to an association or union of an antibody or antigen binding fragment to an antigen with an affinity or K a (i.e., an equilibrium association constant of a particular binding interaction with units of 1/M) equal to or greater than 10 5 M 1 (which equals the ratio of the on-rate [K 0n ] to the off rate [K 0ff ] for this association reaction), while not significantly associating or uniting with any other molecules or components in a sample.
  • K a i.e., an equilibrium association constant of a particular binding interaction with units of 1/M
  • affinity may be defined as an equilibrium dissociation constant (Kd) of a particular binding interaction with units of M (e.g ., 10 5 M to 10 13 M).
  • Antibodies may be classified as “high-affinity” antibodies or as “low-affinity” antibodies.
  • “High- affinity” antibodies refer to those antibodies having a K a of at least 10 7 M 1 , at least 10 8 M 1 , at least 10 9 M 1 , at least 10 10 M 1 , at least 10 11 M 1 , at least 10 12 M _1 , or at least 10 13 M 1 .
  • “Low-affinity” antibodies refer to those antibodies having a K a of up to 10 7 M 1 , up to 10 6 M 1 , up to 10 5 M 1 .
  • affinity may be defined as an equilibrium dissociation constant (K d ) of a particular binding interaction with units of M (e.g., 10 5 M to 10 13 M).
  • assays for identifying antibodies of the present disclosure that bind a particular target, as well as determining binding domain or binding protein affinities, such as Western blot, ELISA (e.g, direct, indirect, or sandwich), analytical ultracentrifugation, spectroscopy, biolayer interferometry, and surface plasmon resonance (Biacore®) analysis (see, e.g., Scatchard etal., Ann. N.Y. Acad. Sci. 57:660, 1949; Wilson, Science 295: 2103, 2002; Wolff etal., Cancer Res. 53: 2560, 1993; and U.S. Patent Nos. 5,283,173, 5,468,614, or the equivalent). Assays for assessing affinity or apparent affinity or relative affinity are also known.
  • an antibody or antigen binding fragment of the present disclosure binds to a spike (S) protein from each of MERS, HKU1, OC43, SARS-CoV, and SARS-CoV-2 with an EC50 in a range from about 7 to about 75 pg/mL.
  • an antibody or antigen binding fragment of the present disclosure binds to each of MERS, OC43, SARS-CoV, and SARS-CoV-2 with a EC50 in a range from about 5 to about 9 pg/mL, or in a range from about 6 to about 8.5 pg/mL, or of about 7, 7.5, 8, or 8.5 pg/mL, as determined by ELISA (e.g, using a pre-fusion stabilized spike protein with wells coated at 1 pg/mL spike protein).
  • the antibody or antigen binding fragment binds to S protein of HKU1 with an EC50 of about 72 pg/mL, as determined by ELISA.
  • an antibody or antigen binding fragment of the present disclosure binds to each of MERS, HKU1, and OC43 with a EC50 in a range from about 200 to about 4300pg/mL. In certain embodiments, an antibody or antigen binding fragment of the present disclosure binds to each of MERS and OC432 with a EC50 in a range from about 200 to about 800 pg/mL, or in a range from about 230 to about 730 pg/mL, or of about 230 or about 730 pg/mL, as determined by ELISA (e.g, using a pre fusion stabilized spike protein with wells coated at 1 pg/mL spike protein).
  • binding can be determined by recombinantly expressing a betacoronavirus antigen in a host cell (e.g, by transfection) and immunostaining the (e.g, fixed, or fixed and permeabilized) host cell with antibody and analyzing binding by flow cytometry (e.g, using a ZE5 Cell Analyzer (BioRad®) and FlowJo software (TreeStar).
  • positive binding can be defined by differential staining by antibody of betacoronavirus-expressing cells versus control (e.g, mock) cells.
  • an antibody or antigen binding fragment of the present disclosure binds to a betacoronavirus spike protein (i.e., from two, three, four, or all five of SARS-CoV-2, SARS-CoV, OC43, and MERS) expressed on the surface of a host cell (e.g, an Expi-CHO cell), as determined by flow cytometry.
  • a betacoronavirus spike protein i.e., from two, three, four, or all five of SARS-CoV-2, SARS-CoV, OC43, and MERS
  • a host cell e.g, an Expi-CHO cell
  • an antibody or antigen binding fragment of the present disclosure binds to a betacoronavirus S protein, as measured using biolayer interferometry.
  • an antibody of the present disclosure is capable of neutralizing infection by a betacoronavirus. In certain embodiments, an antibody of the present disclosure is capable of neutralizing infection by two, three, four, or five betacoronaviruses.
  • a “neutralizing antibody” is one that can neutralize, i.e., prevent, inhibit, reduce, impede, or interfere with, the ability of a pathogen to initiate and/or perpetuate an infection in a host.
  • neutralizing antibody and “an antibody that neutralizes” or “antibodies that neutralize” are used interchangeably herein.
  • the antibody or antigen binding fragment is capable of preventing and/or neutralizing infection by any two, three, four, or five betacoronaviruses in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human
  • an antibody or antigen binding fragment of the present disclosure is capable of neutralizing infection by live SARS-CoV-2 with an IC50 in a range from about 3,300 pg/mL to about 3,900 pg/mL, or in a range from about about 3,400 pg/mL to about 3,800 pg/mL, or in a range from about 3,500 pg/mL to about 3,700 pg/mL, or of about 3,600 pg/mL, about 3,650 pg/mL, or about 3,700 pg/mL.
  • neutralization of infection is determined using SARS-CoV-2/luciferase with a multiplicity of infection (MOI) of 0.01 for 24h on VeroE6 cells.
  • an antibody or antigen binding fragment of the present disclosure is capable of neutralizing infection by MERS-CoV pseudovirus (e.g ., MLV-pp) and SARS-CoV-2 pseudovirus (e.g., MLV-pp) with an IC50 in a range from about 4 pg/mL to about 7 pg/mL, or in a range from about about 4.5 pg/mL to about 6.5 pg/mL.
  • MERS-CoV pseudovirus e.g ., MLV-pp
  • SARS-CoV-2 pseudovirus e.g., MLV-pp
  • an antibody or antigen binding fragment of the present disclosure is capable of neutralizing infection by MERS-CoV pseudovirus (e.g, MLV-pp) with an IC50 of about 6.3 pg/mL, and/or is capable of neutralizing infection by SARS-CoV-2 pseudovirus (e.g, MLV-pp) with an IC50 of about 4.7 pg/mL.
  • MERS-CoV pseudovirus e.g, MLV-pp
  • SARS-CoV-2 pseudovirus e.g, MLV-pp
  • neutralization of infection is determined using MERS-CoV on Huh7 cells.
  • neutralization of infection is determined using SARS-CoV-2 on Vero E6 cells.
  • an antibody or antigen binding fragment of the present disclosure is capable of neutralizing a betacoronavirus infection (e.g, by one, two, three, four, or five betacoronaviruses) or a betacoronavirus pseudotyped virus with an IC50 in a range from about 1 to about 10 pg/ml.
  • an antibody or antigen binding fragment is capable of neutralizing a betacoronaviruse infection, or a betacoronavirus pseudotyped virus, with an IC50 in a range from about 3 to about 6 pg/ml.
  • the antibody or antigen binding fragment (i) recognizes an epitope in the Spike protein of two, three, four, five, or more betacoronaviruses; (ii) is capable of blocking an interaction between the Spike protein of one or more betacoronavirus and a cell surface receptor; (iii) recognizes an epitope that is conserved in the Spike protein of two, three, four, five, or more betacoronaviruses; (iv) is cross-reactive against two, three, four, five, or more betacoronaviruses; or (v) any combination of (i)-(iv).
  • antibody refers to an intact antibody comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, as well as any antigen binding portion or fragment of an intact antibody that has or retains the ability to bind to the antigen target molecule recognized by the intact antibody, such as an scFv, Fab, or Fab'2 fragment.
  • antibody herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen binding) antibody fragments thereof, including fragment antigen binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g ., sdAb, sdFv, nanobody) fragments.
  • Fab fragment antigen binding
  • rlgG recombinant IgG
  • scFv single chain variable fragments
  • single domain antibodies e.g ., sdAb, sdFv, nanobody
  • the term encompasses genetically engineered and/or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific antibodies, diabodies, triabodies, tetrabodies, tandem di-scFv, and tandem tri-scFv.
  • antibody should be understood to encompass functional antibody fragments thereof.
  • the term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof (IgGl, IgG2, IgG3, IgG4), IgM, IgE, IgA, and IgD.
  • variable binding regions refer to the variable binding region from an antibody light chain and an antibody heavy chain, respectively.
  • a VL is a kappa (K) class (also “VK” herein).
  • a VL is a lambda (l) class.
  • the variable binding regions comprise discrete, well-defined sub- regions known as “complementarity determining regions” (CDRs) and “framework regions” (FRs).
  • CDR complementarity determining region
  • HVR hypervariable region
  • an antibody VH comprises four FRs and three CDRs as follows:
  • FR1 -HCDR1 -FR2-HCDR2-FR3 -HCDR3 -FR4; and an antibody VL comprises four FRs and three CDRs as follows: FR 1 -LCDR 1 -FR2-LCDR2-FR3 -LCDR3 -FR4.
  • the VH and the VL together form the antigen binding site through their respective CDRs.
  • a "variant" of a CDR refers to a functional variant of a CDR sequence having up to 1-3 amino acid substitutions (e.g ., conservative or non-conservative substitutions), deletions, or combinations thereof.
  • Numbering of CDR and framework regions may be according to any known method or scheme, such as the Rabat, Chothia, EU, IMGT, Contact, North, Martin, and AHo numbering schemes (see, e.g., Rabat etal., "Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5 th ed.; Chothia and Lesk, J. Mol. Biol. 796:901-917 (1987)); Lefranc et al., Dev. Comp. Immunol. 27:55, 2003; Honegger and Pluckthun, J. Mol. Bio. 309:651-610 (2001); North etal. J Mol Biol. (2011) 406: 228-56; doi: 10.1016/j.jmb.2010.10.030; Abhinandan and Martin, Mol Immunol. (2008) 45:3832-9.
  • Rabat etal. "Sequences of Proteins of Immunological Interest, US
  • an antibody or antigen binding fragment comprises CDRs of a VH sequence according to any one of SEQ ID NOs: 26, 36, 47, 66, 71, 72, 73, or 79 and CDRs of a VL sequence according to any one of SEQ ID NOs: 30, 40, 51, 69,
  • CDRs are according to the IMGT numbering method.
  • CDRs are according to the antibody numbering method developed by the Chemical Computing Group (CCG); e.g ., using Molecular Operating Environment (MOE) software (www.chemcomp.com).
  • CCG Chemical Computing Group
  • MOE Molecular Operating Environment
  • an antibody or an antigen binding fragment comprises a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRLl, a CDRL2, and a CDRL3, wherein: (i) the CDRH1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs: 27, 37, 48, 67, or 80, or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid; (ii) the CDRH2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs: 28, 38, 49, 68, or 81 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid
  • the CDRL2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs: 32,
  • the CDRL3 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs: 33, 43, or 54, or a sequence variant thereof comprising having one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus or betacoronaviruses being expressed on a cell surface of a host cell and/or on a virion.
  • the antibody or antigen binding fragment thereof is capable of neutralizing infection of a betacoronavirus in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human. In certain embodiments, the antibody or antigen binding fragment thereof is capable of neutralizing infection by one, two, three, four, or five betacoronaviruses in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • the antibody or antigen binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs: (i) 27-29 and 31-33, respectively; (ii) 37-39 and 41- 43, respectively; (iii) 48-50 and 52-54, respectively (iv) 67, 68, and 29 and 70, 32, and 33, respectively, (v) 26, 27, and 74 and 31-33, respectively, (vi) 27-29 and 76, 32, and 33, respectively, (vii) 27-29 and 78, 32, and 33, respectively, (viii) 80, 81, and 50 and 83, 53, and 54, respectively.
  • an antibody or an antigen binding fragment of the present disclosure comprises a CDRH1, a CDRH2, a CDRH3, a CDRL1, a CDRL2, and a CDRL3, wherein each CDR is independently selected from a corresponding CDR of Antibody 420_1_1 (also referred to as Antibody S2P6), Antibody 420_1_2 (also referred to as Antibody S2S8), or Antibody S2S43, or a variant antibody thereof, as provided in Table 1. That is, all combinations of CDRs from the betacoronavirus antibodies and the variant sequences thereof provided in Table 1 are contemplated.
  • an antibody or an antigen binding fragment thereof of the present disclosure comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 26, 36, 47, 66, 71, 72, 73, or 79 and a light chain comprising the amino acid sequence of SEQ ID NO: 30, 40, 51, 69, 75, 77, or 82.
  • an antibody or antigen binding fragment thereof of the present disclosure comprises two heavy chain, both comprising comprising the amino acid sequence of SEQ ID NO: 26, 36, 47, 66, 71, 72, 73, or 79 and two light chains, both comprising the amino acid sequence of SEQ ID NO: 30, 40, 51, 69, 75, 77, or 82.
  • CL refers to an "immunoglobulin light chain constant region” or a "light chain constant region,” i.e., a constant region from an antibody light chain.
  • CH refers to an "immunoglobulin heavy chain constant region” or a "heavy chain constant region,” which is further divisible, depending on the antibody isotype into CHI, CH2, and CH3 (IgA, IgD, IgG), or CHI, CH2, CH3, and CH4 domains (IgE, IgM).
  • CHI unimmunoglobulin heavy chain constant region
  • an antibody or antigen binding fragment of the present disclosure comprises any one or more of CL, a CHI, a CH2, and a CH3.
  • a CL comprises an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO:
  • a CH1-CH2-CH3 comprises an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO:6 or SEQ ID NO:7.
  • an antibody or antigen binding fragment of the present disclosure can comprise a heavy chain, a CH1-CH3, a CH3, or an Fc polypeptide wherein a C-terminal lysine residue is present or is absent; in other words, encompassed are embodiments where the C-terminal residue of a heavy chain, a CH1-CH3, or an Fc polypeptide is not a lysine, and embodiments where a lysine is the C-terminal residue.
  • a composition comprises a plurality of an antibody and/or an antigen binding fragment of the present disclosure, wherein one or more antibody or antigen binding fragment does not comprise a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide, and wherein one or more antibody or antigen binding fragment comprises a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide.
  • a “Fab” fragment antigen binding is the part of an antibody that binds to antigens and includes the variable region and CHI of the heavy chain linked to the light chain via an inter-chain disulfide bond. Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen binding site. Pepsin treatment of an antibody yields a single large F(ab')2 fragment that roughly corresponds to two disulfide linked Fab fragments having divalent antigen binding activity and is still capable of cross-linking antigen.
  • Both the Fab and F(ab’)2 are examples of "antigen binding fragments.”
  • Fab' fragments differ from Fab fragments by having additional few residues at the carboxy terminus of the CHI domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • Fab fragments may be joined, e.g ., by a peptide linker, to form a single chain Fab, also referred to herein as "scFab.”
  • a single chain Fab also referred to herein as "scFab.”
  • an inter-chain disulfide bond that is present in a native Fab may not be present, and the linker serves in full or in part to link or connect the Fab fragments in a single polypeptide chain.
  • a heavy chain-derived Fab fragment e.g., comprising, consisting of, or consisting essentially of VH + CHI, or "Fd”
  • a light chain-derived Fab fragment e.g., comprising, consisting of, or consisting essentially of VL + CL
  • a scFab may be arranged, in N-terminal to C-terminal direction, according to (heavy chain Fab fragment - linker - light chain Fab fragment) or (light chain Fab fragment - linker - heavy chain Fab fragment).
  • Peptide linkers and exemplary linker sequences for use in scFabs are discussed in further detail herein.
  • "Fv” is a small antibody fragment that contains a complete antigen-recognition and antigen binding site. This fragment generally consists of a dimer of one heavy- and one light-chain variable region domain in tight, non-covalent association. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although typically at a lower affinity than the entire binding site.
  • Single-chain Fv also abbreviated as “sFv” or “scFv”
  • sFv single-chain Fv
  • the scFv polypeptide comprises a polypeptide linker disposed between and linking the VH and VL domains that enables the scFv to retain or form the desired structure for antigen binding.
  • a peptide linker can be incorporated into a fusion polypeptide using standard techniques well known in the art.
  • the antibody or antigen binding fragment comprises a scFv comprising a VH domain, a VL domain, and a peptide linker linking the VH domain to the VL domain.
  • a scFv comprises a VH domain linked to a VL domain by a peptide linker, which can be in a VH-linker-VL orientation or in a VL-linker- VH orientation.
  • Any scFv of the present disclosure may be engineered so that the C- terminal end of the VL domain is linked by a short peptide sequence to the N-terminal end of the VH domain, or vice versa (i.e., (N)VL(C)-linker-(N)VH(C) or (N)VH(C)-linker- (N)VL(C).
  • a linker may be linked to an N-terminal portion or end of the VH domain, the VL domain, or both.
  • Peptide linker sequences may be chosen, for example, based on: (1) their ability to adopt a flexible extended conformation; (2) their inability or lack of ability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides and/or on a target molecule; and/or (3) the lack or relative lack of hydrophobic or charged residues that might react with the polypeptides and/or target molecule.
  • linker design e.g ., length
  • linker design e.g ., length
  • peptide linker sequences contain, for example, Gly, Asn and Ser residues.
  • linker sequence may also be included in a linker sequence.
  • Other amino acid sequences which may be usefully employed as linker include those disclosed in Maratea et ah, Gene 40:3946 (1985); Murphy et ah, Proc. Natl. Acad. Sci. USA 83:8258 8262 (1986); U.S. Pat. No. 4,935,233, and U.S. Pat. No. 4,751,180.
  • linkers may include, for example, Glu-Gly-Lys-Ser-Ser-Gly-Ser-Gly-Ser-Glu-Ser-Lys-Val- Asp (SEQ ID NO: 19) (Chaudhary et ah, Proc. Natl. Acad. Sci.
  • Any suitable linker may be used, and in general can be about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 15 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100 amino acids in length, or less than about 200 amino acids in length, and will preferably comprise a flexible structure (can provide flexibility and room for conformational movement between two regions, domains, motifs, fragments, or modules connected by the linker), and will preferably be biologically inert and/or have a low risk of immunogenicity in a human.
  • Exemplary linkers include those comprising or consisting of the amino acid sequence set forth in any one or more of SEQ ID NOs: 10-21.
  • the linker comprises or consists of an amino acid sequence having at least 75% (i.e., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) identity to the amino acid sequence set forth in any one of SEQ ID NOs: 10-21.
  • scFv can be constructed using any combination of the VH and VL sequences or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences disclosed herein.
  • linker sequences are not required; for example, when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.
  • DNA in the germline variable (V), joining (J), and diversity (D) gene loci may be rearranged and insertions and/or deletions of nucleotides in the coding sequence may occur. Somatic mutations may be encoded by the resultant sequence, and can be identified by reference to a corresponding known germline sequence.
  • somatic mutations that are not critical to a desired property of the antibody e.g ., binding to a SARS-CoV-2 antigen
  • that confer an undesirable property upon the antibody e.g., an increased risk of immunogenicity in a subject administered the antibody
  • the antibody or antigen binding fragment of the present disclosure comprises at least one more germline-encoded amino acid in a variable region as compared to a parent antibody or antigen binding fragment, provided that the parent antibody or antigen binding fragment comprises one or more somatic mutations.
  • Variable region and CDR amino acid sequences of exemplary anti-betacoronavirus antibodies of the present disclosure are provided in Table 1 herein.
  • an antibody or antigen binding fragment comprises an amino acid modification (e.g, a substitution mutation) to remove an undesired risk of oxidation, deamidation, and/or isomerization.
  • an amino acid modification e.g, a substitution mutation
  • variant antibodies that comprise one or more amino acid alterations in a variable region (e.g, VH, VL, framework or CDR) as compared to a presently disclosed (“parent”) antibody, wherein the variant antibody is capable of binding to a SARS-CoV-2 antigen.
  • a variable region e.g, VH, VL, framework or CDR
  • the VH comprises or consists of an amino acid sequence having at least 85% (i.e., 85%, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) identity to the amino acid sequence according to any one of SEQ ID NOs: 26, 36, 47, 66, 71, 72, 73, and 79 wherein the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline- encoded amino acid; and/or (ii) the VL comprises or consists of an amino acid sequence having at least 85% (i.e., 85%, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) identity to the amino acid sequence according to any one of SEQ ID NOs: 30, 40,
  • variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid.
  • the VH comprises or consists of any VH amino acid sequence set forth in Table 1
  • the VL comprises or consists of any VL amino acid sequence set forth in Table 1.
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs: (i) 26 and 30, respectively; (ii) 26 and 69, respectively, (iii) 26 and 75, respectively, (iv) 26 and 77, respectively, (v) 66 and 69, respectively, (vi) 66 and 30, respectively, (vii) 66 and 75, respectively, (viii) 66 and 77, respectively, (ix) 71 and 30, respectively, (x) 71 and 69, respectively, (xi) 71 and 75, respectively, (xii) 71 and 77, respectively, (xiii) 72 and 30, respectively, (xiv) 72 and 69, respectively, (xv) 72 and 75, respectively, (xvi) 72 and 77, respectively, (xvii) 73 and 30, respectively, (
  • the VH and the VL comprise or consist of the amino acid sequences having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NOs: (i) 26 and 30, respectively; (ii) 26 and 69, respectively, (iii) 26 and 75, respectively, (iv) 26 and 77, respectively, (v) 66 and 69, respectively, (vi) 66 and 30, respectively, (vii) 66 and 75, respectively, (viii) 66 and 77, respectively, (ix) 71 and 30, respectively, (x) 71 and 69, respectively, (xi) 71 and 75, respectively, (xii) 71 and 77, respectively, (xiii) 72 and 30, respectively, (xiv) 72 and 69, respectively, (xv) 72 and 75, respectively, (xvi) 72 and
  • an antibody or antigen binding fragment comprises (1) a VH comprising a CDRH1, a CDRH2, and a CDRH3, and (2) a VL comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 are according to the VH and VL amino acid sequences set forth in SEQ ID NOs: (i) 26 and 30, respectively; (ii) 36 and 40, respectively; (iii) 47 and
  • the CDRs are according to the IMGT numbering system. In some embodiments, the CDRs are according to the Rabat numbering system. In some embodiments, the CDRs are according to the Chothia numbering system. In some embodiments, the CDRs are according to the AHo numbering system. In some embodiments, the CDRs are according to the North numbering system. In some embodiments, the CDRs are according to the Martin numbering system.
  • the antibody or antigen binding fragment is an IgG, IgA, IgM, IgE, or IgD isotype. In some embodiements, the antibody or antigen binding fragment is human, humanized, or chimeric.
  • the antibody, or the antigen binding fragment comprises a human antibody, a monoclonal antibody, a purified antibody, a single chain antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a scFv, or a scFab.
  • an antibody or antigen binding fragment of the present disclosure is monospecific (e.g ., binds to a single epitope) or is multispecific ( e.g ., binds to multiple epitopes and/or target molecules).
  • Antibodies and antigen binding fragments may be constructed in various formats. Exemplary antibody formats disclosed in Spiess et al., Mol. Immunol.
  • SEEDbodies, Triomabs, LUZ-Y assemblies, Fcabs, kl-bodies, orthogonal Fabs, DVD-Igs (e.g., US Patent No. 8,258,268, which formats are incorporated herein by reference in their entirety), IgG(H)-scFv, scFv-(H)IgG, IgG(L)-scFv, scFv-(L)IgG, IgG(L,H)-Fv, IgG(H)-V, V(H)-IgG, IgG(L)-V, V(L)-IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig,
  • the antibody or antigen binding fragment comprises two or more of VH domains, two or more VL domains, or both (i.e., two or more VH domains and two or more VL domains).
  • an antigen binding fragment comprises the format (N-terminal to C-terminal direction) VH-linker-VL-linker-VH-linker- VL, wherein the two VH sequences can be the same or different and the two VL sequences can be the same or different.
  • Such linked scFvs can include any combination of VH and VL domains arranged to bind to a given target, and in formats comprising two or more VH and/or two or more VL, one, two, or more different eptiopes or antigens may be bound. It will be appreciated that formats incorporating multiple antigen binding domains may include VH and/or VL sequences in any combination or orientation.
  • the antigen binding fragment can comprise the format VL4inker-VH4inker-VL-linker-VH, VH-linker-VL-linker-VL4inker-VH, or VL4inker-VH4inker-VH4inker-VL.
  • Monospecific or multispecific antibodies or antigen binding fragments of the present disclosure constructed comprise any combination of the VH and VL sequences and/or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences disclosed herein.
  • a bispecific or multispecific antibody or antigen binding fragment may, in some embodiments, comprise one, two, or more antigen binding domains (e.g ., a VH and a VL) of the instant disclosure.
  • Two or more binding domains may be present that bind to the same or a different betacoronavirus epitope, and a bispecific or multispecific antibody or antigen binding fragment as provided herein can, in some embodiments, comprise a further SARS-CoV-2 binding domain, and/or can comprise a binding domain that binds to a different antigen or pathogen altogether.
  • the antibody or antigen binding fragment can be multispecific; e.g., bispecific, trispecific, or the like.
  • the antibody or antigen binding fragment comprises: (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH and the second VH are different and each independently comprise an amino acid sequence having at least 85% (i.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs: 26, 36, 47, 66, 71, 72, 73 and 79 and wherein the first VL and the second VL are different and each independently comprise an amino acid sequence having at least 85% (i.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
  • the antibody or antigen binding fragment comprises a Fc polypeptide, or a fragment thereof.
  • An Fc polypeptide, an Fc dimer, or a fragment of an Fc can also be referred to as an Fc moiety.
  • the "Fc" fragment or Fc polypeptide comprises the carboxy -terminal portions (i.e., the CH2 and CH3 domains of IgG) of both antibody H chains held together by disulfides.
  • Antibody effector functions refer to those biological activities attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype. Examples of antibody effector functions include: Clq binding and complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation. As discussed herein, modifications (e.g., amino acid substitutions) may be made to an Fc domain in order to modify (e.g, improve, reduce, or ablate) one or more functionality of an Fc-containing polypeptide (e.g, an antibody of the present disclosure).
  • Fc receptor FcR
  • antibody half-life modulation e.g., by binding to FcRn
  • ADCC function protein A binding
  • protein G binding protein G binding
  • complement binding Amino acid modifications that modify (e.g., improve, reduce, or ablate) Fc functionalities include, for example, the T250Q/M428L, M252Y/S254T/T256E, H433K/N434F, M428L/N434S, E233P/L234V/L235A/G236 + A327G/A330S/P331S, E333A, S239D/A330L/I332E, P257EQ311, K326W/E333S, S239D/I332E/G236A, N297Q, K322A, S228P, L235E + E318A/K320A/K322A, L234A/L235A (also referred to herein as
  • the Clq protein complex can bind to at least two molecules of IgGl or one molecule of IgM when the immunoglobulin molecule(s) is attached to the antigenic target (Ward, E. S., and Ghetie, V., Ther. Immunol. 2 (1995) 77-94).
  • Burton, D. R. described ⁇ Mol. Immunol. 22 (1985) 161-206) that the heavy chain region comprising amino acid residues 318 to 337 is involved in complement fixation.
  • FcR binding can be mediated by the interaction of the Fc moiety (of an antibody) with Fc receptors (FcRs), which are specialized cell surface receptors on cells including hematopoietic cells.
  • Fc receptors belong to the immunoglobulin superfamily, and shown to mediate both the removal of antibody-coated pathogens by phagocytosis of immune complexes, and the lysis of erythrocytes and various other cellular targets (e.g. tumor cells) coated with the corresponding antibody, via antibody dependent cell mediated cytotoxicity (ADCC; Van de Winkel, J. G., and Anderson, C. L., J. Leukoc. Biol. 49 (1991) 511-524).
  • ADCC antibody dependent cell mediated cytotoxicity
  • FcRs are defined by their specificity for immunoglobulin classes; Fc receptors for IgG antibodies are referred to as FcyR, for IgE as FceR, for IgA as FcaR and so on and neonatal Fc receptors are referred to as FcRn.
  • Fc receptor binding is described for example in Ravetch, J. V., and Kinet, J. P., Annu. Rev. Immunol. 9 (1991) 457-492; Capel, P. J., et al., Immunomethods 4 (1994) 25-34; de Haas, M., et al., J Lab. Clin. Med. 126 (1995) 330- 341; and Gessner, J. E., et al., Ann. Hematol. 76 (1998) 231-248.
  • FcyR Fc domain of native IgG antibodies
  • FcyRI CD64
  • FcyRII CD32
  • FcyRII CD32
  • FcyRIIA FcyRIIB
  • FcyRIIC FcyRIIC
  • FcyRIIA is found on many cells involved in killing (e.g. macrophages, monocytes, neutrophils) and seems able to activate the killing process.
  • FcyRIIB seems to play a role in inhibitory processes and is found on B-cells, macrophages and on mast cells and eosinophils. Importantly, it has been shown that 75% of all FcyRIIB is found in the liver (Ganesan, L. P. et ak, 2012: “FcyRIIb on liver sinusoidal endothelium clears small immune complexes,” Journal of Immunology 189: 4981-4988).
  • FcyRIIB is abundantly expressed on Liver Sinusoidal Endothelium, called LSEC, and in Kupffer cells in the liver and LSEC are the major site of small immune complexes clearance (Ganesan, L. P. et ak, 2012: FcyRIIb on liver sinusoidal endothelium clears small immune complexes. Journal of Immunology 189: 4981-4988).
  • the antibodies disclosed herein and the antigen binding fragments thereof comprise an Fc polypeptide or fragment thereof for binding to FcyRIIb, in particular an Fc region, such as, for example IgG-type antibodies.
  • Fc region such as, for example IgG-type antibodies.
  • the antibodies of the present disclosure, or the antigen binding fragments thereof comprise an engineered Fc moiety with the mutations S267E and L328F, in particular as described by Chu, S. Y. et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD 19 and FcgammaRIIb with Fc-engineered antibodies.
  • FcyRIIB may function to suppress further immunoglobulin production and isotype switching to, for example, the IgE class.
  • FcyRIIB On macrophages, FcyRIIB is thought to inhibit phagocytosis as mediated through FcyRIIA.
  • the B form On eosinophils and mast cells, the B form may help to suppress activation of these cells through IgE binding to its separate receptor.
  • modification in native IgG of at least one of E233-G236, P238, D265, N297, A327 and P329 reduces binding to FcyRI.
  • IgG2 residues at positions 233-236, substituted into corresponding positions IgGl and IgG4, reduces binding of IgGl and IgG4 to FcyRI by 10 3 -fold and eliminated the human monocyte response to antibody- sensitized red blood cells (Armour, K. L., et al. Eur. J. Immunol. 29 (1999) 2613-2624).
  • FcyRIIA reduced binding for FcyRIIA is found, e.g., for IgG mutation of at least one of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, R292 and K414.
  • allelic forms of human FcyRIIA are the "H131" variant, which binds to IgGl Fc with high affinity, and the "R131” variant, which binds to IgGl Fc with low affinity.
  • FcyRIII binding reduced binding to FcyRIIIA is found, e.g., for mutation of at least one of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, S239, E269, E293, Y296, V303, A327, K338 and D376. Mapping of the binding sites on human IgGl for Fc receptors, the above-mentioned mutation sites, and methods for measuring binding to FcyRI and FcyRIIA, are described in Shields, R. L., et al., J. Biol. Chem. 276 (2001) 6591-6604.
  • FcyRIIIA Two allelic forms of human FcyRIIIA are the "FI 58" variant, which binds to IgGl Fc with low affinity, and the "VI 58" variant, which binds to IgGl Fc with high affinity. See, e.g., Bruhns et al, Blood 773:3716-3725 (2009).
  • two regions of native IgG Fc appear to be involved in interactions between FcyRIIs and IgGs, namely (i) the lower hinge site of IgG Fc, in particular amino acid residues L, L, G, G (234 - 237, EU numbering), and (ii) the adjacent region of the CH2 domain of IgG Fc, in particular a loop and strands in the upper CH2 domain adjacent to the lower hinge region, e.g. in a region of P331 (Wines, B.D., et al., J. Immunol. 2000; 164: 5313 - 5318).
  • FcyRI appears to bind to the same site on IgG Fc
  • FcRn and Protein A bind to a different site on IgG Fc, which appears to be at the CH2-CH3 interface
  • mutations that increase binding affinity of an Fc polypeptide or fragment thereof of the present disclosure to a (i.e., one or more) Fey receptor (e.g., as compared to a reference Fc polypeptide or fragment thereof or containing the same that does not comprise the mutation(s)). See, e.g., Delillo and Ravetch, Cell 161(5): 1035-1045 (2015) and Ahmed et al., J. Struc. Biol. 194(1):78 (2016), the Fc mutations and techniques of which are incorporated herein by reference.
  • an antibody or antigen binding fragment can comprise a Fc polypeptide or fragment thereof comprising a mutation selected from G236A; S239D; A330L; and I332E; or a combination comprising any two or more of the same; e.g., S239D/I332E; S239D/A330L/I332E; G236A/S239D/I332E; G236A/A330L/I332E (also referred to herein as "GAALIE"); or G236A/S239D/A330L/I332E.
  • the Fc polypeptide or fragment thereof does not comprise S239D.
  • the Fc polypeptide or fragment thereof may comprise or consist of at least a portion of an Fc polypeptide or fragment thereof that is involved in binding to FcRn binding.
  • the Fc polypeptide or fragment thereof comprises one or more amino acid modifications that improve binding affinity for (e.g, enhance binding to) FcRn (e.g, at a pH of about 6.0) and, in some embodiments, thereby extend in vivo half-life of a molecule comprising the Fc polypeptide or fragment thereof (e.g., as compared to a reference Fc polypeptide or fragment thereof or antibody that is otherwise the same but does not comprise the modification(s)).
  • the Fc polypeptide or fragment thereof comprises or is derived from a IgG Fc and a half- life-extending mutation comprises any one or more of: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I Q311I; D376V; T307A; E380A (EU numbering).
  • a half-life-extending mutation comprises M428L/N434S (also referred to herein as "MLNS").
  • a half-life- extending mutation comprises M252Y/S254T/T256E.
  • a half-life-extending mutation comprises T250Q/M428L. In certain embodiments, a half-life- extending mutation comprises P257I/Q311I. In certain embodiments, a half-life-extending mutation comprises P257I/N434H. In certain embodiments, a half-life-extending mutation comprises D376V/N434H. In certain embodiments, a half-life-extending mutation comprises T307A/E380A/N434A.
  • an antibody or antigen binding fragment includes a Fc moiety that comprises the substitution mtuations M428L/N434S. In some embodiments, an antibody or antigen binding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mtuations G236A/A330L/I332E. In certain embodiments, an antibody or antigen binding fragment includes a (e.g., IgG) Fc moiety that comprises a G236A mutation, an A330L mutation, and a I332E mutation (GAALIE), and does not comprise a S239D mutation (e.g., comprises a native S at position 239).
  • a Fc moiety that comprises the substitution mtuations M428L/N434S.
  • an antibody or antigen binding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mtuations G236A/A330L/I332E.
  • an antibody or antigen binding fragment includes a (e.g., Ig
  • an antibody or antigen binding fragment includes an Fc polypeptide or fragment thereof that comprises the substitution mutations: M428L/N434S and G236A/A330L/I332E, and optionally does not comprise S239D.
  • an antibody or antigen binding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mutations: M428L/N434S and G236A/S239D/A330L/I332E.
  • the antibody or antigen binding fragment comprises a mutation that alters glycosylation, wherein the mutation that alters glycosylation comprises N297A, N297Q, or N297G, and/or the antibody or antigen binding fragment is partially or fully aglycosylated and/or is partially or fully afucosylated.
  • Host cell lines and methods of making partially or fully aglycosylated or partially or fully afucosylated antibodies and antigen binding fragments are known (see, e.g., PCT Publication No. WO 2016/181357; Suzuki etal. Clin. Cancer Res. 73(6): 1875-82 (2007); Huang et al. MAbs 6:1-12 (2018)).
  • the antibody or antigen binding fragment is capable of eliciting continued protection in vivo in a subject even once no detectable levels of the antibody or antigen binding fragment can be found in the subject (i.e., when the antibody or antigen binding fragment has been cleared from the subject following administration).
  • an antibody or antigen binding fragment comprises one or more modifications, such as, for example, mutations in the Fc comprising G236A, A330L, and I332E, that are capable of activating dendritic cells that may induce, e.g, T cell immunity to the antigen.
  • the antibody or antigen binding fragment comprises a Fc polypeptide or a fragment thereof, including a CH2 (or a fragment thereof, a CH3 (or a fragment thereof), or a CH2 and a CH3, wherein the CH2, the CH3, or both can be of any isotype and may contain amino acid substitutions or other modifications as compared to a corresponding wild-type CH2 or CH3, respectively.
  • a Fc polypeptide of the present disclosure comprises two CH2-CH3 polypeptides that associate to form a dimer.
  • the antibody or antigen binding fragment can be monoclonal.
  • the term "monoclonal antibody” (mAb) as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present, in some cases in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that include different antibodies directed against different epitopes, each monoclonal antibody is directed against a single epitope of the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The term "monoclonal" is not to be construed as requiring production of the antibody by any particular method.
  • monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology first described by Kohler et al, Nature 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal, or plant cells (see, e.g., U.S. Pat. No. 4,816,567). Monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson etal., Nature , 352: 624-628 (1991) and Marks et al., J Mol. Biol., 222:581-597 (1991), for example. Monoclonal antibodies may also be obtained using methods disclosed in PCT Publication No. WO 2004/076677A2.
  • Antibodies and antigen binding fragments of the present disclosure include "chimeric antibodies" in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see, U.S. Pat. Nos. 4,816,567; 5,530,101 and 7,498,415; and Morrison etal., Proc. Natl. Acad. Sci. USA, 57:6851-6855 (1984)).
  • chimeric antibodies may comprise human and non human residues.
  • chimeric antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. For further details, see Jones et al, Nature 321 :522- 525 (1986); Riechmann etal, Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992). Chimeric antibodies also include primatized and humanized antibodies.
  • a “humanized antibody” is generally considered to be a human antibody that has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are typically taken from a variable domain. Humanization may be performed following the method of Winter and co-workers (Jones et al, Nature, 321:522-525 (1986); Reichmann et al., Nature , 332:323-327 (1988); Verhoeyen et al., Science , 239: 1534-1536 (1988)), by substituting non-human variable sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized” antibodies are chimeric antibodies (U.S. Pat. Nos.
  • a “humanized” antibody is one which is produced by a non-human cell or animal and comprises human sequences, e.g ., He domains.
  • human antibody is an antibody containing only sequences that are present in an antibody that is produced by a human.
  • human antibodies may comprise residues or modifications not found in a naturally occurring human antibody (e.g, an antibody that is isolated from a human), including those modifications and variant sequences described herein. These are typically made to further refine or enhance antibody performance.
  • human antibodies are produced by transgenic animals.
  • an antibody or antigen binding fragment of the present disclosure is chimeric, humanized, or human.
  • the present disclosure provides isolated polynucleotides that encode any of the presently disclosed antibodies or an antigen binding fragment thereof, or a portion thereof (e.g, a CDR, a VH, a VL, a heavy chain, or a light chain).
  • the polynucleotide comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), wherein the RNA optionally comprises messenger RNA (mRNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • mRNA messenger RNA
  • the polynucleotide comprises a modified nucleoside, a cap-1 structure, a cap-2 structure, or any combination thereof.
  • the polynucleotide comprises a pseudouridine, a N6-methyladenonsine, a 5-methylcytidine, a 2-thiouridine, or any combination thereof.
  • the pseudouridine comprises Nl-methylpseudouri dine.
  • the polynucleotide is codon-optimized for expression in a host cell.
  • Codon-optimized sequences include sequences that are partially codon-optimized (i.e., one or more codon is optimized for expression in the host cell) and those that are fully codon-optimized.
  • polynucleotides encoding antibodies and antigen binding fragments of the present disclosure may possess different nucleotide sequences while still encoding a same antibody or antigen binding fragment due to, for example, the degeneracy of the genetic code, splicing, and the like.
  • the polynucleotide comprises a polynucleotide having at least 50% (i.e., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the polynucleotide sequence according to any one or more of SEQ ID NOs:34, 35, 44, 45, 55, and 56.
  • a polynucleotide encoding an antibody heavy chain comprises the polynucleotide sequence of SEQ ID NO: 34, 44, or 55.
  • a polynucleotide encoding an antibody light chain comprises the polynucleotide sequence of SEQ ID NO:35, 45, or 56.
  • a polynucleotide encoding an antibody heavy chain comprises the polynucleotide sequence of SEQ ID NO: 34, 44, or 55
  • a polynucleotide encoding an antibody light chain comprises or consists of the polynucleotide sequence of SEQ ID NO: 34, 44, or 55.
  • the polynucleotide can comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • the RNA comprises messenger RNA (mRNA).
  • Vectors are also provided, wherein the vectors comprise or contain a polynucleotide as disclosed herein (e.g, a polynucleotide that encodes an antibody or antigen binding fragment that binds to any two, three, four, or five betacoronaviruses).
  • a vector can comprise any one or more of the vectors disclosed herein.
  • a vector is provided that comprises a DNA plasmid construct encoding the antibody or antigen binding fragment, or a portion thereof (e.g ., so-called "DMAb”; see, e.g., Muthumani etal, J Infect Dis.
  • a DNA plasmid construct comprises a single open reading frame encoding a heavy chain and a light chain (or a VH and a VL) of the antibody or antigen binding fragment, wherein the sequence encoding the heavy chain and the sequence encoding the light chain are optionally separated by polynucleotide encoding a protease cleavage site and/or by a polynucleotide encoding a self-cleaving peptide.
  • the substituent components of the antibody or antigen binding fragment are encoded by a polynucleotide comprised in a single plasmid.
  • the substituent components of the antibody or antigen binding fragment are encoded by a polynucleotide comprised in two or more plasmids (e.g, a first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL).
  • a single plasmid comprises a polynucleotide encoding a heavy chain and/or a light chain from two or more antibodies or antigen binding fragments of the present disclosure.
  • An exemplary expression vector is pVaxl, available from Invitrogen®.
  • a DNA plasmid of the present disclosure can be delivered to a subject by, for example, electroporation (e.g, intramuscular electroporation), or with an appropriate formulation (e.g, hyaluronidase).
  • method comprises administering to a subject a first polynucleotide (e.g., mRNA) encoding an antibody heavy chain, a VH, or a Fd (VH + CHI), and administering to the subject a second polynucleotide (e.g., mRNA) encoding the cognate antibody light chain, VL, or VL+CL.
  • a first polynucleotide e.g., mRNA
  • VH + CHI Fd
  • second polynucleotide e.g., mRNA
  • a polynucleotide e.g., mRNA
  • a polynucleotide e.g., mRNA
  • a polynucleotide e.g., mRNA
  • mRNA e.g. Li, JQ., Zhang, ZR., Zhang, HQ. et al. Intranasal delivery of replicating mRNA encoding neutralizing antibody against SARS-CoV-2 infection in mice. Sig Transduct Target Ther 6, 369 (2021). https://doi.org/10.1038/s41392-021-00783-l, the antibody-encoding mRNA constructs, vectors, and related techniques of which are incorporated herein by reference.
  • a polynucleotide is delivered to a subject via an alphavirus replicon particle (VRP) delivery system.
  • VRP alphavirus replicon particle
  • a replicon comprises a modified VEEV replicon comprising two subgenomic promoters.
  • a polynucleotide or replicon can translate simultaneously the heavy chain (or VH, or VH+1) and the light chain (or VL, or VL+CL) of an antibody or antigen binding fragment thereof.
  • a method is provided that comprises delivering to a subject such a polynucleotide or replicon.
  • the present disclosure also provides a host cell expressing an antibody or antigen binding fragment according to the present disclosure; or comprising or containing a vector or polynucleotide according the present disclosure.
  • the cells include but are not limited to, eukaryotic cells, e.g., yeast cells, animal cells, insect cells, plant cells; and prokaryotic cells, including E. coli.
  • the cells are mammalian cells.
  • the cells are a mammalian cell line such as CHO cells (e.g, DHFR- CHO cells (Urlaub etal, PNAS 77:4216 (1980)), human embryonic kidney cells (e.g, HEK293T cells), PER.C6 cells, Y0 cells, Sp2/0 cells.
  • NS0 cells human liver cells, e.g. Hepa RG cells, myeloma cells or hybridoma cells.
  • mammalian host cell lines include mouse sertoli cells (e.g, TM4 cells); monkey kidney CV1 line transformed by SV40 (COS-7); baby hamster kidney cells (BHK); African green monkey kidney cells (VERO-76); monkey kidney cells (CV1); human cervical carcinoma cells (HELA); human lung cells (W138); human liver cells (Hep G2); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3 A); mouse mammary tumor (MMT 060562); TRI cells; MRC 5 cells; and FS4 cells.
  • Mammalian host cell lines suitable for antibody production also include those described in, for example, Yazaki and Wu, Methods in Molecular Biology , Vol. 248 (B. K. C. Lo, ed., Humana Press, Totowa, N.J.), pp. 255-268 (2003).
  • a host cell is a prokaryotic cell, such as an E. coli.
  • a prokaryotic cell such as an E. coli.
  • the expression of peptides in prokaryotic cells such as E. coli is well established (see, e.g, Pluckthun, A. Bio/Technology 9:545-551 (1991).
  • antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed.
  • For expression of antibody fragments and polypeptides in bacteria see, e.g., U.S. Pat. Nos. 5,648,237; 5,789,199; and 5,840,523.
  • the cell may be transfected with a vector according to the present description with an expression vector.
  • transfection refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g. mRNA) molecules, into cells, such as into eukaryotic cells.
  • RNA e.g. mRNA
  • transfection encompasses any method known to the skilled person for introducing nucleic acid molecules into cells, such as into eukaryotic cells, including into mammalian cells.
  • Such methods encompass, for example, electroporation, lipofection, e.g, based on cationic lipids and/or liposomes, calcium phosphate precipitation, nanoparticle based transfection, virus based transfection, or transfection based on cationic polymers, such as DEAE-dextran or polyethylenimine, etc.
  • the introduction is non-viral.
  • host cells of the present disclosure may be transfected stably or transiently with a vector according to the present disclosure, e.g. for expressing an antibody, or an antigen binding fragment thereof, according to the present disclosure.
  • the cells may be stably transfected with the vector as described herein.
  • cells may be transiently transfected with a vector according to the present disclosure encoding an antibody or antigen binding fragment as disclosed herein.
  • a polynucleotide may be heterologous to the host cell.
  • the present disclosure also provides recombinant host cells that heterologously express an antibody or antigen binding fragment of the present disclosure.
  • the cell may be of a species that is different to the species from which the antibody was fully or partially obtained (e.g ., CHO cells expressing a human antibody or an engineered human antibody).
  • the cell type of the host cell does not express the antibody or antigen binding fragment in nature.
  • the host cell may impart a post-translational modification (PTM; e.g., glysocylation or fucosylation) on the antibody or antigen binding fragment that is not present in a native state of the antibody or antigen binding fragment (or in a native state of a parent antibody from which the antibody or antigen binding fragment was engineered or derived).
  • PTM post-translational modification
  • Such a PTM may result in a functional difference (e.g, reduced immunogenicity).
  • an antibody or antigen binding fragment of the present disclosure that is produced by a host cell as disclosed herein may include one or more post-translational modification that is distinct from the antibody (or parent antibody) in its native state (e.g, a human antibody produced by a CHO cell can comprise a more post-translational modification that is distinct from the antibody when isolated from the human and/or produced by the native human B cell or plasma cell).
  • Insect cells useful expressing a binding protein of the present disclosure are known in the art and include, for example, Spodoptera frugipera Sf9 cells, Trichoplusia ni BTI- TN5B1-4 cells, and Spodoptera frugipera SfSWTOl “MimicTM” cells. See, e.g., Palmberger et al., J. Biotechnol. 755(3-4): 160-166 (2011). Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for transfection of Spodoptera jrugiperda cells.
  • Eukaryotic microbes such as filamentous fungi or yeast are also suitable hosts for cloning or expressing protein-encoding vectors, and include fungi and yeast strains with "humanized” glycosylation pathways, resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat. Biotech. 22:1409-1414 (2004); Li etal, Nat. Biotech. 24:210-215 (2006).
  • Plant cells can also be utilized as hosts for expressing a binding protein of the present disclosure.
  • PLANTIBODIESTM technology (described in, for example, U.S. Pat. Nos. 5,959,177; 6,040,498; 6,420,548; 7,125,978; and 6,417,429) employs transgenic plants to produce antibodies.
  • the host cell comprises a mammalian cell.
  • the host cell is a CHO cell, a HEK293 cell, a PER.C6 cell, a Y0 cell, a Sp2/0 cell, a NSO cell, a human liver cell, a myeloma cell, or a hybridoma cell.
  • the present disclosure provides methods for producing an antibody, or antigen binding fragment, wherein the methods comprise culturing a host cell of the present disclosure under conditions and for a time sufficient to produce the antibody, or the antigen binding fragment.
  • Methods useful for isolating and purifying recombinantly produced antibodies may include obtaining supernatants from suitable host cell/vector systems that secrete the recombinant antibody into culture media and then concentrating the media using a commercially available filter. Following concentration, the concentrate may be applied to a single suitable purification matrix or to a series of suitable matrices, such as an affinity matrix or an ion exchange resin.
  • One or more reverse phase HPLC steps may be employed to further purify a recombinant polypeptide. These purification methods may also be employed when isolating an immunogen from its natural environment. Methods for large scale production of one or more of the isolated/recombinant antibody described herein include batch cell culture, which is monitored and controlled to maintain appropriate culture conditions. Purification of soluble antibodies may be performed according to methods described herein and known in the art and that comport with laws and guidelines of domestic and foreign regulatory agencies.
  • compositions that comprise any one or more of the presently disclosed antibodies, antigen binding fragments, polynucleotides, vectors, or host cells, singly or in any combination, and can further comprise a pharmaceutically acceptable carrier, excipient, or diluent. Carriers, excipients, and diluents are discussed in further detail herein.
  • a composition comprises two or more different antibodies or antigen binding fragments according to the present disclosure.
  • antibodies or antigen binding fragments to be used in a combination each independently have one or more of the following characteristics: neutralize one, two, three, four, five, or more naturally occurring betacoronavirus variants; do not compete with one another for Spike protein binding; bind distinct betacoronavirus Spike protein epitopes; have a reduced formation of resistance to betacoronavirus; when in a combination, have a reduced formation of resistance to betacoronavirus; potently neutralize one, two, three, four, five or more live betacoronaviruses; exhibit additive or synergistic effects on neutralization of one, two, three, four, five or more or more live betacoronaviruses when used in combination; exhibit effector functions; are protective in relevant animal model(s) of infection; are capable of being produced in sufficient quantities for large-scale production.
  • a composition comprises two or more different antibodies or antigen binding fragments according to the present disclosure.
  • a composition comprises a first antibody or antigen binding fragment, comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 26, 66, 71, 72, or 73 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 30, 69, 75, or 77; and a second antibody or antigen binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NOs: 36, and a VL comprising of consisting of the amino acid sequence as set forth in SEQ ID NOs: 40.
  • a composition comprises a first antibody or antigen binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: (i) 27-29, respectively, (ii) 67, 68, and 29, respectively, or (iii) 27, 27, and 74, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: (i) 31-33, respectively, (ii) 70, 32, and 33, (iii) 76, 32, and 33, respectively (iv) 78, 32, and 33, respectively, and a second antibody or antigen binding fragment comprising a heavy chain variable domain (VH) comprising a
  • a composition comprises two or more different antibodies or antigen binding fragments according to the present disclosure.
  • a composition comprises a first antibody or antigen binding fragment, comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 26, 66, 71, 72, or 73 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 30, 69, 75, or 77; and a second antibody or antigen binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NOs: 47 or 79 and a VL comprising of consisting of the amino acid sequence as set forth in SEQ ID NOs: 51 or 82.
  • a composition comprises a first antibody or antigen binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: (i) 27-29, respectively, (ii) 67, 68, and 29, respectively, or (iii) 27, 27, and 74, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: (i) 31-33, respectively, (ii) 70, 32, and 33, (iii) 76, 32, and 33, respectively (iv) 78, 32, and 33, respectively, and a second antibody or antigen binding fragment comprising a heavy chain variable domain (VH) comprising a
  • a composition comprises two or more different antibodies or antigen binding fragments according to the present disclosure.
  • a composition comprises a first antibody or antigen binding fragment, comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 26, 66, 71, 72, or 73 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 30, 69, 75, or 77; and a second antibody or antigen binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NOs: 47 or 79 and a VL comprising of consisting of the amino acid sequence as set forth in SEQ ID NOs: 51 or 82.
  • a composition comprises a first antibody or antigen binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: (i) 27-29, respectively, (ii) 67, 68, and 29, respectively, or (iii) 27, 27, and 74, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: (i) 31-33, respectively, (ii) 70, 32, and 33, (iii) 76, 32, and 33, respectively (iv) 78, 32, and 33, respectively, and a second antibody or antigen binding fragment comprising a heavy chain variable domain (VH) comprising a
  • CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 52-54, respectively, or 83, 83, and 54, respectively.
  • a composition comprises a first vector comprising a first plasmid, and a second vector comprising a second plasmid, wherein the first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL of the antibody or antigen binding fragment thereof.
  • a composition comprises a polynucleotide (e.g ., mRNA) coupled to a suitable delivery vehicle or carrier.
  • Exemplary vehicles or carriers for administration to a human subject include a lipid or lipid-derived delivery vehicle, such as a liposome, solid lipid nanoparticle, oily suspension, submicron lipid emulsion, lipid microbubble, inverse lipid micelle, cochlear liposome, lipid microtubule, lipid microcylinder, or lipid nanoparticle (LNP) or a nanoscale platform (see, e.g., Li et al. Wilery Interdiscip Rev. Nanomed Nanobiotechnol. 77(2):el530 (2019)).
  • LNP lipid nanoparticle
  • Principles, reagents, and techniques for designing appropriate mRNA and and formulating mRNA-LNP and delivering the same are described in, for example, Pardi et al.
  • lipid nanoparticles e.g, ionizable cationic lipid/phosphatidylcholine/cholesterol/PEG-lipid; ionizable lipid:distearoyl PC: cholesterol :poly ethylene glycol lipid
  • subcutaneous, intramuscular, intradermal, intravenous, intraperitoneal, and intratracheal administration of the same, are incorporated herein by reference.
  • Methods of diagnosis may include contacting an antibody, antibody fragment (e.g., antigen binding fragment) with a sample.
  • samples may be isolated from a subject, for example an isolated tissue sample taken from, for example, nasal passages, sinus cavities, salivary glands, lung, liver, pancreas, kidney, ear, eye, placenta, alimentary tract, heart, ovaries, pituitary, adrenals, thyroid, brain, skin or blood.
  • the methods of diagnosis may also include the detection of an antigen/antibody complex, in particular following the contacting of an antibody or antibody fragment with a sample.
  • a detection step can be performed at the bench, i.e. without any contact to the human or animal body. Examples of detection methods are well-known to the person skilled in the art and include, e.g ., ELISA (enzyme-linked immunosorbent assay), including direct, indirect, and sandwich ELISA.
  • Treatment refers to medical management of a disease, disorder, or condition of a subject (e.g, a human or non-human mammal, such as a primate, horse, cat, dog, goat, mouse, or rat).
  • an appropriate dose or treatment regimen comprising an antibody or composition of the present disclosure is administered in an amount sufficient to elicit a therapeutic or prophylactic benefit.
  • Therapeutic or prophylactic/preventive benefit includes improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay or prevention of disease progression; remission; survival; prolonged survival; or any combination thereof.
  • therapeutic or prophylactic/preventive benefit includes reduction or prevention of hospitalization for treatment of a betacoronavirus infection (i.e., in a statistically significant manner).
  • therapeutic or prophylactic/preventive benefit includes a reduced duration of hospitalization for treatment of a betacoronavirus infection (i.e., in a statistically significant manner).
  • therapeutic or prophylactic/preventive benefit includes a reduced or abrogated need for respiratory intervention, such as intubation and/or the use of a respirator device.
  • therapeutic or prophylactic/preventive benefit includes reversing a late-stage disease pathology and/or reducing mortality.
  • a “therapeutically effective amount” or “effective amount” of an antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition of this disclosure refers to an amount of the composition or molecule sufficient to result in a therapeutic effect, including improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay of disease progression; remission; survival; or prolonged survival in a statistically significant manner.
  • a therapeutically effective amount refers to the effects of that ingredient or cell expressing that ingredient alone.
  • a therapeutically effective amount refers to the combined amounts of active ingredients or combined adjunctive active ingredient with a cell expressing an active ingredient that results in a therapeutic effect, whether administered serially, sequentially, or simultaneously.
  • a combination may comprise, for example, two different antibodies that specifically bind betacoronavirus antigens, which in certain embodiments, may be the same or different betacoronavirus antigens, and/or can comprise the same or different epitopes.
  • methods for treating a betacoronavirus infection in a subject, wherein the methods comprise administering to the subject an effective amount of an antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition as disclosed herein.
  • Subjects that can be treated by the present disclosure are, in general, human and other primate subjects, such as monkeys and apes for veterinary medicine purposes. Other model organisms, such as mice and rats, may also be treated according to the present disclosure.
  • the subject may be a human subject.
  • the subjects can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric subjects.
  • a subject treated according to the present disclosure comprises one or more risk factors.
  • a human subject treated according to the present disclosure is an infant, a child, a young adult, an adult of middle age, or an elderly person. In certain embodiments, a human subject treated according to the present disclosure is less than 1 year old, or is 1 to 5 years old, or is between 5 and 125 years old ( e.g ., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 125 years old, including any and all ages therein or therebetween).
  • a human subject treated according to the present disclosure is 0-19 years old, 20-44 years old, 45-54 years old, 55-64 years old, 65-74 years old, 75-84 years old, or 85 years old, or older. Persons of middle, and especially of elderly age are believed to be at particular risk.
  • the human subject is 45-54 years old, 55-64 years old, 65- 74 years old, 75-84 years old, or 85 years old, or older.
  • the human subject is male.
  • the human subject is female.
  • a human subject treated according to the present disclosure is a resident of a nursing home or a long-term care facility, is a hospice care worker, is a healthcare provider or healthcare worker, is a first responder, is a family member or other close contact of a subject diagnosed with or suspected of having a betacoronavirus infection, is overweight or clinically obese, is or has been a smoker, has or had chronic obstructive pulmonary disease (COPD), is asthmatic (e.g., having moderate to severe asthma), has an autoimmune disease or condition (e.g., diabetes), and/or has a compromised or depleted immune system (e.g, due to AIDS/HIV infection, a cancer such as a blood cancer, a lymphodepleting therapy such as a chemotherapy, a bone marrow or organ transplantation, or a genetic immune condition), has chronic liver disease, has cardiovascular disease, has a pulmonary or heart defect, works or otherwise spends time in close proximity with others, such as in a factory, shipping center, hospital
  • COPD
  • a subject treated according to the present disclosure has received a vaccine for a betacoronavirus and the vaccine is determined to be ineffective, e.g, by post-vaccine infection or symptoms in the subject, by clinical diagnosis or scientific or regulatory criteria.
  • treatment is administered as peri-exposure prophylaxis.
  • treatment is administered to a subject with mild-to-moderate disease, which may be in an outpatient setting.
  • treatment is administered to a subject with moderate-to-severe disease, such as requiring hospitalization.
  • Typical routes of administering the presently disclosed compositions thus include, without limitation, oral, topical, transdermal, inhalation, parenteral, sublingual, buccal, rectal, vaginal, and intranasal.
  • parenteral includes subcutaneous injections, intravenous, intramuscular, intrastemal injection or infusion techniques.
  • administering comprises administering by a route that is selected from oral, intravenous, parenteral, intragastric, intrapleural, intrapulmonary, intrarectal, intradermal, intraperitoneal, intratumoral, subcutaneous, topical, transdermal, intracisternal, intrathecal, intranasal, and intramuscular.
  • a method comprises orally administering the antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition to the subject.
  • compositions according to certain embodiments of the present invention are formulated so as to allow the active ingredients contained therein to be bioavailable upon administration of the composition to a patient.
  • Compositions that will be administered to a subject or patient may take the form of one or more dosage units, where for example, a tablet may be a single dosage unit, and a container of a herein described an antibody or antigen binding in aerosol form may hold a plurality of dosage units.
  • Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practice of Pharmacy, 20th Edition (Philadelphia College of Pharmacy and Science, 2000).
  • compositions to be administered will, in any event, contain an effective amount of an antibody or antigen binding fragment, polynucleotide, vector, host cell, , or composition of the present disclosure, for treatment of a disease or condition of interest in accordance with teachings herein.
  • a composition may be in the form of a solid or liquid.
  • the carrier(s) are particulate, so that the compositions are, for example, in tablet or powder form.
  • the carrier(s) may be liquid, with the compositions being, for example, an oral oil, injectable liquid or an aerosol, which is useful in, for example, inhalatory administration.
  • the pharmaceutical composition is preferably in either solid or liquid form, where semi solid, semi liquid, suspension and gel forms are included within the forms considered herein as either solid or liquid.
  • the pharmaceutical composition may be formulated into a powder, granule, compressed tablet, pill, capsule, chewing gum, wafer or the like.
  • a solid composition will typically contain one or more inert diluents or edible carriers.
  • binders such as carboxymethylcellulose, ethyl cellulose, microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, sodium alginate, Primogel, com starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; a flavoring agent such as peppermint, methyl salicylate or orange flavoring; and a coloring agent.
  • a liquid carrier such as polyethylene glycol or oil.
  • the composition may be in the form of a liquid, for example, an elixir, syrup, solution, emulsion or suspension.
  • the liquid may be for oral administration or for delivery by injection, as two examples.
  • preferred compositions contain, in addition to the present compounds, one or more of a sweetening agent, preservatives, dye/colorant and flavor enhancer.
  • a surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonic agent may be included.
  • Liquid pharmaceutical compositions may include one or more of the following adjuvants: sterile diluents such as water for injection, saline solution, preferably physiological saline, Ringer’s solution, isotonic sodium chloride, fixed oils such as synthetic mono or diglycerides which may serve as the solvent or suspending medium, polyethylene glycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • Physiological saline is a preferred adjuvant.
  • a liquid composition intended for either parenteral or oral administration should contain an amount of an antibody or antigen binding fragment as herein disclosed such that a suitable dosage will be obtained. Typically, this amount is at least 0.01% of the antibody or antigen binding fragment in the composition. When intended for oral administration, this amount may be varied to be between 0.1 and about 70% of the weight of the composition. Certain oral pharmaceutical compositions contain between about 4% and about 75% of the antibody or antigen binding fragment. In certain embodiments, pharmaceutical compositions and preparations according to the present invention are prepared so that a parenteral dosage unit contains between 0.01 to 10% by weight of antibody or antigen binding fragment prior to dilution.
  • the composition may be intended for topical administration, in which case the carrier may suitably comprise a solution, emulsion, ointment or gel base.
  • the base may comprise one or more of the following: petrolatum, lanolin, polyethylene glycols, bee wax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers. Thickening agents may be present in a composition for topical administration. If intended for transdermal administration, the composition may include a transdermal patch or iontophoresis device.
  • the pharmaceutical composition may be intended for rectal administration, in the form, for example, of a suppository, which will melt in the rectum and release the drug.
  • the composition for rectal administration may contain an oleaginous base as a suitable nonirritating excipient.
  • bases include, without limitation, lanolin, cocoa butter and polyethylene glycol.
  • a composition may include various materials which modify the physical form of a solid or liquid dosage unit.
  • the composition may include materials that form a coating shell around the active ingredients.
  • the materials that form the coating shell are typically inert, and may be selected from, for example, sugar, shellac, and other enteric coating agents.
  • the active ingredients may be encased in a gelatin capsule.
  • the composition in solid or liquid form may include an agent that binds to the antibody or antigen binding fragment of the disclosure and thereby assists in the delivery of the compound. Suitable agents that may act in this capacity include monoclonal or polyclonal antibodies, one or more proteins or a liposome.
  • the composition may consist essentially of dosage units that can be administered as an aerosol.
  • aerosol is used to denote a variety of systems ranging from those of colloidal nature to systems consisting of pressurized packages. Delivery may be by a liquefied or compressed gas or by a suitable pump system that dispenses the active ingredients. Aerosols may be delivered in single phase, bi phasic, or tri phasic systems in order to deliver the active ingredient(s). Delivery of the aerosol includes the necessary container, activators, valves, subcontainers, and the like, which together may form a kit. One of ordinary skill in the art, without undue experimentation, may determine preferred aerosols.
  • compositions of the present disclosure also encompass carrier molecules for polynucleotides, as described herein (e.g ., lipid nanoparticles, nanoscale delivery platforms, and the like).
  • compositions may be prepared by methodology well known in the pharmaceutical art.
  • a composition intended to be administered by injection can be prepared by combining a composition that comprises an antibody, antigen binding fragment thereof, or antibody conjugate as described herein and optionally, one or more of salts, buffers and/or stabilizers, with sterile, distilled water so as to form a solution.
  • a surfactant may be added to facilitate the formation of a homogeneous solution or suspension.
  • Surfactants are compounds that non-covalently interact with the peptide composition so as to facilitate dissolution or homogeneous suspension of the antibody or antigen binding fragment thereof in the aqueous delivery system.
  • an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (such as described herein, including an improved clinical outcome (e.g ., a decrease in frequency, duration, or severity of diarrhea or associated dehydration, or inflammation, or longer disease-free and/or overall survival, or a lessening of symptom severity).
  • a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder.
  • Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.
  • compositions are administered in an effective amount (e.g., to treat a betacoronavirus infection), which will vary depending upon a variety of factors including the activity of the specific compound employed; the metabolic stability and length of action of the compound; the age, body weight, general health, sex, and diet of the subject; the mode and time of administration; the rate of excretion; the drug combination; the severity of the particular disorder or condition; and the subject undergoing therapy.
  • an effective amount e.g., to treat a betacoronavirus infection
  • test subjects will exhibit about a 10% up to about a 99% reduction in one or more symptoms associated with the disease or disorder being treated as compared to placebo-treated or other suitable control subjects.
  • a therapeutically effective daily dose of an antibody or antigen binding fragment is (for a 70 kg mammal) from about 0.001 mg/kg (i.e., 0.07 mg) to about 100 mg/kg (i.e., 7.0 g); preferably a therapeutically effective dose is (for a 70 kg mammal) from about 0.01 mg/kg (i.e., 0.7 mg) to about 50 mg/kg (i.e., 3.5 g); more preferably a therapeutically effective dose is (for a 70 kg mammal) from about 1 mg/kg (i.e., 70 mg) to about 25 mg/kg (i.e., 1.75 g).
  • a therapeutically effective dose may be different than for an antibody or antigen binding fragment.
  • a method comprises administering the antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition to the subject at 2, 3, 4, 5, 6, 7, 8, 9, 10 times, or more.
  • a method comprises administering the antibody, antigen binding fragment, or composition to the subject a plurality of times, wherein a second or successive administration is performed at about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 24, about 48, about 74, about 96 hours, or more, following a first or prior administration, respectively.
  • a method comprises administering the antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition at least one time prior to the subject being infected by a betacoronavirus.
  • compositions comprising an antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition of the present disclosure may also be administered simultaneously with, prior to, or after administration of one or more other therapeutic agents.
  • combination therapy may include administration of a single pharmaceutical dosage formulation which contains a compound of the invention and one or more additional active agents, as well as administration of compositions comprising an antibody or antigen binding fragment of the disclosure and each active agent in its own separate dosage formulation.
  • an antibody or antigen binding fragment thereof as described herein and the other active agent can be administered to the patient together in a single oral dosage composition such as a tablet or capsule, or each agent administered in separate oral dosage formulations.
  • an antibody or antigen binding fragment as described herein and the other active agent can be administered to the subject together in a single parenteral dosage composition such as in a saline solution or other physiologically acceptable solution, or each agent administered in separate parenteral dosage formulations.
  • a single parenteral dosage composition such as in a saline solution or other physiologically acceptable solution, or each agent administered in separate parenteral dosage formulations.
  • the compositions comprising an antibody or antigen binding fragment and one or more additional active agents can be administered at essentially the same time, i.e., concurrently, or at separately staggered times, i.e., sequentially and in any order; combination therapy is understood to include all these regimens.
  • a combination therapy comprises one or more anti-betacoronavirus antibody (or one or more nucleic acid, host cell, vector, or composition) of the present disclosure and one or more anti-inflammatory agent and/or one or more anti-viral agent.
  • the one or more anti-inflammatory agent comprises a corticosteroid such as, for example, dexamethasone, prednisone, or the like.
  • the one or more anti-inflammatory agents comprise a cytokine antagonist such as, for example, an antibody that binds to IL6 (such as siltuximab), or to IL-6R (such as tocilizumab), or to IL-Ib, IL-7, IL-8, IL-9, IL-10, FGF, G-CSF, GM-CSF, IFN-g, IP-10, MCP-1, MIP-1A, MIP1-B, PDGR, TNF-a, or VEGF.
  • a cytokine antagonist such as, for example, an antibody that binds to IL6 (such as siltuximab), or to IL-6R (such as tocilizumab), or to IL-Ib, IL-7, IL-8, IL-9, IL-10, FGF, G-CSF, GM-CSF, IFN-g, IP-10, MCP-1, MIP-1A, MIP1-B, PDGR, TNF-a,
  • the one or more anti-viral agents comprise nucleotide analogs or nucelotide analog prodrugs such as, for example, remdesivir, sofosbuvir, acyclovir, and zidovudine.
  • an anti-viral agent comprises lopinavir, ritonavir, favipiravir, or any combination thereof.
  • Other anti-inflammatory agents for use in a combination therapy of the present disclosure include non-steroidal anti-inflammatory drugs (NSAIDS).
  • NSAIDS non-steroidal anti-inflammatory drugs
  • the one or more antibody (or one or more nucleic acid, host cell, vector, or composition) and the one or more anti-inflammatory agent and/or one or the more antiviral agent can be administered in any order and any sequence, or together.
  • an antibody (or one or more nucleic acid, host cell, vector, or composition) is administered to a subject who has previously received one or more anti inflammatory agent and/or one or more antiviral agent.
  • one or more anti-inflammatory agent and/or one or more antiviral agent is administered to a subject who has previously received an antibody (or one or more nucleic acid, host cell, vector, or composition).
  • a combination therapy is provided that comprises two or more anti-betacoronavirus antibodies of the present disclosure.
  • a method can comprise administering a first antibody to a subject who has received a second antibody, or can comprise administering two or more antibodies together.
  • a method comprises administering to the subject (a) a first antibody or antigen binding fragment, when the subject has received a second antibody or antigen binding fragment; (b) the second antibody or antigen binding fragment, when the subject has received the first antibody or antigen binding fragment; or (c) the first antibody or antigen binding fragment, and the second antibody or antigen binding fragment.
  • uses of the presently disclosed antibodies, antigen binding fragments, vectors, host cells, and compositions are provided.
  • an antibody, antigen binding fragment, polynucleotide, vector, host cell, or composition is provided for use in a method of treating a betacoronavirus infection in a subject. In certain embodiments, an antibody, antigen binding fragment, or composition is provided for use in a method of manufacturing or preparing a medicament for treating a betacoronavirus infection in a subject.
  • VH, CDRH1, CDRH2, CDRH3, VI, CDRL1, CDRL2, or CDRL3 of any given variant antibody, such as S2P6 Q32Y are the same as in the named antibody, such as S2P6, unless indicated otherwise in Table 1.
  • the disclosure also provides the following numbered embodiments, which may be referenced by number in other embodiments:
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein:
  • the CDRH1 comprises or consists of the amino acid sequence according to SEQ ID NO: 27, 37, 48, 67, or 80, or a functional variant thereof comprising one, two, or three acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid;
  • the CDRH2 comprises or consists of the amino acid sequence according to SEQ ID NO: 28, 38, 49, 68, or 81, or a functional variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid;
  • the CDRH3 comprises or consists of the amino acid sequence according to
  • SEQ ID NO: 29, 39, or 50 or a functional variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid;
  • the CDRL1 comprises or consists of the amino acid sequence according to SEQ ID NO: 31, 41, 52, 70, 76, 78, or 83, or a functional variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid;
  • the CDRL2 comprises or consists of the amino acid sequence according to SEQ ID NO: 32, 42, or 53, or a functional variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid; and/or
  • the CDRL3 comprises or consists of the amino acid sequence according to SEQ ID NO: 33, 43, or 54, or a functional variant thereof comprising having one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus.
  • the antibody or antigen binding fragment of 2 which is capable of binding to a surface glycoprotein of two, three, four, or five betacoronaviruses.
  • the antibody or antigen binding fragment of any one of 1-4 which is capable of binding to the surface glycoprotein of the betacoronavirus or betacoronaviruses expressed on a surface of a host cell and/or on a virion.
  • the antibody or antigen binding fragment of any one of 1-5 which is capable of neutralizing infection by a betacoronavirus in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • the antibody or antigen binding fragment of any one of 1-5 which is capable of neutralizing infection by one, two, three, four, or five betacoronaviruses in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • the antibody or antigen binding fragment of any one of 1-9 comprising: (i) the CDRH1 amino acid sequence set forth in SEQ ID NO:27 or SEQ ID NO:67; (ii) the CDRH2 amino acid sequence set forth in SEQ ID NO:28 or SEQ ID NO:68;
  • the antibody or antigen binding fragment of 1-11 comprising: (i) the CDRH1 amino acid sequence set forth in SEQ ID NO:48 or SEQ ID NO:80; (ii) the CDRH2 amino acid sequence set forth in SEQ ID NO:49 or SEQ ID NO:81; (iii) the CDRH3 amino acid sequence set forth in SEQ ID NO:50; (iv) the CDRL1 amino acid sequence set forth in SEQ ID NO: 52 or SEQ ID NO: 83; (v) the CDRL2 amino acid sequence set forth in SEQ ID NO:53; and (vi) the CDRL3 amino acid sequence SEQ ID NO:54.
  • the antibody or antigen binding fragment of 12 comprising the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences set forth in: (i)
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRL1, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3, of the VL amino acid sequence set forth in SEQ ID NO: 30, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3, of the VL amino acid sequence set forth in SEQ ID NO: 30, wherein CDRs are according to Rabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof, comprising: (i)
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRL1, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 the VL amino acid sequence set forth in SEQ ID NO: 69, wherein CDRs are according to Rabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRL1, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:75, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRL1, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:75, wherein CDRs are according to Rabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • CDRLl CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:75, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU 1.
  • CDRLl CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:75, wherein CDRs are according to Rabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU 1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRL1, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:77, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs:26, 66, 71, 72, and 73; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:77, wherein CDRs are according to Rabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS- CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in SEQ ID NO:36; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:40, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, and CDRH3 of the VH amino acid sequence set forth in SEQ ID NO:36; and (ii) CDRL1, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:40, wherein CDRs are according to Kabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, CDRH3 of the VH amino acid sequence set forth in SEQ ID NO:47 or 79; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:51, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, CDRH3 of the VH amino acid sequence set forth in SEQ ID NO:47 or 79; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO:51, wherein CDRs are according to Kabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, CDRH3 of the VH amino acid sequence set forth in SEQ ID NO:47 or 79; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO: 82, wherein CDRs are according to IMGT, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • An antibody, or an antigen binding fragment thereof comprising: (i) CDRH1, CDRH2, CDRH3 of the VH amino acid sequence set forth in SEQ ID NO:47 or 79; and (ii) CDRLl, CDLR2 or a variant thereof comprising one, two, or three amino acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid, and CDRL3 of the VL amino acid sequence set forth in SEQ ID NO: 82, wherein CDRs are according to Rabat, and wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, wherein, optionally, the betacoronaviruses comprises any one, two, three, four, or five of SARS-CoV-2, SARS-CoV, MERS-CoV, OC43, and HKU1.
  • the VH comprises or consists of an amino acid sequence having at least 85% identity to the amino acid sequence according to SEQ ID NO: 26, 36, 47, 66, 71, 72, or 81, wherein the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid; and/or (ii) the VL comprises or consists of an amino acid sequence having at least 85% identity to the amino acid sequence according to SEQ ID NO: 30, 40, 51, 69, 75, 77, or 84, wherein the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid.
  • VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs: (i) 26 and 30, respectively; (ii) 26 and 69, respectively, (iii) 26 and 75, respectively, (iv) 26 and 77, respectively, (v) 66 and 69, respectively, (vi) 66 and 30, respectively, (vii) 66 and 75, respectively, (viii) 66 and 77, respectively, (ix) 71 and 30, respectively, (x) 71 and 69, respectively, (xi) 71 and 75, respectively, (xii) 71 and 77, respectively, (xiii) 72 and 30, respectively, (xiv) 72 and 69, respectively, (xv) 72 and 75, respectively, (xvi) 72 and 77, respectively, (xvii) 73 and 30, respectively, (xviii) 73 and 69, respectively, (xix) 73 and 75, respectively, (xx) 73 and
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 26 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 30, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 26 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 77, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 72 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 30, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 26 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 75, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 27-29, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 31-33, respectively, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 27-29, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 78, 32, and 33, respectively, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 27, 68, and 29, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 31-33, respectively, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 27-29, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 76, 32, and 33, respectively, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 36 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 40, wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses, and/or is capable of binding to a surface glycoprotein of an alphacoronavirus, optionally NL63-CoV and/or 229E-CoV.
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 37-39, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 41-43, respectively, wherein the antibody or antigen binding fragment is capable of binding to a surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses, and/or is capable of binding to a surface glycoprotein of an alphacoronavirus, optionally NL63-CoV and/or 229E-CoV.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 47 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 51, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 79 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 82, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 48-50, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 52-54, respectively, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • An antibody, or antigen binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 80, 81, and 50, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 83 and 53-54, respectively, wherein the antibody or antigen binding fragment is capable of binding to the surface glycoprotein of a betacoronavirus, optionally of two or more betacoronaviruses.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • BBI biolayer interferometry
  • An antibody or antigen binding fragment thereof that is capable of binding to a betacoronavirus surface glycoprotein amino acid sequence or peptide comprising any one of (i)-(iii): (i) FKEELDKYF [SEQ ID NO:57]; (ii) GIDF QDELDEFFK [SEQ ID NO:58]; and/or (iii) DFKEELDQWFK [SEQ ID NO:59]
  • an antibody or antigen binding fragment thereof that is capable of binding to a betacoronavirus surface glycoprotein amino acid sequence or peptide comprising any one of (i)-(vi): (i) KRSFIEDLLFN [SEQ ID NO:60]; (ii) ARSAIEDLLFD [SEQ ID NO:61]; (iii) SRSAIEDLLFD [SEQ ID NO:62]; (iv) RSFFEDLLF [SEQ ID NO:63]; (v) RS ALEDLLF SK [SEQ ID NO:64]; and/or (vi) GRSAIEDILFS [SEQ ID NO:65]
  • An antibody or antigen binding fragment thereof that recognizes an epitope in a stem helix of a betacoronavirus surface glycoprotein, wherein the epitope is conserved in two, three, four, five, or more betacoronaviruses.
  • the antibody or antigen binding fragment of 51, wherein the two, three, four, five, or more betacoronaviruses comprise SARS-CoV-2, SARS-CoV, OC43, MERS- CoV, HKU1, or any combination thereof.
  • the antibody or antigen binding fragment of any one of 1-52 comprising, in Vn, an amino acid sequence that is encoded by VI -46*01 and/or an amino acid sequence that is encoded by D5-12*01.
  • the antibody or antigen binding fragment of 53 further comprising any one or more of the following: (i) in VH, an amino acid sequence encoded by J4*03 or J*602; (ii) in VL, an amino acid sequence encoded by KV3-20*01 and/or an amino acid sequence encoded by K3*01; (iii) in VL, an amino acid sequence encoded by LV1-51*02 and/or an amino acid sequence encoded by Jl*01. 55.
  • the antibody or antigen binding fragment of any one of 1-54 which is capable of binding to a suface glycoprotein of a sarbecovirus of clade la, a sarbecovirus of clade lb, a sarbecovirus of clade 2, and a sarbecovirus of clade 3.
  • the antibody or antigen binding fragment of any one of 1-55 which is capable of binding to a peptide comprising the amino acid sequence X1X2FX3X4ELDX5YF (SEQ ID NO:84).
  • An antibody or antigen binding fragment that is capable of binding to a peptide comprising the amino acid sequence X1X2FX3X4ELDX5YF (SEQ ID NO:84).
  • the antibody or antigen binding fragment of any one of 1-59 which: (i) recognizes an epitope in the Spike protein of two, three, four, or five betacoronaviruses;
  • (ii) is capable of blocking an interaction between the Spike protein of two, three, four, or five betacoronaviruses and their respective cell surface receptor(s); (iii) recognizes an epitope that is conserved in the Spike protein of two, three, four, or five betacoronaviruses; (iv) is cross-reactive against two, three, four, or five betacoronaviruses; (v)is cross-reactive against any three of SARS-CoV, SARS-CoV-2, MERS-CoV, OC43, and HKU1; (vi) is cross-reactive against any four of SARS-CoV, SARS-CoV-2, MERS-CoV, OC43, and HKU1; (vii) is cross-reactive against SARS-CoV, SARS-CoV-2, MERS-CoV, OC43, and HKU1; (viii) is capable of neutralizing infection by one, two, three, four, five or more different human betacoronaviruses in an in
  • a Fab of the antibody or antigen binding fragment is capable of binding to an immobilized pre-fusion SARS-CoV S protein trimer with a Kd of about 7.3 nM, to an immobilized pre fusion OC43 S protein trimer with a Kd of about 16 nM, to an immobilized pre-fusion MERS S protein trimer with a Kd of about 12 nM, and/or to an immobilized pre-fusion HKU1 S protein trimer with a Kd of about 120 nM, as determined using surface plasmon resonance; and/or (ii) a Fab of the antibody or antigen binding fragment is capable of binding to an immobilized pre-fusion SARS-CoV-2 S protein ectodomain trimer with a Kd of about 6.8 nM and pH 7.4 and/or with a Kd of about 44 nM at pH 5.4, as determined using surface plasmon resonance; and/or (i) a Fab of the antibody or antigen binding fragment is capable of binding to an immobil
  • the antibody or antigen binding fragment of any one of 1-62 which is capable of binding to an epitope in SARS-CoV-2 surface glycoprotein that comprises or consists of the amino acid sequence D SFKEELDK YFKNH (SEQ ID NO:95).
  • QPELD SFKEELDK YFKNHT SP (SEQ ID NO:96).
  • the antibody or antigen binding fragment of any one of 1-65 which is an IgG isotype selected from IgGl, IgG2, IgG3, and IgG4.
  • the antibody or antigen binding fragment of 70 wherein the antibody or antigen binding fragment is a bispecific antibody or antigen binding fragment.
  • the antibody or antigen binding fragment of 70 or 71 comprising: (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH and the second VH are different and each independently comprise an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 26, 36, 47, 66,
  • first VL and the second VL are different and each independently comprise an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 30, 40, 51, 69, 75, 77, or 82; and wherein the first VH and the first VL together form a first antigen binding site, and wherein the second VH and the second VL together form a second antigen binding site.
  • the Fc polypeptide or fragment thereof comprises: (i) a mutation that enhances binding to a FcRn as compared to a reference Fc polypeptide that does not comprise the mutation; and/or (ii) a mutation that enhances binding to a FcyR as compared to a reference Fc polypeptide that does not comprise the mutation.
  • the antibody or antigen binding fragment of 74, wherein the mutation that enhances binding to a FcRn comprises: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I; Q311I; D376V; T307A; E380A; or any combination thereof.
  • the antibody or antigen binding fragment of 74, wherein the mutation that enhances binding to FcRn comprises: (i) M428L/N434S; (ii) M252Y/S254T/T256E;
  • the antibody or antigen binding fragment of 74, wherein the mutation that enhances binding to FcRn comprises M428L/N434S.
  • the antibody or antigen binding fragment of 74, wherein the mutation that enhances binding to a FcyR comprises S239D; I332E; A330L; G236A; or any combination thereof.
  • the antibody or antigen binding fragment of 74, wherein the mutation that enhances binding to a FcyR comprises: (i) S239D/I332E; (ii) S239D/A330L/I332E; (iii) G236 A/S239D/I332E; or (iv) G236A/A330L/I332E.
  • ADCC antibody-dependent cell- mediated cytotoxicity
  • ADCP antibody dependent cellular phagocytosis
  • RNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • mRNA messenger RNA
  • the polynucleotide of 87 or 88 comprising a modified nucleoside, a cap-1 structure, a cap-2 structure, or any combination thereof.
  • polynucleotide of 89 wherein the polynucleotide comprises a pseudouridine, a N6-methyladenonsine, a 5-methylcytidine, a 2-thiouridine, or any combination thereof.
  • the polynucleotide of 90, wherein the pseudouridine comprises Nl- methylpseudouridine.
  • polynucleotide of any one of 87-92 comprising a polynucleotide having at least 50% identity to the polynucleotide sequence according to SEQ ID NO: 34, 35, 44, or 45.
  • polynucleotide of any one of 87-93 comprising a polynucleotide encoding an antibody that comprises, in a VH and/or in a VL, at least one amino acid of a wild type sequence substituted with an amino acid from a corresponding UCA at the equivalent position.
  • a recombinant vector comprising the polynucleotide of any one of 87-94.
  • a host cell comprising the polynucleotide of any one of 87-94 and/or the vector of 95, wherein the polynucleotide is heterologous to the host cell.
  • a human B cell comprising the polynucleotide of any one of 87-94, wherein polynucleotide is heterologous to the human B cell and/or wherein the human B cell is immortalized.
  • a composition comprising: (i) the antibody or antigen binding fragment of any one of 1-86; (ii) the polynucleotide of any one of 87-94; (iii) the recombinant vector of 95; (iv) the host cell of 96; and/or (v)the human B cell of 97, and a pharmaceutically acceptable excipient, carrier, or diluent.
  • composition of 98 comprising two or more antibodies or antigen binding fragments of any one of 1-86.
  • a composition comprising a first antibody or antigen binding fragment and a second antibody or antigen binding fragment, wherein: (i)the first antibody or antigen binding fragment is of any one of 1-86; and (ii) the second antibody or antigen binding fragment comprises: (ii)(a) a CDRH1 amino acid sequence GYPFTSYG (SEQ ID NO: 86), a CDRH2 amino acid sequence ISTYQGNT (SEQ ID NO: 94) or ISTYNGNT (SEQ ID NO: 87), a CDRH3 amino acid sequence ARD YTRGAWF GE SLIGGFDN (SEQ ID NO: 88), a CDRL1 amino acid sequence QTVSSTS (SEQ ID NO: 90), a CDRL2 amino acid sequence GAS (SEQ ID NO: 91), and a CDRL3 amino acid sequence QQHDTSLT (SEQ ID NO: 92); optionally (ii)(a)(l) a VH amino acid sequence
  • composition of 100, wherein the first antibody or antigen binding fragment and/or the second antibody or antigen binding fragment comprises an Fc polypeptide that comprises: (i) M428L and N434S mutations; (ii) G236A, A330L, and I332E mutations; or (iii) M428L, N434S, G236A, A330L, and I332E mutations.
  • a combination comprising: (i) the antibody or antigen binding fragment of any one of 1-86; and (ii) an antibody or antigen binding fragment that is capable of binding to a betacoronavirus surface glycoprotein epitope that is outside of the stem helix, and is optionally comprised in a receptor binding domain (RBD).
  • RBD receptor binding domain
  • a composition comprising the polynucleotide of any one of 87-94 encapsulated in a carrier molecule, wherein the carrier molecule optionally comprises a lipid, a lipid-derived delivery vehicle, such as a liposome, a solid lipid nanoparticle, an oily suspension, a submicron lipid emulsion, a lipid microbubble, an inverse lipid micelle, a cochlear liposome, a lipid microtubule, a lipid microcylinder, lipid nanoparticle (LNP), or a nanoscale platform.
  • a lipid-derived delivery vehicle such as a liposome, a solid lipid nanoparticle, an oily suspension, a submicron lipid emulsion, a lipid microbubble, an inverse lipid micelle, a cochlear liposome, a lipid microtubule, a lipid microcylinder, lipid nanoparticle (LNP), or a nanoscale platform.
  • a method of treating a betacoronavirus infection in a subject comprising administering to the subject an effective amount of (i) the antibody or antigen binding fragment of any one of 1-86; (ii) the polynucleotide of any one of 87-94; (iii) the recombinant vector of 95; (iv) the host cell of 96; (v) the human B cell of 97; (vi) the composition of any one of 98-101 or 104; and/or (vii) the combination of 102 or 103.
  • the method of 105 comprising administering an effective amount of the combination of 102 or 103, wherein administering an effective amount of the combination comprises administering an effective amount of the antibody or antigen binding fragment of (i) and, optionally concurrently or in a sequence, administering an effective amount of the polynucleotide of (ii).
  • the method of 105 comprising administering an effective amount of the combination of 102 or 103, wherein administering an effective amount of the combination comprises administering an effective amount of the antibody or antigen binding fragment of (i) and subsequently administering an effective amount of the polynucleotide of (ii).
  • the method of 105 comprising administering an effective amount of the combination of 102 or 103, wherein administering an effective amount of the combination comprises administering an effective amount of the polynucleotide of (ii) and subsequently administering an effective amount of the antibody or antigen binding fragment of (i).
  • a method for in vitro diagnosis of a betacoronavirus infection comprising: (i) contacting a sample from a subject with an antibody or antigen binding fragment of any one of 1-86; and (ii) detecting a complex comprising an antigen and the antibody, or comprising an antigen and the antigen binding fragment.
  • betacoronavirus comprises: (i) SARS-CoV; (ii) SARS-CoV-2; (iii) MERS-CoV; (iv) OC43; (v) HKU1; or (vi) any combination of (i)-(iii).
  • Antibody 420 1 2 ( Figure 1A) and Antibody 420 1 1 ( Figure IB) to the spike protein of different human beta-coronaviruses was measured by enzyme-linked immunoabsorbant assay (ELISA).
  • Antibody 420 1 2 also called S2S8 herein, comprises a VH comprising the sequence provided in SEQ ID NO:36 and a VL comprising the sequence provided in SEQ ID NO:40.
  • Antibody 420 1 1, also called S2P6 herein comprises a VH comprising the sequence provided in SEQ ID NO:26 and a VL comprising the sequence provided in SEQ ID NO:30.
  • Pre-fusion stabilized spike proteins from SARS-CoV (Urbani strain, GenBank: AAR 13441; ncbi.nlm.nih. gov/protein/30027620), SEQ ID NO:22, SARS-CoV-2 (BetaCoV/Wuhan-Hu- 1/2019, GenBank: MN908947), SEQ ID NO:3, MERS (Londonl/2012; GenBank: KC164505), SEQ ID NO:24, OC43 (GenBank AAT84362.1), SEQ ID NO:23, and HKU1 (GenBank YP 173238.1), SEQ ID NO:25 were coated at 1 pg/ml and PBS-only was used as a negative control.
  • EC50 Half maximal effective concentration
  • Monoclonal antibodies S2S40, S2S41, S2S42, S2S43, and S2X529 were tested for binding to spike protein of different human beta-coronaviruses and to the spike protein subunit S2 for SARS-CoV-2, as described above. Results are shown in Table 2.
  • Antibody 420 1 2 also known as S2S8 and Antibody 420 1 1 (also known as S2P6) (both antibodies expressed as recombinant IgGl bearing M428L/N434S Fc mutations; "MLNS"
  • MLNS recombinant IgGl bearing M428L/N434S Fc mutations
  • Neutralizing activity of Antibody 420_1_1 against infection by SARS-CoV-2 virus was evaluated using a luciferase reporter assay. VeroE6 cells were infected with a SARS- CoV-2-luciferase reporter virus for 24 hours at a multiplicity of infection (MOI) of 0.01. A curve showing percent neutralization at increasing antibody concentration, along with calculatd IC50 values (ng/ml), is shown in Figure 4. Neutralization by comparator antibody “S309” ⁇ See Pinto et al. , Cross-neutralizaiton of SARS-CoV-2 by a human monoclonal SARS-CoV antibody , Nature 583:290-295 (July 2020)), was also tested.
  • Neutralization of pseudotyped virus by Antibody 420_1_1 and Antibody 420_1_2 was evaluated by a luciferase reporter assay.
  • Neutralization by Antibody 420 1 2 of MERS-CoV infection in Huh7 cells ( Figure 6A), and of SARS-CoV-2 in Vero E6 cells, ( Figure 6B) was also evaluated. Curves showing percent neutralization at increasing antibody concentration (ng/ml) are shown, and IC50 values are reported in pg/ml.
  • S2S43 comprises the VH amino acid sequence set forth in SEQ ID NO:47 (CDRH1-H3 of SEQ ID NOs:48-50, respectively) and the VL amino acid sequence set forth in SEQ ID NO:51 (CDRL1-L3 of SEQ ID NOs: 52-54, respectively).
  • Germline sequences of S2P6 and S2S43 V-regions were evaluated. Antibodies comprising unmutated common ancestor (UCA) V-region sequences for each of S2P6 and S2S43 were generated. Also generated were S2P6 antibodies in which one or more CDR (IMGT) amino acid residue was reverted to the germline amino acid. See Figures 76 and 78. Further studies were performed, with data shown in Figures 34-75 and 77.
  • UCA unmutated common ancestor
  • S2S8 is cross-reactive against alpha-coronaviruses ( Figure 37).
  • S2P6 can activate human FcyRIIa (H131 allele) and FcyRIIIa (V158 allele) ( Figures 42A, 42B, and 62), elicits effector function ( Figure 63), and protects against SARS-CoV-2 infection in a Syrian hamster model ( Figures 45, 64, and 65).
  • S2P6 binding did not block SARS-CoV-2 RBD from binding to human ACE2 ( Figure 60).
  • S2P6 inhibited cell-cell fusion using Vero-E6 cells transfected with SARS-CoV-2 S ( Figure 61).
  • S2P6 was shown to bind to all full-length SARS-CoV-2 S variants tested and to 24 S glycoproteins representative of all sarbecovirus clades transiently expressed on the surface of ExpiCHO cells ( Figures 50, 67A-67C, and 68). S2P6 binds comparably to the stem helix peptides of the five beta-coronaviruses that infect humans (albeit with a faster off-rate for HKU1) as well as of the MERS-CoV-related bat viruses (HKU4 and HKU5) and murine hepatitis virus (MHV) (data not shown).
  • S2P6 also exhibited binding to postfusion SARS-CoV-2 spike protein even though its epitope appears to be buried at the interface of the targeted protomer with the other two protomers of the rod-shaped trimer of the spike protein and, therefore, may not be expected to be fully accessible (data not shown).
  • S2P6 activates immune cell-dependent effector functions in vitro and protects hamsters challenged with SARS-CoV-2 Wuhan-1 and B.1.351 strains.
  • mAbs targeting highly conserved regions of the S glycoprotein human IgG + memory B cells from COVID-19 convalescent donors were interrogated. mAbs were identified that bound to the prefusion-stabilized S ectodomain trimers of viruses belonging to all three-human infecting b-coronavirus subgenera, i.e., sarbecovirus (SARS-CoV and SARS-CoV-2), merbecovirus (MERS-CoV) and embecovirus (OC43 and HKU1), but not to the human a-coronaviruses (229E and NL63). S2P6 and S2S43 mAbs are derived from two donors and use VH1-46*01 and D5-12*01 genes.
  • S2P6 was selected for further characterization and shown to bind to all full-length SARS-CoV-2 S variants tested to 24 S glycoproteins representative of all sarbecovirus clades transiently expressed on the surface of ExpiCHO cells.
  • SPR surface plasmon resonance
  • the S2P6 Fab fragment was found to have had the highest affinity for SARS-CoV-2 S and SARS-CoV S followed by MERS-CoV S and OC43 S with equilibrium dissociation constants (KD) of 7, 7, 12 and 16 nM, respectively.
  • KD equilibrium dissociation constants
  • S2P6 also bound to HKU1 S albeit with reduced affinity (KD -120 nM).
  • VSV vesicular stomatitis virus
  • S2P6 inhibited SARS-CoV S, Pangolin Guangdong 2019 (P-GD) S, MERS-CoV S and OC43 S VSV pseudotypes with IC50 values ranging from 0.02 to 17 pg/ml.
  • S2P6 therefore features an unprecedented broad b-coronavirus neutralizing activity, including SARS-CoV-2 and circulating VOC.
  • peptide mapping experiments were performed using 15-mer linear overlapping peptides. All mAbs were found to bind to peptides containing the SARS-CoV-2 motif Fii48KEELDKYFii5 6 located in the stem helix within the S2 subunit. This region is highly conserved among b- coronaviruses. S2P6 bound with comparable magnitudes to the stem helix peptides of the five b-coronaviruses that infect humans (albeit with a faster off-rate for HKU1) as well as of the MERS-CoV-related bat viruses (HKU4 and HKU5) and murine hepatitis virus (MHV). S2S43 exhibited similar overall binding to S2P6 with markedly weaker reactivity towards the HKU1, HKU4 and HKU5 peptides.
  • Viral escape mutant selection was carried out in vitro in the presence of S2P6 using a replication-competent VSV-SARS-CoV-2 S chimeric virus (Case et al. 2020). After two passages, virus neutralization by S2P6 was completely abrogated and deep sequencing analysis revealed the emergence of five distinct resistance mutations: LI 152F,
  • S2P6 binding did not block engagement of SARS- CoV-2 S by ACE2 using ELISA.
  • S2P6 blocked cell-cell fusion between Vero- E6 cells transfected with full-length SARS-CoV-2 S as effectively as the S2M11 mAh which locks SARS-CoV-2 S in the closed state (M. A. Tortorici et al. 2020).
  • mAbs have been described that target RBD antigenic site la (e.g. S2E12) and Ila (e.g. S2X259 or S2X35) which can mimic receptor attachment and prematurely trigger fusogenic S conformational changes (A. C.
  • S2P6 abrogated the formation of syncytia mediated by S2E12 at concentrations as low as 1 ng/ml.
  • Fc-mediated effector functions can contribute to in vivo protection by promoting viral clearance and anti -viral immune responses (Schafer et al. 2021; Bournazos, Wang, and Ravetch 2016; Bournazos et al. 2020; Winkler et al. 2020).
  • S2P6 The potential of S2P6 to trigger activation of FcyRIIa and FcyRIIIa, as well as to exert Fc effector functions in vitro , was analyzed.
  • S2P6 promoted moderate dose-dependent FcyRIIa and FcyRIIIa mediated signaling using a luciferase reporter assay.
  • S2P6 promoted robust activation of Ab- dependent cell cytotoxicity (ADCC), to levels comparable to those observed with the S309 mAh (Pinto et al. 2020), following incubation of SARS-CoV-2 S expressing ExpiCHO target cells (CHO-S) with human NK cells.
  • ADCC Ab-dependent cell cytotoxicity
  • S2P6 also showed Ab-dependent cellular phagocytosis (ADCP) activity using Cell-Trace- Violet-labelled peripheral blood mononuclear cells (PBMCs) as phagocytic cells, and CHO-S cells.
  • PBMCs peripheral blood mononuclear cells
  • S2P6 did not promote complement-dependent cytotoxicity (CDC) indicating that S2P6 Fc-mediated effector functions, but not complement activation, might participate in viral control in vivo.
  • CDC complement-dependent cytotoxicity
  • Hm-S2P6 human IgGl
  • Hm- S2P6 hamster IgG2
  • Hm- S2P6 Two different doses of human IgGl (Hu-S2P6) or hamster IgG2 (Hm- S2P6) were administered 24h prior to intranasal SARS-CoV-2 challenge and the lungs of the animals were assessed 4 days post infection for viral RNA load and replicating virus.
  • Hm-S2P6 administered at 20 mg/kg reduced viral RNA copies and replicating viral titers in the lungs of hamsters by two orders of magnitude relative to a control (irrelevant) mAh.
  • Hm-S2P6 at 20 mg/kg reduced viral RNA copies detected in the lungs to levels significantly lower than those observed with Hu-S2P6, suggesting a beneficial effect of S2P6 effector functions in vivo.
  • the frequency of stem helix specific Abs in the memory B cell repertoire of 21 convalescent and 17 vaccinated individuals was investigated using a clonal analysis based on in vitro polyclonal stimulation (Pinna et al. 2009), here referred as antigen-specific B- cell memory repertoire analysis (AMBRA).
  • AMBRA antigen-specific B- cell memory repertoire analysis
  • frequencies of stem helix specific IgGs ranging from 0.1-2.5% were observed, except for one individual (infected and vaccinated with a single dose of mRNA vaccine) for whom a 97% frequency of SARS- CoV/-2-specific Abs was measured.
  • Most SARS-CoV-2 stem helix specific Abs were found to be cross-reactive with OC43, consistent with the high sequence identity of the stem helices of these two viruses.
  • the coronavirus S2 subunit (so-called fusion machinery) contains several important antigenic sites, including the fusion peptide and the heptad-repeat 2 regions, and is more conserved than the Si subunit (Daniel et al. 1993; Zhang et al. 2004; Poh et al. 2020; Elshabrawy et al. 2012; Zheng et al. 2020). As a result, it is an attractive target for broad coronavirus detection and neutralization (A. C. Walls et al. 2016).
  • S2P6 broadly neutralizes all sarbecoviruses, merbecoviruses and embecoviruses evaluated through inhibition of membrane fusion and provide evidence that an S2 subunit-directed mAh protects hamsters from SARS-CoV-2 challenge, including with the SARS-CoV-2 B.1.351 VOC, with a beneficial effect of Fc-mediated effector functions.
  • stem helix- targeted Abs are elicited upon natural infection by endemic (OC43 or HKU1) or pandemic (SARS-CoV-2) coronaviruses as well as by COVID-19 mRNA vaccines.
  • stem helix-specific Abs are present at low titers in convalescent or vaccinated individuals in plasma samples and at low frequency in their memory B cell repertoire possibly as a result of limited epitope exposure.
  • Stem helix-targeted Abs are predominantly of narrow specificities and only few of them mediate broad b-coronavirus neutralization and protection through accumulation of somatic mutations.
  • Lentiviruses were generated by co-transfection of Lenti-X 293T cells (Takara) with lentiviral expression plasmids encoding DC-SIGN (CD209), L-SIGN (CLEC4M), SIGLEC1, TMPRSS2 or ACE2 (all obtained from Genecopoeia) and the respective lentiviral helper plasmids. Forty-eight hours post transfection, lentivirus in the supernatant was harvested and concentrated by ultracentrifugation for 2 h at 20,000 rpm.
  • Lenti-X 293T (Takara), Vero E6 (ATCC), MRC5 (Sigma-Aldrich), A549 (ATCC) were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h. Cell lines overexpressing two transgenes were transduced subsequently. Selection with puromycin and/or blasticidin (Gibco) was started two days after transduction and selection reagent was kept in the growth medium for all subsequent culturing. Single cell clones were derived from the A549-ACE2-TMPRSS2 cell line, all other cell lines represent cell pools.
  • SARS-CoV-2 isolated USA-WA1/2020, passage 3, passaged in Vero E6 cells
  • Neutralization was determined using SARS-CoV-2-Nluc, an infectious clone of SARS-CoV-2 (based on strain 2019-nCoV/USA_WAl/2020) encoding nanoluciferase in place of the viral ORF7, which demonstrates comparable growth kinetics to wild type virus (Xie et ak, Nat Comm, 2020, https://doi.org/10.1038/s41467-020-19055-7).
  • Cells were seeded into black-walled, clear-bottom 96-well plates at 20,000 cells/well (293T cells were seeded into poly-L-lysine-coated wells at 35,000 cells/well) and cultured overnight at 37°C.
  • Lenti-X 293T cells (Takara) were seeded in 10-cm dishes for 80% next day confluency. The next day, cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP 009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions. One day post-transfection, cells were infected with VSV(G*AG-luciferase) (Kerafast) at an MOI of 3 infectious units/cell.
  • Viral inoculum was washed off after one hour and cells were incubated for another day at 37°C.
  • the cell supernatant containing SARS-CoV-2 pseudotyped VSV was collected at day 2 post-transfection, centrifuged at 1000 x g for 5 minutes to remove cellular debris, aliquoted, and frozen at -80°C.
  • Lenti-X 293T cells were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia): ACE2 (NM_021804), DC-SIGN (NM_021155), L-SIGN (BC110614), LGALS3 (NM_002306), SIGLEC1 (NM_023068), SIGLEC3 (XM 057602), SIGLEC9 (BC035365), SIGLEC10 (NM 033130), MGL (NM_182906), MINCLE (NM_014358), CD147 (NM_198589), ASGR1 (NM_001671.4), ASGR2 (NM_080913), NRP1 (NM_003873).
  • CHO cells stably expressing SARS-CoV-2 S-glycoprotein were seeded in 96 well plates for microscopy (Thermo Fisher Scientific) at 12’ 500 cells/well and the following day, different concentrations of mAbs and nuclei marker Hoechst (final dilution 1:1000) were added to the cells and incubated for additional 24h hours. Fusion degree was established using the Cytation 5 Imager (BioTek) and an object detection protocol was used to detect nuclei as objects and measure their size.
  • the nuclei of fused cells i.e., syncytia
  • the area of the objects in fused cells divided by the total area of all the object multiplied by 100 provides the percentage of fused cells
  • HEK 293T cells were seeded onto poly-D-Lysine-coated 96-well plates (Sigma- Aldrich) and fixed 24 h after seeding with 4% paraformaldehyde for 30 min, followed by two PBS (pH 7.4) washes and permeabilization with 0.25% Triton X-100 in PBS for 30 min.
  • Cells were incubated with primary antibodies anti-DC-SIGN/L-SIGN (Biolegend, cat. 845002, 1:500 dilution), anti-DC-SIGN (Cell Signaling, cat. 13193 S, 1:500 dilution), anti- SIGLEC1 (Biolegend, cat.
  • Intracellular levels of ACE2 (Forward Primer: C AAGAGC AAACGGTTGAAC AC (SEQ ID NO: 97), Reverse Primer: CCAGAGCCTCTCATTGTAGTCT(SEQ ID NO: 98), HPRT (Forward Primer: CCTGGCGTCGTGATTAGTG (SEQ ID NO: 99), Reverse Primer: ACACCCTTTCCAAATCCTCAG (SEQ ID NO: 100), and TMPRSS2 (Forward Primer: CAAGTGCTCCRACTCTGGGAT (SEQ ID NO: 101), Reverse Primer: AACACACCGRTTCTCGTCCTC (SEQ ID NO: 102) were quantified using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s protocol. Levels of ACE2 and TMPRSS2 were normalized to HPRT. Hela cells were used as the reference sample. All qPCRs were run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems).
  • Prefusion-stabilized SARS2 D614G spike (comprising amino acid sequence Q14 to K1211) with a C-terminal TEV cleavage site, T4 bacteriophage fibritin foldon, 8x His-, Avi- and EPEA-tag was transfected into HEK293 Freestyle cells, using 293fectin as a transfection reagent. Cells were left to produce protein for three days at 37°C. Afterwards, supernatant was harvested by centrifuging cells for 30 minutes at 500 xg, followed by another spin for 30 minutes at 4000 xg.
  • SARS2 D614G spike was eluted, using 10 column volumes of 100 mM Tris, 200 mM NaCl and 3.8 mM SEPEA peptide. Elution peak was concentrated and injected on a Superose 6 increase 10/300 GL gel filtration column, using 50 mM Tris pH 8 and 200 mM NaCl as a running buffer. SEC fractions corresponding to monodisperse SARS2 D614G spike were collected and flash frozen in liquid nitrogen for storage at -80°C.
  • Purified SARS2 D614G spike protein was biotinylated using BirA500 biotinylation kit from Avidity. To 50 ug of spike protein, 5 ug of BirA, and 11 uL of BiomixA and BiomixB was added. Final spike protein concentration during the biotinylation reaction was ⁇ 1 uM. The reaction was left to proceed for 16 hours at 4°C. Then, protein was desalted using two Zeba spin columns pre-equilibrated with lx PBS pH 7.4.
  • HEK 293T cells expressing DC-SIGN, L-SIGN, SIGLEC1 or ACE2 were resuspended at 4xl0 6 cells/mL and 100 pL per well were seeded onto V-bottom 96-well plates (Corning, 3894). The plate was centrifuged at 2,000 rpm for 5 minutes and washed with PBS (pH 7.4). The cells were resuspended in 200 pL of PBS containing ghost violet 510 viability dye (Cell Signaling, cat. 13-0870-T100, 1:1,000 dilution), incubated for 15 minutes on ice and then washed.
  • PBS PBS containing ghost violet 510 viability dye
  • the cells were resuspended in 100 pL of FACS buffer prepared with 0.5% BSA (Sigma-Aldrich) in PBS containing the primary antibodies at a 1:100 dilution: mouse anti-DC/L-SIGN (Biolegend, cat. 845002), rabbit anti-DC-SIGN (Cell Signaling, cat. 13193), mouse anti-SIGLECl (Biologend, cat. 346002) or goat anti- ACE2 (R&D Systems, cat. AF933).
  • BSA Sigma-Aldrich
  • the cells were washed two times and resuspended in FACS buffer containing the Alexa Fluor-488-labeled secondary antibodies at a 1:200 dilution: goat anti-mouse (Invitrogen cat. A11001), goat anti-rabbit (Invitrogen cat. A11008) or donkey anti-goat (Invitrogen cat. A11055).
  • FACS buffer containing the Alexa Fluor-488-labeled secondary antibodies at a 1:200 dilution: goat anti-mouse (Invitrogen cat. A11001), goat anti-rabbit (Invitrogen cat. A11008) or donkey anti-goat (Invitrogen cat. A11055).
  • the cells were washed three times with 200pL of FACS buffer and fixed with 200pL of 4% PFA (Alfa Aesar) for 15 mins at room temperature. Cells were washed three times, resuspended in 200pL of FACS buffer and analyzed by flow
  • Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647- strep, Invitrogen, S21374) at a 1 :20 ratio by volume for 20 min at room temperature. The labeled proteins were then stored at 4°C until further use. Cells were dissociated with TrpLE Express (Gibco, 12605-010) and 10 5 cells were transferred to each well of a 96-well V bottom plate (Corning, 3894).
  • Human mAbs were isolated from plasma cells or memory B cells of SARS-CoV-2 immune donors, as previously described. Recombinant antibodies were expressed in ExpiCHO cells at 37°C and 8% CO2. Cells were transfected using ExpiFectamine. Transfected cells were supplemented 1 day after transfection with ExpiCHO Feed and ExpiFectamine CHO Enhancer. Cell culture supernatant was collected eight days after transfection and filtered through a 0.2 pm filter.
  • Recombinant antibodies were affinity purified on an Af TA xpress FPLC device using 5 mL HiTrapTM MabSelectTM PrismA columns followed by buffer exchange to Histidine buffer (20 mM Histidine, 8% sucrose, pH 6) using HiPrep 26/10 desalting columns
  • the SARS-CoV-2 strain used in this study BetaCov/Belgium/GHB-03021/2020 (EPI ISL 109407976
  • a close relation with the prototypic Wuhan-Hu-1 2019-nCoV (GenBank accession 112 number MN908947.3) strain was confirmed by phylogenetic analysis. Infectious virus was isolated by serial passaging on HuH7 and Vero E6 cells; passage 6 virus was used for the study described here. The titer of the virus stock was determined by end-point dilution on Vero E6 cells by the Reed and Muench method.
  • Vero E6 cells African green monkey kidney, ATCC CRL-1586 were cultured in minimal essential medium (Gibco) supplemented with 10% fetal bovine serum (Integra), 1% L- glutamine (Gibco) and 1% bicarbonate (Gibco). End-point titrations were performed with medium containing 2% fetal bovine serum instead of 10%.
  • Animals were prophylactically treated 48h before infection by intraperitoneal administration (i.p.) and monitored for appearance, behavior, and weight.
  • hamsters were euthanized by i.p. injection of 500 pL Dolethal (200 mg/mL sodium pentobarbital, Vetoquinol SA).
  • Lungs were collected and viral RNA and infectious virus were quantified by RT-qPCR and end-point virus titration, respectively. Blood samples were collected before infection for PK analysis.
  • SARS-CoV-2 RT-qPCR Collected lung tissues were homogenized using bead disruption (Precellys) in 350pL RLT buffer (RNeasyMinikit, Qiagen)and centrifuged (10.000 rpm, 5 min) to pellet the cell debris. RNA was extracted according to the manufacturer’s instructions. Of 50 pL eluate, 4 pL was used as a template in RT-qPCR reactions. RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid. Standards of SARS-CoV- 2 cDNA (IDT) were used to express viral genome copies per mg tissue or per mL serum.
  • IDT SARS-CoV-2 cDNA
  • Lung tissues were homogenized using bead disruption (Precellys) in 350 pL minimal essential medium and centrifuged (10,000 rpm, 5min, 4°C) to pellet the cell debris.
  • Precellys bead disruption
  • endpoint titrations were performed on confluent Vero E6 cells in 96- well plates.
  • Viral titers were calculated by the Reed and Muench method using the Lindenbach calculator and were expressed as 50% tissue culture infectious dose (TCID50) per mg tissue.
  • the scored parameters were the following: congestion, intra-alveolar hemorrhagic, apoptotic bodies in bronchus wall, necrotizing bronchiolitis, perivascular edema, bronchopneumonia, perivascular inflammation, peribronchial inflammation and vasculitis.
  • Immunocomplexes were generated by complexing S309 mAh (hamster IgG, either wt or N297A) with a biotinylated anti-idiotype fab fragment and Alexa-488- streptavidin, using a precise molar ratio (4:8:1, respectively). Pre-generated fluorescent IC were serially diluted incubated at 4°C for 3 hrs with freshly revitalized hamster splenocytes, obtained from a naive animal. Cellular binding was then evaluated by cytometry upon exclusion of dead cells and physical gating on monocyte population. Results are expressed as Alexa-488 mean florescent intensity of the entire monocyte population.
  • HLCA Human Lung Cell Atlas
  • Github github.com/krasnowlab/HLCA
  • Processed single-cell transcriptome data and annotation of lung epithelial and immune cells from SARS-CoV-2 infected individuals were downloaded from NCBI GEO database (ID: GSE158055) and Github (github.com/zhangzlab/covid_balf).
  • Available sequence data from the second single-cell transcriptomics study by Liao et al. were downloaded from NCBI SRA (ID: PRJNA608742) for inspection of reads corresponding to viral RNA. The proportion of sgRNA relative to genomic RNA was estimated by counting TRS-containing reads supporting a leader- TRS junction.
  • leader-TRS junction reads were adapted from Alexandersen et al. The viral genome reference and TRS annotation was based on Wuhan-Hu-1 NC_045512.2/MN908947 49 . Only 2 samples from individuals with severe COVID-19 had detectable leader-TRS junction reads (SRRl 1181958, SRR11181959).
  • Cell lines used in this study were obtained from ATCC (HEK293T and Vero-E6) or ThermoFisher Scientific (Expi CHO cells, FreeStyleTM 293-F cells and Expi293FTM cells).
  • Samples were obtained from cohorts of individuals enrolled before June 2019 (pre pandemic), of SARS-CoV-2 infected individuals or of vaccinated individuals immunized with Moderna or Pfizer/BioNTech BNT162b2 vaccines under study protocols approved by the local Institutional Review Boards (Canton Ticino Ethics Committee, Switzerland, the Ethical committee of Luigi Sacco Hospital, Milan, Italy and WCG North America, Princeton, NJ, US). All donors provided written informed consent for the use of blood and blood components (such as PBMCs, sera or plasma) and were recruited at hospitals or as outpatients.
  • PBMCs were isolated from blood by Ficoll density gradient centrifugation and either used freshly or stored in liquid nitrogen for later use.
  • Sera were obtained from blood collected using tubes containing clot activator, followed by centrifugation and stored at -80 °C.
  • Antigen specific IgG+ memory B cells were isolated and cloned from total PBMCs of convalescent individuals. Antibody VH and VL sequences were obtained by reverse transcription PCR (RT-PCR) and mAbs were expressed as recombinant human IgGl, carrying the half-life extending M428L/N434S (LS) mutation in the Fc region or Fab fragment. ExpiCHO cells were transiently transfected with heavy and light chain expression vectors as previously described (Pinto et al. 2020). For in vivo experiments in Syrian hamsters, S2P6 was produced with a Syrian hamster IgG2 Fc.
  • UCA sequences were constructed using IMGT/V-QUEST and VH and VL with somatic mutation recumbently produced.
  • MAbs affinity purification was performed on AKTA Xpress FPLC (Cytiva) operated by UNICORN software version 5.11 (Build 407) using HiTrap Protein A columns (Cytiva) for full length human and hamster mAbs and CaptureSelect CHI -XL MiniChrom columns (ThermoFisher Scientific) for Fab fragments, using PBS as mobile phase. Buffer exchange to the appropriate formulation buffer was performed with a HiTrap Fast desalting column (Cytiva). The final products were sterilized by filtration through 0.22 pm filters and stored at 4 °C.
  • S plasmids (Pinto et al. 2020; M. Alejandra Tortorici et al. 2021) were diluted in cold OptiPRO SFM, mixed with ExpiFectamine CHO Reagent (Life Technologies, A29130) and added to the cells seeded at 6 x 106 cells/ml in a volume of 5 ml in a 50 ml bioreactor. Transfected cells were incubated at 37°C, 8% C02 with an orbital shaking speed of 209 rpm (orbital diameter of 25 mm) for 42 hours.
  • transfected ExpiCHO cells were collected, washed twice in wash buffer (1% w/v solution of Bovine Serum Albumin (BSA; Sigma) in PBS, 2 mM EDTA) and distributed at 60,000 cells/well into 96 U-bottom plates (Corning).
  • mAh serial dilutions from 10 pg/ml were added onto cells for 30 minutes on ice and, after two washes, Alexa Fluot647-labelled Goat Anti-Human IgG secondary Ab (Jackson Immunoresearch, 109-606-098) was used for detection. After 15 minutes of incubation on ice, cells were washed twice and mAh binding analyzed by flow cytometry using a ZE5 Cell Analyzer (Biorard).
  • Spectraplate-384 with high protein binding treatment (Perkin Elmer) or 96-well plates (Corning) were coated overnight at 4°C with recombinant stabilized prefusion spike trimers or S2 subunit at 1 pg/ml or coronaviruses stem helix peptides at 8 pg/ml, all diluted in phosphate-buffered saline (PBS). Plates were blocked with a 1% w/v solution of Bovine Serum Albumin (BSA; Sigma) in PBS or, for ELISA with plasma, with Blocker Casein (1% w/v) in PBS (Thermo Fisher Scientific) supplemented with 0.05% Tween 20.
  • BSA Bovine Serum Albumin
  • Blocker Casein 1% w/v
  • SARS-CoV-2 S prefusion (final concentration 300 ng/ml) was incubated with 1 pg/ml of S309 mouse Fc-tagged mAb (S309-mFc) 30 minutes at 37°C before the addition of serially diluted S2P6 (from 20 pg/ml) and incubated for additional 30 minutes at 37°C.
  • the complex spike:S309:S2P6 was then added to a pre-coated hACE2 (2 pg/ml in PBS) 96-well plate MaxiSorp (Nunc) and incubated 1 hour at room temperature.
  • PEPperMAP Epitope Mapping was performed to determine mAbs epitope through a Pan-corona Spike Protein Microarray covering the spike proteins of all beta-coronaviruses. Briefly, microarray containing 15- mer peptides (overlapping of 13-mer) was incubated with 10 pg/ml mAb for 16 hours at 4°C shaking at 140 rpm followed by staining with secondary and control Abs for 45 minutes at room temperature. Microarray read-out was performed with a LI-COR Odyssey Imaging System at scanning intensities of 7/7 (red/green). Epitope substitution scan was performed on the identified epitope based on a stepwise single amino acid exchange on all amino acid positions. The mAbs binding to the generated microarray was performed as above.
  • SPR binding measurements were performed using a Biacore T200 instrument using anti-AviTag pAb covalently immobilized on CM5 chips to capture S ECDs except the Cytiva Biotin CAPture kit was used to capture biotinylated OC43 S ECD.
  • Running buffer was Cytiva HBS-EP+ (pH 7.4) or 20 mM phosphate pH 5.4, 150 mM NaCl, 0.05% P-20, for neutral or acidic pH experiments, respectively. All measurements were performed at 25 °C.
  • S2P6 Fab or IgG concentrations were 11, 33, 100, and 300 nM run as single-cycle kinetics. Double reference-subtracted data were fit to a binding model using Biacore Evaluation software.
  • serial dilutions of mAbs (1:4) were incubated with 200 PFU (plaque forming units, corresponding to a multiplicity of infection of 0.01) of authentic SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero-E6 cells) for 30 minutes at 37°C. After removal of cell culture supernatants, cells were infected with the virus: antibody mixtures and incubated for 20 hours at 37°C.
  • Serial 1:4 dilution series of mAbs were incubated with 200 PFU of SARS-CoV-2 Nluc, an infectious clone of SARS-CoV-2 (strain 2019-nCoV/USA_WAl/2020) in which the viral ORF7 gene was replaced with a nanoluciferase reporter (Xie et al. 2020). After 30 minutes incubation at 37°C, the virus:antibody mixtures were used to infect the target cells at a multiplicity of infection of 0.01. At 20 hours post infection, cells were allowed to equilibrate to room temperature and cell culture supernatants were aspirated. A 1:1 mixture of Nano-Glo®
  • Sarbecovirus spike cassettes with a C-terminal deletion of 19 amino acids were synthesized and cloned into Mammalian expression constructs (pcDNA3.1(+) or pTwist-CMV) for the following Sarbecoviruses: SARS-CoV-2 (Accession QOU99296.1), SARS-CoV-1 (Accession AAP13441.1), hCoV-19/pangolin/Guangdong/l/2019 (GD19, Accession QLR06867.1), and Middle East respiratory syndrome-related coronavirus (MERS, Accession YP_009047204).
  • SARS-CoV-2 Accession QOU99296.1
  • SARS-CoV-1 Accession AAP13441.1
  • GD19 hCoV-19/pangolin/Guangdong/l/2019
  • MERS Middle East respiratory syndrome-related coronavirus
  • VSV-SARS-CoV-2 VSV-SARS-CoV-1
  • VSV- GD19and Huh7 cells were used for VSV-MERS. Cells were seeded into clear bottom white-walled 96-well plates at 20,000 cells/well. The following day, 1:3 serial dilutions of Ab were prepared in basal DMEM in triplicate.
  • Pseudotyped VS Vs were diluted in basal DMEM and added to each Ab dilution such that the final dilution of pseudovirus was 1 :20.
  • Pseudovirus:antibody mixtures were incubated for 1 hour at 37°C. Media was removed from the cells seeded the previous day and replaced with 50 pi of pseudovirus:Ab mixtures and incubated at 37°C. One hour post-infection, 50 m ⁇ of complete culture media was added to each well and cells incubated overnight at 37°C. The media from infected cells was then removed and 100 m ⁇ of 1:1 diluted PBS:Bio-Glo (Promega, G7940) luciferase substrate was added to each well.
  • DMEM Gibco 11995-040
  • FBS VWR 97068-085 lot#345K19
  • Penicillin-Streptomycin Gibco 15140-122
  • 250,000 VeroE6-TMPRSS2 cells were seeded in 12-well plates in 2 ml of DMEM (Gibco 11995-040) supplemented with 10% FBS (VWR 97068-085 lot#345K19) and 100 U/ml Penicillin-Streptomycin (Gibco 15140-122) and incubated overnight at 37C.
  • S2P6 was serially diluted 1:4 starting at 80 ug/ml in infection media (DMEM (supplemented with 2% FBS and 20mM HEPES (Gibco, 15630- 080)) and incubated with replication-competent VSV-SARS-CoV-2 (Case et al. 2020) at MOI 2 for 1 hour at 37°C.
  • DMEM supplied with 2% FBS and 20mM HEPES (Gibco, 15630- 080)
  • replication-competent VSV-SARS-CoV-2 (Case et al. 2020) at MOI 2 for 1 hour at 37°C.
  • a no Ab control was included to account for any tissue culture adaptations and quasispecies variability that may occur during virus replication.
  • the mAb- virus complexes were adsorbed on the cells for lhour at 37°C, with manual rocking every 15 minutes.
  • Viral RNA was extracted from the supernatant of viral passages using the QIAamp Viral RNA Mini Kit (Qiagen, 52904) according to the manufacturer’s instructions, without the addition of carrier RNA. Reverse transcription reactions were performed with 6 pi of purified RNA and random primers using the NEB ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S), according to manufacturer’s instructions.
  • the resulting cDNA was used as a template for PCR amplification of the spike gene using the KapaBiosystems polymerase (KAPA HiFi HotStart Ready PCR Kit KK2601) with primers 5’- C GAG A AA A AGGC AT C T GG AG -3’ (SEQ ID NO: 103) and 5’- CATTGAACTCGTCGGTCTC -3 ’(SEQ ID NO: 104).
  • Amplification conditions included an initial 3 minutes at 95°C, followed by 28 cycles with 20 seconds at 98°C,
  • PCR products were purified using AMPure XP beads (Beckman Coulter, A63881) following manufacturer’s instructions. The size of the amplicon was confirmed by analyzing 2 pi of PCR products using the Agilent D5000 ScreenTape System (Agilent D5000 ScreenTape, 5067-5588, Agilent D5000, Reagents 5067-5589). Products were quantified by analyzing 2 pi with the Quant-iT dsDNA High-Sensitivity Assay Kit (Thermo Fisher, Q331120).
  • Bioinformatic analysis The average read length after running Illumina’s Bcl2fastq command was ranging from 149 to 188bp on average per sample. For consistency across samples, paired-end reads were initially trimmed to 2X150bp and further cleaned to remove Illumina’s adapter and low quality bases using Trimmomatic (Bolger, Lohse, and Usadel 2014). Read alignment was performed with Burrows- Wheeler Aligner (BWA (Li 2013)) using a custom reference sequence. Variants were called with LoFreq upon indel realignment and base quality recalibration (Wilm et al. 2012), using a frequency threshold of 1%.
  • Determination of mAb-dependent activation of human FcyRIIIa and FcyRIIa was performed using ExpiCHO cells stably expressing full-length wild-type SARS-CoV-2 spike (S) (target cells). Cells were incubated with different amounts of mAbs for 10 minutes before incubation with Jurkat cells stably expressing FcyRIIIa receptor (VI 58 variant) or FcyRIIa receptor (H131 variant) and NFAT-driven luciferase gene (effector cells) at an effector to target ratio of 6: 1 for FcyRIIIa and 5:1 for FcyRIIa.
  • S SARS-CoV-2 spike
  • Activation of human FcyRs was quantified by the luciferase signal produced as a result of NFAT pathway activation. Luminescence was measured after 21 hours of incubation at 37°C with 5% C02 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega, Cat. Nr.: G7018 and G9995).
  • ADCC Antibody-dependent cell cytotoxicity
  • ADCC assays were performed using SARS-CoV2 CHO-K1 cells (genetically engineered to stably express a HaloTag-HiBit-tagged) as target cells and PBMC as effector cells at a E:T ratio of 33:1.
  • HiBit-cells were seeded at 3,000 cells/well and incubated for 16 hours at 37°C, while PBMC isolated from fresh blood (VV donor) were cultivated overnight in an incubator at 37°C in the presence of 5 ng/ml of IL-2. The day after, media was removed and titrated concentrations of mAbs were added before the addition of PBMCs at 100,000 cells/well. As 100% specific lysis, Digitonin at 100 ug/ml was used.
  • ADCC was measured with Nano-Glo HiBiT Extracellular Detection System (Promega; Cat. Nr.: N2421) using a luminometer (Integration Time 00:30).
  • ADCP Antibody-dependent cellular phagocytosis
  • ADCP was performed using CHO cells stably expressing full-length wild-type SARS-CoV-2 S glycoprotein (target cells) fluorescently labelled with PKH67 Fluorescent Cell Linker Kits (Sigma Aldrich; Cat. Nr.: MINI67).
  • Target cells were incubated with titrated concentrations of mAbs for 10 minutes, followed by incubation with PBMCs fluorescently labelled with Cell Trace Violet (Invitrogen, cat. no. C34557) after an overnight incubation in 5 ng/ml IL-2 (Recombinant Human Interleukin-2; ImmunoTools GmbH; Cat. Nr. : 11340027).
  • An effectontarget ratio of 20: 1 was used.
  • ADCP was determined by flow cytometry, gating on CD14+ cells that were double-positive for cell trace violet and PKH67.
  • CDC Complement-dependent cytotoxicity
  • the system was equilibrated in PBST for 300 seconds prior to immersing the sensors in 0.1 mM S2P6 mAb, respectively, for 300 seconds prior to dissociation in buffer for 300 seconds.
  • 1 pg/ml biotinylated to SARS CoV-2 peptide was loaded on SA biosensors to a threshold of 0.5 nm.
  • the system was equilibrated in PBST for 180 seconds and each subsequent step was monitored for 900 seconds.
  • the first sample biosensor was immersed in 0.1 pM mAb S2P6 prior to immersing the sample biosensor in a solution of 0.1 pM mAb S2P6 and B6, respectively.
  • the second sample biosensor was immersed in PBST and subsequently in 0.1 pM mAb B6. To monitor unspecific binding, identical experiments were performed without loading stem peptides to the biosensors.
  • VeroE6 cells were seeded in 96 well plates at 20,000 cells/ well in 70 pi DMEM with high glucose and 2.4% FBS (Hyclone). After 16 hours, cells were transfected with S ARS-CoV-2-S-D 19_pcDNA3 1 as follows: for 10 wells, 0.57 pg plasmid SARS-CoV-2- S-D19_pcDNA3.1 were mixed with 1.68 m ⁇ X-tremeGENE HP in 30 m ⁇ OPTIMEM. After 15 minutes incubation, the mixture was diluted 1 : 10 in DMEM medium and 30 m ⁇ was added per well.
  • a 4-fold serial dilution mAh was prepared and added to the cells, with a starting concentration of 20 pg/ml. The following day, 30 m ⁇ 5X concentrated DRAQ5 in DMEM was added per well and incubated for 2 hours at 37°C. Nine images of each well were acquired with a Cytation 5 equipment for analysis.
  • the titer of the virus stock was determined by end-point dilution on Vero-E6 cells by the Reed and Muench method (Reed and Muench 1938).
  • the variant strain B.1.351 (hCoV- 19/Belgium/rega- 1920/2021; EPI_ISL_896474, 2021-01-11) was isolated from nasopharyngeal swabs taken from a traveler returning to Belgium and developing respiratory symptoms.
  • the patients’ nasopharyngeal swabs were directly subjected to sequencing on a MinlON platform (Oxford Nanopore) (Abdelnabi et al https://www.biorxiv.Org/content/10.l 101/2021.02.26.433062vl).
  • Live virus-related work was conducted in the high-containment A3 and BSL3+ facilities of the KU Leuven Rega Institute (3CAPS), under licenses AMY 30112018 SBB 2192018 0892 and AMV 23102017 SBB 21920170589 according to institutional guidelines.
  • 3CAPS KU Leuven Rega Institute
  • Wildtype Syrian hamsters (Mesocricetus auratus) were purchased from Janvier Laboratories and were housed per two in ventilated isolator cages (IsoCage N Biocontainment System, Tecniplast) with ad libitum access to food and water and cage enrichment (wood block). Housing conditions and experimental procedures were approved by the ethical committee of animal experimentation of KU Leuven (license P065-2020).
  • Female hamsters of 6-10 weeks old were anesthetized with ketamine/xylazine/atropine and inoculated intranasally with 50 pi containing 2x106 or 1x104 TCID50 for wt or B.1.351 variants respectively.
  • Monoclonal antibody treatment human or hamster S2P6 (2-20 mg/kg) was initiated either 24) or 48 hours before infection by intraperitoneal injection.
  • Hamsters were monitored for appearance, behavior and body weight.
  • Dolethal 200 mg/mL sodium pentobarbital, Vetoquinol SA.
  • Lungs were collected, and viral RNA and infectious virus were quantified by RT-qPCR and end-point virus titration, respectively. Blood samples were collected before infection for pharmacokinetics analysis.
  • RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (Boudewijns et al. 2020).
  • Standards of SARS-CoV-2 cDNA (IDT) were used to express viral genome copies per mg tissue or per ml serum. End-point virus titrations
  • Lung tissues were homogenized using bead disruption (Precellys) in 350 m ⁇ minimal essential medium and centrifuged (10,000 rpm, 5 minutes, 4°C) to pellet the cell debris.
  • Precellys bead disruption
  • endpoint titrations were performed on confluent Vero-E6 cells in 96-well plates.
  • Viral titers were calculated by the Reed and Muench method (Reed and Muench 1938) using the Lindenbach calculator and were expressed as 50% tissue culture infectious dose (TCID50) per mg tissue.
  • Piccoli L., Y. J. Park, M. A. Tortorici, N. Czudnochowski, A. C. Walls, M. Beltramello, C. Silacci-Fregni, et al. 2020. “Mapping Neutralizing and Immunodominant Sites on the SARS-CoV-2 Spike Receptor-Binding Domain by Structure-Guided High- Resolution Serology.” Cell 183 (4): 1024-1042. e21.
  • Tortorici M. A., M. Beltramello, F. A. Lempp, D. Pinto, H. V. Dang, L. E. Rosen, M. McCallum, et al. 2020. “Ultrapotent Human Antibodies Protect against SARS-CoV-2 Challenge via Multiple Mechanisms.” Science 370 (6519): 950-57.
  • Tortorici M. A., and D. Veesler. 2019. “Structural Insights into Coronavirus Entry.” Advances in Virus Research 105: 93-116.
  • Tortorici M. Alejandra, Nadine Czudnochowski, Tyler N. Starr, Roberta Marzi, Alexandra C. Walls, Fabrizia Zatta, John E. Bowen, et al. 2021. “Structural Basis for Broad Sarbecovirus Neutralization by a Human Monoclonal Antibody.” BioRxiv. Org: The Preprint Server for Biology, April https://doi.org/10.1101/2021.04.07.438818. Walls, A. C., B. Fiala, A. Schafer, S. Wrenn, M. N. Pham, M. Murphy, L. V. Tse, et al. 2020. “Elicitation of Potent Neutralizing Antibody Responses by Designed Protein Nanoparticle Vaccines for SARS-CoV-2 ” Cell 183 (5): 1367-1382.el7.
PCT/US2021/060631 2020-11-25 2021-11-23 Antibodies that bind to multiple betacoronaviruses WO2022115486A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP21827340.7A EP4251279A1 (en) 2020-11-25 2021-11-23 Antibodies that bind to multiple betacoronaviruses
JP2023531541A JP2023550785A (ja) 2020-11-25 2021-11-23 複数のベータコロナウイルスに結合する抗体

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US202063118474P 2020-11-25 2020-11-25
US63/118,474 2020-11-25
US202163170342P 2021-04-02 2021-04-02
US63/170,342 2021-04-02
US202163177724P 2021-04-21 2021-04-21
US63/177,724 2021-04-21
US202163186779P 2021-05-10 2021-05-10
US63/186,779 2021-05-10

Publications (1)

Publication Number Publication Date
WO2022115486A1 true WO2022115486A1 (en) 2022-06-02

Family

ID=79024041

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/060631 WO2022115486A1 (en) 2020-11-25 2021-11-23 Antibodies that bind to multiple betacoronaviruses

Country Status (4)

Country Link
EP (1) EP4251279A1 (zh)
JP (1) JP2023550785A (zh)
TW (1) TW202235107A (zh)
WO (1) WO2022115486A1 (zh)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022266546A3 (en) * 2021-06-18 2023-01-26 Vanderbilt University Cross-reactive coronavirus antibodies
WO2023154824A1 (en) * 2022-02-10 2023-08-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Human monoclonal antibodies that broadly target coronaviruses
WO2023235827A3 (en) * 2022-06-03 2024-01-04 The Rockefeller University Coronavirus-inhibiting antibodies

Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4751180A (en) 1985-03-28 1988-06-14 Chiron Corporation Expression using fused genes providing for protein product
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4935233A (en) 1985-12-02 1990-06-19 G. D. Searle And Company Covalently linked polypeptide cell modulators
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5648237A (en) 1991-09-19 1997-07-15 Genentech, Inc. Expression of functional antibody fragments
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5789199A (en) 1994-11-03 1998-08-04 Genentech, Inc. Process for bacterial production of polypeptides
US5840523A (en) 1995-03-01 1998-11-24 Genetech, Inc. Methods and compositions for secretion of heterologous polypeptides
US5959177A (en) 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US6040498A (en) 1998-08-11 2000-03-21 North Caroline State University Genetically engineered duckweed
US6420548B1 (en) 1999-10-04 2002-07-16 Medicago Inc. Method for regulating transcription of foreign genes
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
WO2004076677A2 (en) 2003-02-26 2004-09-10 Institute For Research In Biomedicine Monoclonal antibody production by ebv transformation of b cells
US7049426B2 (en) 1999-06-10 2006-05-23 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
US7498415B2 (en) 2003-09-24 2009-03-03 Kyowa Hakko Kogyo Co., Ltd. Recombinant antibody against human insulin-like growth factor
US8119772B2 (en) 2006-09-29 2012-02-21 California Institute Of Technology MART-1 T cell receptors
US8258268B2 (en) 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
WO2015103072A1 (en) 2013-12-30 2015-07-09 Epimab Biotherapeutics Fabs-in-tandem immunoglobulin and uses thereof
WO2016071376A2 (en) * 2014-11-06 2016-05-12 F. Hoffmann-La Roche Ag Fc-region variants with modified fcrn-binding and methods of use
WO2016181357A1 (en) 2015-05-13 2016-11-17 Zumutor Biologics, Inc. Afucosylated protein, cell expressing said protein and associated methods
WO2019025391A1 (en) 2017-07-31 2019-02-07 Institute For Research In Biomedicine ANTIBODIES HAVING FUNCTIONAL DOMAINS IN THE ELBOW REGION BETWEEN A VARIABLE DOMAIN AND A CONSTANT DOMAIN
WO2019057122A1 (en) 2017-09-22 2019-03-28 Wuxi Biologics (Shanghai) Co., Ltd. NEW BISPECIFIC POLYPEPTIDE COMPLEXES

Patent Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4751180A (en) 1985-03-28 1988-06-14 Chiron Corporation Expression using fused genes providing for protein product
US4935233A (en) 1985-12-02 1990-06-19 G. D. Searle And Company Covalently linked polypeptide cell modulators
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5959177A (en) 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US6417429B1 (en) 1989-10-27 2002-07-09 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5468614A (en) 1990-01-24 1995-11-21 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5648237A (en) 1991-09-19 1997-07-15 Genentech, Inc. Expression of functional antibody fragments
US5789199A (en) 1994-11-03 1998-08-04 Genentech, Inc. Process for bacterial production of polypeptides
US5840523A (en) 1995-03-01 1998-11-24 Genetech, Inc. Methods and compositions for secretion of heterologous polypeptides
US6040498A (en) 1998-08-11 2000-03-21 North Caroline State University Genetically engineered duckweed
US7049426B2 (en) 1999-06-10 2006-05-23 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
US6420548B1 (en) 1999-10-04 2002-07-16 Medicago Inc. Method for regulating transcription of foreign genes
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
WO2004076677A2 (en) 2003-02-26 2004-09-10 Institute For Research In Biomedicine Monoclonal antibody production by ebv transformation of b cells
US7498415B2 (en) 2003-09-24 2009-03-03 Kyowa Hakko Kogyo Co., Ltd. Recombinant antibody against human insulin-like growth factor
US8258268B2 (en) 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
US8119772B2 (en) 2006-09-29 2012-02-21 California Institute Of Technology MART-1 T cell receptors
WO2015103072A1 (en) 2013-12-30 2015-07-09 Epimab Biotherapeutics Fabs-in-tandem immunoglobulin and uses thereof
WO2016071376A2 (en) * 2014-11-06 2016-05-12 F. Hoffmann-La Roche Ag Fc-region variants with modified fcrn-binding and methods of use
WO2016181357A1 (en) 2015-05-13 2016-11-17 Zumutor Biologics, Inc. Afucosylated protein, cell expressing said protein and associated methods
WO2019025391A1 (en) 2017-07-31 2019-02-07 Institute For Research In Biomedicine ANTIBODIES HAVING FUNCTIONAL DOMAINS IN THE ELBOW REGION BETWEEN A VARIABLE DOMAIN AND A CONSTANT DOMAIN
WO2019024979A1 (en) 2017-07-31 2019-02-07 Institute For Research In Biomedicine FUNCTIONAL DOMAIN ANTIBODIES IN THE ELBOW REGION
WO2019057122A1 (en) 2017-09-22 2019-03-28 Wuxi Biologics (Shanghai) Co., Ltd. NEW BISPECIFIC POLYPEPTIDE COMPLEXES

Non-Patent Citations (161)

* Cited by examiner, † Cited by third party
Title
"Epidemiological update: Occurrence of variants of SARS-CoV-2 in the Americas", 20 January 2021, PAN AMERICAN HEALTH ORGANIZATION
"GenBank", Database accession no. YP-173238.1
"NCBI", Database accession no. NC _045512.2
"Remington: The Science and Practice of Pharmacy", 2000, PHILADELPHIA COLLEGE OF PHARMACY AND SCIENCE
ABHINANDANMARTIN, MOLLMMUNOL, vol. 45, 2008, pages 3832 - 9
AHMED ET AL., J. STRUC. BIOL., vol. 194, no. 1, 2016, pages 78
ALTSCHUL ET AL., NUCLEIC ACIDS RES.
ANDERSON, ELIZABETH M.EILEEN C. GOODWINANURAG VERMACLAUDIA P. AREVALOMARCUS J. BOLTONMADISON E. WEIRICKSIGRID GOUMA ET AL.: "Seasonal Human Coronavirus Antibodies Are Boosted upon SARS-CoV-2 Infection but Not Associated with Protection", CELL, vol. 184, no. 7, 2021, pages 1858 - 1864
ARMOUR, K. L. ET AL., EUR. J. IMMUNOL., vol. 29, 1999, pages 2613 - 2624
AZOITEI, M. LB. E. CORREIAY. E. BANC. CARRICOO. KALYUZHNIYL. CHENA. SCHROETER ET AL.: "Computation-Guided Backbone Grafting of a Discontinuous Motif onto a Protein Scaffold.", SCIENCE, vol. 334, no. 6054, 2011, pages 373 - 76
BEGUM FEROZA ET AL: "Polymonoclonal (Not Polyclonal) Antibodies Derived from Convalescent Human B Cell Hybridomas Might Be a Better Therapeutic Option than Single Target Monoclonal Antibodies", ACS PHARMACOLOGY & TRANSLATIONAL SCIENCE, vol. 3, no. 4, 14 August 2020 (2020-08-14), pages 786 - 787, XP055897684, ISSN: 2575-9108, DOI: 10.1021/acsptsci.0c00084 *
BOLGER, ANTHONY M.MARC LOHSEBJOERN USADEL: "Trimmomatic: A Flexible Trimmer for Illumina Sequence Data", BIOINFORMATICS, vol. 30, no. 15, 2014, pages 2114 - 20, XP055862121, DOI: 10.1093/bioinformatics/btu170
BOUDEWIJNS, R., H. J. THIBAUT, S. J. F. KAPTEIN, R. LI, V. VERGOTE, L. SELDESLACHTS , J. VAN WEYENBERGH: "STAT2 Signaling Restricts Viral Dissemination but Drives Severe Pneumonia in SARS-CoV-2 Infected Hamsters", NATURE COMMUNICATIONS, vol. 11, no. 1, 2020, pages 5838
BOURNAZOS, S.D. CORTIH. W. VIRGINJ. V. RAVETCH: "Fc-Optimized Antibodies Elicit CD8 Immunity to Viral Respiratory Infection", NATURE, vol. 588, no. 7838, 2020, pages 485 - 90, XP037317195, DOI: 10.1038/s41586-020-2838-z
BOURNAZOS, S.T. T. WANGJ. V. RAVETCH: "The Role and Function of Fey Receptors on Myeloid Cells", MICROBIOL SPECTR, vol. 4, no. 6, 2016, Retrieved from the Internet <URL:https://doi.org/10.1128/microbiolspec.MCHD-0045-2016>
BOYOGLU-BARNUM, SEYHANDANIEL ELLISREBECCA A. GILLESPIEGEOFFREY B. HUTCHINSONYOUNG-JUN PARKSYED M. MOINOLIVER J. ACTON ET AL.: "Quadrivalent Influenza Nanoparticle Vaccines Induce Broad Protection", NATURE, 2021, Retrieved from the Internet <URL:https://doi.org/10.1038/s41586-021-03365-x>
BRINKMANNKONTERMANN, MABS, vol. 9, no. 2, 2017, pages 182 - 212
BRUHNS ET AL., BLOOD, vol. 113, 2009, pages 3716 - 3725
BURTON, D. R., MOL. IMMUNOL., vol. 22, 1985, pages 161 - 206
CAI, Y.J. ZHANGT. XIAOH. PENGS. M. STERLINGR. M. WALSHS. RAWSONS. RITS-VOLLOCHB. CHEN.: "Distinct Conformational States of SARS-CoV-2 Spike Protein", SCIENCE, vol. 369, no. 6511, 2020, pages 1586 - 957
CAPEL, P. J. ET AL., IMMUNOMETHODS, vol. 113, 1994, pages 269 - 315
CASE, J. B.P. W. ROTHLAUFR. E. CHENZ. LIUH. ZHAOA. S. KIML. M. BLOYET ET AL.: "Neutralizing Antibody and Soluble ACE2 Inhibition of a Replication-Competent VSV-SARS-CoV-2 and a Clinical Isolate of SARS-CoV-2", CELL HOST & MICROBE, vol. 28, no. 3, 2020, pages 475 - 485, XP055865245, DOI: 10.1016/j.chom.2020.06.021
CASIPIT C L ET AL: "IMPROVING THE BINDING AFFINITY OF AN ANTIBODY USING MOLECULAR MODELING AND SITE-DIRECTED MUTAGENESIS", PROTEIN SCIENCE, WILEY, US, vol. 7, 1 August 1998 (1998-08-01), pages 1671 - 1680, XP001007633, ISSN: 0961-8368 *
CHAUDHARY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1066 - 1070
CHEK MENG POH ET AL: "Two linear epitopes on the SARS-CoV-2 spike protein that elicit neutralising antibodies in COVID-19 patients", NATURE COMMUNICATIONS, vol. 11, no. 1, 1 June 2020 (2020-06-01), pages 1 - 7, XP055746936, DOI: 10.1038/s41467-020-16638-2 *
CHEN, S.G. MCMULLANA. R. FARUQIG. N. MURSHUDOVJ. M. SHORTS. H. SCHERESR. HENDERSON: "High-Resolution Noise Substitution to Measure Overfitting and Validate Resolution in 3D Structure Determination by Single Particle Electron Cryomicroscopy", ULTRAMICROSCOPY, vol. 135, 2013, pages 24 - 35
CHI XIANGYANG ET AL: "A neutralizing human antibody binds to the N-terminal domain of the Spike protein of SARS-CoV-2", SCIENCE, vol. 369, no. 6504, 7 August 2020 (2020-08-07), US, pages 650 - 655, XP055850542, ISSN: 0036-8075, DOI: 10.1126/science.abc6952 *
CHOTHIALESK: "J. Mol. Biol.", vol. 196, 1987, pages: 901 - 917
CHU, S. ET AL.: "Accelerated Clearance of IgE In Chimpanzees Is Mediated By Xmab7195, An Fc-Engineered Antibody With Enhanced Affinity For Inhibitory Receptor FcyRIIb", AM J RESPIR CRIT, 2014
CHU, S. Y. ET AL.: "Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies", MOLECULAR IMMUNOLOGY, vol. 45, 2008, pages 3926 - 3933, XP002498116, DOI: 10.1016/j.molimm.2008.06.027
CINGOLANI, PABLOADRIAN PLATTSLE LILY WANGMELISSA COONTUNG NGUYENLUAN WANGSUSAN J. LANDXIANGYI LUDOUGLAS M. RUDEN: "A Program for Annotating and Predicting the Effects of Single Nucleotide Polymorphisms, SnpEff: SNPs in the Genome of Drosophila Melanogaster Strain W1118; Iso-2; Iso-3", FLY, vol. 6, no. 2, 2012, pages 80 - 92
CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
COFFIN, J. M. ET AL.: "Fundamental Virology", 1996, LIPPINCOTT-RAVEN PUBLISHERS, article "Retroviridae: The viruses and their replication"
CORREIA, B. E.J. T. BATESR. J. LOOMISG. BANEYXC. CARRICOJ. G. JARDINEP. RUPERT ET AL.: "Proof of Principle for Epitope-Focused Vaccine Design", NATURE, vol. 507, no. 7491, 2014, pages 201 - 6, XP037115503, DOI: 10.1038/nature12966
CORTI ET AL., PNAS, vol. 122, no. 33, 2015, pages 10473 - 10478
CORTI, D.J. VOSSS. J. GAMBLING. CODONIA. MACAGNOD. JARROSSAYS. G. VACHIERI ET AL.: "A Neutralizing Antibody Selected from Plasma Cells That Binds to Group 1 and Group 2 Influenza A Hemagglutinins", SCIENCE, vol. 333, no. 6044, 2011, pages 850 - 56, XP002689150, DOI: 10.1126/science.1205669
DANECEK, PETRJAMES K. BONFIELDJENNIFER LIDDLEJOHN MARSHALLVALERIU OHANMARTIN O. POLLARDANDREW WHITWHAM ET AL.: "Twelve Years of SAMtools and BCFtools", GIGASCIENCE, vol. 10, no. 2, 2021, Retrieved from the Internet <URL:https://doi.org/10.1093/gigascience/giab008>
DANIEL, CR. ANDERSON, M.J. BUCHMEIERJ. O. FLEMINGW. J. SPAANH. WEGEP. J. TALBOT: "Identification of an Immunodominant Linear Neutralization Domain on the S2 Portion of the Murine Coronavirus Spike Glycoprotein and Evidence That It Forms Part of Complex Tridimensional Structure", JOURNAL OF VIROLOGY, vol. 67, no. 3, 1993, pages 1185 - 94, XP000608292
DE HAAS, M. ET AL., J LAB. CLIN. MED., vol. 126, 1995, pages 330 - 341
DELILLORAVETCH, CELL, vol. 161, no. 5, 2015, pages 1035 - 1045
DI TOMMASOPAOLO, MARIA CHATZOUEVAN W. FLODENPABLO PRIETO BARJAEMILIO PALUMBOCEDRIC NOTREDAME: "Nextflow Enables Reproducible Computational Workflows", NATURE BIOTECHNOLOGY, vol. 35, no. 4, 2017, pages 316 - 19
DILILLO, D. J.G. S. TAN, P. PALESEJ. V. RAVETCH.: "Broadly Neutralizing Hemagglutinin Stalk-Specific Antibodies Require FcyR Interactions for Protection against Influenza Virus in Vivo", NATURE MEDICINE, vol. 20, no. 2, 2014, pages 143 - 51
DUNCAN, A. R.WINTER, G., NATURE, vol. 332, 1988, pages 323 - 327
ELLIOTT ET AL., NPJ VACCINES, vol. 18, 2017
ELSHABRAWY, H. A.M. M. COUGHLINS. C. BAKERB. S. PRABHAKAR: "Human Monoclonal Antibodies against Highly Conserved HR1 and HR2 Domains of the SARS-CoV Spike Protein Are More Broadly Neutralizing", PLOS ONE, vol. 7, no. 11, 2012, pages e50366, XP055695602, DOI: 10.1371/journal.pone.0050366
ENGELS ET AL., HUM. GENE THER., vol. 14, 2003, pages 1155
EWELS, PHILIPMANS MAGNUSSONSVERKER LUNDINMAX KALLER: "MultiQC: Summarize Analysis Results for Multiple Tools and Samples in a Single Report", BIOINFORMATICS, vol. 32, no. 19, 2016, pages 3047 - 300
EYLER ET AL., PNAS, vol. 116, no. 46, 2019, pages 23068 - 23071
FAN, XD. CAOL. KONGX. ZHANG: "Cryo-EM Analysis of the Post-Fusion Structure of the SARS-CoV Spike Glycoprotein", NATURE COMMUNICATIONS, vol. 11, no. 1, 2020, pages 3618
FLINGAI ET AL., SCI REP., vol. 5, 2015, pages 12616
FRECHA ET AL., MOL. THER., vol. 18, 2010, pages 1748
GANESAN, L. P. ET AL.: "FcyRIIb on liver sinusoidal endothelium clears small immune complexes", JOURNAL OF IMMUNOLOGY, vol. 189, 2012, pages 4981 - 4988, XP002724347, DOI: 10.4049/jimmunol.1202017
GERNGROSS, NAT. BIOTECH, vol. 22, 2004, pages 1409 - 1414
GESSNER, J. E. ET AL., ANN. HEMATOL., vol. 76, 1998, pages 231 - 248
GEURTS ET AL., MOL. THER., vol. 8, 2003, pages 108
GRUNING, BJORNRYAN DALEANDREAS SJODINBRAD A. CHAPMANJILLIAN ROWECHRISTOPHER H. TOMKINS-TINCHRENAN VALIERISJOHANNES KOSTERBIOCONDA : "Bioconda: Sustainable and Comprehensive Software Distribution for the Life Sciences", NATURE METHODS, vol. 15, no. 7, 2018, pages 475 - 76, XP036732972, DOI: 10.1038/s41592-018-0046-7
GUI, M.W. SONGH. ZHOUJ. XUS. CHENY. XIANGX. WANG: "Cryo-Electron Microscopy Structures of the SARS-CoV Spike Glycoprotein Reveal a Prerequisite Conformational State for Receptor Binding", CELL RESEARCH, vol. 27, no. 1, 2017, pages 119 - 29
HIROYUKI KOBAYASHI ET AL: "Tryptophan H33 plays an important role in pyrimidine (6–4) pyrimidone photoproduct binding by a high-affinity antibody A variety of techniques have been used to examine the", PROTEIN ENGINEERING, 1 January 1999 (1999-01-01), pages 879 - 884, XP055364172, Retrieved from the Internet <URL:https://academic.oup.com/peds/article-pdf/12/10/879/9908089/120879.pdf> *
HOFFMANN, M.H. KLEINE-WEBERS. POHLMANN, MOLECULAR CELL, vol. 78, no. 4, 2020, pages 779 - 784
HOFFMANN, M.H. KLEINE-WEBERS. SCHROEDERN. KRUGERT. HERRLERS. ERICHSENT. S. SCHIERGENS ET AL.: "SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor", CELL, vol. 181, no. 2, 2020, pages 271 - 280, XP086136225, DOI: 10.1016/j.cell.2020.02.052
HOFFMANN, M.K. MOSBAUERH. HOFMANN-WINKLERA. KAULH. KLEINE-WEBERN. KRUGERN. C. GASSENM. A. MULLERC. DROSTENS. POHLMANN: "Chloroquine Does Not Inhibit Infection of Human Lung Cells with SARS-CoV-2", NATURE, vol. 585, no. 7826, 2020, pages 588 - 90, XP037253990, DOI: 10.1038/s41586-020-2575-3
HONEGGERPLUCKTHUN, J. MOL. BIO., vol. 309, 2001, pages 657 - 670
HUANG ET AL., MABS, vol. 6, 2018, pages 1 - 12
JOEL F. SCHILDBACH ET AL: "Modulation of antibody affinity by a non-contact residue", PROTEIN SCIENCE, vol. 2, no. 2, 1 February 1993 (1993-02-01), pages 206 - 214, XP055103868, ISSN: 0961-8368, DOI: 10.1002/pro.5560020209 *
JOLLY, D J., EMERGING VIRAL VECTORS, 1999, pages 209 - 40
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
KALLEWAARD, N. L.D. CORTIP. J. COLLINSU. NEUJ. M. MCAULIFFEE. BENJAMINL. WACHTER-ROSATI ET AL.: "Structure and Function Analysis of an Antibody Recognizing All Influenza A Subtypes", CELL, vol. 166, no. 3, 2016, pages 596 - 608, XP029667814, DOI: 10.1016/j.cell.2016.05.073
KANAME, Y.H. TANIC. KATAOKAM. SHIOKAWAS. TAGUWAT. ABEK. MORIISHIT. KINOSHITAY. MATSUURA: "Acquisition of Complement Resistance through Incorporation of CD55/Decay-Accelerating Factor into Viral Particles Bearing Baculovirus GP64", JOURNAL OF VIROLOGY, vol. 84, no. 7, 2010, pages 3210 - 19
KANEKIYO, M.C. J. WEIH. M. YASSINEP. M. MCTAMNEYJ. C. BOYINGTONJ. R. WHITTLES. S. RAOW. P. KONGL. WANGG. J. NABEL: "Self-Assembling Influenza Nanoparticle Vaccines Elicit Broadly Neutralizing H1N1 Antibodies", NATURE, vol. 499, no. 7456, 2013, pages 102 - 6, XP002735539, DOI: 10.1038/nature12202
KANEKIYO, M.M. G. JOYCER. A. GILLESPIEJ. R. GALLAGHERS. F. ANDREWSH. M. YASSINEA. K. WHEATLEY ET AL.: "Mosaic Nanoparticle Display of Diverse Influenza Virus Hemagglutinins Elicits Broad B Cell Responses", NATURE IMMUNOLOGY, vol. 20, no. 3, 2019, pages 362 - 72, XP036757672, DOI: 10.1038/s41590-018-0305-x
KIRCHDOERFER, R. N., N. WANGJ. PALLESEND. WRAPPH. L. TURNERC. A. COTTRELLK. S. CORBETTB. S. GRAHAMJ. S. MCLELLANA. B. WARD.: "Stabilized Coronavirus Spikes Are Resistant to Conformational Changes Induced by Receptor Recognition or Proteolysis", SCIENTIFIC REPORTS, vol. 8, no. 1, 2018, pages 15701, XP055734535, DOI: 10.1038/s41598-018-34171-7
KOHLER ET AL., NATURE, vol. 256, no. 495, 1975
KOSE ET AL., SCI. IMMUNOL., vol. 4, 2019, pages eaaw6647
KRISKY ET AL., GENE THER., vol. 5, 1998, pages 1517
LEFRANC ET AL., DEV. COMP. IMMUNOL., vol. 27, 2003, pages 55
LEMPP, FLORIAN A.LEAH SORIAGAMARTIN MONTIEL-RUIZFABIO BENIGNIJULIA NOACKYOUNG-JUN PARKSIRO BIANCHI ET AL.: "Membrane Lectins Enhance SARS-CoV-2 Infection and Influence the Neutralizing Activity of Different Classes of Antibodies", BIORXIV. BIORXIV, 2021, Retrieved from the Internet <URL:https://doi.org/10.1101/2021.04.03.438258>
LEUNG, K. ET AL.: "Early empirical assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom, October to November 2020", MEDRXIV, 2020, pages 20248581
LI ET AL., NAT. BIOTECH., vol. 24, 2006, pages 210 - 215
LI ET AL., WILERY INTERDISCIP REV. NANOMEDNANOBIOTECHNOL., vol. 11, no. 2, 2019, pages e1530
LI, HENG.: "Aligning Sequence Reads, Clone Sequences and Assembly Contigs with BWA-MEM", ARXIV, 2013, Retrieved from the Internet <URL:http://arxiv.org/abs/1303.3997>
LI, JQ.ZHANG, ZR.ZHANG, HQ ET AL.: "Intranasal delivery of replicating mRNA encoding neutralizing antibody against SARS-CoV-2 infection in mice", SIG TRANSDUCT TARGET THER, vol. 6, no. 369, 2021, Retrieved from the Internet <URL:https://doi.org/10.1038/s41392-021-00783-1>
LIU ET AL., MABS, vol. 6, no. 5, 2014, pages 1145 - 1154
MARATEA ET AL., GENE, vol. 40, 1985, pages 39 - 46
MARCANDALLI, J.B. FIALAS. OLSM. PEROTTIW. DE VAN DER SCHUERENJ. SNIJDERE. HODGE ET AL.: "Induction of Potent Neutralizing Antibody Responses by a Designed Protein Nanoparticle Vaccine for Respiratory Syncytial Virus", CELL, vol. 176, no. 6, 2019, pages 1420 - 1431, XP055699521, DOI: 10.1016/j.cell.2019.01.046
MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 - 597
MATES ET AL., NAT. GENET, vol. 41, 2009, pages 753
MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855
MURPHY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 8258 - 8262
MUTHUMANI ET AL., HUM VACCIN IMMUNOTHER, vol. 9, 2013, pages 2253 - 2262
MUTHUMANI ET AL., J INFECT DIS., vol. 214, no. 3, 2016, pages 369 - 378
NANCEMEIER, ACS CENT. SCI., vol. 7, no. 5, 2021, pages 748 - 756
NG KEVIN W. ET AL: "Preexisting and de novo humoral immunity to SARS-CoV-2 in humans", SCIENCE, vol. 370, no. 6522, 6 November 2020 (2020-11-06), US, pages 1339 - 1343, XP055897378, ISSN: 0036-8075, DOI: 10.1126/science.abe1107 *
NGUYEN-CONTANT PHUONG ET AL: "S Protein-Reactive IgG and Memory B Cell Production after Human SARS-CoV-2 Infection Includes Broad Reactivity to the S2 Subunit", MBIO, vol. 11, no. 5, 27 October 2020 (2020-10-27), US, XP055897377, ISSN: 2161-2129, DOI: 10.1128/mBio.01991-20 *
NORTH ET AL., JMOLBIOL., vol. 406, 2011, pages 228 - 56
PALMBERGER ET AL., J. BIOTECHNOL., vol. 153, no. 3-4, 2011, pages 160 - 166
PARDI ET AL., J CONTROL RELEASE, 2015, pages 217345 - 351
PEDERSEN, BRENT S.AARON R. QUINLAN.: "Mosdepth: Quick Coverage Calculation for Genomes and Exomes", BIOINFORMATICS, vol. 34, no. 5, 2018, pages 867 - 68
PICCOLI, LY. J. PARKM. A. TORTORICIN. CZUDNOCHOWSKIA. C. WALLSM. BELTRAMELLOC. SILACCI-FREGNI ET AL.: "Mapping Neutralizing and Immunodominant Sites on the SARS-CoV-2 Spike Receptor-Binding Domain by Structure-Guided High-Resolution Serology", CELL, vol. 183, no. 4, 2020, pages 1024 - 1042, XP086341451, DOI: 10.1016/j.cell.2020.09.037
PINNA, DEBORADAVIDE CORTIDAVID JARROSSAYFEDERICA SALLUSTOANTONIO LANZAVECCHIA: "Clonal Dissection of the Human Memory B-Cell Repertoire Following Infection and Vaccination", EUROPEAN JOURNAL OF IMMUNOLOGY, vol. 39, no. 5, 2009, pages 1260 - 70, XP055250859, DOI: 10.1002/eji.200839129
PINTO DORA ET AL: "CORONAVIRUS Broad betacoronavirus neutralization by a stem helix-specific human antibody", 3 September 2021 (2021-09-03), XP055896554, Retrieved from the Internet <URL:https://www.science.org/doi/epdf/10.1126/science.abj3321> [retrieved on 20220301] *
PINTO ET AL.: "Cross-neutralizaiton of SARS-CoV-2 by a human monoclonal SARS-CoV antibody", NATURE, vol. 583, July 2020 (2020-07-01), pages 290 - 295
PINTO ET AL.: "Cross-neutralizaiton of SARS-CoV-2 by a human monoclonal SARS-CoVantibody", NATURE, vol. 583, July 2020 (2020-07-01), pages 290 - 295
PINTO, D.Y. J. PARKM. BELTRAMELLOA. C. WALLSM. A. TORTORICIS. BIANCHIS. JACONI ET AL.: "Cross-Neutralization of SARS-CoV-2 by a Human Monoclonal SARS-CoV Antibody", NATURE, vol. 583, no. 7815, 2020, pages 290 - 95, XP037289888, DOI: 10.1038/s41586-020-2349-y
PLUCKTHUN, A, BIO/TECHNOLOGY, vol. 9, 1991, pages 545 - 551
POH, C. M.G. CARISSIMOB. WANGS. N. AMRUNC. Y. LEER. S. CHEES. W. FONG ET AL.: "Two Linear Epitopes on the SARS-CoV-2 Spike Protein That Elicit Neutralising Antibodies in COVID-19 Patients.", NATURE COMMUNICATIONS, vol. 11, no. 1, 2020, pages 2806, XP055746936, DOI: 10.1038/s41467-020-16638-2
PRESTA, CURR. OP. STRUCT. BIOL., vol. 2, 1992, pages 593 - 596
PUNJANI, A.J. L. RUBINSTEIND. J. FLEETM. A. BRUBAKER: "CryoSPARC: Algorithms for Rapid Unsupervised Cryo-EM Structure Determination", NATURE METHODS, vol. 14, no. 3, 2017, pages 290 - 96, XP055631965, DOI: 10.1038/nmeth.4169
RAVETCH, J. V.KINET, J. P., ANNU. REV. IMMUNOL., vol. 9, 1991, pages 457 - 492
REED, L. J.H. MUENCH.: "A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS 12.", AMERICAN JOURNAL OF EPIDEMIOLOGY, vol. 27, no. 3, 1938, pages 493 - 97
REN, X. ET AL.: "COVID-19 immune features revealed by a large-scale single cell transcriptome atlas", CELL, 2021
RUDIKOFF S ET AL: "Single amino acid substitution altering antigen-binding specificity", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 79, 1 March 1982 (1982-03-01), pages 1979 - 1983, XP007901436, ISSN: 0027-8424, DOI: 10.1073/PNAS.79.6.1979 *
SABNIS ET AL., MOL. THER., vol. 26, 2018, pages 1509 - 1519
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY
SAUER, MAXIMILIAN M.M. ALEXANDRA TORTORICIYOUNG-JUN PARKALEXANDRA C. WALLSLEAH HOMADOLIVER ACTONJOHN BOWEN ET AL.: "Structural Basis for Broad Coronavirus Neutralization.", BIORXIV : THE PREPRINT SERVER FOR BIOLOGY, 2020, Retrieved from the Internet <URL:https://doi.org/10.1101/2020.12.29.424482>
SCATCHARD ET AL., ANN. N.Y. ACAD. SCI., vol. 51, 1949, pages 660
SCHAFER, A.F. MUECKSCHJ. C. C. LORENZIS. R. LEISTM. CIPOLLAS. BOURNAZOSF. SCHMIDT ET AL.: "Antibody Potency, Effector Function, and Combinations in Protection and Therapy for SARS-CoV-2 Infection in Vivo", THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 218, no. 3, 2021, Retrieved from the Internet <URL:https://doi.org/10.1084/jem.20201993>
SCHOLTEN ET AL., CLIN. IMMUNOL., vol. 119, 2006, pages 135
SESTERHENN, F.C. YANGJ. BONETJ. T. CRAMERX. WENY. WANGC. I. CHIANG ET AL.: "De Novo Protein Design Enables the Precise Induction of RSV-Neutralizing Antibodies", SCIENCE, vol. 368, no. 6492, 2020, Retrieved from the Internet <URL:https://doi.org/10.1126/science.aay5051>
SHIELDS, R. L. ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 6591 - 6604
SONG GE ET AL: "Cross-reactive serum and memory B cell responses to spike protein in SARS-CoV-2 and endemic coronavirus infection", BIORXIV, 23 September 2020 (2020-09-23), XP055897375, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2020.09.22.308965v1.full.pdf> [retrieved on 20220303], DOI: 10.1101/2020.09.22.308965 *
SONG, GEWAN-TING HESEAN CALLAGHANFABIO ANZANELLODELI HUANGJAMES RICKETTSJONATHAN L. TORRES ET AL.: "Cross-Reactive Serum and Memory B Cell Responses to Spike Protein in SARS-CoV-2 and Endemic Coronavirus Infection", BIORXIV, 2020
SPIESS ET AL., MOL. IMMUNOL, vol. 67, no. 2, 2015, pages 95
SUZUKI ET AL., CLIN. CANCER RES, vol. 13, no. 6, 2007, pages 1875 - 82
TEGALLY, H. ET AL.: "Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) lineage with multiple spike mutations in South Africa", MEDRXIV, 2020
TEGALLY, H.: "Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) lineage with multiple spike mutations in South Africa", MEDRXIV, 2020, pages 20248640
TEGUNOV, D.P. CRAMER.: "Real-Time Cryo-Electron Microscopy Data Preprocessing with Warp", NATURE METHODS, vol. 16, no. 11, 2019, pages 1146 - 52, XP036917491, DOI: 10.1038/s41592-019-0580-y
THESS ET AL., MOL THER, vol. 23, 2015, pages 1456 - 1464
THOMSON, E.C. ET AL.: "The circulating SARS-CoV-2 spike variant N439K maintains fitness while evading antibody-mediated immunity", BIORXIV, 2020
THRAN, EMBO MOLMED, vol. 9, no. 10, 2017, pages 1434 - 1448
TORTORICI, M. A.D. VEESLER: "Structural Insights into Coronavirus Entry", ADVANCES IN VIRUS RESEARCH, vol. 105, 2019, pages 93 - 116
TORTORICI, M. A.M. BELTRAMELLOF. A. LEMPPD. PINTOH. V. DANGL. E. ROSENM. MCCALLUM ET AL.: "Ultrapotent Human Antibodies Protect against SARS-CoV-2 Challenge via Multiple Mechanisms", SCIENCE, vol. 370, no. 6519, 2020, pages 950 - 57, XP055794998, DOI: 10.1126/science.abe3354
TORTORICI, M. ALEJANDRANADINE CZUDNOCHOWSKITYLER N. STARRROBERTA MARZIALEXANDRA C. WALLSFABRIZIA ZATTAJOHN E. BOWEN ET AL.: "Structural Basis for Broad Sarbecovirus Neutralization by a Human Monoclonal Antibody", BIORXIV.ORG: THE PREPRINT SERVER FOR BIOLOGY, 2021, Retrieved from the Internet <URL:https://doi.org/10.1101/2021.04.07.438818>
URLAUB ET AL., PNAS, vol. 77, 1980, pages 4216
VAN DE WINKEL, J. G.ANDERSON, C. L., J. LEUKOC. BIOL., vol. 49, 1991, pages 511 - 524
VAN HOECKEROOSE, J. TRANSLATIONAL MED, vol. 17, no. 54, 2019, Retrieved from the Internet <URL:https://doi.org/10.1186/sl2967-019-1804-8>
VERHOEYEN ET AL., METHODS MOL. BIOL., vol. 506, 2009, pages 97
VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536
WALCHLI ET AL., PLOS ONE, vol. 6, 2011, pages 327930
WALLS, A. C.M. A. TORTORICIJ. SNIJDERX. XIONGB. J. BOSCHF. A. REYD. VEESLER: "Tectonic Conformational Changes of a Coronavirus Spike Glycoprotein Promote Membrane Fusion", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 114, no. 42, 2017, pages 11157 - 62, XP055825682, DOI: 10.1073/pnas.1708727114
WALLS, A. C.X. XIONGY. J. PARKM. A. TORTORICIJ. SNIJDERJ. QUISPEE. CAMERONI ET AL.: "Unexpected Receptor Functional Mimicry Elucidates Activation of Coronavirus Fusion", CELL, vol. 176, no. 5, 2019, pages 1026 - 1039, XP055809776, DOI: 10.1016/j.cell.2018.12.028
WALLS, A. C.Y. J. PARKM. A. TORTORICIA. WALLA. T. MCGUIRED. VEESLER: "Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein", CELL, vol. 181, no. 2, 2020, pages 281 - 292, XP086136222, DOI: 10.1016/j.cell.2020.02.058
WALLS, A. CB. FIALAA. SCHAFERS. WRENNM. N. PHAMM. MURPHYL. V. TSE ET AL.: "Elicitation of Potent Neutralizing Antibody Responses by Designed Protein Nanoparticle Vaccines for SARS-CoV-2.", CELL, vol. 183, no. 5, 2020, pages 1367 - 1382, XP086368302, DOI: 10.1016/j.cell.2020.10.043
WALLS, A. CM. A. TORTORICIB. J. BOSCHB. FRENZP. J. M. ROTTIERF. DIMAIOF. A. REYD. VEESLER: "Cryo-Electron Microscopy Structure of a Coronavirus Spike Glycoprotein Trimer", NATURE, vol. 531, no. 7592, 2016, pages 114 - 17, XP037065821, DOI: 10.1038/nature16988
WALLS, ALEXANDRA C.MARCOS C. MIRANDAMINH N. PHAMALEXANDRA SCHAFERALLISON GREANEYPRABHU S. ARUNACHALAMMARY-JANE NAVARRO ET AL.: "Elicitation of Broadly Protective Sarbecovirus Immunity by Receptor-Binding Domain Nanoparticle Vaccines", BIORXIV.ORG: THE PREPRINT SERVER FOR BIOLOGY, 2021, Retrieved from the Internet <URL:https://doi.org/10.1101/2021.03.15.435528>
WANG CHUNYAN ET AL: "Isolation of cross-reactive monoclonal antibodies against divergent human coronaviruses that delineate a conserved and vulnerable site on the spike protein", BIORXIV, 20 October 2020 (2020-10-20), XP055847620, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2020.10.20.346916v1.full.pdf> [retrieved on 20211005], DOI: 10.1101/2020.10.20.346916 *
WANG, CHUNYANRIEN VAN HAPERENJAVIER GUTIERREZ-ALVAREZWENTAO LINISREEN M. A. OKBAIRINA ALBULESCUIVY WIDJAJA ET AL.: "A Conserved Immunogenic and Vulnerable Site on the Coronavirus Spike Protein Delineated by Cross-Reactive Monoclonal Antibodies", NATURE COMMUNICATIONS, vol. 12, no. 1, 2021, pages 1715, XP055813796, DOI: 10.1038/s41467-021-21968-w
WARD, E. S.GHETIE, V., THER. IMMUNOL., vol. 2, 1995, pages 77 - 94
WILM, ANDREASPAULINE POH KIM AWDENIS BERTRANDGRACE HUI TING YEOSWEE HOE ONGCHANG HUA WONGCHIEA CHUEN KHORROSEMARY PETRICMARTIN LLO: "LoFreq: A Sequence-Quality Aware, Ultra-Sensitive Variant Caller for Uncovering Cell-Population Heterogeneity from High-Throughput Sequencing Datasets", NUCLEIC ACIDS RESEARCH, vol. 40, no. 22, 2012, pages 11189 - 201
WILSON, SCIENCE, vol. 295, 2002, pages 2103
WINES, B.D. ET AL., J. IMMUNOL., vol. 164, 2000, pages 5313 - 5318
WINKLER, EMMA S.PAVLO GILCHUKJINSHENG YUADAM L. BAILEYRITA E. CHENSETH J. ZOSTHYESUN JANG ET AL.: "Human Neutralizing Antibodies against SARS-CoV-2 Require Intact Fc Effector Functions and Monocytes for Optimal Therapeutic Protection", BIORXIV, 2020.12.28.424554, 2020
WOLFF ET AL., CANCER RES., vol. 53, 1993, pages 2560
WRAPP, D.N. WANGK. S. CORBETTJ. A. GOLDSMITHC. L. HSIEHO. ABIONAB. S. GRAHAMJ. S. MCLELLAN: "Cryo-EM Structure of the 2019-NCoV Spike in the Prefusion Conformation", SCIENCE, vol. 367, no. 6483, 2020, pages 1260 - 63, XP055829062, DOI: 10.1126/science.abb2507
XIE, XUPINGANTONIO E. MURUATOXIANWEN ZHANGKUMARI G. LOKUGAMAGECAMILA R. FONTES-GARFIASJING ZOUJIANYING LIU ET AL.: "A Nanoluciferase SARS-CoV-2 for Rapid Neutralization Testing and Screening of Anti-Infective Drugs for COVID-19", NATURE COMMUNICATIONS, vol. 11, no. 1, 2020, pages 5214
YAZAKIWU: "Methods in Molecular Biology", vol. 248, 2003, HUMANA PRESS, pages: 255 - 268
YUAN, Y.D. CAOY. ZHANGJ. MAJ. QIQ. WANGG. LU ET AL.: "Cryo-EM Structures of MERS-CoV and SARS-CoV Spike Glycoproteins Reveal the Dynamic Receptor Binding Domains", NATURE COMMUNICATIONS, vol. 8, 2017, pages 15092, XP055840834, DOI: 10.1038/ncomms15092
ZHANG ET AL., FRONT. IMMUNOL.,
ZHANG, H.G. WANGJ. LIY. NIEX. SHIG. LIANW. WANG ET AL.: "Identification of an Antigenic Determinant on the S2 Domain of the Severe Acute Respiratory Syndrome Coronavirus Spike Glycoprotein Capable of Inducing Neutralizing Antibodies", JOURNAL OF VIROLOGY, vol. 78, no. 13, 2004, pages 6938 - 45, XP002393486, DOI: 10.1128/JVI.78.13.6938-6945.2004
ZHAO ET AL., J. IMMUNOL., vol. 174, 2005, pages 4415
ZHENG, Z.V. M. MONTEILS. MAURER-STROHC. W. YEWC. LEONGN. K. MOHD-ISMAILS. CHEYYATRAIVENDRAN ARULARASU ET AL.: "Monoclonal Antibodies for the S2 Subunit of Spike of SARS-CoV-1 Cross-React with the Newly-Emerged SARS-CoV-2", EURO SURVEILLANCE: BULLETIN EUROPEEN SUR LES MALADIES TRANSMISSIBLES = EUROPEAN COMMUNICABLE DISEASE BULLETIN, vol. 25, no. 28, 2020, XP055850940, Retrieved from the Internet <URL:https://doi.org/10.2807/1560-7917.ES.2020.25.28.2000291> DOI: 10.2807/1560-7917.ES.2020.25.28.2000291
ZHOU, P.X. L. YANGX. G. WANGB. HUL. ZHANGW. ZHANGH. R. SI ET AL.: "A Pneumonia Outbreak Associated with a New Coronavirus of Probable Bat Origin.", NATURE,, 2020, Retrieved from the Internet <URL:https://doi.org/10.1038/s41586-020-2012-7>

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022266546A3 (en) * 2021-06-18 2023-01-26 Vanderbilt University Cross-reactive coronavirus antibodies
WO2023154824A1 (en) * 2022-02-10 2023-08-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Human monoclonal antibodies that broadly target coronaviruses
WO2023235827A3 (en) * 2022-06-03 2024-01-04 The Rockefeller University Coronavirus-inhibiting antibodies

Also Published As

Publication number Publication date
JP2023550785A (ja) 2023-12-05
TW202235107A (zh) 2022-09-16
EP4251279A1 (en) 2023-10-04

Similar Documents

Publication Publication Date Title
US11479599B2 (en) Antibodies against SARS-CoV-2 and methods of using the same
AU2021268361A1 (en) Antibodies against SARS-CoV-2
US20240059757A1 (en) Antibodies against sars-cov-2 and methods of using the same
WO2021203053A1 (en) Immunotherapy targeting a conserved region in sars coronaviruses
EP4251279A1 (en) Antibodies that bind to multiple betacoronaviruses
EP4217385A2 (en) Antibodies against sars-cov-2
WO2021247925A1 (en) Structure-guided immunotherapy against sars-cov-2
US20240092876A1 (en) Broadly neutralizing antibodies against influenza neuraminidase
TW202204395A (zh) 抗sars-cov-2之抗體及使用其之方法
WO2023230448A1 (en) Combination immunotherapy for influenza
WO2022204202A1 (en) Antibodies that bind to multiple sarbecoviruses
WO2023028603A2 (en) Engineered compositions
TW202210505A (zh) 抗sars-cov-2之抗體
WO2023230445A2 (en) Broadly neutralizing antibodies against influenza neuraminidase
WO2024006472A1 (en) Antibodies that bind to multiple sarbecoviruses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21827340

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023531541

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021827340

Country of ref document: EP

Effective date: 20230626