WO2022075478A1 - Agent thérapeutique pour glioblastome, procédé de criblage, procédé de détermination d'efficacité et procédé de détermination de pronostic - Google Patents

Agent thérapeutique pour glioblastome, procédé de criblage, procédé de détermination d'efficacité et procédé de détermination de pronostic Download PDF

Info

Publication number
WO2022075478A1
WO2022075478A1 PCT/JP2021/037488 JP2021037488W WO2022075478A1 WO 2022075478 A1 WO2022075478 A1 WO 2022075478A1 JP 2021037488 W JP2021037488 W JP 2021037488W WO 2022075478 A1 WO2022075478 A1 WO 2022075478A1
Authority
WO
WIPO (PCT)
Prior art keywords
selenoprotein
glioblastoma
antibody
apoer2
gbm
Prior art date
Application number
PCT/JP2021/037488
Other languages
English (en)
Japanese (ja)
Inventor
芳郎 斎藤
喬士 外山
ひかり 杉浦
Original Assignee
国立大学法人東北大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人東北大学 filed Critical 国立大学法人東北大学
Publication of WO2022075478A1 publication Critical patent/WO2022075478A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
    • A61K31/26—Cyanate or isocyanate esters; Thiocyanate or isothiocyanate esters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to a glioblastoma therapeutic agent, a screening method for a glioblastoma therapeutic agent, a method for determining the efficacy of a glioblastoma therapeutic agent, and a method for determining the prognosis of a glioblastoma patient.
  • Glioma is a malignant tumor that develops in the brain and is classified into four grades (grades I to IV) according to the standards of the World Health Organization (WHO) (see Non-Patent Document 1). Among them, grade IV glioblastoma (GBM) is a serious fatal disease with a high frequency of 40% of adult glioblastoma and a 5-year survival rate of 20% or less.
  • WHO World Health Organization
  • the standard treatment for GBM is to remove the tumor as much as possible by surgery and then perform radiation therapy and chemotherapy with temozolomide (TMZ).
  • TMZ temozolomide
  • GBM shows high resistance to drugs such as irradiation and TMZ, the prognostic survival time has hardly improved in recent decades even by the above-mentioned standard treatment methods. ..
  • selenoprotein is a general term for proteins containing selenocysteine residues in which sulfur in cysteine residues is replaced with selenium.
  • glutathione peroxidase (GPx) glutathione peroxidase (GPx), thioredoxin reductase (TR), iodothyronine deiodination enzyme, selenophosphate synthesizer, selenoprotein P (SeP), selenoprotein W, 15 kDa selenoprotein and the like are known, and these are cells. It is also known to be a protein involved in oxidative reduction within.
  • selenoprotein P which is mainly biosynthesized in the liver, is known to be a major selenoprotein in plasma (concentration in plasma is 5.3 ⁇ g / ml) and a glycoprotein of 69 kDa (362 amino acids). ing.
  • the relationship between the amino acid primary structure and function of selenoprotein P has been studied in detail, and the C-terminal side, which has an enzyme active site on the N-terminal side and is rich in selenocysteine residues, exerts the function of supplying selenium to cells. Is believed to be. It is also known to have a histidine-rich domain in a region that is neither the N-terminal nor the C-terminal (Non-Patent Documents 2 to 5).
  • An object of the present invention is to provide a development target for a new therapeutic agent for GBM. It is also an object of the present invention to provide a new therapeutic agent for GBM. Furthermore, it is an object of the present invention to provide a novel screening method for a therapeutic agent for GBM. In addition, it is an object of the present invention to provide a new method for determining the efficacy or feasibility of administration of a GBM therapeutic agent. Furthermore, it is an object of the present invention to provide a new method for determining the prognosis of a glioblastoma patient.
  • selenoprotein P is a target for GBM therapeutic agents, and that a component having a selenoprotein P inhibitory action can suppress the cell proliferation rate.
  • selenoprotein P are highly expressed in GBM cells, which are found to have low temozolomid sensitivity, and it has been clarified that a component having a selenoprotein P inhibitory action is useful as a therapeutic agent for GBM.
  • the present invention has been completed based on these findings, and includes a wide range of inventions shown below.
  • the component having an inhibitory effect on selenoprotein P is siRNA against the mRNA of the selenoprotein P gene, an antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P, sulforaphane and its derivatives, curcumin and its derivatives, Item 2.
  • [Item 3A] A method for determining the efficacy or administration of the prophylactic or therapeutic agent according to Item 1 or 2, using the expression level or the degree of function of selenoprotein P or ApoER2 in a biological sample derived from a subject as an index.
  • Item 3B Item 3. The method for determining the efficacy or administration of a prophylactic or therapeutic agent according to Item 1 or 2, which comprises a step of measuring the expression level or the degree of function of selenoprotein P or ApoER2 in a biological sample derived from a subject.
  • [Item 4] A method for determining the prognosis of glioblastoma using the expression level or the degree of function of selenoprotein P or ApoER2 in a biological sample derived from a subject as an index.
  • Item 5 Item 3. The method according to Item 3 or 4, wherein the biological sample derived from the subject is a glioblastoma cell.
  • Item 6 A therapeutic agent for glioblastoma, in which glioblastoma cells are cultured in the presence and absence of a test substance, and the expression level or the degree of function of selenoprotein P or ApoER2 is compared in the presence and absence of the test substance. Screening method.
  • Item 7 Item 6.
  • the component having an inhibitory effect on selenoprotein P is siRNA against the mRNA of the selenoprotein P gene, an antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P, sulforaphane and its derivatives, curcumin and its derivatives, Item 6.
  • [Item 9] A method for preventing or treating glioblastoma, which comprises administering to a subject an effective amount of an ingredient having an inhibitory effect on selenoprotein P.
  • [Item 10] A pharmaceutical composition for preventing or treating glioblastoma, which comprises a component having an inhibitory effect on selenoprotein P and a pharmaceutical carrier.
  • Item 12] Item 3. A method for treating glioblastoma, which comprises the step of administering the prophylactic or therapeutic agent according to Item 1 or 2 to a subject determined to be effective or administrable in the method of Item 3.
  • selenoprotein P can be used as a therapeutic drug target for GBM.
  • a novel therapeutic agent for GBM can be provided by using a component having a selenoprotein P inhibitory action.
  • the expression level of selenoprotein P in GBM patients can be used as an index for determining the efficacy and prognosis of a GBM therapeutic agent.
  • the mRNA expression level of selenoprotein P after 48 hours of culture in Example 1 is shown.
  • the fluorescence intensity measurement result of the temozolomide susceptibility test of T98G and A172 in Example 2 is shown.
  • the cell proliferation rate of each glioma cell in Example 3 is shown.
  • the amount of mRNA in T98G after knockdown of selenoprotein P by siRNA of selenoprotein P in Example 4 is shown.
  • the cell proliferation rate in T98G after knockdown of selenoprotein P by siRNA of selenoprotein P in Example 4 is shown.
  • the number of cells in T98G 72 hours after the addition of the selenoprotein P neutralizing antibody in Example 5 is shown.
  • Example 6 The comparison result of the expression level of ApoER2 in each cell type in Example 6 is shown.
  • the result of the decrease in the amount of T98G ApoER2 mRNA by the treatment with ApoER2 siRNA in Example 7 is shown.
  • the number of T98G cells after 72 hours by ApoER2 siRNA treatment in Example 7 is shown.
  • the results of the cell viability of T98G when the compound having a selenoprotein P inhibitory action is added in Example 8 are shown. Results at 24, 48, 72 hours with the addition of each selenoprotein P inhibitor (sulforaphane (SFN), curcumin (CCM), epigallocatechin gallate (EGCg), parabenzoquinone (p-benzoquinone)). ..
  • SFN selenoprotein P inhibitor
  • CCM curcumin
  • EMCg epigallocatechin gallate
  • p-benzoquinone parabenzoquinone
  • Example 9 The examination result of the CCDC gene expression condition in Example 9 is shown. The results of confirming the effect of high expression of CCDC on T98G on cell proliferation in Example 10 are shown. The results of immunohistochemical staining in human brain tumor tissue in Example 11 are shown. A: Selenoprotein P negative (Anaplastic astrocytoma), B: Selenoprotein P positive (glioblastoma). The elemental analysis result in the plasma of a brain tumor patient in Example 13 is shown.
  • the term "treatment” means to obtain a desired pharmacological and / or physiological effect.
  • This effect includes partial or complete cure of the disease and / or the adverse effects caused by the disease (pathology, symptoms, etc.).
  • the above-mentioned effects include the effect of blocking or delaying the progression of the disease and / or the adverse effect (pathology, symptom, etc.) caused by the disease, and alleviating the pathology and / or the symptom (relapse or progression of the disease, symptom, etc.).
  • the effect of causing reversal), the effect of preventing recurrence, etc. are included.
  • the above effects may have a predisposition to the disease and / or adverse effects caused by the disease (pathological condition, symptom, etc.), but in individuals who have not yet been diagnosed as having the disease, the disease and / or the adverse effects caused by the disease. It includes the effect of partially or completely preventing the occurrence of (pathology, symptoms, etc.). Therefore, the term “treatment” also includes meanings such as “remission”, “prevention of recurrence", and "prevention”.
  • the present invention provides a screening method for a therapeutic agent for GBM or a candidate substance thereof.
  • the screening method of the present invention compares the steps of culturing GBM cells in the presence and absence of a test substance, and the degree of expression or function of selenoprotein P or ApoER2 under both conditions. Including the process of
  • test substance selected by the screening method of the present invention is useful as a therapeutic agent of the present invention, and can be suitably used for the treatment of GBM.
  • test substance selected by the present screening method is useful as a candidate substance for the GBM therapeutic agent of the present invention, and may become the therapeutic agent of the present invention after further screening.
  • test substance used in the screening method of the present invention is not particularly limited, and is limited to nucleic acids, peptides, proteins, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, cell culture supernatants, plant extracts, and mammals.
  • the tissue extract, plasma, etc. may be used.
  • the test substance may be a novel substance or a known substance. These test substances may form salts.
  • a salt with a physiologically acceptable acid or base is preferable.
  • a step of culturing GBM cells in the presence and absence of a test substance is performed.
  • the GBM cell include tumor cells collected from the brain tumor tissue of a glioblastoma patient, and those known in the technical field to which the present invention belongs can be used.
  • the GBM cell may be a primary cultured cell or a cell subcultured in a suitable medium.
  • a medium that can be used for culturing GBM cells can be appropriately used, and for example, RPMI-1640 medium, D'MEM medium, E'MEM. Examples include a medium.
  • FBS penicillin, streptomycin, sodium selenite and the like may be added to the above medium. Since the content of selenium is low in FBS, it is preferable to add sodium selenite when adding FBS to the medium.
  • the amount of sodium selenite added is preferably 5 to 2000 nM, more preferably 50 to 200 nM.
  • a pH adjuster, sodium hydrogencarbonate, or the like may be added to the medium as an option.
  • the medium for culturing the GBM cells in the presence of the test substance the medium exemplified for the subculture can be used.
  • the concentration of the test substance in the medium is not particularly limited, but can be set, for example, in the range of 0.1 to 100 ⁇ g / mL, preferably 1 to 20 ⁇ g / mL.
  • the culture temperature is preferably in the range of 36 to 38 ° C.
  • the pH of the medium is preferably 7.3 to 7.6.
  • the culture time can be set in the range of 12 to 72 hours, preferably 24 to 36 hours.
  • GBM cells are cultured in the same manner as above except that a medium to which no test substance is added is used.
  • selenoprotein P consists of the amino acid sequence set forth in SEQ ID NO: 21 and ApoER2 consists of the amino acid sequence set forth in SEQ ID NO: 39.
  • a preset cutoff value can be used as a selection criterion for a substance having an effect of inhibiting selenoprotein P.
  • the cutoff value can be set, for example, in the range of 0.6 to 0.7.
  • the step of measuring the expression level of selenoprotein P in GBM cells cultured under both of the above conditions will be described below.
  • the expression level of selenoprotein P is measured by quantifying the mRNA of selenoprotein P or by quantifying the protein amount of selenoprotein P.
  • the quantification of selenoprotein P mRNA is carried out by a known method such as RT-PCR method or Northern blotting method using RNA isolated from cells cultured under the above culture conditions or complementary polynucleotide transcribed from the RNA. be able to.
  • An internal standard target gene can be used for quantification of selenoprotein P mRNA, and examples of the internal standard target gene include GAPDH mRNA and Actin mRNA.
  • a known method such as Western blotting using an antibody that recognizes selenoprotein P can be used for the lysate of cells cultured under the above culture conditions.
  • the antibody that recognizes selenoprotein P for example, the antibody described in the following "Antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P" can be used.
  • the expression level of selenoprotein P mRNA or selenoprotein P protein in cells cultured in a medium supplemented with the test substance is that of selenoprotein P mRNA or selenoprotein P protein in cells cultured in a medium not supplemented with the test substance. If it is 70% or less, preferably 60% or less of the expression level, the test substance can be selected as a substance having an effect of inhibiting selenoprotein P.
  • the membrane fraction of GBM cells is isolated according to a conventional method, and labeled selenoprotein P is used in the presence and absence of the test substance.
  • a method of contacting and comparing the amount of selenoprotein P bound to the cell membrane fraction in the presence and absence of the test substance can be mentioned.
  • the binding protein of selenoprotein P include ApoER2 and the like.
  • the test substance can be selected as a substance having an effect of inhibiting selenoprotein P.
  • the reference value T (%) can be set in the range of, for example, 50 ⁇ T ⁇ 80, preferably 60 ⁇ T ⁇ 70.
  • a known method such as Western blotting using an antibody that recognizes glutathione peroxidase against a lysate of cells cultured in the presence or absence of a test substance.
  • an antibody that recognizes glutathione peroxidase for example, an antibody such as ab22604 (Abcam, Anti-Glutathione peroxidase 1), ab125066 (Abcam, Anti-Glutathione peroxidase 4) can be used.
  • the amount of glutathione peroxidase in the lysate of cells cultured in the presence of the test substance is less than or equal to the preset reference value T% as compared with the amount of glutathione peroxidase in the lysate of cells cultured in the absence of the test substance. If so, the test substance can be selected as a substance having an effect of inhibiting selenoprotein P.
  • the reference value T (%) can be set in the range of, for example, 50 ⁇ T ⁇ 80, preferably 60 ⁇ T ⁇ 70.
  • the step of measuring the expression level of ApoER2 in GBM cells cultured under both of the above conditions will be described below.
  • the expression level of ApoER2 is measured by quantifying the mRNA of ApoER2 or by quantifying the amount of protein of ApoER2.
  • the quantification of ApoER2 mRNA can be performed by a known method such as RT-PCR method or Northern blotting method using RNA isolated from cells cultured under the above culture conditions or complementary polynucleotide transcribed from the RNA. can.
  • An internal standard target gene can be used for quantification of ApoER2 mRNA, and examples of the internal standard target gene include GAPDH mRNA and Actin mRNA.
  • a known method such as Western blotting using an antibody that recognizes ApoER2 can be used for the lysate of cells cultured under the above culture conditions.
  • an antibody that recognizes ApoER2 for example, Anti-ApoER2 antibody [EPR3326] (ab108208) can be used.
  • the expression level of ApoER2 mRNA or ApoER2 in the cells cultured in the medium supplemented with the test substance is 70% or less as compared with the expression level of the ApoER2 mRNA or ApoER2 in the cells cultured in the medium not supplemented with the test substance. If it is preferably 60% or less, the test substance can be selected as a substance having an effect of inhibiting selenoprotein P.
  • the membrane fraction of GBM cells is isolated according to a conventional method, and labeled selenoprotein P is used in the presence and absence of a test substance.
  • a method of contacting and comparing the amount of selenoprotein P bound to the cell membrane fraction in the presence and absence of the test substance can be mentioned.
  • the test substance If the amount of ApoER2 bound to the cell membrane fraction in the presence of the test substance is T% or less of the preset reference value as compared with the amount of ApoER2 bound to the cell membrane fraction in the absence of the test substance, the test substance. Can be selected as a substance having an effect of inhibiting selenoprotein P.
  • the reference value T (%) can be set in the range of, for example, 50 ⁇ T ⁇ 80, preferably 60 ⁇ T ⁇ 70.
  • a screening method focusing on the intermolecular interaction between ApoER2 and its binding protein, for example, only the extracellular domain of ApoER2 is expressed in GBM cells, a recombinant of the extracellular domain of ApoER2 is prepared, and in the presence of a test substance. And a method of comparing molecular interactions with selenoprotein P in the absence.
  • a known method such as a surface plasmon resonance method can be used.
  • the test substance If the analysis result of the intermolecular interaction in the presence of the test substance is less than or equal to the preset reference value T% as compared with the analysis result of the intermolecular interaction in the absence of the test substance, the test substance. Can be selected as a substance having an effect of inhibiting selenoprotein P.
  • the reference value T (%) can be set in the range of, for example, 50 ⁇ T ⁇ 80, preferably 60 ⁇ T ⁇ 70.
  • a component having an inhibitory effect on selenoprotein P is selected as a GBM therapeutic agent or a candidate substance thereof.
  • the term "component having an inhibitory effect on selenoprotein P” refers to any substance that inhibits the action of selenoprotein P, and its mechanism of action is to inhibit the expression of selenoprotein P and to function. Includes inhibition, etc.
  • the "component having an inhibitory action on selenoprotein P” is a substance that inhibits the expression of selenoprotein P, a substance that inhibits the function of selenoprotein P, and finally seleno even if the mechanism of action is unknown. Contains any substance that inhibits the action of protein P.
  • Examples of known components having an inhibitory effect on selenoprotein P include siRNA against mRNA of the selenoprotein P gene, an antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P, and the like.
  • siRNA against mRNA of the selenoprotein P gene an antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P, and the like.
  • Compounds such as 4,4a, 5,6,6a, 11,12b, 13, 14, 14a, 14b-tetradecahydropicene-2-carboxylate and the like can also be mentioned.
  • Double-stranded RNA consisting of an oligo RNA complementary to the mRNA of the selenoprotein P gene and its complementary strand, so-called siRNA, is effective in suppressing the expression of selenoprotein P.
  • siRNA oligo RNA complementary to the mRNA of the selenoprotein P gene and its complementary strand
  • the sequence targeted by siRNA is a continuous 19 to 27 bases, preferably 21 to 23 bases, selected from the group consisting of the bases of the base numbers 1 to 2056 of SEQ ID NO: 22 (selenoprotein P). It is desirable that the siRNA of the present invention and the target sequence are the same, but they may be substantially the same, that is, homologous sequences as long as the RNA interference can be induced. Specifically, as long as the antisense strand sequence of the siRNA of the present invention and the target sequence hybridize, there may be one or several (for example, a few) mismatches.
  • the siRNA of the present invention is one in which one or several bases are substituted, added, or deleted from the target sequence and can induce RNA interference, or 90% or more, preferably 90% or more of the target sequence. Those having 95% or more, more preferably 98% or more homology, and capable of inducing RNA interference are included.
  • siRNA may have a protruding sequence at the 3'end, and specific examples thereof include those to which dTdT (dT represents a deoxythymidine residue of a deoxyribonucleic acid) is added. Further, it may have a blunt end without end addition.
  • dTdT represents a deoxythymidine residue of a deoxyribonucleic acid
  • the ribonucleoside molecule constituting siRNA can be subjected to various chemical modifications in order to improve chemical stability and / or anti-enzymatic stability, and / or affinity with RNA.
  • replacement of all ribonucleoside molecules in native RNA with modified forms may result in loss of RNA activity, requiring the introduction of minimal modified nucleosides.
  • Specific examples of the modification include Accell modification, siSTABLE modification and the like.
  • the sense strand and antisense strand of the target sequence on the mRNA are synthesized by a DNA / RNA automatic synthetic group, respectively, and denatured in a suitable annealing buffer at about 90 to 95 ° C. for about 1 minute, and then about 1 minute. It can be prepared by annealing at 35-40 ° C. for about 1-2 hours.
  • siRNA sequence for the mRNA of the selenoprotein P gene examples include selenoprotein P siRNA # 1 (SEQ ID NO: 23). GAGAUAUGCCAGCAAGUGA [dT] [dT] and its complementary strand annealed Selenoprotein P siRNA # 2 (SEQ ID NO: 24) GCAUAUCCUGUUUAUCAA [dT] [dT] and its complementary strand annealed Selenoprotein P siRNA # 3 (SEQ ID NO: 25) Examples thereof include those obtained by annealing GAGAAUGACCUCAUCAAACUA [dT] [dT] and its complementary strand.
  • nucleic acids designed to be capable of producing siRNA against selenoprotein P mRNA in vivo are also included in the components that inhibit selenoprotein P.
  • examples of such nucleic acids include expression vectors constructed to express the above siRNA.
  • Antibodies that specifically bind to an epitope present in the amino acid sequence of selenoprotein P include a wide range of antibodies that specifically bind to selenoprotein P. Preferably, it comprises an antibody that specifically binds to an epitope present in the amino acid sequence 204-261 of selenoprotein P. An antibody that specifically binds to an epitope present in the amino acid sequence 204 to 254, and more preferably to an epitope present in the amino acid sequence 204 to 217.
  • the antibody exerts an effect of inhibiting the intracellular uptake of selenoprotein P by specifically binding to an epitope present in the amino acid sequence of positions 204 to 261 of selenoprotein P.
  • the antibody also exerts an effect of suppressing the induction of intracellular glutathione peroxidase.
  • the above term “specifically binds” is not limited to selectively binding to an epitope present in, for example, the 204th to 261st amino acid sequences of selenoprotein P, and the 204th to 261st positions of selenoprotein P.
  • a molecule having a primary or higher-order structure similar to selenoprotein P such as a homologue of selenoprotein P, coexists with selenoprotein P in an amino acid sequence other than the amino acid sequence of selenoprotein P, 204 to It is explained by preferentially binding to an epitope present in the 261st amino acid sequence.
  • the degree of specific binding of such an antibody to an epitope present in, for example, the amino acid sequence 204 to 261 of selenoprotein P is also evaluated by reaction rate constants such as Kd value, Koff value, or Kon value. Will be done.
  • Kd value is a value obtained by dividing the Koff value by the Kon value.
  • the reaction rate constant for binding to the epitope present in the 204 to 261st amino acid sequence of selenoprotein P of the above antibody is not particularly limited, but for example, if it is a Kd value, it is usually about 0.01 to 100 nM. Is.
  • the above antibody may be a monoclonal antibody or a polyclonal antibody. Further, the origin of the antibody is not particularly limited.
  • the structure of the above antibody is not limited to the immunoglobulin (Ig) molecule, and may be a fragment thereof.
  • a fragment may include a heavy chain and / or a light chain variable region, and may have a structure in which such a fragment is appropriately reconstructed.
  • Specific structures of such an antibody include, for example, F (ab') 2 , Fab, Fv, scFv, scFv-Fc, tetrabody, minibody and the like.
  • the isotype of the above-mentioned immunoglobulin is not limited, and examples thereof include IgA, IgD, IgE, IgG, IgM, and IgY.
  • the subclass of IgG is also not particularly limited, and examples thereof include IgG1, IgG2, IgG2a, IgG2b, IgG3, and IgG4.
  • the above antibody can be an embodiment having a heavy chain variable region and / or a light chain variable region containing a specific amino acid sequence.
  • Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 3 or 13.
  • Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 4 or 14, and heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 5 or 15.
  • Light chain CDR1 consisting of a heavy chain variable region comprising, and / or the amino acid sequence set forth in SEQ ID NO: 8 or 18.
  • Light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 9 or 19, and light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 10 or 20. Included are antibodies having a light chain variable region comprising.
  • Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 3
  • Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 4
  • heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 5.
  • Heavy chain variable region containing, or heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 13.
  • Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 14 and heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 15.
  • Light chain CDR1, consisting of a heavy chain variable region comprising, and / or the amino acid sequence set forth in SEQ ID NO: 8.
  • Light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 9 and light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 10.
  • Light chain variable region comprising, or light chain CDR1 consisting of the amino acid sequence set forth in SEQ ID NO: 18.
  • Light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 19 and light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 20. Included are antibodies having a light chain variable region comprising.
  • Heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 3
  • Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 4
  • heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 5.
  • Light chain CDR1 consisting of a heavy chain variable region containing the above and the amino acid sequence shown in SEQ ID NO: 8.
  • Light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 9 and light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 10.
  • Light chain variable region comprising; or heavy chain CDR1, consisting of the amino acid sequence set forth in SEQ ID NO: 13.
  • Heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 14 and heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 15.
  • Light chain CDR1, consisting of a heavy chain variable region comprising, and an amino acid sequence set forth in SEQ ID NO: 18.
  • Light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 19 and light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 20. Included are antibodies having a light chain variable region comprising.
  • the antibody having the heavy chain variable region and / or the light chain variable region described above may further contain a framework region (FR) or a quasi-region thereof.
  • FR framework region
  • the amino acid sequence constituting FR can be appropriately determined by a known method. Specifically, the information described on the website (http://www.ncbi.nlm.nih.gov/) of The National Center for Biotechnology Information (NCBI) may be referred to.
  • FR obtained from human-derived functional germ cells include KOL, NEWM, REI, EU, TUR, TEI, LAY, POM and the like. Examples of these human-type FRs are described in Kabat, et. al. "Sequences of Products of Immunological Interest”: US Department of Health AND human Services, NIH (1991) USA, or Wu TT, Kabat EA. "An analysis of the equations of the variable regions of Bence Jones protein and myeloma lights" chains and ther impedanceMiplications for 132: 211-50 (1970) and the like may be referred to.
  • an antibody having such a heavy chain variable region and / or a light chain variable region containing FR for example, a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 2 or 12, and / or an amino acid shown in SEQ ID NO: 7 or 17.
  • a heavy chain variable region containing the amino acid sequence shown in SEQ ID NO: 2 or 12 and / or an amino acid shown in SEQ ID NO: 7 or 17.
  • examples thereof include antibodies having a light chain variable region containing a sequence.
  • Examples thereof include antibodies having a light chain variable region containing an amino acid sequence.
  • the antibody having the heavy chain variable region and / or the light chain variable region described above may further have a constant region.
  • these antibodies may be humanized or chimeric.
  • the humanized antibody means an antibody in which the FRs in the constant region and the variable region are amino acid sequences derived from humans, and the other portions are amino acid sequences derived from organisms other than humans. Further, the chimerization is an amino acid sequence in which the constant region is derived from a human and the variable region is an amino acid sequence derived from a species other than human.
  • Such non-human species are not particularly limited, and examples thereof include mice, rats, rabbits, ostriches, monkeys, chimpanzees, horses, donkeys, hamsters, and guinea pigs.
  • Examples of such a constant region include, in the case of a heavy chain constant region, an amino acid sequence having ETT in order from the N-terminal, and more preferably a constant region containing an amino acid sequence having ETTA in order from the N-terminal. Further, in the case of the light chain constant region, an amino acid sequence having RA in order from the N-terminal, more preferably a constant region containing an amino acid sequence having RAA in order from the N-terminal can be mentioned.
  • Examples thereof include an antibody having a heavy chain containing the amino acid sequence shown in SEQ ID NO: 1 or 11 and / or a light chain containing the amino acid sequence shown in SEQ ID NO: 6 or 16.
  • An antibody having a heavy chain containing the amino acid sequence shown in SEQ ID NO: 1 and a light chain containing the amino acid sequence shown in SEQ ID NO: 6 or a heavy chain containing the amino acid sequence shown in SEQ ID NO: 11 and a light chain containing the amino acid sequence shown in SEQ ID NO: 16. Can be mentioned.
  • the above amino acid sequence may be appropriately mutated as long as the function, effect, etc. of the above antibody are not attenuated.
  • the specific number of mutations introduced is not particularly limited, but usually, the identity with the amino acid sequence before the mutation is 85% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more.
  • the number of mutations introduced may be set so as to be a mutant having.
  • the location where the mutation is introduced is not particularly limited, but it is preferable to introduce the mutation into, for example, the above-mentioned FR region, constant region, etc., in view of not attenuating the function, effect, etc. of the antibody of the present invention.
  • identity refers to the degree to which two or more comparable amino acid sequences or base sequences have the same amino acid sequence or base sequence with respect to each other. Therefore, the higher the identity of two amino acid sequences or base sequences, the higher the identity or similarity of those sequences.
  • the level of amino acid sequence or base sequence identity is usually determined using the sequence analysis tool FASTA and using default parameters.
  • BLAST by Karlin and Altschul (eg, Karlin S, Altschul SF.Proc.Natur Acad Sci USA.87: 2264-2268 (1990), Karlin S, Altschul SF.Natur Acad Sci USA.90). It can be determined by using 1993) etc.).
  • a program called BLASTN or BLASTX based on such a BLAST algorithm has been developed (for example, Altschul SF, GishW, Miller W, Myers EW, Lipman DJ.J Mol Biol. 215: 403-10 (1990), etc. ). Specific methods of these analysis methods are known, and IgBLAST (http://www.ncbi.nlm.nih.gov/igblast/) provided by the NCBI website may be referred to.
  • the above mutation introduction is substitution, deletion, insertion, etc.
  • a known method can be adopted for specific mutagenesis, and the present invention is not particularly limited, but for example, in the case of substitution, a conservative substitution technique may be adopted.
  • conservative substitution technique means a technique in which an amino acid residue is replaced with an amino acid residue having a similar side chain.
  • substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine is a conservative substitution technique.
  • Other amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having non-charged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine and cysteine; alanine, valine, leucine, isoleucine, Amino acid residues with non-polar side chains such as proline, phenylalanine, methionine and tryptophan; amino acid residues with ⁇ -branched side chains such as threonine, valine and isoleucine, and aromatic side chains such as tyrosine, phenylalanine, tryptophan and histidine.
  • Substitution between amino acid residues is also a conservative substitution technique.
  • the above-mentioned antibody production method may be produced by using a known method described in Japanese Patent Application Laid-Open No. 2015-64513.
  • Compounds that inhibit selenoprotein P other than the above include sulforaphane and its derivatives, curcumin and its derivatives, which are polyphenol derivatives having a diphenylheptanoid skeleton, sanguinarine, bufazienolide, and methyl 10-hydroxy-2,4a, 6a, 9, Compounds such as 12b, 14a-hexamethyl-11-oxo-1,2,3,4,4a, 5,6,6a, 11,12b, 13,14,14a, 14b-tetradecahydropicene-2-carboxylate, etc. Or the salt thereof.
  • catechin compounds which are polyoxy derivatives of 3-oxyflavan (for example, epigallocatechin gallate and its derivatives, etc.), benzoquinone and its derivatives, hydrogen peroxide and the like can also be mentioned.
  • sulforaphane and its derivatives, curcumin and its derivatives are particularly preferable.
  • Examples of sulforaphane and its derivatives include sulforaphane, sulforaphane glucosinolate, sulforaphane nitrile and the like.
  • Examples of curcumin and its derivatives include curcumin, demethoxycurcumin, bisdemethoxycurcumin and the like.
  • Examples of the catechin compound include catechin, epicatechin, gallocatechin, epigalocatechin, catechin gallate, epicatechin gallate, gallocatechin gallate, epigallocatechin gallate and the like.
  • Examples of benzoquinone and its derivatives include 1,4-benzoquinone, 1,2-benzoquinone and the like.
  • the CCDC gene which is a non-coding RNA, has an effect of suppressing the expression of selenoprotein P.
  • the region of the CCDC gene may be a region that has an effect of suppressing the expression of selenoprotein P by overexpressing it, and is not particularly limited, but is not particularly limited, for example, NCBI ACCESSION No. NM_001134848; VERSION. Examples thereof include a gene having the base sequence (SEQ ID NO: 26) described in No. NM_001134848.1, particularly a gene consisting of the base sequence.
  • mutant of the base sequence shown in SEQ ID NO: 26 is also included in the CCDC gene, as long as it has the effect of suppressing the expression of selenoprotein P.
  • Such mutants are not particularly limited.
  • a variant in which one or more bases are mutated such as insertion, addition or deletion with respect to the base sequence shown in SEQ ID NO: 26 can be mentioned.
  • the degree of such mutation is not particularly limited as long as it is within the range in which the above effects are exhibited.
  • the homology of the base sequence before and after the mutation can be usually about 90% or more, preferably about 95% or more, and more preferably about 98% or more.
  • nucleic acids designed to generate the CCDC gene in vivo are also included in the components that inhibit selenoprotein P.
  • examples of such nucleic acids include expression vectors constructed to express the CCDC gene.
  • the present invention provides a prophylactic or therapeutic agent for GBM containing a component having an inhibitory effect on selenoprotein P.
  • the target disease of the prophylactic or therapeutic agent in the present embodiment is GBM, and among them, GBM in which the expression level of selenoprotein P is high is preferable.
  • the patients to be treated include GBM patients having a high expression level of selenoprotein P. preferable.
  • the component having an inhibitory action on selenoprotein P those listed above are preferably used.
  • one type of component having an inhibitory effect on selenoprotein P may be used alone, or two or more types may be mixed and used.
  • the GBM prophylactic or therapeutic agent of the present invention may further contain an existing GBM therapeutic agent (eg, temozolomide, bevacizumab, glioblastoma, nidoran, etc., preferably temozolomide, etc.).
  • the content of the above-mentioned component having an inhibitory effect on selenoprotein P in the GBM prophylactic or therapeutic agent according to the present invention is usually about 0.001 to 100 weight by weight with respect to 100 parts by weight of the GBM prophylactic or therapeutic agent. And it is sufficient. That is, the above-mentioned component itself having an inhibitory effect on selenoprotein P may be used as a prophylactic or therapeutic agent for GBM according to the present invention.
  • the GBM prophylactic or therapeutic agent according to the present invention may contain a known pharmaceutically acceptable carrier or additive used in producing a composition in the pharmaceutical field.
  • a known pharmaceutically acceptable carrier or additive used in producing a composition in the pharmaceutical field.
  • Specific examples of such carriers or additives include arbitrary carriers, diluents, excipients, suspending agents, lubricants, adjuvants, media, delivery systems, emulsifiers, tablet degradants, absorbents, preservatives, surfactants. Examples thereof include activators, colorants, fragrances, sweeteners and the like.
  • the GBM prophylactic or therapeutic agent according to the present invention can be formed into any dosage form by appropriately combining the above carriers or formulations.
  • specific dosage forms include intraventricular injections, intravenous injections, infusions, implantable injections, continuous injections and other injections; uncoated tablets, sugar-coated tablets, film-coated tablets, enteric coated tablets.
  • the target animal for using the intracellular uptake inhibitor of selenoprotein P according to the present invention is not limited to humans as long as it is a living body, and any individual animal can be targeted.
  • experimental animals such as mice, rats, rabbits, hamsters, guinea pigs, monkeys and chimpanzees; pet animals such as dogs and cats; and all other animal species requiring protection.
  • the method for administering the GBM prophylactic or therapeutic agent according to the present invention is not particularly limited, and a known administration method may be adopted in consideration of the above-mentioned administration target, dosage form and the like. Specific examples thereof include oral administration, intramuscular injection, intravenous administration, intraarterial administration, intraarachnoid space, intraventricular administration, and the like.
  • the dose of the preventive or therapeutic agent for GBM according to the present invention may be usually about 1 to 10 mg / kg, and if the animal to be administered is a mouse, the dose is usually 1 to 1 to 10. It may be about 10 mg / kg. For other animals to be administered, it can be appropriately set based on the above-mentioned doses in humans and mice.
  • the amount of the GBM prophylactic or therapeutic agent according to the present invention is usually 0.5 to 50 mg in terms of the amount of the above-mentioned component having an inhibitory effect on selenoprotein P. It may be used in an amount of about / kg (individual body weight).
  • the GBM prophylactic or therapeutic agent according to the present invention may be administered in the above amount once a day or in several divided doses.
  • the administration interval may be daily, every other day, every other week, every two to three weeks, every month, every other month, or every two to three months as long as it has a therapeutic effect on the above-mentioned diseases.
  • two or more kinds of GBM prophylactic or therapeutic agents containing components having different selenoprotein P inhibitory effects may be used in combination, and the GBM prophylactic or therapeutic agent according to the present invention may be used as an existing GBM prophylactic or therapeutic agent. It can also be used in combination with temozolomide or the like.
  • Prognosis determination method 3-1 Prognosis determination method using brain tumor tissue of glioblastoma patient
  • the present invention determines the degree of expression or function of selenoprotein P or ApoER2, and determines the prognosis of glioblastoma. Provide a method as an index for doing so.
  • the present embodiment is a method for determining the prognosis of GBM, which comprises a step of measuring the expression level or the degree of function of serenoprotein P or ApoER2 in GBM cells collected from the brain tumor tissue of a glioblastoma patient.
  • the disease activity of GBM is determined based on the expression level or the degree of function of glioblastoma P or ApoER2, and the prognosis of GBM is determined based on the disease activity.
  • the steps for measuring the expression level or the degree of function of selenoprotein P or ApoER2 in GBM cells collected from the brain tumor tissue of a glioblastoma patient are as follows.
  • a step of culturing GBM cells is performed.
  • the GBM cell include tumor cells collected from the brain tumor tissue of a glioblastoma patient, and those known in the technical field to which the present invention belongs can be used.
  • the GBM cell may be a primary cultured cell or a cell subcultured in a suitable medium.
  • a medium that can be used for culturing GBM cells can be appropriately used, and for example, RPMI-1640 medium, D'MEM medium, E'MEM.
  • Examples include a medium.
  • FBS, penicillin, streptomycin, sodium selenite and the like may be added to the above medium. Since the content of selenium is low in FBS, it is preferable to add sodium selenite when adding FBS to the medium.
  • the amount of sodium selenite added is preferably 5 to 2000 nM, more preferably 50 to 200 nM.
  • a pH adjuster, sodium hydrogencarbonate, or the like may be added to the medium as an option.
  • the medium for culturing the GBM cells in the presence of the test substance the medium exemplified for the subculture can be used.
  • the concentration of the test substance in the medium is not particularly limited, but can be set, for example, in the range of 0.1 to 100 ⁇ g / mL, preferably 1 to 20 ⁇ g / mL.
  • the culture temperature is preferably in the range of 36 to 38 ° C.
  • the pH of the medium is preferably 7.3 to 7.6.
  • the culture time can be set in the range of 12 to 72 hours, preferably 24 to 36 hours.
  • selenoprotein P consists of the amino acid sequence set forth in SEQ ID NO: 21 and ApoER2 consists of the amino acid sequence set forth in SEQ ID NO: 39.
  • the step of measuring the expression level of selenoprotein P in GBM cells will be described below.
  • the expression level of selenoprotein P is measured by quantifying the mRNA of selenoprotein P or by quantifying the protein amount of selenoprotein P.
  • the quantification of selenoprotein P mRNA is carried out by a known method such as RT-PCR method or Northern blotting method using RNA isolated from cells cultured under the above culture conditions or complementary polynucleotide transcribed from the RNA. be able to.
  • An internal standard target gene can be used for quantification of selenoprotein P mRNA, and examples of the internal standard target gene include GAPDH mRNA and Actin mRNA.
  • a known method for quantifying the amount of protein of selenoprotein P a known method such as Western blotting using an antibody that recognizes selenoprotein P can be used for the lysate of cells cultured under the above culture conditions.
  • the antibody that recognizes selenoprotein P for example, the antibody described in "Antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P" can be used.
  • the prognosis is determined by comparing the expression level of selenoprotein P mRNA or selenoprotein P protein in GBM cells with a preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • the membrane fraction of GBM cells is isolated according to a conventional method, and in the presence or absence of a test substance. Then, a method of contacting the labeled selenoprotein P and comparing the amount of selenoprotein P bound to the cell membrane fraction in the presence and absence of the test substance can be mentioned.
  • the binding protein of selenoprotein P include ApoER2 and the like.
  • the prognosis is determined by comparing the amount of selenoprotein P bound to the cell membrane fraction of GBM cells with a preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • an antibody that recognizes glutathione peroxidase was used against the lysate of cells cultured in the presence and absence of the test substance.
  • a known method such as Western blotting can be used.
  • an antibody that recognizes glutathione peroxidase for example, an antibody such as ab22604 (Abcam, Anti-Glutathione peroxidase 1), ab125066 (Abcam, Anti-Glutathione peroxidase 4) can be used.
  • the prognosis is determined by comparing the amount of glutathione peroxidase in the lysate of GBM cells with a preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • the step of measuring the expression level of ApoER2 in GBM cells will be described below.
  • the expression level of ApoER2 is measured by quantifying the mRNA of ApoER2 or by quantifying the amount of protein of ApoER2.
  • the quantification of ApoER2 mRNA can be performed by a known method such as RT-PCR method or Northern blotting method using RNA isolated from cells cultured under the above culture conditions or complementary polynucleotide transcribed from the RNA. can.
  • An internal standard target gene can be used for quantification of ApoER2 mRNA, and examples of the internal standard target gene include GAPDH mRNA and Actin mRNA.
  • a known method such as Western blotting using an antibody that recognizes ApoER2 or immunohistochemical staining can be used for the lysate of cells cultured under the above culture conditions.
  • an antibody that recognizes ApoER2 for example, Anti-ApoER2 antibody [EPR3326] (ab108208) can be used.
  • the prognosis is determined by comparing the expression level of ApoER2 mRNA or ApoER2 in GBM cells with a preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • Functions of ApoER2 include binding of ApoER2 to its binding protein (selenoprotein P, etc.). Therefore, as a method for measuring the degree of function of ApoER2, attention can be paid to the binding inhibitory activity between ApoER2 and its binding protein, the intramolecular interaction between ApoER2 and its binding protein, and the like.
  • the membrane fraction of GBM cells was isolated according to a conventional method and labeled in the presence and absence of a test substance.
  • a method of contacting selenoprotein P and comparing the amount of selenoprotein P bound to the cell membrane fraction in the presence and absence of the test substance can be mentioned.
  • the prognosis is determined by comparing the amount of ApoER2 present in the cell membrane fraction of GBM cells with a preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • the prognosis is determined by comparing the analysis result of the intramolecular interaction in the absence of the test substance with the preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • the cutoff value can be set by a statistically conventional calculation method as the method for setting the cutoff value in the present embodiment.
  • the cutoff value is applied to the minimum p-value method determined by the logrank test. Can be set. It can also be set using an ROC curve or the like.
  • the method for determining the prognosis of GBM in the present embodiment is intended to be able to evaluate a statistically significant proportion of subjects. Therefore, the method for determining the prognosis of GBM according to the present invention includes the case where correct results cannot always be obtained for all of the evaluation targets (that is, 100%). Statistically superior proportions can be determined using various well-known statistical tabulation tools such as confidence interval determination, p-value determination, Student's t-test, Mann-Whitney test, and the like. It was
  • the present invention uses the selenoprotein P concentration or a specific element concentration in the blood of a glioblastoma patient to determine the prognosis of glioblastoma.
  • a method as an index for determining a method for determining the prognosis of GBM, which comprises a step of measuring a selenoprotein P concentration in the blood of a glioblastoma patient or a specific element concentration, and comprises a step of measuring the selenoprotein P concentration in the blood.
  • the disease activity of GBM is determined based on a specific element concentration
  • the prognosis of GBM is determined based on the disease activity.
  • an ELISA method using an antibody that recognizes selenoprotein P For the measurement of the selenoprotein P concentration in the blood of a glioblastoma patient, an ELISA method using an antibody that recognizes selenoprotein P, a western blotting method, an immunoprecipitation method, a radioimmunoassay method, etc. It can be carried out by using a known method of.
  • the antibody that recognizes selenoprotein P for example, the antibody described in "Antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P" can be used.
  • the prognosis is determined by comparing the selenoprotein P concentration in the blood with the preset cutoff value. For example, if it is equal to or higher than a preset cutoff value, it can be determined that there is a possibility of poor prognosis.
  • ICP mass spectrometry As a measurement of a specific element concentration in the blood of a glioblastoma patient, ICP mass spectrometry, colorimetric method, atomic absorption spectrometry, X-ray fluorescence spectrometry, ion chromatograph, ICP emission spectrometry are performed on the blood component of the subject. It can be carried out by using a known element concentration measuring method such as a method.
  • the specific element include Se, Zn, Cu, Fe, V, Cr, K, Ca, Mn, Co, As, Mo, Ag, Cd, Na, Mg, Al, Si, P, S, Ni and Sn. , Sb, Hg, Pb, preferably Se, Zn, Cu, Fe, V, Cr, K, Ca, Mn, Co, As, Mo, Ag, Cd.
  • the prognosis is determined by comparing the concentration of the specific element in blood with a preset cutoff value. For example, for Se, V, Ca, Mn, Mo, Ag, and Cd, if it is at least a preset cutoff value, it can be determined that there is a possibility of poor prognosis. Further, if Zn, Cu, Fe, Cr, K, Co, and As are equal to or less than the preset cutoff values, it can be determined that the prognosis may be poor.
  • the cutoff value can be set by a statistically conventional calculation method as the method for setting the cutoff value in the present embodiment.
  • the cutoff value is applied to the minimum p-value method determined by the logrank test. Can be set. It can also be set using an ROC curve or the like.
  • the method for determining the prognosis of GBM in the present embodiment is intended to be able to evaluate a statistically significant proportion of subjects. Therefore, the method for determining the prognosis of GBM according to the present invention includes the case where correct results cannot always be obtained for all of the evaluation targets (that is, 100%). Statistically superior proportions can be determined using various well-known statistical tabulation tools such as confidence interval determination, p-value determination, Student's t-test, Mann-Whitney test, and the like. It was
  • tissue staining by tissue staining the brain tumor tissue of a glioblastoma patient, the expression of selenoprotein P in GBM cells is qualitatively observed to determine the prognosis. It is also possible to do.
  • tissue staining include immunohistochemical staining, immunoblotting and the like, and immunohistochemical staining is preferably used.
  • an antibody that recognizes selenoprotein P is used in brain tumor tissue, if expression of selenoprotein P is observed, it can be determined that the prognosis may be poor.
  • the antibody that recognizes selenoprotein P for example, the antibody described in "Antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P" can be used.
  • Immunohistochemical staining using brain tumor tissue of glioblastoma patients can be performed according to a known method. Immunohistochemical staining is preferably performed on a fixed tissue specimen prepared by fixing the tissue specimen to be evaluated. Physical modification with temperature and / or pressure (eg, thermal coagulation, freezing, etc.) may be used for fixation, but chemical treatment with a fixative is preferred.
  • the fixative is not particularly limited, but is, for example, formalin fixative, phosphate buffered formalin fixative, paraformaldehyde fixative, glutaaldehyde fixative, buoy fixative, zamboni fixative, osmium fixative, zinc fixative, Hollande.
  • fixatives examples include fixatives, alcohol fixatives, alcohol / formalin fixatives, FAA fixatives and the like.
  • Preferred fixatives include formalin fixatives, phosphate buffered formalin fixatives and the like. These can be used alone or in combination of two or more. Further, additives such as buffers, salts and sugars may be used in combination as appropriate.
  • the fixed time can be appropriately determined as appropriate, and is preferably 24 hours to 48 hours.
  • the fixed temperature is preferably 15 to 25 ° C.
  • the fixed tissue specimen can be observed with an optical microscope, for example, after further cutting, dehydrating, embedding, slicing, and / or staining.
  • the cutout may be performed by reducing the size of the specimen to a size suitable for observation and making it easier to observe the lesioned part and the normal part in the specimen.
  • the embedding method is not particularly limited, and examples thereof include a paraffin embedding method, a celloidin embedding method, an OCT compound embedding method, a gelatin embedding method, and a synthetic resin embedding method.
  • a microtome may be used for slicing.
  • the target antigen in the specimen may be activated in some cases. , The staining may be enhanced. It was
  • the method for activating the antigen is not particularly limited, but is, for example, treatment with a proteolytic enzyme such as pepsin, trypsin, pronase or protein kinase K; heat treatment by microwave, autoclave or boiling; alkali or acid (for example, hydrochloric acid or Treatment with formic acid) and the like can be mentioned.
  • a method using a citric acid buffer or a neutral buffer is preferable.
  • the antigen activation treatment is preferably carried out at room temperature for 1 to 5 minutes.
  • the antibody causes a non-specific adsorption reaction with other than the target protein
  • pretreatment using a blocking agent can be performed in order to prevent non-specific adsorption.
  • the blocking agent include biological proteins such as normal serum (eg, goat, horse, rabbit, etc.), bovine serum albumin, gelatin, skim milk, and the like.
  • surfactants for example, TWEEN (registered trademark) 20 etc.
  • hydroxyalkyl cellulose for example, TWEEN (registered trademark) 20 etc.
  • polyvinyl alcohol polyvinyl alcohol and the like
  • an enzyme antibody method may be used in which the antibody is labeled with a specific enzyme, the substrate is reacted, and the coloration of the formed dye product is observed with an optical microscope or the like.
  • the enzyme antibody method a known method can be used, for example, a direct method in which a primary antibody is labeled and an antigen-antibody reaction is performed only once, and a first antigen-antibody reaction using an unlabeled primary antibody. This is an indirect method in which the primary antibody itself is used as an antigen, another antibody (secondary antibody) is labeled, and the reaction is further carried out to carry out an antigen-antibody reaction two or more times.
  • Indirect methods include the PAP method using a soluble immune complex (PAP) of peroxidase / anti-peroxidase antibody, the LAB (Linked Avidin-Biotin) method, the ABC method using an avidin / biotin complex, and the LSAB (Linked) using streptavidin.
  • PAP soluble immune complex
  • LAB Linked Avidin-Biotin
  • ABC avidin / biotin complex
  • LSAB Linked
  • the color development method in the enzyme antibody method is not limited, but for example, the DAB method in which peroxidase is reacted with the color-developing substrate diaminobenzidine (DAB) as a labeling enzyme; the DAB method is performed in the presence of nickel ions, the nickel DAB method; A method of reacting peroxidase with the color-developing substrate aminoethylcarbazole (AEC); or a method of reacting an alkali phosphatase as a labeling enzyme with the color-developing substrate BCIP / NBT, a method of reacting with the color-developing substrate Fast Red, or a method of reacting with the color-developing substrate Fast. Examples thereof include a method of reacting with Blue.
  • the antibody of the present invention (concentration 20 to 40 ⁇ g / mL) is added to a specimen as a primary antibody, and the sample is reacted at 4 ° C to room temperature for 1 to 12 hours, and then the primary antibody is washed. Then, a labeled antibody (concentration 1 to 10 ⁇ g / mL) is added as a secondary antibody, and the reaction is carried out at 4 ° C. to room temperature for 30 minutes to 12 hours, and then the secondary antibody is washed and then colored. You may. Alternatively, the ABC method may be used to increase the detection sensitivity.
  • the antibodies of the present invention concentration 20 to 40 ⁇ g / mL
  • an autoradiography method in which a radioactive isotope is bound to an antibody and exposed to a printing paper; the antibody is bound to a visible substance such as gold particles.
  • Colloidal gold method for observing with an electron microscope or the like; a fluorescent antibody method may be used in which an antibody is labeled with a fluorescent dye, and after an antigen-antibody reaction, an excitation wavelength is applied to develop fluorescent color and the antibody is observed with a fluorescent microscope.
  • the preferred conditions for immunohistochemical staining are autoclave 121 ° C. for 5 minutes treatment with a neutral buffer for antigen activation, and the antibody of the present invention as the primary antibody in a concentration range of 2 to 40 ⁇ g / mL. Conditions used at (preferably 21.25 ⁇ g / mL) can be mentioned.
  • the present invention determines the expression level or the degree of function of selenoprotein P or ApoER2, and the efficacy or administration of the preventive or therapeutic agent for GBM of the present invention.
  • a method as an index for determining the propriety of the above it is a method for determining the efficacy or administration of the preventive or therapeutic agent for GBM of the present invention, and the expression level or function of selenoprotein P or ApoER2 in a biological sample of a gliobrostoma patient.
  • the high sensitivity to the component having an inhibitory effect on selenoprotein P is determined based on the expression level or the degree of function of selenoprotein P or ApoER2, and based on the high sensitivity, Whether or not the prophylactic or therapeutic agent for GBM of the present invention is effective or administerable is determined.
  • the biological sample of the glioblastoma patient is not particularly limited, and examples thereof include brain tumor tissue and blood, and brain tumor tissue is preferable.
  • the step of measuring the expression level or the degree of function of selenoprotein P or ApoER2 in a biological sample of a glioblastoma patient is "3-1 prognosis determination method using brain tumor tissue of glioblastoma patient” or "3-2 glioblastoma”.
  • the measurement method described in the section "Prognosis determination method using blood of glioblastoma patient” is preferably used.
  • the measured value of the expression level or the degree of function of selenoprotein P or ApoER2 in the biological sample of the glioblastoma patient is compared with the preset cutoff value, and the sensitivity to the component having an inhibitory effect on selenoprotein P is high. Is determined. For example, if it is equal to or higher than a preset cutoff value, it can be determined that the sensitivity to a component having an inhibitory effect on selenoprotein P may be high.
  • the prophylactic or therapeutic agent for GBM of the present invention is likely to act effectively, or the GBM of the present invention. It can be determined that the prophylactic or therapeutic agent can be administered to the glioblastoma patient to be tested. On the other hand, when it is determined that the sensitivity to the component having an inhibitory effect on selenoprotein P may be low, it is unlikely that the preventive or therapeutic agent for GBM of the present invention acts effectively, or the present invention It can be determined that the preventive or therapeutic agent for GBM cannot be administered to the glioblastoma patient to be tested.
  • the prophylactic or therapeutic agent for GBM of the present invention is likely to act effectively by the above-mentioned determination method, or the prophylactic or therapeutic agent for GBM of the present invention is administered to a gliobrostoma patient as a subject.
  • a method for treating glioblastoma which comprises a step of administering a prophylactic or therapeutic agent for GBM of the present invention to a glioblastoma patient as a subject determined to be possible.
  • the dose of the preventive or therapeutic agent for GBM of the present invention is usually about 0.5 to 50 mg / kg (individual body weight) in terms of the amount of the component having an inhibitory effect on selenoprotein P of the present invention. It may be used in quantity.
  • the GBM prophylactic or therapeutic agent according to the present invention may be administered in the above amount once a day or in several divided doses.
  • the administration interval may be daily, every other day, every week, every other week, every two to three weeks, every month, every other month, or every two to three months, as long as it has a therapeutic effect on glioblastoma.
  • two or more kinds of prophylactic or therapeutic agents for glioblastoma containing components having different selenoprotein P inhibitory effects may be used in combination, and the prophylactic or therapeutic agent for glioblastoma according to the present invention may be used as an existing glioblastoma. It can also be used in combination with temozolomide, which is a prophylactic or therapeutic drug for glioblastoma.
  • a diagnostic agent for determining the efficacy or administration of the preventive or therapeutic agent for GBM of the present invention is provided.
  • the component of the diagnostic agent is not particularly limited as long as it can quantitatively evaluate the expression level or the degree of function of selenoprotein P or ApoER2, but an antibody that recognizes selenoprotein P or an antibody that recognizes ApoER2 is preferably used. Be done.
  • the antibody that recognizes selenoprotein P include the antibody described in "Antibody that specifically binds to an epitope present in the amino acid sequence of selenoprotein P".
  • Examples of the antibody that recognizes ApoER2 include Anti-ApoER2 antibody [EPR3326] (ab108208).
  • T98G, YKG1, and A172 cells were obtained from the Cell Bank of the Institute of Aging Medicine, Tohoku University.
  • T98G and A172 are RPMI-1640 medium (10% FBS, 10 Units / mL penicillin, 10 ⁇ g / mL streptomycin)
  • YKG1 is D'MEM (10% FBS, 10 Units / mL penicillin, 10 ⁇ g / mL streptomycin).
  • the cells were cultured in a wet incubator under the conditions of 37 ° C., 5% CO 2 , 95% indoor air.
  • Sodium selenite (100 nM) maintained and subcultured in the presence or absence of each for 2 weeks or more was used for each experiment.
  • Example 1 Examination of mRNA level of selenoprotein P by qPCR> Each cell was seeded on a 12-well plate (A172: 7 ⁇ 10 4 cells / well, T98G, YKG1: 1 ⁇ 10 5 cells / well), washed with PBS after 24 hours, and attached with Isogen2 (Nippon Gene). Total RNA was adjusted according to the instructions. The reverse transcription reaction was carried out at PrimeScript RT (Takara) according to the attached instructions. Quantitative PCR was performed by KAPA SYBR® (KAPA Bioscience) using the Thermal Cycle Disk real time system (Takara). The PCR reaction cycle consists of one cycle of 95 ° C. for 30 seconds, then 40 cycles of 95 ° C.
  • the measured mRNA amount of selenoprotein P was corrected using the GAPDH mRNA level as an internal standard target gene.
  • the sequence of primers used for quantitative PCR is shown below.
  • Example 2 Measurement of cell viability> Each cell was seeded on a 96-well plate at 3.5 ⁇ 10 3 cells / well, and after 24 hours, the medium was replaced with a temozolomide-containing medium. After 72 hours, the medium was replaced with a medium containing 10% AramarBlue and cultured for 2 hours. After coloration, firefly light of AramarBlue was measured with a plate reader at an excitation wavelength of 544 nm and a fluorescence wavelength of 590 nm (SpectraMax iD5, Molecular Devices). The results are shown in FIG. As shown in FIG. 2, it was found that the temozolomide sensitivity of T98G was lower than that of A172 in the presence of selenous acid. From this result, it was found that there is a correlation between the expression level of selenoprotein P and the sensitivity to temozolomide.
  • Example 3 Measurement of cell proliferation rate> Each cell was seeded on a 6-well plate at 7 ⁇ 10 4 cells / well, and after a predetermined time, the cells were treated with trypsin, the detached cells were collected, and cell counting was performed after trypan blue staining. The results are shown in FIG. From FIG. 3, it was suggested that the cells having a high expression level of selenoprotein P among the glioblastoma cells had a faster cell proliferation rate.
  • Example 4 Selenoprotein P expression suppression>
  • the siRNA for selenoprotein P used had the following sequence.
  • MISSION siRNA Universal Negative Control (Sigma) was used.
  • T98G cells (2.0 ⁇ 10 5 cells / well) were seeded on the 6-well plate, and 24 hours later, each siRNA was transfected. After further culturing for 24 hours, the cells were reseeded into a 6-well plate so as to have 7 ⁇ 10 4 cells / well, and the increase in the number of cells over time was measured by the method described in Example 3. The amount of mRNA level was measured by the method described in Example 1. The results are shown in FIGS. 4 and 5. From this result, it was clarified that the cell proliferation rate was significantly reduced in T98G cells in which selenoprotein P was knocked down by siRNA.
  • Example 5 Examination of an antibody that specifically binds to selenoprotein P> AA3 and BD3, which are antibodies (neutralizing antibodies) that specifically bind to selenoprotein P, were used for the study.
  • culture without addition of neutralizing antibody and culture with addition of IgG were also examined. Then, the increase in the number of cells over time was measured for each by the method described in Example 3. The results are shown in FIG. From this result, it was clarified that the antibody that specifically binds to selenoprotein P has an effect of suppressing cell proliferation of T98G.
  • Example 7 Suppression of ApoER2 expression> Transfection of siRNA of ApoER2, which is a selenoprotein P receptor, was performed by the forward transfection method in Lipofectamine RNAiMAX according to the attached instructions. T98G cells (2.0 ⁇ 10 5 cells / well) were seeded on the 6-well plate, and 24 hours later, each siRNA was transfected. After further culturing for 24 hours, the cells were reseeded into a 6-well plate to 7 ⁇ 10 4 cells / well, and the mRNA after 48 hours was measured by the method described in Example 1. In addition, cell proliferation at 72 hours was measured by the method described in Example 3. The results are shown in FIGS. 8 and 9.
  • siRNA had the following sequence.
  • Control siRNA MISSION siRNA Universal Negative Control (Sigma) was used.
  • ApoER2 siRNA # 1 (# 1) forward: CGCUGAUCUCCUCCACUGA [dT] [dT] (SEQ ID NO: 33) reverse: UCAGUGGAGAGAGAUCAGCG [dT] [dT] (SEQ ID NO: 34)
  • ApoER2 siRNA # 2 (# 2) forward: GUGACCUCUCCUACCGUAA [dT] [dT] (SEQ ID NO: 35) reverse: UUACGGUAGGAGAGGUCAC [dT] [dT] (SEQ ID NO: 36)
  • ApoER2 siRNA # 3 (# 3) forward: GACCUACUGACCAAGAACU [dT] [dT] (SEQ ID NO: 37) reverse: AGUUCUGGUCAGUAGGUC [dT] [dT] (SEQ ID NO: 38)
  • Example 8 Confirmation of the effect of a compound having a selenoprotein P inhibitory effect on cell proliferation> T98G cells were seeded on a 96-well plate at 3.5 ⁇ 10 3 cells / well (similar to Example 2), and 24 hours later, each selenoprotein P inhibitor (sulforaphan (SFN), curcumin (CCM)) was placed in the medium. , Epigallocatechin gallate (EGCg), 1,4-benzoquinone (p-benzoquinone)) was added. The effect of T98G on the cell viability (proliferation) after 24, 48, and 72 hours was examined by the same AramarBlue method as in Example 2. The results are shown in FIG. As shown in FIG. 10, selenoprotein P inhibitors have been shown to significantly reduce the cell viability of T98G.
  • SFN selenoprotein P inhibitor
  • CCM curcumin
  • Example 9 Examination of CCDC gene expression conditions in T98G>
  • the CCDC expression plasmid that suppresses selenoprotein P expression was carried out with polyethyleneimine (PEI MAX) according to the attached instructions.
  • PET cells 2.5 ⁇ 10 5 cells / well
  • the transfection mix meaning
  • CCDC mRNA was quantified by the same method as in Example 1. The results are shown in FIG. From this result, high expression of the CCDC gene in T98G was confirmed.
  • Example 10 Confirmation of the effect of high expression of CCDC gene on T98G on cell proliferation>
  • the CCDC expression plasmid was carried out with polyethyleneimine (PEIMAX) in the same manner as in Example 9 according to the attached instructions.
  • T98G cells (2.5 ⁇ 10 5 cells / well) were seeded on a 6-well plate, and 24 hours later, a transfection mix was prepared at a ratio of 2.5 ⁇ g of DNA / 5 ⁇ L of PEI and added to the medium.
  • Example 11 Selenoprotein P immunohistochemical staining in human brain tumor tissue>
  • tissue sections of brain tumor patients were immunostained with selenoprotein P antibody (BD1) by the following method, there were cases of staining in glioblastoma patients.
  • the results are shown in FIG. FIG. 13A shows an image of a human brain tumor tissue not a glioblastoma patient
  • FIG. 13B shows an image of a human brain tumor tissue of a glioblastoma patient.
  • human brain tumor tissues of glioblastoma patients were immunostained with selenoprotein P antibody.
  • the immunostaining method is as follows.
  • the specimen was immersed in methanol supplemented with 0.3% H2O 2 and reacted for 30 minutes, then the specimen was washed with PBS and then a biotin-labeled antibody (4 ⁇ g / g /) as a secondary antibody. mL) was added and reacted at room temperature for 30 minutes, then washed with PBS, then HRP-labeled streptavidin was added and reacted at room temperature for 30 minutes, and then washed with PBS.
  • Example 12 Selenoprotein P immunohistochemical staining in human brain tumor tissue> Selenoprotein P in plasma of brain tumor patients (23 samples) and plasma of healthy subjects (261 samples) was quantified by the sandwich ELISA method using AA3 antibody or BD1 antibody (both antibodies against selenoprotein P). The results are shown in Table 1. As a result of ELISA with BD1 antibody, a slight and significant increase in plasma selenoprotein P was observed in patients with brain tumors.
  • Example 13 Elemental analysis in crystals of brain tumor patient> 100 ⁇ L of plasma of brain tumor patients (44 samples) and plasma of healthy subjects (261 samples) were incinerated with 500 ⁇ L of 70% nitrate, diluted with 1400 ⁇ L of milliQ water, and then the elements in the sample were collected by ICP / MS (Agilent). Was quantitatively analyzed. The results are shown in Table 2 and FIG. Significant changes in 14 elements were observed in patients with brain tumors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Emergency Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)

Abstract

Le problème à la base de la présente invention concerne : un agent thérapeutique pour le glioblastome ; un procédé de criblage ; un procédé de détermination de l'efficacité d'un agent thérapeutique ; et un procédé de détermination d'un pronostic. Dans la présente invention, un procédé de criblage est réalisé à l'aide de la sélénoprotéine P en tant que molécule cible pour le GBM pour fournir un agent thérapeutique pour le GBM qui comprend un constituant présentant un effet inhibiteur de la sélénoprotéine P. De plus, la quantité d'expression de la sélénoprotéine P ou similaire est utilisée en tant que mesure pour la détermination de l'efficacité d'un agent thérapeutique pour le GBM et d'une mesure pour la détermination d'un pronostic.
PCT/JP2021/037488 2020-10-09 2021-10-08 Agent thérapeutique pour glioblastome, procédé de criblage, procédé de détermination d'efficacité et procédé de détermination de pronostic WO2022075478A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2020-171561 2020-10-09
JP2020171561 2020-10-09

Publications (1)

Publication Number Publication Date
WO2022075478A1 true WO2022075478A1 (fr) 2022-04-14

Family

ID=81126530

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2021/037488 WO2022075478A1 (fr) 2020-10-09 2021-10-08 Agent thérapeutique pour glioblastome, procédé de criblage, procédé de détermination d'efficacité et procédé de détermination de pronostic

Country Status (1)

Country Link
WO (1) WO2022075478A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080254033A1 (en) * 2004-01-21 2008-10-16 Kristen Pierce Pharmaceutical Compositions Containing Antagonists to Lrp4, Lrp8 or Megalin for Treatment of Diseases
WO2009068322A1 (fr) * 2007-11-27 2009-06-04 Max-Planck-Gesellschaft Zur Förderung Der Wissens Chaften E.V. Inhibition sélective de la polo-like kinase 1
US20140011702A1 (en) * 2011-03-23 2014-01-09 Centre Hospitalier Universitaire Pontchaillou Biomarkers and methods for the prognosis of glioblastoma
JP2019006773A (ja) * 2017-06-23 2019-01-17 学校法人同志社 セレノプロテインｐの発現抑制剤及びその利用
US20200255838A1 (en) * 2017-09-07 2020-08-13 University Of Massachusetts Selenium Cancer Therapy

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080254033A1 (en) * 2004-01-21 2008-10-16 Kristen Pierce Pharmaceutical Compositions Containing Antagonists to Lrp4, Lrp8 or Megalin for Treatment of Diseases
WO2009068322A1 (fr) * 2007-11-27 2009-06-04 Max-Planck-Gesellschaft Zur Förderung Der Wissens Chaften E.V. Inhibition sélective de la polo-like kinase 1
US20140011702A1 (en) * 2011-03-23 2014-01-09 Centre Hospitalier Universitaire Pontchaillou Biomarkers and methods for the prognosis of glioblastoma
JP2019006773A (ja) * 2017-06-23 2019-01-17 学校法人同志社 セレノプロテインｐの発現抑制剤及びその利用
US20200255838A1 (en) * 2017-09-07 2020-08-13 University Of Massachusetts Selenium Cancer Therapy

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
MIAO ZIWEI, YU FEI, REN YAHAO, YANG JUN: "d,l-Sulforaphane Induces ROS-Dependent Apoptosis in Human Gliomablastoma Cells by Inactivating STAT3 Signaling Pathway", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 18, no. 1, 4 January 2017 (2017-01-04), pages 1 - 14, XP055919686, DOI: 10.3390/ijms18010072 *
OKUNO, TOMOFUMI: "28PA-am045 Effect of Amyloid beta on Human Astrocytoma U251 Cells", PROCEEDINGS OF THE PHARMACEUTICAL SOCIETY OF JAPAN; MARCH 25-28, 2015, vol. 135, 1 January 2015 (2015-01-01) - 28 March 2015 (2015-03-28), JP , pages 220, XP009535567, ISSN: 0918-9823 *
WANG ZEXIA; LIU FEI; LIAO WENLI; YU LIANGZHU; HU ZHENWU; LI MINCAI; XIA HONGLI: "Curcumin suppresses glioblastoma cell proliferation by p-AKT/mTOR pathway and increases the PTEN expression", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, ACADEMIC PRESS, US, vol. 689, 21 May 2020 (2020-05-21), US , XP086210474, ISSN: 0003-9861, DOI: 10.1016/j.abb.2020.108412 *
YOKOYAMA SHUNICHI, HIRANO HIROFUMI, WAKIMARU NARUHITO, SARKER KRISHNA PADA, KURATSU JUN-ICHI: "Inhibitory effect of epigallocatechin-gallate on brain tumor cell lines in vitro", NEURO-ONCOLOGY, 1 January 2001 (2001-01-01), XP055919683, Retrieved from the Internet <URL:https://watermark.silverchair.com/p22.pdf?token=AQECAHi208BE49Ooan9kkhW_Ercy7Dm3ZL_9Cf3qfKAc485ysgAAAuMwggLfBgkqhkiG9w0BBwagggLQMIICzAIBADCCAsUGCSqGSIb3DQEHATAeBglghkgBZQMEAS4wEQQMfXg2YquZM9O2rMCRAgEQgIIClnFq9d5kzMwO6EtTaIFki_AfQMUtlHpl3ldAqr-9NcAF55WNVmV1AV5nvK_ogkMoBfIauZn8v3Tl-_TK2lPNckAxSQrLHO1b0GUooU9Q1T3xofGO6kyxomk5HUpcocH1tZgcrhMqe1pGICsB7-dPdAwiH-ZtBp9lPuH1vNwfm5yCv1LsafpDcKuuCkRegNS9l015Xj3mN9ibf5mw4Ak7cMidu8zVXTeEHWeRXjx5vu6AZYmvimjIwomV6NVFxY7OcjSXdx6vptWcmTANXBfARi5k6f8YVCr6wrxjogrKimEhiESJh-bRQKovkxKg7TY-TFRXh36dTotvmQsdxQqqIVI4n2a3LgH2QTRW914BO-iP4uyckcgNZPHGd1A_Jild91ykIcjomkGNbm3ztUeHGvv_BRUo2dpe54oqMSKX-KeIUFnsWxgyZddkVD0raiqxjw-m-E2uKJEachEU106Iffn3i5FSfueX9kismGTYF-BeDtPLILPKptOZPjNM6-k0i9pG9JXqLIbYe3- *

Similar Documents

Publication Publication Date Title
JP6983746B2 (ja) 葉酸受容体１の検出用の抗体及びアッセイ
JP6666905B2 (ja) Ｐｄ−ｌ１抗体及びその使用
AU2015265976B2 (en) Anti-B7-H3 antibodies and diagnostic uses thereof
US20110027186A1 (en) Taz/wwtr1 for diagnosis and treatment of cancer
KR20150119164A (ko) Dll3 결합 시약을 포함하는 암에 대한 치료적 및 진단적 타겟
DK2876446T3 (en) Method for detecting cancer
CA2813098C (fr) Moyens et procedes de diagnostic du cancer en utilisant un anticorps se liant specifiquement a braf v600e
Yu et al. Mesothelin as a potential therapeutic target in human cholangiocarcinoma
JP6588893B2 (ja) 卵巣がんの自己抗体バイオマーカー
JP6599861B2 (ja) 男性不妊治療用の抗体、化合物、およびその誘導体
JP5654989B2 (ja) グッドパスチャー抗原結合タンパク質およびその検出
TW200427463A (en) Compositions and methods for the detection and treatment of methylthioadenosine phosphorylase deficient cancers
Frische et al. AE2 isoforms in rat kidney: immunohistochemical localization and regulation in response to chronic NH4Cl loading
WO2022075478A1 (fr) Agent thérapeutique pour glioblastome, procédé de criblage, procédé de détermination d&#39;efficacité et procédé de détermination de pronostic
DK2984108T3 (en) Anti-s100a7 antibodies for the treatment and diagnosis of cancer
WO2017173250A1 (fr) Procédés et compositions servant à l&#39;expression de sirt1 en tant que marqueur servant à l&#39;endométriose et la sous-fertilité
JP2014517911A (ja) アディポネクチン受容体ｃ末端フラグメント（ｃｔｆ）免疫グロブリン
KR20210126057A (ko) 암세포에 존재하는 케라틴 14(krt14)의 세포외 부분을 표적화함으로써 암을 치료하거나 예방하는 방법
AU2009246994B2 (en) Treatment prediction involving HMGCR protein
US20110189707A1 (en) Goodpasture Antigen Binding Protein and its Detection
KR101567053B1 (ko) 방사선 피폭에 의한 간 손상 예측용 바이오마커 및 그 예측방법
Yue Supplemental file
Anzai et al. Distribution of the organic anion transporters NaDC3 and OAT1-3 along the human nephron 2
JP2023132247A (ja) シヌクレイノパシー検出用バイオマーカー及びその利用
JP2022514077A (ja) 前立腺がん用の精液中のマーカーとしてのｍｃｍ５の使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21877777

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21877777

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP