WO2022093051A1

WO2022093051A1 - Method and kit for detecting nematodes, tapeworms and flukes using the multiplex pcr technique, and oligonucleotides

Info

Publication number: WO2022093051A1
Application number: PCT/PL2020/050036
Authority: WO
Inventors: Zdzisław LASKOWSKI
Original assignee: Biomibo Boguś Mieczysława
Priority date: 2020-05-09
Filing date: 2020-05-09
Publication date: 2022-05-05
Also published as: EP4010499A1

Abstract

The present invention provides a method for detecting in the biological material nematodes, tapeworms, and flukes, selected from the group including Toxocara cati, Toxocara canis, Taenia solium, Taenia saginata, Echinococcus multilocularis, Ascaris lumbhcoides, Trichuris thchiura, Enterobius vermicularis, Dipylidium caninum, Taenia taeniaeformis, Fasciola hepatica, Ascaris suum, Toxascaris leonina, Parascaris equorum, and Echinococcus granulosus, comprising the following steps: a) providing a sample of the biological material; b) isolation of DNA from the sample; c) carrying out a multiplex PCR reaction with a selected set of primers; d) size analysis of the multiplex PCR reaction products; wherein for the identification of one of the above species in the multiplex PCR reaction a species-specific set of primers is used. The invention relates also to the primer sets and nucleotides being part of these sets.

Description

Method and Kit for Detecting Nematodes, Tapeworms and Flukes Using the Multiplex PCR Technique, and Oligonucleotides

Field of the Invention

The present invention relates to a method and kit for detecting nematodes, tapeworms, and flukes using the multiplex PCR technique via the parasite DNA detection.

The resultant method and kit of the present invention which are based on the PCR reaction are intended to detect the presence of genetic material (DNA) of the parasites in a biological material, such as food, samples taken from the environmental, human and animal feces, etc. Parasite DNA detection in the test samples may indicate the presence of live and invasive forms of these parasites. The great parasite egg survival rate, even in extremely adverse environmental conditions, poses a serious sanitation problem. Health hazards caused by the parasites (nematodes, tapeworms, and flukes) are digestive, respiratory and neurological disorders, allergies, and in case of toxocariasis, vision disorders. Parasites are also associated with the growing number of liver and pancreatic cancer cases.

Background of the Invention

Currently, in the parasite diagnostics, techniques based on nucleic acid analysis, including these which employ polymerase chain reaction (PCR), are increasingly used. The basis of the PCR technique is the amplification of DNA fragment(s), which are specific for a given organism, to a level enabling its/their quick and simple detection by electrophoresis. This is achieved by using short single-stranded oligonucleotides (of 12-40 nucleotides), so- called primers, specific for the amplified DNA fragment and an enzyme - a thermostable polymerase, which enables amplification of the given fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis.

Usually, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which allows its identification by gel electrophoresis.

Multiplex PCR is a technique used in molecular biology for amplification multiple matrices during one PCR reaction. Thanks to the simultaneous use of different sets of primers, this method provides a great saving of time and allows reducing the cost of testing while maintaining high quality of results. The presence of many primers can lead to their cross-hybridization and increases the risk of errors when binding to the target sequence. Therefore, a proper design of primers plays a very important role, being a key step affecting the efficiency of the multiplex PCR. It is recommended that the primers used in one test have similar reaction kinetics. They should have the right length (18-30 bp) and comparable melting point, which depends on the percentage of guanine and cytosine in the chain. Due to the competition occurring between the primers in one reaction mixture, the key feature of the primers is their specificity to the amplified target sequence.

The object of the present invention was to develop PCR primers for the amplification of the mitochondrial cox1 fragment and 18S rDNA of some helminths, which in a fairly wide spectrum of PCR reaction parameters, amplify the relevant parasite DNA fragments without entering into any reaction with plant DNA or DNA obtained from the feces.

This object was accomplished by the universal multiplex PCR assay for many parasites posing a serious threat to the human health (nematodes - Toxocara canis, Toxocara cati, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis; tapeworms - Echinococcus multilocularis, Dipylidium caninum, Taenia taeniaeformis; fluke - Fasciola hepatica) according to the present invention.

Summary of the Invention

Thus, the present invention provides a method for detecting in the biological material nematodes, tapeworms, and flukes, selected from the group including Toxocara cati, Toxocara canis, Taenia solium, Taenia saginata, Echinococcus multilocularis, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis, Dipylidium caninum, Taenia taeniaeformis, Fasciola hepatica, Ascaris suum, Toxascaris leonina, Parascaris equorum, and Echinococcus granulosus, comprising the following steps: a) Providing a sample of the biological material; b) Isolation of DNA from the sample; c) Carrying out a multiplex PCR reaction with a selected set of primers; d) Size analysis of the multiplex PCR reaction products; wherein for the identification of one of the above species in the multiplex PCR reaction a species-specific set of primers is used selected from the list:

Preferably, the method comprises an additional step of sequencing the multiplex PCR reaction product.

The present invention provides also a kit for detecting in the biological material nematodes, tapeworms, and flukes, selected from the group including Toxocara cati, Toxocara canis, Taenia solium, Taenia saginata, Echinococcus multilocularis, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis, Dipylidium caninum, Taenia taeniaeformis, Fasciola hepatica, Ascaris suum, Toxascaris leonina, Parascaris equorum, and Echinococcus granulosus, using the multiplex PCR reaction, characterized in that it comprises at least one set of primers among such as either SEQ ID NO. 1 -3 or SEQ ID NO. 4-9 or SEQ ID NO. 10-12 or SEQ ID NO. 13-21.

Preferably, the kit comprises a species-specific set of primers selected from the list:

The invention relates also to an oligonucleotide having sequence selected from SEQ ID NO. 1 -21.

Brief Description of the Figures

Figure 1. Agarose gel with Toxocara cati and Toxocara canis cox1 DNA fragment amplification products obtained by PCR.

Figure 2. Agarose gel with Echinococcus multilocularis, Dipylidium caninum, and Taenia taeniaeformis cox1 DNA amplification products obtained by PCR.

Figure 3. Alignment of the 18S rDNA sequence fragment with marked sites for nematode (Ascaris lumbricoides, Ascaris suum, Toxascaris leonina, Parascaris equorum, Toxocara cati, Toxocara canis, and Enterobius vermicularis) PCR primer binding.

Figure 4. Result of PCR reaction employing NcF1 (SEQ ID NO. 10), and Nc452R (SEQ ID NO. 12) primers.

Figure 5. Visualization of sequencing result of the 18S tortoise pinworm sequence fragment (S151).

Figure 6. Visualization of sequencing result of the 18S Toxocara cati sequence fragment (S142).

Figure 7. Visualization of sequencing result of the 18S Toxocara canis sequence fragment (S12).

Figure 8. Visualization of sequencing result of the 18S Toxocara canis sequence fragment (S11).

Figure 9. Alignment of the 18S rDNA sequence fragment obtained by sequencing the PCR reaction products with a pair of primers Nc1 F (SEQ ID NO. 10) and Nc452R (SEQ ID NO. 12). Figure 10. S11 and S12 sequences matching Toxocara canis sequences.

Figure 11. S142 sequence matching Toxocara cati sequences.

Figure 12. Tortoise pinworm sequence (S151) is identical, in the analyzed section, with the horse and goat pinworm sequences.

Figure 13. Alignment of the 18S rDNA sequence fragment with marked sites for tapeworm (Dipylidium caninum, Taenia solium, Taenia saginata, Hydatigera (Taenia) taeniaeformis, Echinococcus multilocularis, Echinococcus granulosus); nematode (Ascaris lumbricoides, Ascaris suum, Toxascaris leonina, Parascaris equorum, Toxocara cati, Toxocara canis, Enterobius vermicularis), and fluke Fasciola hepatica PCR primer binding.

Figure 14. Photo of the gel with multiplex PCR reaction products employing 9 primers (NA950F (SEQ ID NO. 13), C950F (SEQ ID NO. 15), NTr950F (SEQ ID NO. 14), Fh950F (SEQ ID NO. 16), Em950F (SEQ ID NO. 17), Tt950F (SEQ ID NO. 18), Nc1200R (SEQ ID NO. 19), C1200R (SEQ ID NO. 20), and Fh1200R (SEQ ID NO. 21)).

Figure 15. Visualization of sequencing result of the 18S sequence fragment of the Did sample.

Figure 16. Visualization of sequencing result of the 18S sequence fragment of the Em2 sample.

Figure 17. Em2 sequence matching Echinococcus spp. sequences.

Figure 18. Did sequence matching Hydatigera spp. and Taenia taeniaeformis sequences.

Detailed Description of the Invention

The method and kit of the present invention are based on the multiplex PCR reaction by which the presence of nematode (Toxocara canis, Toxocara cati, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis), tapeworm (Echinococcus multilocularis, Dipylidium caninum, Hydatigera taeniaeformis — formerly Taenia taeniaeformis), and fluke (Fasciola hepatica) DNA could be detected.

A set of multiplex PCR primers was designed for the assay, which amplify a specific DNA fragment of the aforementioned parasites, while not entering into any reaction with neither plant DNA nor DNA obtained from the feces.

The developed assay can be used as a tool to control the biological purity of food for the presence of parasites potentially dangerous to humans (nematodes, tapeworms, and flukes). The main source of parasites occurring in food could be the natural fertilizers used for plant cultivation, wild animals being intermediate hosts of the parasites and the lack of hygiene maintenance by the producer during harvesting, processing and packaging.

EMBODIMENTS

Example 1 ; Isolation of the parasite eggs from the test material

Isolation of the parasite eggs is carried out from soil, feces or plant material samples by flotation method consisting in a thorough mixing of 2 g of the test sample with 10% NaCI solution with the addition of sucrose (65 g per 100 mL). Plant material should be ground beforehand. Test samples should be homogeneous. The 50 mL test tube containing the sample covered with the flotation solution to the rim should be covered with a glass plate and left to stand for 2 hours at room temperature. Eggs accumulated on the glass plate should be flushed with 1 mL of distilled water into a 1.5 mL test tube and centrifuged (7000xg, 1 minute, room temperature) and then the water from above the eggs should be pipetted off. The centrifuged eggs should be covered with 100 pL distilled water, stirred and counted in a hemocytometer using a light microscope, choosing the egg sample volume and the degree of its dilution with distilled water depending on the hemocytometer type and the egg number.

Example 2: Isolation of the DNA from the test material

For parasite DNA isolation, commercially available ready-made kits for DNA isolation, comprising glass beads or other "abrasive" material with similar properties, can be used. Dried and thoroughly ground plant material should be soaked in water in a sterile glass container (e.g. a watch glass) for 5 minutes, with addition of 0.15 g sterile distilled water to 0.05 g dry plant material. Further steps should follow the instructions of the commercial DNA isolation kit manufacturer.

Example 3: PCR reactions

All PCR reactions with no reaction parameters given were carried out in the reaction buffer containing MgClz and supplied with polymerase at the concentration recommended by the polymerase manufacturer using each dNTP (dATP, dCTP, dGTP, and dTTP) and each reaction primer at a concentration of 200 pM. One polymerase unit was used per 50 pL of the mixture.

Example 4: Detection of Toxocara cati and Toxocara canis based on cox1 sequence

The PCR assay primers for Toxocara cati and Toxocara canis DNA detection were developed based on the sequence analysis of genes encoding the cytochrome c oxidase subunit 1 (cox1). For the sequence analysis and design of reaction primers, NCBI reference sequences of the complete Toxocara cati (NC_010773.1) and Toxocara canis (NC_010690.1) mitochondrial genome were used.

Primers for the amplification of Toxocara cati and Toxocara canis mitochondrial DNA (cox1) fragments.

COIF280TS (SEQ ID NO. 1) - 5’-3’TTGATGTTGGGGGCTCCTGA

COIR497CN (SEQ ID NO. 2) - 5’-3’CCAAGAATAGAACTAACTCCCGCAC

COIR634CT (SEQ ID NO. 3) - 5 -3’ CCCCCGCCAAAACTGGTAG

Polymerase - HiFi Taq DNA Polymerase (Novazym) or other of similar parameters.

Biological material prepared according to the methods of Examples 1 and 2 was subjected to PCR reaction using the following conditions:

94°C - 2 minutes

35 cycles: 95°C - 30 seconds, 60°C - 30 seconds, 72°C - 1 minute

72°C - 5 minutes

10°C - holding until the test sample removal. Figure 1 shows a photograph of an agarose gel with products of Toxocara cati and Toxocara canis cox1 DNA fragment amplification obtained by PCR, where

M - 100 bp DNA ladder molecular marker Nova (Novazym), concentration 0.1 pg/mL;

K(-)H₂O - negative control, water was added instead of DNA;

1 - T. cati and T. canis DNA isolated from purified eggs. DNA isolation: a commercial kit for isolation from tissues with the addition of quartz sand;

2 - T. canis DNA isolated from purified eggs. DNA isolation: a commercial kit for isolation from tissues with the addition of quartz sand;

3 - T. canis DNA isolated from purified eggs. DNA isolation: a commercial kit for isolation from tissues;

4 - T. canis DNA isolated from eggs in a stool sample. DNA isolation: a commercial kit for isolation from stool;

5 - T. cati DNA isolated from purified eggs. DNA isolation: a commercial kit for isolation from tissues;

6 - DNA isolated from a stool sample from an uninfected host (dog);

7 - T. cati DNA isolated from eggs in a stool sample. DNA isolation: commercial kit for isolation from stool.

Amplified DNA fragment sizes: Toxocara canis - 220 base pairs, Toxocara cati - 360 base pairs.

Example 5: Detection of Taenia solium, T. saginata, and Echinococcus multilocularis based on cox1 sequence

The PCR assay primers for Taenia solium, T. saginata, and Echinococcus multilocularis DNA detection were developed based on sequence analysis of genes encoding the cytochrome c oxidase subunit 1 (cox1). For the sequence analysis and design of reaction primers Taenia solium mitochondrial DNA, complete genome GenBank: AB086256.1, Taenia saginata mitochondrion, complete genome GenBank: AY684274, and Echinococcus multilocularis mitochondrial cox1 gene for cytochrome c oxidase subunit 1 GenBank: AB461413.1 sequences were used.

PCR primers:

Echinococcus multilocularis

Em656F (SEQ ID NO. 4) 5-3': TTTTGATCCGTTAGGTGGGGGT

Em912R (SEQ ID NO. 5) 5'-3': AAAAAACCGCCGTCTTCACA

Taenia solium

Tsl663F (SEQ ID NO. 6) 5'-3’: CCGTTAGGAGGTGGTGATCC

Tsl954R (SEQ ID NO. 7) 5'-3': TAATCCCCGTAGGCACTCCAA

Taenia saginata

Tsg661 F (SEQ ID NO. 8) 5 -3': ATCCATTGGGTGGTGGTGATCCT

Tsg1078R (SEQ ID NO. 9) 5'-3': GACAACACAATACCAGTCACACCA Biological material prepared according to the methods of Examples 1 and 2 was subjected to PCR reaction using the following conditions:

94°C - 2 minutes

34 cycles: 95°C - 20 seconds, 58°C - 20 seconds, 72°C - 1 minute

72°C - 5 minutes

10°C - holding until the test sample removal.

Echinococcus multilocularis tapeworm DNA was obtained from the digestion of the tapeworm uterine proglottid (which contains 200 to 600 eggs). DNA isolated from a single uterine proglottid was suspended in 200 pL of water. 1 pL of DNA was used for the PCR reaction, which corresponds to the amount of DNA obtained from 1 to 3 eggs. In addition, to test the specificity of the designed primers, PCR reactions were carried out with DNA isolated from the two tapeworm species commonly found in cats and dogs: Dipylidium caninum, and Taenia taeniaeformis. The polymerase activity is strongly inhibited by the DNA isolated from historical specimens of Taenia solium and Taenia saginata preserved with formalin (fresh specimens of these tapeworms are currently not available in Poland).

Figure 2 shows a photograph of an agarose gel with products of Echinococcus multilocularis, Dipylidium caninum and Taenia taeniaeformis cox1 DNA fragment amplification obtained by PCR, where

M - marker (100 bp - Novazym); H₂O - control sample without DNA;

Em1 - Echinococcus multilocularis DNA;

Tt1 - Taenia taeniaeformis DNA;

K6 - DNA from dried dandelion leaves;

K7 - DNA from dried dandelion flowers;

K7^+Tt1 > DNA from dried dandelion flowers + Taenia taeniaeformis DNA;

K7^+Em1 - DNA from dried dandelion flowers + Echinococcus multilocularis DNA;

Dipl - Dipylidium caninum DNA.

Amplified Echinococcus multilocularis DNA fragment size - 220 base pairs. In case of Dipylidium caninum and Taenia taeniaeformis a 'ladder' of amplified DNA fragments is formed.

Example 6: Detection of nematode, tapeworm and fluke DNA based on 18S rDNA sequence

For nematodes: Toxocara canis, Toxocara cati, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis, tapeworms: Echinococcus multilocularis, Dipylidium caninum, Taenia taeniaeformis, and flukes Fasciola hepatica PCR primers were designed and tested allowing to amplify fragments of 18S rDNA genes encoding a small subunit (SSU) of ribosomal RNA. For testing the sensitivity and specificity of the assays, material (parasites) was obtained which was initially identified on the basis of morphological characteristics, and then the DNA obtained from it was used for amplification and sequencing of the obtained sequences. DNA from Toxocara cati (S142) and Toxocara canis (S12) adult specimens was isolated with a standard tissue DNA isolation kit according to the manufacturer's protocol (Qiagen).

In case of Toxocara cati (obtained from cat feces after deworming), the isolated DNA was additionally purified (to remove the PCR inhibitors) by additional precipitation in ethyl alcohol. Pinworm eggs (S15 - 5 eggs, S151 - 30 eggs) were isolated from Hermann's tortoise (Testudo hermanni) feces in the process of flotation, followed by decantation. For DNA isolation, a stool DNA isolation kit (Qiagen) was used with a slight modification of the manufacturer's procedure (instead of 0.2 g of feces, 5 eggs (S15) and 30 eggs (S151 ) suspended in 200 pL of water were added). Toxocara canis (S11) egg DNA was isolated directly from the feces of an infected dog.

Example 7

Based on the aligned sequence of the 18S rDNA fragment, a set of PCR primers was designed:

NcF1 (SEQ ID NO. 10) 5'-3’: GGTTATATGCTTATCTCAAAGGCTAAG

Nc291 R (SEQ ID NO. 11) 5 -3': GGCAGACACTTGATAGACACGTCG

Nc452R (SEQ ID NO. 12) 5'-3': CGAGAGTGGGTAATTTGCGCGCCT

Figure 3 shows the alignment of the 18S rDNA sequence fragment with marked sites for nematode (Ascaris lumbricoides, Ascaris suum, Toxascaris leonina, Parascaris equorum, Toxocara cati, Toxocara canis, and Enterobius vermicularis) PCR primer binding.

In addition to DNA obtained from the parasites, DNA isolates from dandelion were used in the PCR reaction. DNA from dried plants was isolated with a stool DNA isolation kit (Qiagen).

The reaction was carried out in a volume of 25 pL: 2.5 pL 10x PCR buffer (pH 8.6; 15 mM MgClz), 0.25 pL of each primer (20 mM), 0.5 pL dNTPs mix (20 mM), 0.3 pL Taq DNA polymerase (1 U/pL), and 2.5 pL DNA of the analyzed sample. 2.5 pL sterile water was used In the control sample. The reaction was carried out in TM100 Thermal Cycler (Bio-Rad).

The prepared biological material was subjected to PCR reaction using the following conditions:

95°C - 1 minute

34 cycles: 95°C - 20 seconds, 60°C - 20 seconds, 72°C - 30 seconds

72°C - 3 minutes

12°C - holding until the test sample removal.

Figure 4 shows the result of PCR reaction employing NcF1 and Nc452R primers, where

M - marker (100 bp - Novazym);

KH₂O - control sample without DNA;

511 - Toxocara canis eggs isolated from dog feces;

512 - Toxocara canis (adult specimen);

S142 - Toxocara cati (adult specimen);

S15 - pinworm eggs (5 pieces) from tortoise feces; S151 - pinworm eggs (25 pieces) from tortoise feces;

K7 - dandelion flowers;

K11 - dandelion leaves.

The PCR reaction products (NcF1 - Nc452R) for the isolates: S151 , S142, and S12 were purified with a commercial PCR product purification kit (QIAquick - PCR Purification Kit, QIAGEN). The purified DNA was sequenced (Genomed, Warsaw). PCR primers (NcF1 - Nc452R) were used as sequencing primers. The 18S rDNA sequences obtained were analyzed and compiled using ContigExpress software, which is a part of the Vector NTI Advance 11 molecular analysis software package (Invitrogen, USA). The compiled sequences were checked against GenBank database using Blast software.

Figure 5 shows the visualization of sequencing result of the 18S tortoise pinworm sequence fragment (S151 ).

Figure 6 shows the visualization of sequencing result of the 18S Toxocara cati sequence fragment (S142).

Figure 7 shows the visualization of sequencing result of the 18S Toxocara canis sequence fragment (S12).

Figure 8 shows the visualization of sequencing result of the 18S Toxocara canis sequence fragment (S11).

Figure 9 shows the alignment of the 18S rDNA sequence fragment obtained by sequencing the PCR reaction products with a pair of primers Nc1 F, and Nc452R.

For Toxocara spp. (S11, S12, and S142) a sequence of 371 base pairs was obtained, for S151 sample - a sequence of 369 base pairs. S11 and S12 sequences were found to be identical.

The sequences obtained were compared with the sequences in GenBank using the Blast software.

Figure 10 shows that the S11 and S12 sequences are matching the Toxocara canis sequences.

Figure 11 shows that the S142 sequence matches the Toxocara cati sequences.

Figure 12 shows that the tortoise pinworm sequence (S151) is identical, in the analyzed section, with the horse and goat pinworm sequences.

Example 8

A multiplex PCR assay was designed in which a short (250 base pairs) fragment of nematode, tapeworm, and fluke 18S rDNA is amplified. Nine PCR primers were designed for this assay:

NA950F (SEQ ID NO. 13) 5'-3': ACGGGGGCATTCGTATCGCTGC

NTr950F (SEQ ID NO. 14) 5 -3': ACGGGGACATTCGTATTGCTGCG

C950F (SEQ ID NO. 15) 5'-3': GCGGGGACGTTTGTATGGCTGC

Fh950F (SEQ ID NO. 16) 5'- 3': ACGGGGGCATTTGTATGGCGG

Em950F (SEQ ID NO. 17) 5'-3': GCGGGGGCGTTTGTATGGCTG

Tt950F (SEQ ID NO. 18) 5 -3': GCGGGGACGTTTGTATGGTTGCG

Nc1200R (SEQ ID NO. 19) 5’ -3': CAACCATACTTCCCCCGGAACCGAAA

C1200R (SEQ ID NO. 20) 5 -3': CAACCATACTTCCCCCGGAACCGAAA Fh1200R (SEQ ID NO. 21) 5’-3': AACCATACTTCCCCCGGAGCCCAAA

Figure 13 shows the alignment of the 18S rDNA sequence fragment with marked sites for tapeworm (Dipylidium caninum, Taenia solium, Taenia saginata, Hydatigera (Taenia) taeniaeformis, Echinococcus multilocularis, Echinococcus granulosus); nematode (Ascaris lumbricoides, Ascaris suum, Toxascaris leonina, Parascaris equorum, Toxocara cati, Toxocara canis, Enterobius vermicularis), and fluke Fasciola hepatica PCR primer binding.

PCR reactions were carried out according to the following program:

95°C - 1 minute

40 cycles: 95°C - 10 seconds, 58°C - 10 seconds, 72°C - 20 seconds

72°C - 3 minutes

12°C - holding until the test sample removal.

Figure 14 shows the multiplex PCR reaction products with 9 primers (NA950F, C950F, NTr950F, Fh950F, Em950F, Tt950F, Nc1200R, C1200R, and Fh1200R).

MgCl₂ concentration: 1.5 mM. Reaction products after 1 hour electrophoresis on a 1.4% agarose gel.

M - DNA marker (100 bp, Novazym);

KH₂O - control, water was added instead of DNA;

S142 - Toxocara cati (adult specimen)

S151 - Pinworm eggs from tortoise feces

K6 - dandelion leaves

Did - eggs of unidentified tapeworms from cat feces

S61 - eggs of Trichuris sp. from dog feces

Fh1 - Fasciola hepatica fluke from a bison liver

Em2 - Echinococcus sp. tapeworm fragment from a fox intestine

Two of the obtained amplified DNA samples (Did and Em2) were purified and sequenced (Genomed, Warsaw).

Figure 15 shows the visualization of sequencing result of the 18S sequence fragment of the Did sample.

Figure 16 shows the visualization of sequencing result of the 18S sequence fragment of the Em2 sample.

The sequences obtained were compared to the sequences in GenBank using the Blast software.

Figure 17 shows that the Em2 sequence is matching the Echinococcus spp. sequences.

Figure 18 shows that the Did sequence matches Hydatigera spp. and Taenia taeniaeformis sequences.

Example 9: Optimization of the multiplex PCR reaction

The reaction was carried out in a volume of 35 pL: 3.5 pL 10x PCR buffer (pH 8.6, 2.2 mM MgClz), 0.4 pL of each primer (20 mM), 0.5 pL dNTPs mix (20 mM), 1 pL Taq DNA polymerase (1 U/pL), 24.5 pL sterile water, and 3.5 pL DNA of the analyzed sample. In the control sample 3.5 pL sterile water was added instead of DNA. The reaction was carried out in TM100 Thermal Cycler (Bio-Rad) according to the program: 95°C - 1 minute

34 cycles: 95°C - 20 seconds, 60°C - 20 seconds, 72°C - 20 seconds

72°C - 3 minutes

12°C - holding until the test sample removal.

Conclusions

An assay was developed to detect nematode, tapeworm, and fluke DNA by determining experimentally the appropriate concentration of magnesium chloride (MgClz) and Taq DNA polymerase as well as the parameters of the PCR reaction program (time, temperatures, and number of cycles).

A number of PCR primers have been developed to amplify the mitochondrial cox1 fragment and 18S rDNA of some helminths, which in a fairly wide spectrum of PCR reaction parameters amplify the relevant parasite DNA fragments without entering into any reaction with plant DNA or DNA obtained from feces.

A universal multiplex PCR assay has been developed for many parasites that pose a serious threat to human health (nematodes - Toxocara canis, Toxocara cati, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis; tapeworms - Echinococcus multilocularis, Dipylidium caninum, Taenia taeniaeformis, and a fluke - Fasciola hepatica).

The helminth 18S rDNA fragments obtained during assays allow confirmation of the parasite species after sequencing.

Sequence listing

SEQUENCE LI STING

Claims

1. A method for detecting in the biological material nematodes, tapeworms, and flukes, selected from the group including Toxocara cati, Toxocara canis, Taenia solium, Taenia saginata, Echinococcus multilocularis, Ascaris lumbricoides, Trichuris trichiura, Enterobius vermicularis, Dipylidium caninum, Taenia taeniaeformis, Fasciola hepatica, Ascoris suum, Toxascaris leonina, Parascaris equorum, Echinococcus granulosus, comprising the following steps: a) Providing a sample of the biological material; b) Isolation of DNA from the sample; c) Carrying out a multiplex PCR reaction with a selected set of primers; d) Size analysis of the multiplex PCR reaction products; wherein for the identification of one of the above species in the multiplex PCR reaction a species-specific set of primers is used selected from the list:

2. The method according to claim 1 , characterized in that it comprises the additional sequencing step of the multiplex PCR reaction product.

3. A kit for detecting in the biological material nematodes, tapeworms, and flukes, selected from the group including Toxocara cati, Toxocara canis, Taenia solium, Taenia saginata, Echinococcus multilocularis, Ascoris lumbricoides, Trichuris trichiura, Enterobius vermicularis, Dipylidium caninum, Taenia taeniaeformis, Fasciola hepatica, Ascoris suum, Toxascaris leonina, Parascaris equorum, and Echinococcus granulosus using the multiplex PCR reaction, characterized in that it comprises at least one set of primers among such as either SEQ ID NO. 13-21 or SEQ ID NO. 1-3 or SEQ ID NO. 4-9 or SEQ ID NO. 10-12.

4. Kit according to claim 3, characterized in that it comprises a species-specific set of primers selected from the list:

5. An oligonucleotide of a sequence selected from SEQ ID NO. 1-21.