WO2022070142A1 - METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF - Google Patents

METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF Download PDF

Info

Publication number
WO2022070142A1
WO2022070142A1 PCT/IB2021/059018 IB2021059018W WO2022070142A1 WO 2022070142 A1 WO2022070142 A1 WO 2022070142A1 IB 2021059018 W IB2021059018 W IB 2021059018W WO 2022070142 A1 WO2022070142 A1 WO 2022070142A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
mir
aimp2
seq
target sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2021/059018
Other languages
English (en)
French (fr)
Inventor
Jin Woo Choi
Kyunghwa BAEK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Generoath Co Ltd
Original Assignee
Generoath Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Generoath Co Ltd filed Critical Generoath Co Ltd
Priority to US18/246,578 priority Critical patent/US20240050527A1/en
Priority to CN202180066944.7A priority patent/CN116406304A/zh
Priority to CA3192711A priority patent/CA3192711A1/en
Priority to EP21874708.7A priority patent/EP4221760A4/en
Priority to JP2023519465A priority patent/JP2023544142A/ja
Priority to KR1020237014891A priority patent/KR20230110503A/ko
Priority to AU2021354969A priority patent/AU2021354969A1/en
Publication of WO2022070142A1 publication Critical patent/WO2022070142A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1761Apoptosis related proteins, e.g. Apoptotic protease-activating factor-1 (APAF-1), Bax, Bax-inhibitory protein(s)(BI; bax-I), Myeloid cell leukemia associated protein (MCL-1), Inhibitor of apoptosis [IAP] or Bcl-2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • a vector comprising AIMP2-DX2 and optionally a target sequence for miR-142.
  • AMD Age-related macular disease
  • AMD is the leading cause of vision loss in Europe, the United States and Australia. Almost two-thirds of the population over 80 years of age will have signs of AMD resulting from the wet or exudative form, which is characterized by the presence of drusen and CNV (subfoveal choroidal neovascularization).
  • AMD is a chronic progressive disease characterized by damage to the central retina zone. Changes in choriocapillaries, retinal pigment epithelium (RPE), and Bruch’s membrane (typical for aging) underlie AMD pathogenesis; however, the mechanisms launching the transfer of typical age-related changes in the pathological process are unknown.
  • “Dry” and “wet” forms of the disease are categorized. Approximately 90% cases are of the “dry” atrophic form of AMD; today, there is no method of its treatment. In the “dry” form of AMD, drusen are diagnosed in the macular area, pigment redistribution occurs, defects of pigment epithelium and the choriocapillary layer appear, and death of photoreceptors occurs against a background of RPE cell atrophy. “Wet” (exudative) form develops in -10% of AMD patients and is characterized by ingrowing of newly generated vessels through Bruch’s membrane defects under the retinal pigment epithelium or under neuroepithelium.
  • the model has proven to be suitable for testing the efficacy of new drugs through systemic or local (intraocular) administration and has shown predictive value for drug effects in patients with AMD, for example, with vascular endothelial growth factor receptor (VEGFR) trap or anecortave acetate (Telegina 2017).
  • AMD vascular endothelial growth factor receptor
  • VEGF vascular endothelial growth factor
  • bevacizumab (Genentech Inc., South San Francisco, CA; commercialized worldwide by Roche) is a full-length humanized antibody that binds and blocks all VEGF isoforms.
  • Oxidative stress can trigger apoptosis, which may activate and recruit macrophages and induce inflammation.
  • Apoptosis may be one of the triggers of the choroidal inflammation and consequently angiogenesis in CNV model (Du 2013).
  • AIMP2-DX2 is an alternative, antagonistic splicing variant of AIMP2, which is a multifactorial apoptotic gene.
  • AIMP2-DX2 is known to suppress cell apoptosis by hindering the functions of AIMP2.
  • AIMP2-DX2, acting as competitive inhibitor of AFMP2 suppresses TNF-alpha mediated apoptosis through inhibition of ubiquitination/degradation of TRAF2.
  • AIMP2-DX2 has been confirmed as an existing lung cancer induction factor and, in the existing research, it was confirmed that AIMP2-DX2, manifested extensively in cancer cells, induces cancer by interfering with the cancer suppression functions of AIMP2.
  • manifestation of AIMP2-DX2 in normal cell progresses cancerization of cells while suppression of manifestation of AIMP2-DX2, suppresses cancer growth, thereby displaying treatment effects.
  • AIMP2-DX2 can be useful in treating neuronal diseases (KR10-2015-0140723 (2017) and US2019/0298858 (2019).
  • AMD age-related macular disease
  • methods of treating age-related macular disease comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
  • the AMD is wet AMD.
  • the AMD is dry AMD.
  • the recombinant vector can further comprise an miR-142 target sequence.
  • the vector can further comprise a promoter operably linked to the AIMP2-DX2.
  • the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter or opsin promoter.
  • the miR-142 target sequence can be 3’ to the AIMP2-DX2 gene.
  • the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20.
  • the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20.
  • the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.
  • the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 10 or 11.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA.
  • the miR-142 target sequence comprises ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO: 5.
  • the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA).
  • the miR-142 target sequence can comprise a nucleotide sequence of SEQ ID NO:5.
  • the miR-142 target sequence comprises ACTTTA. In some embodiments, the miR-142 target sequence comprises ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7. In some embodiments, the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:7 (AGTAGTGCTTTCTACTTTATG). In some embodiments, the miR-142 target sequence comprises a nucleotide sequence of SEQ ID NO:7.
  • the miR-142 target sequence can be repeated 2-10 times in the vector disclosed herein.
  • the vector can be a viral vector.
  • the viral vector can be an adenovirus, adeno- associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), avian sarcoma/leukosis (ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), Herpes simplex virus, or vaccinia virus vector.
  • HIV human immunodeficiency virus
  • MMV murine leukemia virus
  • ASLV avian sarcoma/leukosis
  • SNV spleen necrosis virus
  • RSV Rous sarcoma virus
  • MMTV mouse mammary tumor virus
  • Herpes simplex virus Herpes simplex virus, or vaccinia virus vector.
  • the recombinant vector is administered topically to, by intravitreal injection to, by subconjunctival injection to, or into a subretinal space of the subject.
  • the methods disclosed herein can further comprise administering to the subject an additional therapeutic agent.
  • the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab.
  • FIG. 1 illustrates an example recombinant vector.
  • FIG. 2 shows nerve cell-specific expression of a recombinant vector under an in vitro environment.
  • FIG. 3 shows an miR142-3pT (target) sequence with 4 repeats of miR142-3pT (underlined) (SEQ ID NO:6).
  • FIG. 4A shows a schematic of miR142-3pT with lx, 2x, and 3x repeats, and mutant.
  • FIG. 4B shows miR142-3p inhibition on DX2 expression with lx, 2x, and 3x repeats of miR- 142-3pT.
  • FIG. 5 shows that a core binding sequence is important in DX2 inhibition.
  • a vector with Tseq x3 repeats, which showed significant inhibition of DX2 (FIG. 4B), and DX2 construct were used as controls.
  • 100 pmol of miR-142-3p treatment inhibited Tseq x3 vector significantly but DX2 and mutant sequence were not inhibited.
  • FIGS. 6A-6C A comparison of the amino acid sequences of AIMP2-DX2 and variants (FIGS. 6B and 6C are continuations of FIG. 6 A).
  • FIG. 7 Preventive potency of DX2 in the CNV mouse model. Fluorescein angiography and indocyanine green angiography images of laser photocoagulation sites after treatment with scAAV2-GFP or scAAV2-DX2. Twenty-one days after virus injection laser-induced CNV.
  • FIG. 9 Expression of VEGF in laser-induced choroidal neovascularization(CNV) mouse model.
  • FIG. 10 Cross-sectional histology (H&E staining) of retina.
  • FIGS. 11A-1 IE Histological measurements of histological retinal thickness.
  • FIG. 11 A Retina thickness.
  • FIG. 1 IB RPE (Retinal Pigment Epithelial) thickness.
  • FIG. 11C ONL (Outer Nuclear Layer of Photoreceptors) thickness.
  • FIG. 11D Outer Segment thickness.
  • FIG. HE OPL Outer Plexiform Layer
  • FIG. 12 Integrity and proliferation of RPE (Retinal Pigment Epithelial). Transfection of DX2 gene resulted in the recovery of RPE integrity by activating proliferation of RPE.
  • FIG. 13 PR (Photoreceptor) recovery. Transfection of DX2 gene resulted in recovery of PR population by activating proliferation of PR.
  • FIGS. 14A-14B Cellular proliferation of RPE and PR. Ki67 expression was measured to analyze proliferation in RPE and photoreceptor layers. Proliferation in RPE (FIG. 14A) and photoreceptor outer segment layer (FIG. 14B) was significantly higher in the AAV2-DX2 transfected sample.
  • FIGS. 15A-15F Functional recovery of retina. Electroretinograph of AAV2-DX2 transfected sample showed increased regaining of normal ERG graph format (FIGS. 15A and 15B). AAV2-DX2 transfection showed increased a-wave amplitude (FIG. 15C) and reduced latency (FIG.
  • AIMP2-DX2 is an alternative, antagonistic splicing variant of AIMP2 (aminoacyl tRNA synthase complex-interacting multifunctional protein 2), which is a multifactorial apoptotic gene.
  • AIMP2-DX2 is known to suppress cell apoptosis by hindering the functions of AIMP2.
  • AIMP2-DX2 acting as a competitive inhibitor of AIMP2, suppresses TNF-alpha mediated apoptosis through inhibition of ubiquitination/degradation of TRAF2.
  • AIMP2-DX2 can treat neuronal diseases (US2019/0298858 Al).
  • AMD age-related macular disease
  • methods of treating age-related macular disease comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
  • the AMD is wet AMD.
  • the AMD is dry AMD.
  • a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
  • the recombinant vectors as disclosed herein can further comprise an miR-142 target sequence.
  • the vector can further comprise a promoter operably linked to the AIMP2-DX2.
  • the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, Synapsin promoter, MeCP2 promoter, CaMKII promoter, Hb9 promoter, or opsin promoter.
  • the recombinant vectors can comprise exon 2-deleted AIMP2 variant (AIMP2-DX2) gene and an miR-142 target sequence.
  • the miR-142 target sequence can be 3’ to the AIMP2-DX2 gene.
  • the vectors described herein can express AIMP2-DX2 in neuronal cells but not in hematopoietic cells, such as leukocytes and lymphoid cells.
  • the AIMP2-DX2 polypeptide (SEQ ID NO:2) is a splice variant of AIMP2 (e.g., aa sequence of SEQ ID NO: 12; e,g., nt sequence of SEQ ID NO:3), in which the second exon (SEQ ID NO: 10; nt sequence of SEQ ID NO:4) of AIMP2 is omitted.
  • the AIMP2-DX2 gene has a nucleotide sequence set forth in SEQ ID NO: 1
  • the AIMP2- DX2 polypeptide has an amino acid sequence set forth in SEQ ID NO:2.
  • variants or isoforms of the AIMP2-DX2 polypeptide are also known and can be determined by those in the art (see, e.g., SEQ ID NOS: 13-19.
  • FIGS. 6 A-6C show a comparison of AIMP2 (SEQ ID NO:2) and variants, SEQ ID NOS: 13-19, as well as a consensus or core sequence of AIMP2 or AIMP2-DX2 (SEQ ID NO:20).
  • the AIMP2-DX2 gene can comprise a nucleotide sequence encoding an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical to SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20, or any ranges of % identity therein.
  • the AIMP2-DX2 gene can comprise a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20.
  • the AIMP2-DX2 gene can comprise a nucleotide sequence at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical to a nucleotide sequence of SEQ ID NO: 1, or any ranges of % identity therein.
  • the AIMP2-DX2 gene can comprise a nucleotide sequence of SEQ ID NO: 1.
  • the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 10 or 11.
  • the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 10 or 11.
  • the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:4.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA and a sum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides that are contiguous 5’ or 3’ of ACACTA as shown in SEQ ID NO:5.
  • the miR-142 target sequence can comprise a nucleotide sequence at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to a nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA; miR-142-3pT).
  • the miR- 142 target sequence can comprise a nucleotide sequence of SEQ ID NO:5.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACTTTA.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACTTTA and 1- 15 additional contiguous nucleotides of SEQ ID NO:7.
  • the miR-142 target sequence can comprise a nucleotide sequence comprising ACTTTA and a sum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additional nucleotides that are contiguous 5’ or 3’ of ACTTTA as shown in SEQ ID NO:7.
  • the miR-142 target sequence can comprise a nucleotide sequence at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to a nucleotide sequence of SEQ ID NO:7 (AGTAGTGCTTTCTACTTTATG; miR-142-5pT).
  • the miR-142 target sequence can comprise a nucleotide sequence of SEQ ID NO:7.
  • An example miR142-3pT mutant sequence is:
  • a mutant sequence refers to one or more regions, e.g., four regions, of core sequences of miR142 3pT that are substituted as follows: (5’- AACACTAC-3’ 5’-CCACTGCA-3’).
  • Inhibition of DX2 expression in vector transfected HEK293 cells was observed with the miR142-3p xl repeat (100 pmol) miR142-3p target sequence and as the number of core binding sequence in miR142-3p target seq are increased, miR142-3p inhibition on DX2 expression was also increased.
  • the Tseq x3 core sequence containing vector showed significant inhibition, whereas no inhibition was observed for the mutated 3x sequence.
  • a microRNA is a non-coding RNA molecule that functions to control gene expression.
  • MiRNAs function via base-pairing with complementary sequences within mRNA molecules, i.e., a miRNA target sequences.
  • miRNAs can bind to target messenger RNA (mRNA) transcripts of protein-coding genes and negatively control their translation or cause mRNA degradation.
  • miRNA messenger RNA
  • miRbase databases are publicly available. Many miRNAs are expressed in a tissue-specific manner and have an important roles in maintaining tissue-specific functions and differentiation.
  • MiRNA acts at the post-transcription stage of the gene and, in the case of mammals, and it is known that approximately 60% of the gene expression is controlled by miRNA.
  • miRNA plays an important role in a diverse range of processes within living body and has been disclosed to have correlation with cancer, cardiac disorders and nerve related disorders.
  • miR-142-3p and miR-142-5p exist in miR-142 and any of the target sequences thereof can be used.
  • miR-142 or miRNA-142 refers to, e.g., miR-142-3p and/or miR-142- 5p, and can bind to the miR-142 target sequence, e.g., miR-142-3pT or miR-142-5pT.
  • the miR-142 target sequence can be 5’ or 3’ to the AIMP2-DX2 gene.
  • miR-142-3p can exist in the area at which translocation of its gene occurs in aggressive B cell leukemia and is known to express in hemopoietic tissues (bone marrow, spleen and thymus, etc.).
  • miR-142-3p is known to be involved in the differentiation of hemopoietic system with confirmation of expression in the liver of fetal mouse (hemopoietic tissue of mouse).
  • the miR-142-3p and/or miR-142-5p target sequence is repeated at least 2-10 times, at least 2-8 times, at least 2-6 times, at least 4 times, or any range or number of times thereof.
  • the miR-142-3p e.g., having a nucleotide sequence of SEQ ID NO:23
  • a miR-142-3p target sequence miR-142-3pT
  • the miR-142-5p e.g., having a nucleotide sequence of SEQ ID NO:24
  • a miR-142-5p target sequence miR-142-5pT
  • an miR-142-3p can have a nucleotide sequence of SEQ ID NO:23 and an miR-142-5p can have a nucleotide sequence of SEQ ID NO:24.
  • recombinant vectors that can control the side effect of overexpression of the AIMP2-DX2 variant by inserting an miR-142-3p target sequence and/or miR- 142-5p target sequence (miR-142-3pT and/or miR-142-5pT, respectively) into a terminal end of AIMP2-DX2, and controlling suppression of AIMP2-DX2 expression in CD45-derived cells, in particular, the lymphatic system and leukocytes.
  • the expression of AIMP2-DX2 variant can be restricted to only in the injected neuronal cells and tissues but not in nonneuronal hematopoietic cells, the major population in the injected tissue areas.
  • MiR142-3p is expressed only in hematopoietic cells.
  • recombinant vectors containing a target sequence for miR-142-3p and/or miR-142-5p.
  • recombinant vectors comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene and miR-142-3p and/or miR-142-5p target sequences as disclosed herein.
  • vector refers to vector that can be expressed as the target protein or RNA in appropriate host cells, and gene construct that contains essential operably linked control factor to enable the inserted gene to be expressed appropriately.
  • operably linked refers to functional linkage between the nucleic acid expression control sequence and nucleic acid sequence that codes the targeted protein and RNA to execute general functions. For example, it can affect the expression of nucleic acid sequence that codes promoter and protein or RNA that has been linked for operability of the nucleic acid sequence.
  • Operable linkage with recombinant vector can be manufactured by using gene recombinant technology, which is known well in the corresponding technology area, and uses generally known enzymes in the corresponding technology area for the area-specific DNA cutting and linkage.
  • the recombinant vectors can further comprise a promoter operably linked to a AIMP2- DX2 as disclosed herein.
  • the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, Synapsin promoter, MeCP2 promoter, CaMKII promoter, Hb9 promoter, or opsin promoter.
  • the recombinant vector can additionally contain heterogeneous promoter and operably linked heterogeneous gene in the promoter.
  • heterogeneous gene as used herein can include protein or polypeptide with biologically appropriate activation, and encrypted sequence of the targeted product such as immunogen or antigenic protein or polypeptide, or treatment activation protein or polypeptide.
  • Polypeptides can supplement deficiency or absent expression of endogenous protein in host cells.
  • the gene sequence can be induced from a diverse range of suppliers including DNA, cDNA, synthesized DNA, RNA or its combinations.
  • the gene sequence can include genome DNA that contains or does not contain natural intron. In addition, the genome DNA can be acquired along with promoter sequence or polyadenylated sequence.
  • Genome DNA or cDNA can be acquired in various methods, genome DNA can be extracted and purified from appropriate cells through method publicly notified in the corresponding area.
  • mRNA can be used to produce cDNA by reverse transcription or other method by being separated from the cells.
  • polynucleotide sequence can contain sequence that is complementary to RNA sequence, e.g., antisense RNA sequence, and the antisense RNA can be administered to individual to suppress expression of complementary polynucleotide in the cells of individuals.
  • the heterogeneous gene is an AIMP-2 splicing variant with the loss of exon 2 and miR-142-3p target sequence can be linked to 3’ UTR of the heterogeneous gene.
  • the sequence of the AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC0 13630.1) are described in the literature (312aa version: Nicolaides, N.C., Kinzler, K.W. and Vogelstein, B.
  • AIMP2 splicing variant refers to the variant generated due to partial or total loss of exon 2 among exons 1 to 4. As such, the variant signifies interference of the normal function of AIMP2 by forming AIMP2 protein and heterodimer.
  • the injected AIMP2-DX2 gene is rarely expressed in tissues other than the injected tissue.
  • an miR142 target sequence can be inserted to completely block the possibility of AIMP2-DX2 being expressed in hematopoietic cells, the major population of non-neuronal cells in the injected tissue area.
  • the recombinant vector can include SEQ ID NOS: 1 and 5.
  • % of sequence homology can be, e.g., confirmed by comparing the 2 optimally arranged sequence with the comparison domain and some of the nucleotide sequences in the comparison domain can include addition or deletion (that is, gap) in comparison to the reference sequence on the optimal arrange of the 2 sequences (does not include addition or deletion).
  • Proteins as disclosed herein not only include those with its natural type amino acid sequence but also those with variant amino acid sequences.
  • Variants of the protein signifies proteins with difference sequences due to the deletion, insertion, non-conservative or conservative substitution or their combinations of the natural amino acid sequence and more than 1 amino acid residue. Amino acid exchange in protein and peptide that does not modify the activation of the molecule in overall is notified in the corresponding area (H.Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979).
  • the protein or its variant can be manufactured through natural extraction, synthesis (Merrifield, J. Amer. Chem. Soc. 85: 2149-2156, 1963), or genetic recombination on the basis of the DNA sequence (Sambrook et al, Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2 nd Ed., 1989).
  • Amino acid mutations can occur on the basis of the relative similarity of the amino acid side chain substituent such as hydrophilicity, hydrophobicity, electric charge and size, etc.
  • amino acid side chain substituent such as hydrophilicity, hydrophobicity, electric charge and size, etc.
  • arginine, lysine and histidine are residues with positive charge
  • alanine, glycine and serine have similar sizes
  • phenylalanine, tryptophan and tyrosine have similar shapes.
  • arginine, lysine and histidine alanine, glycine and serine
  • phenylalanine, tryptophan and tyrosine can be deemed functional equivalents biologically.
  • hydrophobic index of amino acid can be considered. Hydrophobic index is assigned to each amino acid according to hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (- 3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5)
  • hydrophobic amino acid index is very important. It is possible to have similar biological activation only if a substitution is made with an amino acid with a similar hydrophobic index. In the event of introducing a mutation by making reference to the hydrophobic index, substitution between amino acids with hydrophobic index differences within ⁇ 2, within ⁇ 1, or within ⁇ 0.5.
  • substitutions can be made between amino acids with hydrophilic value differences within ⁇ 2, within ⁇ 1, or within ⁇ 0.5. but not limited thereto.
  • Vectors disclosed herein can be constructed as a typical vector for cloning or for expression.
  • the vectors can be constructed with prokaryotic or eukaryotic cells as the host. If the vector is an expression vector and prokaryotic cell is used as the host, it is general to include powerful promoter for execution of transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, Ipp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosome binding site for commencement of decoding and transcription/decoding termination sequence.
  • powerful promoter for execution of transcription e.g., tac promoter, lac promoter, lacUV5 promoter, Ipp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc
  • coli e.g., HB101, BL21, DH5a, etc.
  • promoter and operator site of the tryptophan biosynthesis route of E. coli (Yanofsky, C.(1984), J. Bacteriol., 158: 1018-1024) and left directional promoter of phage X (pLX promoter, Herskowitz, I. and Hagen, D.(1980), Ann. Rev. Genet., 14: 399-445) can be used as the control site.
  • vectors that can be used can be more than 1 type, such as a virus vector, linear DNA, or plasmid DNA.
  • Virus vector refers to a virus vector capable of delivering gene or genetic substance to the desired cells, tissue and/or organ.
  • the virus vectors can include more than 1 species from the group composed of Adenovirus, Adeno-associated virus, Lentivirus, Retrovirus, HIV (Human immunodeficiency virus), MLV (Murine leukemia virus), ASLV (Avian sarcoma/leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus) and Herpes simplex virus, it is not limited thereto.
  • the viral vector can be an adeno-associated virus (AAV), adeonovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.
  • Retrovirus has an integration function for the genome of host cells and is harmless to the human body, it can have characteristic including suppressing functions of normal cells at the time of integration, ability to infect a diverse range of cells, ease of proliferation, accommodate approximately 1-7 kb of external gene, and generate duplication deficient virus.
  • Retroviruses can also have disadvantages including difficulties in infecting cells after mitotic division, gene delivery under an in vivo condition, and need to proliferate somatic cells under in vitro condition.
  • Retroviruses have the risk of spontaneous mutations as it can be integrated into proto-oncogene, thereby presenting the possibility of cell necrosis.
  • Adenoviruses have various advantages as a cloning vector including duplication even in nucleus of cells in medium level size, clinically nontoxic, stable even if external gene is inserted, no rearrangement or loss of genes, transformation of eukaryotic organism and stably undergoes expression at high level even when integrated into host cell chromosome.
  • Good host cells of Adenoviruses are the cells that are the causes of hemopoietic, lymphatic and myeloma in human.
  • proliferation is difficult since it is a linear DNA and it is not easy to recover the infected virus along with low infection rate of virus.
  • expression of the delivered gene is most extensive during 1-2 weeks with expression sustained over the 3-4 weeks only in some of the cells. Another issue is that it has high immunoantigenicity.
  • Adeno-associated virus has been preferred in recent years since it can supplement the aforementioned problems and has a lot of advantages as gene therapy agent. It is also referred as adenosatellite virus. Diameter of adeno-associated virus particle is 20nm and is known to have almost no harm to human body. As such, its sales as gene therapy agent in Europe were approved.
  • AAV is a provirus with single strand that needs auxiliary virus for duplication and AAV genome has 4,680 bp that can be inserted into specific area of the chromosome 19 of the infected cells.
  • Trans-gene is inserted into the plasma DNA connected by the 2 inverted terminal repeat (ITR) sequence section with 145bp each and signal sequence section.
  • ITR 2 inverted terminal repeat
  • Transfection is executed along with other plasmid DNA that expresses the AAV rep and cap sections, and Adenovirus is added as an auxiliary virus.
  • AAV has the advantages of wide range of host cells that deliver genes, little immunological side effects at the time of repetitive administration and long gene expression period.
  • the Adeno-associated virus is known to have a total of 4 serotypes.
  • the serotypes of many Adeno-associated viruses that can be used in the delivery of the target gene the most widely researched vector is the Adeno-associated virus serotype 2 and is currently used in the delivery of clinical genes of cystic fibrosis, hemophilia and Canavan’s disease.
  • the potential of recombinant adeno-associated virus (rAAV) is increasing in the area of cancer gene therapy (Du 2013).
  • the Adeno-associated virus serotype 2 can be used. Although it is possible to select and apply appropriate viral vector, it is not limited to this.
  • vectors are expression vectors and use eukaryotic cells as the host
  • promoter derived from the genome of mammalian cells e.g., metallothionein promoter
  • promoter derived from mammalian virus e.g., post-adenovirus promoter, vaccine virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV TK promoter
  • telomere a virus that promotes the transcription termination sequence.
  • CMV cytomegalovirus
  • RSV Rous sarcoma virus
  • MT MT promoter
  • EF-1 alpha promoter a promoter that promotes the transcription termination sequence.
  • UB6 Rous sarcoma virus
  • UB6 EF-1 alpha promoter
  • UB6 EF-1 alpha promoter
  • UB6 EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promoter
  • UB6 promoter EF-1 alpha promote
  • Vectors disclosed herein can be fused with other sequences as need to make the purification of the protein easier.
  • the fused sequence such as glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6xHis (hexahistidine; Quiagen, USA), etc.
  • expression vectors can include tolerance gene against antibiotics generally used in the corresponding industry as the selective marker including Ampicillin, Gentamycin, Carbenicillin, Chloramphenicol, Streptomycin, Kanamycin, Geneticin, Neomycin and Tetracycline, as examples.
  • gene carriers including the recombinant vector containing a target sequence (miR-142-3pT and/or miR-142-5pT) for miR-142, such as miR- 142-3p and/or miR-142-5p, respectively.
  • the term “gene transfer” includes delivery of genetic substances to cells for transcription and expression in general. Its method is ideal for protein expression and treatment purposes. A diverse range of delivery methods such as DNA transfection and virus transduction are announced. It signifies virus-mediated gene transfer due to the possibility of targeting specific receptor and/or cell types through high delivery efficiency and high level of expression of delivered genes, and, if necessary, nature-friendliness or pseudo-typing.
  • the gene carriers can be transformed entity that has been transformed into the recombinant vector, and transformation includes all methods of introducing nucleic acid to organic entity, cells, tissues or organs, and, as announced in the corresponding area, it is possible to select and execute appropriate standard technology in accordance with the host cells. Although such methods include electroporation, fusion of protoplasm, calcium phosphate (CaPCU) sedimentation, calcium chloride (CaCh) sedimentation, mixing with the use of silicone carbide fiber, agribacteria-mediated transformation, PEG, dextran sulphate and lipofectamin, etc., it is not limited to these.
  • the gene carriers are for the purpose of expression of heterogeneous genes in neuron. As such it suppresses the expression of the heterogeneous gene in CD45-derived cells and can increase the expression of heterogeneous gene in brain tissue.
  • Majority of the CD45 are transmembrane protein tyrosine phosphatase situated at the hematopoietic cell. Cells can be defined in accordance with the molecules situated on the cell surface and the CD45 is the cell marker for all leukocyte groups and B lymphocytes.
  • the gene carrier is not be expressed in the CD45-derived cells, in particular, in lymphoid and leukocyte range of cells.
  • the gene carriers can additionally include carrier, excipient or diluent allowed to be used pharmacologically.
  • the methods can increase the expression of heterogeneous gene in cerebral tissues and control heterogeneous gene expression in other tissues.
  • vectors comprising 1) a promoter; 2) a nucleotide sequence that encodes a target protein linked with the promoter to enable operation; and 3) an expression cassette that includes the nucleotide sequence targeting miR-142-3p inserted into 3’UTR of the nucleotide sequence.
  • the vectors can comprise 1) a promoter; 2) a nucleotide sequence that encodes a target protein linked with the promoter to enable operation; and 3) an expression cassette that includes the nucleotide sequence targeting miR-142-5p inserted into 3’UTR of the nucleotide sequence.
  • expression cassette refers to the unit cassette that can execute expression for the production and secretion of the target protein operably linked with the downstream of signal peptide as it includes gene that encodes the target protein and nucelotide sequence that encodes the promoter and signal peptide.
  • Secretion expression cassette can be used mixed with the secretion system. A diverse range of factors that can assist the efficient production of the target protein can be included in and out of such expression cassette.
  • preventive or therapeutic preparations for AMD that includes a nucleotide sequence that encodes AIMP-2 splicing variant with loss of exon 2 and nucleotide sequence that targets miR-142-3p linked to 3’UTR of the nucleotide sequence.
  • the AMD is wet AMD.
  • the AMD is dry AMD.
  • the vectors disclosed herein can effect, but not limited to, apoptosis inhibition, dyskinesia amelioration, and/or oxidative stress inhibition, and thus prevent or treat AMD.
  • treatment includes not only complete treatment of AMD but also partial treatment, improvement and/or reduction in the overall symptoms of AMD as results of application of the pharmacological agent disclosed herein.
  • prevention signifies prevention of the occurrence of overall symptoms of AMD in advance by suppressing or blocking the symptoms or phenomenon such as cognition disorder, behavior disorder and destruction of brain nerves by applying pharmacological agents disclosed herein to the entity with degenerative cerebral disorders.
  • Adjuvants other than the active ingredients can be included additionally to the pharmacological agents disclosed herein. Although any adjuvant can be used without restrictions as long as it is known in the corresponding technical area, it is possible to increase immunity by further including complete and incomplete adjuvant of Freund, for example.
  • Pharmacological agents disclosed herein can be manufactured in the format of having mixed the active ingredients with the pharmacologically allowed carrier.
  • pharmacologically allowed carrier includes carrier, excipient and diluent generally used in the area of pharmacology.
  • Pharmacologically allowed carrier that can be used for the pharmacological agents disclosed herein include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil, but not limited to these.
  • Pharmacological agents disclosed herein can be used by being manufactured in various formats including oral administration types such as powder, granule, pill, capsule, suspended solution, emulsion, syrup and aerosol, etc., and external application, suppository drug or disinfection injection solution, etc. in accordance with their respective general manufacturing methods.
  • Solid preparations for oral administration include pill, tablet, powder, granule and capsule preparations, and such solid preparations can be manufactured by mixing more than 1 excipient such as starch, calcium carbonate, sucrose, lactose and gelatin with the active ingredients.
  • lubricants such as magnesium stearate and talc can also be used in addition to simple excipients.
  • Liquid preparations for oral administration include suspended solution, solution for internal use, oil and syrup, etc.
  • Preparations for non-oral administration include sterilized aqueous solution, non-aqueous solvent, suspension agent, oil, freeze dried agent and suppository. Vegetable oil such as propylene glycol, polyethylene glycol and olive oil, and injectable esters such as ethylate can be used as non-aqueous solvent and suspension solution.
  • Agents for suppository can include witepsol, tween 61, cacao oil, laurine oil and glycerogelatin, etc.
  • Pharmacological agents disclosed herein can be administered into entity through diversified channels. All formats of administration such as oral administration, and intravenous, muscle, subcutaneous and intraperitoneal injection can be used.
  • the recombinant vector is administered topically to, by intravitreal injection to, by subconjunctival injection to, or into a subretinal space of the subject.
  • the methods disclosed herein can further comprise administering to the subject an additional therapeutic agent(s).
  • the additional therapeutic agent is ranibizumab, aflibercept, and/or bevacizumab.
  • Desirable doses of administration of therapeutic agents disclosed herein differs depending on various factors including preparation production method, administration format, age, weight and gender of the patient, extent of the symptoms of the disease, food, administration period, administration route, discharge speed and reaction sensitivity, etc. Nonetheless, it can be selected appropriately by the corresponding manufacturer.
  • skilled medical doctor can determine and prescribe effective dose for the targeted treatment.
  • the treatment agents include intravenous, subcutaneous and muscle injection, and direction injection into cerebral ventricle or spinal cord by using micro-needle.
  • the effective dose is 0.05 to 15 mg/kg in the case of vector, 5 X 10 11 to 3.3 X 10 14 viral particle (2.5 X 10 12 to 1.5 X 10 16 IU)/kg in the case of recombinant virus and 5 X 10 2 to 5 X 10 7 cells/kg in the cells.
  • the doses are 0.1 to 10 mg/kg in the case of vector, 5 X 10 12 to 3.3 X 10° particles (2.5 X 10 13 to 1.5 X10 15 IU)/kg in the case of recombinant virus and 5 X10 3 to 5 X 10 6 cells/kg in the case of cells at the rate of 2 to 3 administrations per week.
  • the dose is not strictly restricted. Rather, it can be modified in accordance with the condition of the patient and the extent of manifestation of the neural disorders.
  • Effective dose for other subcutaneous fat and muscle injection, and direct administration into the affected area is 9 X 10 10 to 3.3 X 10 14 recombinant viral particles with the interval of 10cm and at the rate of 2 ⁇ 3 times per week.
  • the dose is not strictly restricted. Rather, it can be modified in accordance with the condition of the patient and the extent of manifestation of the neural disorders.
  • pharmacological agents disclosed herein can include 1 X 10 10 to 1 X 10 12 vg (virus genome)/mL of recombinant adeno-associated virus and, generally, it is advisable to inject 1 X 10 12 vg once every 2 days over 2 weeks. It can be administered once a day or by dividing the dose for several administrations throughout the day.
  • the vectors can be administered in a dose of 0.1 X 10 8 vg to 500 X 10 8 vg, 1 X 10 8 vg to 100 X 10 8 vg, 1 X 10 8 vg to 10 X 10 8 vg, e.g., 5 X 10 8 vg, or any ranges derived therefrom.
  • vg can be translated to doses for human based on body weight for IV injection.
  • vg can also be translated to doses for humans based on the target cell number and effective MOI (multiplicity of infection).
  • the vectors disclosed herein can be injected to a subject by, e.g., subretinal injection, intravitreal injection, or subchoroidal injection.
  • the injection can be in the form of a liquid.
  • the vectors disclosed herein can be administered to a subject in the form of eye drops or ointment.
  • the pharmacological preparations can be produced in a diverse range of orally and non- orally administrable formats.
  • the vector disclosed herein can be administered to the brain or spinal cord.
  • the vectors disclosed herein can be administered to the brain by stereotaxic injection.
  • Orally administrative agents include pills, tablets, hard and soft capsules, liquid, suspended solution, oils, syrup and granules, etc. These agents can include diluent (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine) and glidents (e.g., silica, talc, and stearic acid and its magnesium or calcium salts, and/ or polyethylene glycol) in addition to the active ingredients.
  • diluent e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine
  • glidents e.g., silica, talc, and stearic acid and its magnesium or calcium salts, and/ or polyethylene glycol
  • the pills can contain binding agents such as magnesium aluminum silicate, starch paste, gelatin, tragacanthin, methyl cellulose, sodium carboxymethyl cellulose and/or polyvinyl pyrrolidine, and, depending on the situation, can contain disintegration agent such as starch, agar, alginic acid or its sodium salt or similar mixture and/or absorbent, coloring, flavor and sweetener.
  • binding agents such as magnesium aluminum silicate, starch paste, gelatin, tragacanthin, methyl cellulose, sodium carboxymethyl cellulose and/or polyvinyl pyrrolidine
  • disintegration agent such as starch, agar, alginic acid or its sodium salt or similar mixture and/or absorbent, coloring, flavor and sweetener.
  • the agents can be manufactured by general mixing, granulation or coating methods.
  • injection agents are the representative form of non-orally administered preparations.
  • Solvents for such injection agents include water, Ringer’s solution, isotonic physiological saline and suspension.
  • Sterilized fixation oil of the injection agent can be used as solvent or suspension medium, and any non-irritating fixation oil including mono- and diglyceride can be used for such purpose.
  • the injection agent can use fatty acids such as oleic acid.
  • CD45 transmembrane protein tyrosine phosphatase of the hematopoietic cell, which can be used to define the cells in accordance with the molecule on the cell surface.
  • CD45 is a marker for all leukocyte groups and B lymphocytes.
  • a recombinant vector has been produced that is expressed specifically and only in neurons without being expressed in CD45- derived cells, in particular, lymphoid and leukocyte cells.
  • the recombinant vector contains a splicing variant in which exon 2 of the Aminoacyl tRNA Synthetase Complex Interacting Multifunctional Protein 2 (AIMP2) has been deleted and an miRNA capable of controlling the expression of the AIMP2 splicing variant.
  • AIMP2 Aminoacyl tRNA Synthetase Complex Interacting Multifunctional Protein 2
  • the recombinant vector was produced as a distribution safety measure in order to induce specific expression of the AIMP2 splicing variant in injected neuronal tissues. Also this was done to completely block any possibility of AIMP2-DX2 being expressed in hematopoietic cells, which is the major population of non-neuronal cells in the injected tissue area.
  • Example 1-1 Production of AIMP2 variant
  • AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARSs) and acts as a multifactorial apoptotic protein.
  • ARSs aminoacyl-tRNA synthetase
  • cDNA of AIMP2 splicing variant was cloned into pcDNA3.1-myc.
  • the sub-cloning in pcDNA3.1-myc was executed by using EcoRl and Xhol after having amplified the AIMP2 splicing variant by using a primer having EcoRl and Xhol linker attached to the H322 cDNA.
  • AIMP2 variant having a nucleotide sequence of SEQ ID NO: 1 and an amino acid sequence of SEQ ID NO:2 was used.
  • Example 1-2 Sorting of miRNA and selection of its target sequence
  • the recombinant vector was produced as above in order to confine the expression of the AIMP2 variant in injected neuronal cells and to completely block the possibility of AIMP2-DX2 being expressed in hematopoietic cells, the major population of non-neuronal cells in the injected tissue area.
  • miR-142-3p that is specifically expressed only in hematopoietic cells that generate leukocyte and lymphoid related cells was selected as the target.
  • miR-142-3p In order to produce the sequence that targets only the miR-142-3p, microarray data of mouse B cells and computer programming of genes targeted by miR'142-3p (mirSVR score) were used.
  • the miR- 142-3p is a nucleotide sequence indicated SEQ ID NO:.
  • the miR-142-3p target sequence of SEQ ID NO:5 binds to miR-142-3p
  • the miR-142-3p target sequence includes Nhe 1 and Hind III, Bmt 1 site sequence (ccagaagcttgctagc; SEQ ID NO:21) and Hind H site sequence (aagcttgtag; SEQ ID NO:22).
  • the miR-142-3pT can comprise the nucleotide sequence of SEQ ID NO:5 that has been repeated 4 times with the linkers (tcac and gatatc) that connects them (FIG. 4; SEQ ID NO:6).
  • Example 1-3 Production of the recombinant vector
  • the miR-142-3p target sequence (SEQ ID NO:5) was inserted into 3’UTR of the AIMP2 variant (sequence number of 1). Connecting of the AIMP-2 variant and miR-142-3p target sequence is indicated with base sequence number of 6, and, specifically, was cut and inserted by using Nhe I and Hind III sites.
  • the recombinant vector is shown in FIG. 1.
  • Example 2 Confirmation of the nerve cells specific expression of recombinant vector in vitro [0133] Since miR142-3p is specifically expressed only in hemopoietic cells, the extent of the expression of AIMP2 variant was confirmed in specific cells in accordance with the knockdown of AIMP2 variant according to the expression of miR142-3p target sequence of the recombinant vector.
  • AIMP2 variant is not expressed in the SHAM and NC vector groups.
  • the AIMP2 variant is specifically expressed only in the SH-SY5Y cell strain in the group treated with the recombinant vector (FIG. 2).
  • miR-142-3p inhibition on DX2 expression could be observed from xl miR-142-3p target sequence.
  • the HEK293 cells were transiently transfected with the xl, x2, and x3 repeat miR-142-3p target sequence vectors, and also with 100 pmol miR-142-3p using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hrs. The amount of DX2 mRNA was analyzed by PCR. miR142-3p inhibition on DX2 expression was observed from Tseq xl repeat miR142-3p target seq (FIG. 4B).
  • Tseq xl contains 1 core binding sequence
  • Tseq x2 contains 2 core binding sequences
  • Tseq x3 contains 3 core binding sequences (FIG. 4A).
  • miR142-3p (100 pmol) inhibition on DX2 expression was started to be observed from xl repeat miR142-3p target sequence.
  • the HEK293 cells were transiently transfected with the xl, x2, and x3 repeat miR-142-3p T seq vectors, and also with 100 pmol miR-142-3p using lipofectamin 2000 (invitrogen, US), then incubated for 48 h. Amount of DX2 mRNA was analyzed by PCR. When the number of core binding sequence in miR142-3p target seq are increased, miR142-3p inhibition on DX2 expression was also increased. Tseq x3 core sequence containing vector showed significant inhibition (FIG. 4B).
  • FIG. 4A Four core sequences were substituted (FIG. 4A).
  • the HEK293 cells were transiently transfected with the DX2- miR-142-3p T seq x3 repeated vector (Tseq3x) or with core sequence mutated vector (mut), and with 100 pmol miR-142-3p by using lipofectamin 2000 (Invitrogen, US), and then incubated for 48 hrs.
  • Expression of DX2 mRNA was analyzed by PCR.
  • Tseq x3 repeated vector which showed significant inhibition of DX2 (FIG. 4B) and DX2 construct were used as control.
  • 100 pmol of miR142-3p treatment inhibited Tseq x3 vector significantly but DX2 and mut sequence were not inhibited (FIG. 5).
  • the animals were housed in individual cages under specific pathogen-free conditions and a constant environment condition (21°C - 23°C temperature, 50-60% humidity and 12-h light/dark cycle) in the animal facility.
  • the mouse Ocular sinister (OS, left eye) in each group treated AAV-GFP and Ocular Dexter (OD, right eye) treated AAV-DX2. (Injection: 5xl0 8 vg).
  • OS left eye
  • OD Ocular Dexter
  • AAV-DX2 AAV-DX2.
  • AAV2-GFP was injected at OS (left).
  • AAV2-DX2 was injected at OD (right). Retract the syringe slowly. Apply eye moisturizing drops to keep the eye hydrated. Continue to monitor the animal until it regains sternal recumbency.
  • mouse-stage Adjusts the placement of mouse on the mouse-stage, so that it is ideally positioned for visualization of optic nerve. Orient the mouse on its holder so it lies horizontally, perpendicular to slit lamp beam, with the head at one side and tail at the other.
  • Eyes were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 2 hours after removal of the cornea and lens. Posterior eyecups of the RPE/choroid/sclera were dissected, and the vitreous was removed. Eyecups were incubated overnight at 4°C with (AlexaFluor 647 or FITC)-conjugated Isolectin B4 (1 :200, Invitrogen, Carlsbad, CA) to label invading choroidal vessels.
  • scAAV2-DX2 treated mice attenuates laser-induced choroidal neovascularization.
  • DX2 injected mice were showed reduced CNV area compared to GFP injected mice in ICG angiography (FIG. 7). Also, choroid flat mounts stained with isolectin-B4 demonstrates significant reduction in CNV formation areas in DX2 injected mice (FIG. 7).
  • the ratio of leaky area to CNV area were estimated by measuring the total hyperfluorescent area using fluorescein angiography (FA) and the CNV area using ICGA (FIG. 8).
  • Inflammatory cells in particular (macrophages), have been histologically demonstrated near/within AMD lesions, including areas of Bruch membrane breakdown, RPE atrophy, and CNV. (Macrophages) in CNV lesions have been shown to secrete proangiogenic factors such as VEGF and proinflammatory cytokines such as TNF. In FIG. 8, number of inflammatory cells of DX2 injected mice are significantly smaller compare to GFP control CNV cell.
  • VEGF vascular endothelial growth factor
  • Mdml-/-(CRISPR/Cas9 KO) mouse present progressive photoreceptor and RPE degeneration for both dry-AMD & hereditary retinal degeneration.
  • the animals were housed in individual cages under specific pathogen- free conditions and a constant environment condition (21 °C - 23 °C temperature, 50-60% humidity and 12-h light/dark cycle) in the animal facility.
  • AAV2-DX2 and Negative control (AAV2-GFP) injection at Sub-retinal space at 3 weeks old. Histological measurements and functional recovery of retina were performed at 3 -months old.
  • AAV2-GFP/DX2 was injected into the same animal.
  • AAV2-GFP was injected at OS (left).
  • AAV2-DX2 was injected at OD (right).
  • the data were analyzed using ERGVIEW and the combined standard Rod&Cone response value was selected to analyze with a flash intensity of 3000mcd.s/m 2 , 0.10Hz.
  • A-wave analysis was performed for photoreceptor cell function.
  • B- wave analysis was performed for bipolar and horizontal cell function. Amplitude and latency values for a-wave and b-wave were analyzed.
  • Retina cryosections were analyzed. H&E was used for layer thickness analysis. Layer thickness analysis was performed with Leica LAS program. Immunofluorescence was used for RPE65 and Opsin expression, and Proliferation evaluation(Ki67). Immunofluorescence ROI set and overlapping coefficient measurements were measured with Image J.
  • FIG. 10 shows cross-sectional histology (H&E staining) of retina.
  • FIGS. 11A-11E show histological measurements of histological retinal thickness.
  • FIG. 11 A shows retina thickness.
  • FIG. 11B shows RPE (Retinal Pigment Epithelial) thickness.
  • FIG. 11C shows ONL (Outer Nuclear Layer of Photoreceptors) thickness.
  • FIG. 11D shows Outer Segment thickness.
  • FIG. HE shows OPL Outer Plexiform Layer) thickness. All the samples were acquired from the optic nerve containing section with 10 pm thickness. Transfection of DX2 gene in retina resulted in the recovery of the total neural retina thickness (FIG. 11 A). Transfection of DX2 showed thicker RPE layer (FIG. 11B) and the photoreceptor outer segment layer (FIG.
  • FIG. 12 shows integrity and proliferation of RPE (Retinal Pigment Epithelial). Transfection of DX2 gene resulted in the recovery of RPE integrity by activating proliferation of RPE.
  • RPE Retinal Pigment Epithelial
  • FIG. 13 shows PR (Photoreceptor) recovery. Transfection of DX2 gene resulted in recovery of PR population by activating proliferation of PR.
  • FIGS. 14A-14B show cellular proliferation of RPE and PR. Ki67 expression was measured to analyze proliferation in RPE and photoreceptor layers. Proliferation in RPE (FIG. 14 A) and photoreceptor outer segment layer (FIG. 14B) was significantly higher in the AAV2- DX2 transfected sample.
  • FIGS. 15A-15D show functional recovery of retina.
  • AAV2-DX2 transfection showed increased a- wave amplitude (FIG. 15 A) and reduced latency (FIG. 15B) compared to the dry- AMD model (mdml-/-) or the negative control (mdml-/- + AAV-GFP), indicating that DX2 expression reduces damage of photoreceptors’ electrophysiological function and visual acuity.
  • AAV2-DX2 transfected sample did not show a change in b-wave amplitude (FIG. 15C) but reduced the latency (FIG. 15D) compared to the dry AMD model (mdml-/-), which suggests that DX2 affects only the RPE and photoreceptor, but not the bipolar cells (post-photoreceptors neurons).
  • Electroretinograph of AAV2-DX2 transfected sample showed increased regaining of normal ERG graph format (FIGS. 15A and 15B).
  • AAV2-DX2 transfected sample showed slightly increased a- wave amplitude (FIG. 15C) than and reduced latency (FIG. 15D) than the dry AMD model (mdml-/-) indicating that the DX2 expression reduced the damage of photoreceptors’ electrophysiological function.
  • AAV2-DX2 transfected sample showed did not change b-wave amplitude (FIG. 15E) but reduced the latency (FIG. 15F) than the dry AMD model (mdml-/-).
  • JNK inhibition reduces apoptosis and neovascularization in a murine model of age-related macular degeneration. Proceedings of the National Academy of Sciences 110.6 (2013): 2377-2382.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Ophthalmology & Optometry (AREA)
  • Immunology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/IB2021/059018 2020-09-30 2021-09-30 METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF Ceased WO2022070142A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
US18/246,578 US20240050527A1 (en) 2020-09-30 2021-09-30 METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF
CN202180066944.7A CN116406304A (zh) 2020-09-30 2021-09-30 使用AIMP2-DX2和任选地miR-142的靶序列及其组合物治疗年龄相关的黄斑疾病的方法
CA3192711A CA3192711A1 (en) 2020-09-30 2021-09-30 Methods of treating age-related macular diseases using aimp2-dx2 and optionally a target sequence for mir-142 and compositions thereof
EP21874708.7A EP4221760A4 (en) 2020-09-30 2021-09-30 METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR MIR-142 AND RELATED COMPOSITIONS
JP2023519465A JP2023544142A (ja) 2020-09-30 2021-09-30 AIMP2-DX2および必要に応じてmiR-142の標的配列ならびにその組成物を使用した加齢黄斑疾患を処置する方法
KR1020237014891A KR20230110503A (ko) 2020-09-30 2021-09-30 AIMP2-DX2 및 선택적으로 miR-142에 대한 표적 서열 및 이의 조성물을 이용한 노인성 황반 질환의 치료방법
AU2021354969A AU2021354969A1 (en) 2020-09-30 2021-09-30 METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063085922P 2020-09-30 2020-09-30
US63/085,922 2020-09-30

Publications (1)

Publication Number Publication Date
WO2022070142A1 true WO2022070142A1 (en) 2022-04-07

Family

ID=80949802

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2021/059018 Ceased WO2022070142A1 (en) 2020-09-30 2021-09-30 METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF

Country Status (8)

Country Link
US (1) US20240050527A1 (cg-RX-API-DMAC7.html)
EP (1) EP4221760A4 (cg-RX-API-DMAC7.html)
JP (1) JP2023544142A (cg-RX-API-DMAC7.html)
KR (1) KR20230110503A (cg-RX-API-DMAC7.html)
CN (1) CN116406304A (cg-RX-API-DMAC7.html)
AU (1) AU2021354969A1 (cg-RX-API-DMAC7.html)
CA (1) CA3192711A1 (cg-RX-API-DMAC7.html)
WO (1) WO2022070142A1 (cg-RX-API-DMAC7.html)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115487203A (zh) * 2022-07-22 2022-12-20 郑州大学 miRNA-142a-5p在制备干预或治疗视网膜色素变性的药物中的应用
US12233134B2 (en) 2018-03-29 2025-02-25 Generoath Co., Ltd. Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102248420B1 (ko) * 2019-03-15 2021-05-06 주식회사 제너로스 miR-142-3p의 표적 서열을 포함하는 재조합 벡터

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060110397A1 (en) * 2004-11-24 2006-05-25 Sunghoon Kim AIMP2-DX2 and its uses
WO2007000668A2 (en) * 2005-05-27 2007-01-04 Fondazione Centro San Raffaele Del Monte Tabor Gene vector comprising mi-rna
KR20170041363A (ko) * 2015-10-07 2017-04-17 원광대학교산학협력단 신경질환 예방 또는 치료를 위한 aimp2-dx2를 포함하는 약학 조성물 및 이의 용도
WO2020188472A1 (en) * 2019-03-15 2020-09-24 Generoath Co., Ltd. Vectors containing aimp2-dx2 and target nucleic acids for mir-142 and uses thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060057992A (ko) * 2004-11-24 2006-05-29 재단법인서울대학교산학협력재단 p38-DX2 및 이의 용도
US10716866B2 (en) * 2018-03-29 2020-07-21 Generoath Co., Ltd Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060110397A1 (en) * 2004-11-24 2006-05-25 Sunghoon Kim AIMP2-DX2 and its uses
WO2007000668A2 (en) * 2005-05-27 2007-01-04 Fondazione Centro San Raffaele Del Monte Tabor Gene vector comprising mi-rna
KR20170041363A (ko) * 2015-10-07 2017-04-17 원광대학교산학협력단 신경질환 예방 또는 치료를 위한 aimp2-dx2를 포함하는 약학 조성물 및 이의 용도
WO2020188472A1 (en) * 2019-03-15 2020-09-24 Generoath Co., Ltd. Vectors containing aimp2-dx2 and target nucleic acids for mir-142 and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JO, S.-M. ET AL.: "Rapid detection of exon 2-deleted AIMP2 mutation as a potential biomarker for lung cancer by molecular beacons", BIOSENSORS AND BIOELECTRONICS, vol. 46, 2013, pages 142 - 149, XP055421159, DOI: 10.1016/j.bios.2013.02.037 *
See also references of EP4221760A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12233134B2 (en) 2018-03-29 2025-02-25 Generoath Co., Ltd. Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof
CN115487203A (zh) * 2022-07-22 2022-12-20 郑州大学 miRNA-142a-5p在制备干预或治疗视网膜色素变性的药物中的应用

Also Published As

Publication number Publication date
CA3192711A1 (en) 2022-04-07
CN116406304A (zh) 2023-07-07
JP2023544142A (ja) 2023-10-20
KR20230110503A (ko) 2023-07-24
AU2021354969A1 (en) 2023-07-27
EP4221760A1 (en) 2023-08-09
US20240050527A1 (en) 2024-02-15
EP4221760A4 (en) 2025-08-13

Similar Documents

Publication Publication Date Title
JP7503590B2 (ja) 遺伝子構築物
US20240050527A1 (en) METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF
JP6266811B2 (ja) 血管新生病の免疫療法
JP2003522160A (ja) 眼関連疾患の治療のための遺伝子治療
AU2021354996A9 (en) METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF
US20250281573A1 (en) Methods of Treating Retinal Degenerative Diseases Using AIMP2-DX2 and Optionally a Target Sequence for miR-142 and Compositions Thereof
KR20200136850A (ko) 글루타치온-s-전이효소 및 혈관 내피 성장인자, 혈관 내피 성장인자 수용체 또는 종양괴사인자-알파에 특이적으로 결합하는 표적 세포 또는 표적 단백질 결합능을 갖는 단백질을 포함하는 융합 단백질 및 이의 용도
EA048792B1 (ru) СПОСОБЫ ЛЕЧЕНИЯ ВОЗРАСТНОЙ МАКУЛОДИСТРОФИИ С ПРИМЕНЕНИЕМ AIMP2-DX2 И, НЕОБЯЗАТЕЛЬНО, ПОСЛЕДОВАТЕЛЬНОСТИ-МИШЕНИ ДЛЯ miR-142 И ИХ КОМПОЗИЦИЙ
EP2383286A1 (en) Methods and compositions for treatment of retinal degenerative diseases
US20220331241A1 (en) Treatment of x-linked juvenile retinoschisis
US20210308169A1 (en) Methods and compositions for treatment of retinal degenerative diseases
Chen et al. AAV2 Delivery of Flt23k Intraceptors Inhibits Murine Choroidal Neovascularization 2

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21874708

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3192711

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2023519465

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023005936

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202347029418

Country of ref document: IN

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021874708

Country of ref document: EP

Effective date: 20230502

ENP Entry into the national phase

Ref document number: 112023005936

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230329

ENP Entry into the national phase

Ref document number: 2021354969

Country of ref document: AU

Date of ref document: 20210930

Kind code of ref document: A