WO2022094102A1 - Oligonucléotides immunostimulateurs pour la prévention et le traitement du covid-19 - Google Patents

Oligonucléotides immunostimulateurs pour la prévention et le traitement du covid-19 Download PDF

Info

Publication number
WO2022094102A1
WO2022094102A1 PCT/US2021/057080 US2021057080W WO2022094102A1 WO 2022094102 A1 WO2022094102 A1 WO 2022094102A1 US 2021057080 W US2021057080 W US 2021057080W WO 2022094102 A1 WO2022094102 A1 WO 2022094102A1
Authority
WO
WIPO (PCT)
Prior art keywords
effective amount
cov
sars
antigen
vaccine
Prior art date
Application number
PCT/US2021/057080
Other languages
English (en)
Inventor
David L. HORN
David V. Jobes
Original Assignee
Mid-Atlantic Biotherapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mid-Atlantic Biotherapeutics, Inc. filed Critical Mid-Atlantic Biotherapeutics, Inc.
Publication of WO2022094102A1 publication Critical patent/WO2022094102A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/17—Immunomodulatory nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • Embodiments herein are directed to a SARS-CoV-2 vaccine comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence
  • the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow-release delivery vehicle. Some embodiments further comprise a pharmaceutically acceptable carrier. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS- CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg.
  • the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg. In some embodiments, the at least one SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.
  • RBD receptor binding domain
  • Some embodiments are directed to a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence
  • the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method.
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen is encoded in a plasmid.
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg.
  • the effective amount of the immunostimulatory oligonucleotide is about 1 mg.
  • the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.
  • Some embodiments are directed to a method of vaccination of a subject comprising administering to a subject an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered to the subject by intramuscular, subcutaneous, or intradermal injection at the same site. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered by the oral, intranasal, anal, vaginal, transdermal, or mucosal route. In some embodiments, the subject is a human. In some embodiments, the subject is a human greater than 18 years of age.
  • the subject is a human less than 18 years of age.
  • the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow- release delivery vehicle. In some embodiments, the effective amount is effective for treating, preventing, or ameliorating COVID-19 in the subject. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered contemporaneously or simultaneously. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method.
  • the effective amount of the least one recombinant SARS-CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, at least one SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.
  • FIG.1 depicts a schematic representation of the mechanism of action of IMT504.
  • FIG. 2 shows that IMT504 generates rapid and robust immune responses in other vaccines.
  • FIG 3. depicts structural insights for SARS-CoV-2 vaccine design.
  • FIG. 4 depicts virus neutralizing titers (VNT) with NidoVax Vaccine Constructs.
  • VNT virus neutralizing titers
  • A There were no significant VNTs when rats were immunized with the antigens without adjuvant (60 micrograms (mcg)).
  • B Rats immunized with RBD2, S1+S2 and SI antigens (15 mcg) with IMT504 adjuvant resulted in significant neutralizing antibody responses.
  • RBD219N SARS-CoV
  • S2 did not result in significant neutralizing antibody responses.
  • FIG. 5 depicts comparison of 15 mcg and 60 mcg doses of NidoVax vaccines. There were no significant differences (t-test) in VNTs between the 15 mcg and 60 mcg doses, for RBD2, S1+S2 and SI antigens, when immunized with IMT504 adjuvant. This suggests that a lower dose of 15 mcg is sufficient to induce the necessary neutralizing antibody responses. Log transformed (Log2) virus neutralization titers were expressed on the y-axis, with the vaccine groups on the x-axis.
  • Log transformed (Log2) virus neutralization titers were expressed on the y-axis, with the vaccine groups on the x-axis.
  • Some embodiments herein are directed to a ready-to-use, rapid-response coronavirus vaccine for single dose protection and antigen sparing.
  • Some embodiments make use of IMT504, an immunomodulatory adjuvant.
  • IMT504 engenders rapid immune protection after one dose, allows for antigen (dose) sparing, has an excellent safety profile, rapidly induces a robust antibody response in elder animals, and can be made in a cost-effective manner.
  • the properties exhibited by IMT504 are ideal for vaccines targeting SARS-CoV-2.
  • Some embodiments are directed to safe COVID- 19 vaccine formulations that offer single dose, rapid response protection and significant dose sparing.
  • vaccines are built on an adjuvant system that is an immunomodulatory oligonucleotide (IMT504).
  • IMT504 immunomodulatory oligonucleotide
  • IMT504 also has additional effects on the immune system, including activating CD4+ and CD8+ T cells and natural killer cells.
  • direct protective antibodies are produced within 21 days following a single dose.
  • subjects receiving IMT504-based vaccination have higher antibody titers when compared to subjects receiving unadj uv anted vaccine.
  • IMT504 allows for significant antigen (dose) sparing (reducing cost/dose), while also affording protective antibody levels.
  • IMT504 is relatively easy to produce under GMP conditions using a rapid automatic process that is economically scalable, and large quantities can be produced at a reasonable cost.
  • IMT504 is stable with a shelf-life of at least 24 months.
  • the vaccine targets SARS-CoV-2.
  • the vaccine antigen is the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), or a combination thereof.
  • the vaccine antigen is selected from RBD2, S1+S2 and SI antigens.
  • Some embodiments are directed to methods of preventing COVID-19 via vaccination comprising administering to a subject a recombinant SARS-CoV-2 antigen and IMT504.
  • the combination of recombinant SARS-CoV-2 antigen and IMT504 is administered to the subject once.
  • the combination of recombinant SARS-CoV-2 antigen and IMT504 may be administered two or more times.
  • administering to a subject a recombinant SARS-CoV-2 antigen and IMT504 produces a potent, safe antibody response by combining a recombinant SARS- CoV- 2 antigen with IMT504 adjuvant.
  • IMT504 works by directly acting on B cells to stimulate an antibody response.
  • the methods described herein are antigen (dose) sparing.
  • the methods described herein do not result in toxicity in the subject.
  • the methods described herein rapidly induce robust antibody response in older adults who are at most risk in this pandemic.
  • the combination of SARS-CoV-2 antigen and IMT504 and can be made in a cost-effective manner.
  • antigen dosing is between about 15 mcg and about 300 mcg. In some embodiments, the dose of IMT504 is about 1 mg. In some embodiments, the dose of IMT504 is between about 1 mcg and 1 g. In some embodiments, the dose of IMT504 is between about 1 mcg and about 1 mg. In some embodiments, the dose of IMT504 is between about 1 mg and 1 g. In some embodiments, the dose of IMT504 is between about 1 mg and lOOmg. In some embodiments, the dose of IMT504 is between about 1 mg and 10 mg.
  • the subject is a human. In some embodiments, the subject is a human greater than 18 years of age. In some embodiments, the subject is a human less than 18 years of age.
  • IMT504 safely and effectively stimulates the host immune system.
  • IMT504 (5’-TCATCATTTTGTCATTTTGTCATT-3’(SEQ ID NO.l)) is a modified single-strand piece of DNA (oligonucleotide or oligodeoxynucleotide, ODN) that directly binds to B cells to stimulate the production of potent antibodies.
  • Immunomodulatory ODNs fall into two classes - CpG ODNs and non-CpG PyNTTTTGT ODNs.
  • CpG and PyNTTTTGT ODNs differ in their active sites; CpG ODNs contain at least one active site with an unmethylated CpG in a given sequence, while the PyNTTTTGT ODNs have at least one active site with the sequence (C/T)(A/T/C/G)TTTTGT15. Both kinds of ODNs can act on B cells and plasmacytoid dendritic cells, but differ in effects.
  • PyNTTTTGT ODNs do not induce interferon (IFN) a secretion but do induce IFNy and granulocyte macrophage-colony stimulating factor (GM-CSF) secretion in the presence of interleukin (IL) 2, and have the ability to stimulate mesenchymal stem cell (MSC) precursor expansion.
  • IFN interferon
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • IMT504 is a PyNTTTTGT ODN with a novel mechanism of action (See FIG. 1). IMT504 has been shown to directly activate B cells to increase cytokine production and antibody production, maturation, and diversity, as well as increase B cells’ antigen-presenting abilities. IMT504 has additional effects on the immune system, including activating CD4+ and CD8+ T cells and natural killer (NK) cells. IMT504 also activates activation-induced cytidine deaminase (AID). Additionally, IMT504 is not a Toll-like Receptor (TLR) agonist, but, instead, works through an entirely different receptor system that bypasses the toxic issues often seen with TLR agonists.
  • TLR Toll-like Receptor
  • IMT504 has been studied in other indications, especially rabies and Pseudomonas aeruginosa infection, and has been studied in 11 different species, including humans. In every case, IMT504 has been well-tolerated and effective and there has never been any indication of cytokine storm. Importantly, IMT504 has been administered in compassionate usage cases for a few advanced human cancer patients (melanoma, ovarian cancer, lymphoma). No serious adverse events (SAEs) occurred, even with the administration of very large amounts of IMT504 (e.g., one patient’s total IMT504 exposure exceeded 700 mg) for durations ranging from months to years.
  • SAEs serious adverse events
  • IMT504 was also successfully used in human volunteers as a vaccine adjuvant with a rabies vaccine, again showing an excellent safety profile and robust immune response.
  • IMT504 has been well-tolerated, even at very high doses, much greater than that proposed for treating infectious diseases.
  • vaccine formulations may consist of different concentrations of IMT504 and different dilutions of the recombinant proteins to optimize the response, compared to non-adjuvanted vaccine.
  • an optimized vaccine will mean one that is highly immunogenic and elicits antibodies that will neutralize virus in vitro, as well as provide protection against live SARS- CoV-2 challenge.
  • the combination of a SARS-CoV-2 vaccine and IMT504 results in an augmented immune response to the SARS-CoV-2 vaccine compared with a SARS-CoV-2 vaccine alone and produces high levels of SARS-CoV-2 neutralizing antibodies compares with a SARS-CoV-2 vaccine alone.
  • the term “allergy” refers to acquired hypersensitivity to a substance
  • allergies include eczema, allergic rhinitis, asthma, and urticaria.
  • immune system deficiency refers to a disease in which the immune system is not functioning in normal capacity.
  • oligonucleotide or “oligo” shall mean multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)).
  • a substituted pyrimidine e.g., cytosine (C), thymine (T) or uracil (U)
  • a substituted purine e.g., adenine (A) or guanine (G)
  • oligonucleotide refers to both oligoribonucleotides (ORNs) and oligodeoxyribonucleotides (ODNs).
  • ODNs oligodeoxyribonucleotides
  • oligonucleotide shall also include oligonucleosides (i.e., an oligonucleotide minus the phosphate) and any other organic base containing polymer.
  • Oligonucleotides can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by oligonucleotide chemical synthesis). Oligonucleotides can also be obtained from a plasmid or via recombinant technology.
  • the term “oligonucleotide” may also refer to multiple nucleotides linked by phosphodiester or phosphorothioate bonds.
  • the term “immunostimulatory oligonucleotide” refers to an oligonucleotide which stimulates, (i.e., has a mitogenic effect on, or induces or increases cytokine expression by) a cell of the immune system (i.e., a lymphocyte, a macrophage).
  • CpG refers to an unmethylated cytosine-guanine dinucleotide.
  • CpG oligonucleotide refers to an oligonucleotide which stimulates a cell of the immune system and its immunostimulatory activity critically depends on the presence of at least one CpG in its sequence.
  • non-CpG oligonucleotide refers to an oligonucleotide which stimulates a cell of the immune system and its immunostimulatory activity does not critically depend on the presence of a CpG in its sequence.
  • the term “subject” refers to an animal of the order Primate, including humans.
  • treating refers to a process by which the symptoms of a disease, and more particularly infectious diseases such as COVID-19 are ameliorated or completely eliminated.
  • the term “preventing” refers to a process by which a disease, and more particularly infectious diseases such as COVID-19 are obstructed or delayed.
  • lymphocytes have an important characteristic, which is their ability to specifically recognize antigens, a feature not possessed by any other cell. This means that any lymphocyte function stimulated by an antigen is directed solely at that antigen.
  • Lymphocytes may be divided into two maj or populations: T and B.
  • T-lymphocytes have a central role in regulating the immune response and for this they produce and secrete lymphokines (i.e., interleukins).
  • B-lymphocytes are the only cells that produce antibodies, which are proteins — Immunoglobulins (IgG) — that recognize and bind antigens.
  • IgG Immunoglobulins
  • T-lymphocytes are known as helper (Th-lymphocytes) because they assist B cells to produce antibody. T-lymphocytes express a characteristic membrane molecule designated CD4. Other T-lymphocytes are known as cytotoxic (CTL) because they are capable of killing certain cells. They express a different characteristic membrane protein designated CD8.
  • CTL cytotoxic
  • Th-lymphocytes in mice, have been subdivided according to the lymphokines they produce in groups designated ThO, Thl and Th2.
  • Th 1 -lymphocytes produce lymphokines which stimulate macrophages and CTLS (IL2, IFNy, TNF-J3)
  • Th2-lymphocytes produce lymphokines which stimulate B-lymphocytes to proliferate and produce antibody (IL 2, IL5, IL6, IL10, IL13)
  • ThO-lymphocytes produce a mixture of lymphokines and are thought to be an intermediate stage from which Thl- and Th2-lymphocytes are derived.
  • Thl- and Th2-like lymphocytes have been demonstrated, although they do seem to show a less strict division with respect to their patterns of cytokine secretion.
  • a third population of lymphocytes which lack the major makers of T and B cells include the natural killer cells (NK cells), the killer cells (K cells) and the lymphokine-activated killer cells (L A K cells).
  • NK cells can kill certain tumor cells and some virally infected cells, but unlike cytotoxic T-lymphocytes they are not capable of recognizing a specific antigen.
  • K cells are able to bind to cells, which have antibody to them via their antigen-binding regions and kill them.
  • L A K cells do not specifically recognize an antigen but they are capable of destroying a wider range of targets than NK cells.
  • Macrophages and dendritic cells play a critical role in initiating immune responses, helping T cells to respond to antigens.
  • the IgG class comprises most of the circulating antibodies and it has four subclasses designated IgGl, IgG2, IgG3 and IgG4.
  • the IgM class comprises about 10% of the circulating antibodies. These are the principal antibodies produce during the primary immunological response.
  • the IgA class comprises most of the antibody secreted at mucous membranes and exerts its protective effect by blocking access of the antigen to the inner body.
  • the IgD class comprises less than 1% of serum antibodies and its biological role is largely unknown.
  • the IgE class comprises antibodies that are mainly bound to the surface of most cells and basophils. These antibodies are associated with reactions that occur in individuals who are undergoing allergic reactions.
  • Vaccines are preparations used to stimulate animals to mount an immune response against antigens included in the vaccine.
  • the vaccines described herein include adjuvants, which are substances that used in combination with specific antigen produce more immunity than the antigen used alone.
  • poly (I, C) is an inducer of interferon (IFN) production, macrophage activation and NK cell activation (Talmadge, J. E., Adams, J., Phillips, H., Collins, M., Lenz, B., Schneider, M., Schlick, E., Ruffmann, R., Wiltrout, R. H., Chirigos, M. A. 1985.
  • IFN interferon
  • NK cell activation Talmadge, J. E., Adams, J., Phillips, H., Collins, M., Lenz, B., Schneider, M., Schlick, E., Ruffmann, R., Wiltrout, R. H., Chirigos, M. A. 1985.
  • poly (dG, dC) is mitogenic for B cells (Messina, J. P., Gilkerson, G. S., Pisetsky, D. S. 1993. The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens. Cell. Immunol. 147:148) and induces IFN and NK activity (Tocunaga, T., Yamamoto, S., Namba, K.1988. A synthetic single-stranded DNA, poly(dG,dC), induces interferon-a/p and - y, augments natural killer activity, and suppresses tumor growth. Jpn.J. Cancer Res. 79:682).
  • Bacterial DNA has also been reported to have immunostimulatory properties. These properties include the induction of cytokines (interferon gamma (IFN y), alpha (IFN a), beta (IFN ); tumor necrosis factor alpha (TNF a), interleukin 6 (IL6), 12 (IL 12) and 18 (IL 18), as well as the direct stimulation of B cells (Yamamoto, S. et al. 1988. In vitro augmentation of natural killer cell activity of interferon a/p and y with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. (Gann) 79: 866-873; Yamamoto S. et al, 1992.
  • IFN y interferon gamma
  • IFN a alpha
  • beta IFN
  • TNF a tumor necrosis factor alpha
  • IL6 interleukin 6
  • IL 12 interleukin 12
  • IL 18 interleuk
  • CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12 and interferon y. Proc. Natl. Acad. Sci. USA 93, 2879-2883. Halpern, M. D., et al. 1996. Bacterial DNA induces murine interferon-y production by stimulation of interleukin- 12 and tumor necrosis factor-a. Cell. Immunol. 167: 72-78. Sparwasser, T. et al, 1997. Macrophages sense pathogens via DNA motifs: induction of tumor necrosis factor-a-mediated shock. Eur. J. Immunol. 27: 1671-1679; Krieg, A. M. et al., 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374: 345-349.
  • This particular non-CpG oligonucleotide containing phosphorothioate bonds is a poly-T chain, 20 nucleotides long.
  • Vollmer et al Vollmer J, Janosch A, Laucht M, Ballas Z K, Schetter C, Krieg A M. Highly immunostimulatory CpG-free oligodeoxynucleotides for activation of human leukocytes.
  • Antisense Nucleic Acid Drug Dev. 12: 165-175, 2002 reported immunostimulation by phosphorothioate poly T ODNs. These authors pointed out that poly T ODNs are only active as phosphorothioate ODNs and have much lower activity than CpG ODNs.
  • Xi is C,T,G or A (preferably T or C);
  • X2 is C,T,G or A;
  • X7 is C,T,G or A (preferably G);
  • at least three, and preferably all, of X3, X4, X5, Xe and Xs are T; with the proviso that, in the motif, a C does not precede a G, have potent immunostimulatory activity. Therefore, these oligonucleotides can be administered to subjects to treat “immune system deficiencies” or in conjunction with a vaccine, as adjuvants, to boost the immune system in order to have a better response to the vaccine or administered to subjects to increase the responsiveness to tumors.
  • Xi, X2 and X7 are C,T,G or A; at least three of X3, X4, X5, Xe and Xs are T; with the proviso that, in the motif, a C does not precede a G, are useful as immunostimulants in animals of the order Primate, including humans.
  • Xi consist of a C or a T and X7 consist of a G. More preferably X3,X4,X5,Xe X7 Xs of the immunostimulatory motif consist of TTTTGT. Even more advantageously X1X2X3X4X5X6X7X8 consist of CNTTTTGT or TNTTTTGT wherein N is C, T, G or A.
  • Those of X3-X6 and Xs that are not T can be any nucleotide (e.g., C, T, G, A) or can be absent so that the nucleotide preceding links directly with the nucleotide following the position of the omitted nucleotide (S).
  • the oligonucleotides of this invention are useful as adjuvants in a vaccine formulation comprising one or more antigens.
  • the vaccine formulation can be liquid or lyophilized in dosage form. Many dosage forms are known in the art and can be applied herein.
  • the oligonucleotides of this invention are present in the composition at a dose of from about 10 to 10,000 pg per dose. In these preparations, the oligonucleotides of this invention may be combined with other immunostimulant compounds.
  • immunostimulants examples include: a-interferon, [3-interferon, y-interferon, granulocyte macrophage colony stimulator factor (GM-CSF), interleukin 2 (IL2), interleukin 12 (IL 12) and CpG oligonucleotide.
  • GM-CSF granulocyte macrophage colony stimulator factor
  • IL2 interleukin 2
  • IL 12 interleukin 12
  • CpG oligonucleotide CpG oligonucleotide.
  • the nucleic acids and oligonucleotides described herein can be synthesized by a variety of synthetic chemistry methodologies that involve the chemical synthesis of relatively short fragments of nucleic acids with defined chemical structures.
  • Common techniques include solid-phase synthesis using phosphoamidite and phosphorami dite building blocks derived from protected 2'-deoxynucleosides (dA, dC, dG, and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides.
  • Other methods may include, but are not limited to, H- phosphonate and phosphate triester methods of oligonucleotide synthesis, phosphodiester synthesis, phosphotriester synthesis, phosphite tri ester synthesis or phosphorothioate synthesis.
  • the synthetic chemistry methods described herein may optionally include post-synthetic processing methodologies.
  • the antigenic component of the vaccine is one or more, natural or recombinant, antigens of the SARS-CoV-2 virus.
  • Embodiments herein are directed to a SARS-CoV-2 vaccine comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and effective amount of an immunostimulatory oligonucleotide having about 15 to about 100 nucleotides.
  • Embodiments herein are directed to a SARS-CoV-2 vaccine comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence
  • the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow-release delivery vehicle. Some embodiments further comprise a pharmaceutically acceptable carrier. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method. In some embodiments, the effective amount of the at least one recombinant SARS- CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg.
  • the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg.
  • the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.
  • An “effective amount” of a compound is a predetermined amount calculated to achieve the desired effect (e.g., prevent COVID-19).
  • Some embodiments are directed to a pharmaceutical composition comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having about 15 to about 100 nucleotides. Some embodiments are directed to a pharmaceutical composition comprising an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence
  • the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method.
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen is encoded in a plasmid.
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg.
  • the effective amount of the immunostimulatory oligonucleotide is about 1 mg.
  • the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg.
  • the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.
  • Some embodiments are directed to a method of vaccination of a subject comprising administering to a subject an effective amount of at least one recombinant SARS-CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having about 15 to about 100 nucleotides.
  • Some embodiments are directed to a method of vaccination of a subject comprising administering to a subject an effective amount of at least one recombinant SARS- CoV-2 antigen and an effective amount of an immunostimulatory oligonucleotide having 24 to 100 nucleotides, comprising the nucleotide sequence
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered to the subject by intramuscular, subcutaneous, or intradermal injection at the same site. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered by the oral, intranasal, anal, vaginal, transdermal, or mucosal route. In some embodiments, the subject is a human. In some embodiments, the subject is a human greater than 18 years of age.
  • the subject is a human less than 18 years of age.
  • the effective amount of the immunostimulatory oligonucleotide is encapsulated in a slow- release delivery vehicle. In some embodiments, the effective amount is effective for treating, preventing or ameliorating COVID- 19 in the subject. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen and the effective amount of the immunomodulatory oligonucleotide are administered contemporaneously or simultaneously. In some embodiments, the subject is vaccinated prophylactically or therapeutically. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is produced via a suitable synthetic chemistry method.
  • the effective amount of the at least one recombinant SARS-CoV-2 antigen is encoded in a plasmid. In some embodiments, the effective amount of the at least one recombinant SARS-CoV-2 antigen is about 15 mcg to about 300 mcg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is about 1 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mcg and about 1 mg.
  • the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 1 g. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 100 mg. In some embodiments, the effective amount of the immunostimulatory oligonucleotide is between about 1 mg and 10 mg. In some embodiments, the at least one recombinant SARS-CoV-2 antigen is selected from the full S protein, spike protein SI, spike protein S2, receptor binding domain (RBD), and a combination thereof.
  • one or more of the oligonucleotides of this invention and the antigen are administered simultaneously locally (by oral, rectal, intranasal, or transdermal route) or by intradermic, subcutaneous, or intramuscular injection.
  • An aspect of this invention is a method of vaccination of a person. The person can be vaccinated prophylactically or therapeutically.
  • a prophylactic vaccine is designed to elicit protection from a disease caused by an infectious agent through the induction of specific immunity.
  • a therapeutic vaccine is designed to induce remission of an illness (i.e., a tumor and metastasis or illness associated with, an infectious agent like the human immunodeficiency virus).
  • the method of vaccination includes administering one or more of the oligonucleotides of this invention and one or more antigens — that is, the vaccine can be designed against one disease target or a combination of disease targets.
  • one or more of the oligonucleotide of this invention is/are present in a pharmaceutical formulation that can be liquid or lyophilized in dosage form. Many dosage forms are known in the art and can be applied herein. In embodiments of this aspect one or more of the oligonucleotides of this invention is/are present in the composition at a dose of from about 10 to 10,000 pg per dose. In these preparations, one or more of the oligonucleotides of this invention may be combined with other immunostimulant compounds.
  • oligonucleotides of this invention may be combined with an anti-infective or anticancer drug, or a surgical procedure. In all these cases, the oligonucleotides of this invention may be administered before, after, or simultaneously with the alternative treatment.
  • the immunostimulatory oligonucleotides of the invention are advantageously modified into stabilized oligonucleotides.
  • Such stabilized immunostimulatory oligonucleotide may be particularly useful to obtain a prolonged immunostimulation.
  • a “stabilized oligonucleotide” refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via an exo- or endonuclease).
  • stabilized oligonucleotides of the present invention comprise a phosphate backbone modification.
  • the phosphate backbone modification is a 5' inter-nucleotide linkage modification, for instance, at the first two nucleotides of the 5' end of the oligonucleotide of the invention.
  • the phosphate backbone modification may be a 3' inter-nucleotide linkage modification. In such a case, the modification may occur, for instance, at the last two nucleotides of the 3' end of the oligonucleotide of the invention.
  • the immunostimulatory oligonucleotide of the invention may be stably modified so as to comprise a phosphorothioate-linked nucleotide (i.e., at least one of the phosphate oxygens is replaced by sulfur). In some embodiments, most if not all the nucleotides of the immunostimulatory oligonucleotides of the invention comprise a phosphorothioate- linked nucleotide.
  • oligonucleotides may alternatively include: nonionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated.
  • nonionic DNA analogs such as alkyl- and aryl-phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group)
  • phosphodiester and alkylphosphotriesters in which the charged oxygen moiety is alkylated.
  • Oligonucleotides which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
  • the present invention provides methods to augment the immune response of animals of the order Primate, including humans, adding to vaccines one or more of the oligonucleotides of this invention or performing a treatment based in the administration of one or more of the oligonucleotides of this invention to a person with COVID- 19 or at risk of contracting COVID- 19 due to exposure to the SARS-CoV-2 virus with one or more of the oligonucleotides of this invention “ex vivo”, and readministering these activated white blood cells to the same person.
  • Vaccine compositions useful containing one or more of the oligonucleotides of this invention can present antigens directly (i.e., in the form of a defined protein or polysaccharide) or as a part of a complex biological entity (i.e., complete viruses; complete bacterial cells; bacterial membranes or artificial conjugates like polysaccharide-protein conjugates). These antigens can be combined in multiple vaccines.
  • a vaccine composition including at least one antigen is formulated to include one or more of the oligonucleotides of this invention.
  • One or more of the oligonucleotides of this invention may be formulated alone or together with one or more antigens in a pharmaceutical composition, which may also include carriers, thickeners, diluents, buffers, preservatives, surface active agents, anti-microbial agents, anti-inflammatory agents, anesthetics and the like.
  • the formulation can be liquid or lyophilized.
  • the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be done topically, orally, by inhalation or parenterally.
  • Formulation for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, tablets and the like. Thickeners, flavorings, diluents, emulsifiers and the like may be necessary or desirable.
  • Formulations for parenteral administration include sterile aqueous solutions, which may also contain buffers, diluents and other additives.
  • a vaccine containing one or more antigens and one or more of the oligonucleotides of this invention can be formulated and used for prophylactic or therapeutic purposes.
  • a further refinement of a vaccine formulation is to incorporate one or more of the oligonucleotides of this invention as adjuvant/s and the antigen/s into a delivery vehicle to provide for delayed release of the active compounds of the vaccine over time.
  • This can be accomplished by various means known in the art. Examples of these means are encapsulation into Poly (lactide-coglycolide) micro particles (Kersten, G. F. A. and Gander, B. 1996. Biodegradable Micro Spheres as vehicles for antigens, in: S. H. E. Kaufmann, ed. Concepts in Vaccine Development. Walter de Gruyter. Berlin-N.Y.), liposomes (Gregoriadis, G. et al. 2000.
  • Liposomes as Immunological Adjuvants and Vaccine Carriers in: S. H. E. Kaufmann, ed. Concepts in Vaccine Development. Walter de Gruyter. Berlin-N.Y.) and poly (methyl methacrylate) nanoparticles (Kreuter, J. 2000. Poly (Methyl Methacrylate) nanoparticles as vaccine adjuvants, in: S. H. E. Kaufmann, ed. Concepts in Vaccine Development. Walter de Gruyter. Berlin-N.Y.).
  • Another refinement of the vaccine formulation is to conjugate the antigen/s and one or more of the oligonucleotides of this invention, by chemical means (Mier W, Eritja R, Mohammed A, Haberkom U, Eisenhut M. 2000. Preparation and evaluation of tumor-targeting peptide-oligonucleotide conjugates. Bioconjug. Chem. 11:855).
  • the pharmaceutical composition for these treatments may include one or more of the oligonucleotides of this invention together with carriers, thickeners, diluents, buffers, preservatives, surface active agents, anti-microbial agents, anti-inflammatory agents, anesthetics and the like.
  • the formulation can be liquid or lyophilized.
  • the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be done topically, orally, by inhalation or parenterally.
  • Formulation for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, tablets and the like. Thickeners, flavorings, diluents, emulsifiers and the like may be necessary or desirable.
  • Formulations for parenteral administration include sterile aqueous solutions, which may also contain buffers, diluents and other additives.
  • one or more of the oligonucleotides of this invention can be contacted with immunocompetent cells (i.e., B cells or plasmacy toid dendritic cells) obtained from a subj ect having a tumoral disease or an immune system deficiency “ex vzvo” and activated cells can then be reintroduced in the subject.
  • immunocompetent cells i.e., B cells or plasmacy toid dendritic cells
  • IMT504 pharmacokinetic studies were carried out in male and female Sprague Dawley rats by intraperitoneal (i.p.) and subcutaneous (s.c.) administration routes; IMT504 showed good bioavailability by both routes.
  • a mixture of IMT504 and 32 P -labeled IMT504 (tracer) yielded a specific activity of 7 pCi/mg.
  • a total of 2 mg IMT504 was administered per animal (roughly 15 mg/kg). The maximum plasma concentration (Cmax) was reached 60 minutes after s.c. IMT504 injection.
  • IMT504 primarily was associated with liver, spleen, thymus, intestine, kidney, and heart. IMT504 passage across the blood-brain border was negligible. IMT504 is primarily excreted in urine.
  • IMT504 dosing route and regimen was determined based on intended clinical use.
  • Single-dose toxicity studies were performed either by s.c. or intravenous (i.v.) route in male and female Sprague Dawley rats and by i.v. route in C. apella monkeys.
  • 50 mg/kg was tentatively defined as the “maximum tolerated dose” for s.c. administration in rats.
  • Rat and monkey studies indicate 3.5 mg/kg as the NOAEL dose for i.v. administration.
  • Table 1 Monkey multiple i.v. doses (3.5 mg/kg/day). Combined data from animals in control (3 males and 3 females) or treated (3 males and 3 females) groups.
  • ALP alkaline phosphatase. GT, glutamyl transferase; IG, immunoglobulin; KPTT, kaolin partial thromboplastin time; N/D, not determined; RBC, red blood cell; SGOT, serum glutamic oxaloacetic transaminase; SGPT, serum glutamic-pyruvic transaminase; TP, prothrombin time. *p ⁇ 0.05.
  • IMT504 was also assessed for genotoxic potential by three different assays: the Ames test, chromosomal aberrations assay, and the sister chromatid exchange assay. IMT504 is not mutagenic under any condition tested. Another study indicated that IMT504 does not alter embryonic development in rats, when administered s.c. in a 20 mg/kg single dose.
  • NOAEL dose 10 mg/kg/day is the NOAEL dose of IMT504. This dose is hundreds of times higher than IMT504 doses used in efficacy studies (e.g., 1-25 pg used in influenza studies below). The high NOAEL dose suggests a dose range that will allow for safe IMT504 usage in humans.
  • IMT504 human safety
  • IMT504 has been administered to human subjects outside the US.
  • IMT504 was administered as a vaccine adjuvant for rabies virus vaccine to healthy male Caucasian volunteers (ages 39-51) immunized with three doses of 1 mg/dose IMT504 injected at days 0, 30, and 60. Positive immune response was observed without any SAEs, including no indications of a cytokine storm.
  • IMT504 has also been administered in an expanded access use setting for treating aggressive, terminal cancers in a select group of patients (unpublished data). Again, no SAEs occurred, even with the administration of very large amounts of IMT504 (e.g., one patient’s total exposure to IMT504 exceeded 700 mg).
  • IMT504 In the small number of human patients studied, IMT504 has been well-tolerated, even at very high doses, much greater than that proposed for use as a vaccine adjuvant. These data strongly support the safety profile of IMT504 that was demonstrated in the various preclinical safety studies.
  • a combination ofIMT504 with either recombinantly-expressed spike SI protein, the spike S2 protein, or the receptor binding domain (RBD) were tested to determine immunogenicity, in vitro virus neutralization at different timepoints.
  • RBD receptor binding domain
  • Vaccine and Adjuvant Production, Manufacturing, and Regulatory Affairs A variety of cell-based production systems can be used for vaccine production. Our strategy is to express full-length S protein and separately, the spike protein SI, spike protein S2, and receptor binding domain (RBD).
  • IMT504 is a short single-stranded synthetic 24-mer DNA segment with a well- defined stable, simple formulation. As such, it is relatively easy to produce under GMP conditions using a rapid automatic process. This process is economically scalable, and large quantities can be produced at a reasonable cost.
  • Vaccine formulations will consist of different concentrations of IMT504 and different dilutions of the recombinant proteins to optimize the response, compared to non- adjuvanted vaccine. An optimized vaccine will mean one that is highly immunogenic and elicits antibodies that will neutralize virus in vitro, as well as provide protection against live SARS-CoV-2 challenge. Immunogenicity studies and live challenge work will be done in Sprague-Dawley rats.
  • Participants will receive an intramuscular injection of our vaccine formulations determined in prior studies (described above) and will be followed for 12 months.
  • Primary outcomes measures include percentage of participants with adverse events, percentage of participants with injection site reactions, percentage of participants with adverse events of special interest, change from baseline in antigen-specific binding antibody titers, and change from baseline in antigen-specific IFNy cellular immune responses.
  • the secondary outcome measure will be demonstration of serum neutralization.
  • Example 4 Comparison of recombinant SARS-CoV-2 antigen in combination with IMT504 with other SARS-CoV-2 vaccines
  • Table 4 shows a comparison of the recombinant SARS-CoV-2 antigen in combination with IMT504 with other SARS-CoV-2 vaccines.
  • Recombinant SARS-CoV-2 antigen in combination with IMT504 achieved peak neutralizing titers significantly higher than other SARS-CoV-2 vaccines in animal models. Neutralizing titers are a surrogate marker for vaccine efficacy. Studies have shown that higher titers lead to a more sustained and durable immune response.
  • Example 5 Peak animal neutralizing titers for SARS-CoV-2 antigen in combination with
  • Table 5 displays peak animal neutralizing titers for SARS-CoV-2 antigen in combination with IMT504 in various SARS-CoV-2 variants

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Des modes de réalisation de la présente invention concernent des vaccins contre le SARS-CoV-2 et des compositions pharmaceutiques comprenant une quantité efficace d'au moins un antigène recombiné du SARS-CoV-2 et une quantité efficace d'un oligonucléotide immunostimulateur ayant 24 à 100 nucléotides, comprenant la séquence nucléotidique TCATCATTTTGTCATTTTGTCATT (SEQ ID NO.1) et leur utilisation dans le traitement et la prévention de l'infection par la maladie COVID-19.
PCT/US2021/057080 2020-10-30 2021-10-28 Oligonucléotides immunostimulateurs pour la prévention et le traitement du covid-19 WO2022094102A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063107641P 2020-10-30 2020-10-30
US63/107,641 2020-10-30

Publications (1)

Publication Number Publication Date
WO2022094102A1 true WO2022094102A1 (fr) 2022-05-05

Family

ID=81384294

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/057080 WO2022094102A1 (fr) 2020-10-30 2021-10-28 Oligonucléotides immunostimulateurs pour la prévention et le traitement du covid-19

Country Status (1)

Country Link
WO (1) WO2022094102A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120219571A1 (en) * 2007-08-13 2012-08-30 Coley Pharmaceutical Gmbh Combination motif immune stimulatory oligonucleotides with improved activity
US20130243811A1 (en) * 2002-05-30 2013-09-19 Ricardo Agustin Lopez Immunostimulatory oligonucleotides and uses thereof
US20200325182A1 (en) * 2020-06-11 2020-10-15 MBF Therapeutics, Inc. Alphaherpesvirus glycoprotein d-encoding nucleic acid constructs and methods

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130243811A1 (en) * 2002-05-30 2013-09-19 Ricardo Agustin Lopez Immunostimulatory oligonucleotides and uses thereof
US20120219571A1 (en) * 2007-08-13 2012-08-30 Coley Pharmaceutical Gmbh Combination motif immune stimulatory oligonucleotides with improved activity
US20200325182A1 (en) * 2020-06-11 2020-10-15 MBF Therapeutics, Inc. Alphaherpesvirus glycoprotein d-encoding nucleic acid constructs and methods

Similar Documents

Publication Publication Date Title
US7943316B2 (en) Immunostimulatory oligonucleotides and uses thereof
KR101107818B1 (ko) 향상된 면역자극 효능을 가진 ｃ-부류 올리고뉴클레오티드유사체
JP6434204B2 (ja) オリゴヌクレオチドの処方に関する組成物および方法
ES2268736T3 (es) Moleculas de acido nucleico inmunoestimulantes.
JP5016733B2 (ja) 免疫賦活性オリゴヌクレオチド
JP2006512927A (ja) ５’ｃｐｇ核酸およびその使用方法
JP2008000001A (ja) 免疫刺激オリゴヌクレオチドおよびその医薬用途
JP2001503254A (ja) 免疫刺激ポリヌクレオチド／免疫調節分子複合体
CA2412026A1 (fr) Molecules hybrides arn/adn immunostimulatrices
JP2008516634A (ja) セミソフトｃクラス免疫刺激性オリゴヌクレオチド
JP2007506790A (ja) 核酸親油性接合体
JP5755827B2 (ja) 強化された免疫刺激活性を有するリン酸が修飾されたオリゴヌクレオチド類似体
WO2006053861A1 (fr) Oligonucléotides qui induisent la sécrétion de gm-csf
WO2022094102A1 (fr) Oligonucléotides immunostimulateurs pour la prévention et le traitement du covid-19
CA2487904A1 (fr) Oligonucleotides immunostimulateurs et leur utilisation
US20110111016A1 (en) Non-dna base-containing polynucleotide compositions and their use for the modulation of immune responses
MXPA06004891A (en) C-class oligonucleotide analogs with enhanced immunostimulatory potency

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21887530

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21887530

Country of ref document: EP

Kind code of ref document: A1