WO2022070141A1 - METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF - Google Patents
METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF Download PDFInfo
- Publication number
- WO2022070141A1 WO2022070141A1 PCT/IB2021/059017 IB2021059017W WO2022070141A1 WO 2022070141 A1 WO2022070141 A1 WO 2022070141A1 IB 2021059017 W IB2021059017 W IB 2021059017W WO 2022070141 A1 WO2022070141 A1 WO 2022070141A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aimp2
- promoter
- gene
- subject
- mir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4747—Apoptosis related proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
Definitions
- a vector comprising AIMP2-DX2 and optionally a target sequence for miR-142.
- the brain of mammals can execute complex functions through establishment of systemic neural network after having undergone a series of processes including division, differentiation, survival and death of neuronal stem cells, and formation of synapses, etc.
- Neurons in the animal brain continuously produce a wide range of substances necessary in the growth of nerves even during their matured state, thereby inducing the growths of axon and dendrite.
- they continuously undergo differentiation since there is ceaseless synaptic remodeling of the neural network and synaptic connections whenever new learning and memorization is executed.
- target-derived survival factors such as neural growth factor in the process of cell differentiation and synaptic formation and apoptosis due to stress and cytotoxic agents become the main cause of degenerative cerebral disorders.
- target-derived survival factors such as neural growth factor in the process of cell differentiation and synaptic formation and apoptosis due to stress and cytotoxic agents become the main cause of degenerative cerebral disorders.
- target-derived survival factors such as neural growth factor in the process of cell differentiation and synaptic formation and apoptosis due to stress and cytotoxic agents become the main cause of degenerative cerebral disorders.
- GDNF glial derived neuronal factor
- AIMP2-DX2 is an alternative, antagonistic splicing variant of AIMP2, which is a multifactorial apoptotic gene.
- AIMP2-DX2 is known to suppress cell apoptosis by hindering the functions of AIMP2.
- AIMP2-DX2, acting as competitive inhibitor of AFMP2 suppresses TNF-alpha mediated apoptosis through inhibition of ubiquitination/degradation of TRAF2.
- AIMP2-DX2 has been confirmed as an existing lung cancer induction factor and, in the existing research, it was confirmed that AIMP2-DX2, manifested extensively in cancer cells, induces cancer by interfering with the cancer suppression functions of AIMP2.
- manifestation of AIMP2-DX2 in normal cell progresses cancerization of cells while suppression of manifestation of AIMP2-DX2, suppresses cancer growth, thereby displaying treatment effects.
- AIMP2-DX2 can be useful in treating neuronal diseases (KR10-2015-0140723 (2017) and US2019/0298858 (pub. Oct. 23, 2019).
- ALS amyotrophic lateral sclerosis
- ALS amyotrophic lateral sclerosis
- the subject has amyotrophic lateral sclerosis (ALS).
- the subject has spinal muscular atrophy (SMA).
- PD Parkinson’s disease
- methods for increasing survival rate or prolonging lifespan of a subject with Parkinson’s disease (PD) comprising administering to the subject a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
- PD Parkinson’s disease
- AIMP2-DX2 amyloid beta oligomer
- NMJ neuromuscular junction
- SMA spinal muscular atrophy
- NMJ neuromuscular junction
- AIMP2-DX2 exon 2-deleted AIMP2 variant
- ALS amyotrophic lateral sclerosis
- PD Parkinson’s disease
- methods of suppressing anoikis, and/or increasing laminin receptor stabilization in a subject with amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD) comprising administering to the subject a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
- ALS amyotrophic lateral sclerosis
- PD Parkinson’s disease
- the recombinant vector can further comprise an miR-142 target sequence.
- the vector can further comprise a promoter operably linked to the AIMP2-DX2.
- the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter or opsin promoter.
- LTR Retrovirus
- CMV cytomegalovirus
- RSV Rous sarcoma virus
- MT promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20.
- the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20.
- the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.
- the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 10 or 11.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA.
- the miR-142 target sequence comprises ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO: 5.
- the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA).
- the miR-142 target sequence can comprise a nucleotide sequence of SEQ ID NO:5.
- the miR-142 target sequence comprises ACTTTA. In some embodiments, the miR-142 target sequence comprises ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7. In some embodiments, the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO:7 (AGTAGTGCTTTCTACTTTATG). In some embodiments, the miR-142 target sequence comprises a nucleotide sequence of SEQ ID NO:7.
- the miR-142 target sequence can be repeated 2-10 times in the vector disclosed herein.
- the vector can be a viral vector.
- the viral vector can be an adenovirus, adeno- associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), avian sarcoma/leukosis (ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), Herpes simplex virus, or vaccinia virus vector.
- HIV human immunodeficiency virus
- MMV murine leukemia virus
- ASLV avian sarcoma/leukosis
- SNV spleen necrosis virus
- RSV Rous sarcoma virus
- MMTV mouse mammary tumor virus
- Herpes simplex virus Herpes simplex virus, or vaccinia virus vector.
- FIG. 1 illustrates an example recombinant vector.
- FIG. 2 shows the nerve cell-specific expression effect of a recombinant vector under an in vitro environment.
- FIG. 3 shows brain specific expression following intraparenchymal (substantia nigra) injection of scAAV-DX2-miR142-3pT in a Parkinson’s Disease model.
- FIG. 4 shows an miR142-3pT (target) sequence (SEQ ID NO:6) with 4 repeats of miR142-3pT (underlined).
- FIG. 5A shows a schematic of miR142-3pT with lx, 2x, and 3x repeats, and mutant sequence.
- FIG. 5B shows miR142-3p inhibition on DX2 expression with lx, 2x, and 3x repeats of miR- 142-3 pT.
- FIG. 6 shows that a core binding sequence is important in DX2 inhibition.
- a vector with Tseq x3 repeats, which showed significant inhibition of DX2 (FIG. 5B), and DX2 construct were used as controls.
- 100 pmol of miR- 142-3 p treatment inhibited Tseq x3 vector significantly but DX2 and mutant sequence were not inhibited.
- FIG. 7 shows total RNA extracted from the spinal cord of ALS model following intrathecal injection of scAAV2-DX2-miR142-3p. qRT-PCR was performed.
- FIG. 8 shows nerve cell-specific expression effect of an expression vector of the invention under an in vitro environment.
- FIGS. 9A-9E DX2 transgenic mice recover motor symptoms in rotenone-treated mice.
- FIG. 9A TH expression was analyzed with mice brain in the indicated mice. The black dotted square shows TF-stained regions.
- FIG. 9B Rotarod analysis. Latency to fall in rotenone- treated wild type and DX2 transgenic (TG) mice.
- FIGS. 9D and 9E are examples of mice recover motor symptoms in rotenone-treated mice.
- FIG. 9A TH expression was analyzed with mice brain in the indicated mice. The black dotted square shows TF-stained regions.
- FIG. 9B Rotarod analysis. Latency to fall in rotenone- treated wild type and
- FIG. 9D The pole test. scAAV-DX2 recovered motor coordination and balance in the rotenone- treated PD mouse model.
- Con and “GFP” indicate wild type and rotenone-treated GFP injection mice.
- Dose 1 and “Dose 2” represent the different injection dose of DX2 in rotenone-treated mice.
- FIGS. 10A-10H DX2 prevents behavioral deficits in the 6-OHDA-induced PD model.
- FIG. 10A scAAV-DX2 -treated mouse showed lower levels of contralateral rotation compared to that of saline or vehicle (GFP), indicating that DX2 attenuated damage in dopaminergic neurons.
- FIG. 10B DX2-treated mice showed increased contralateral forepaw contacts, indicating that AAV-DX2 attenuated unilateral damage in dopaminergic neurons.
- FIG. 10C AAV-DX2 treated mouse showed less right-biased body swing.
- FIG. 10D Immunofluorescence image of GFP and DX2-injected mice brain.
- FIG. 10H RNA in situ hybridization to identify the DX2 expressed cells in AAV-DX2 injected 6-OHDA mice model.
- FIGS. 11A-11G DX2 restores motor symptoms in MPTP-induced PD model.
- FIG. 11 A scAAV-DX2 -treated mouse showed slightly longer latency to fall in the rotarod test when compared with that of vehicle (scAAV-GFP, GFP) indicating that scAAV-DX2 attenuated damage towards dopaminergic neurons.
- FIG. 11B DX2 -treated mouse showed improved locomotor activity based on the SHIRPAtest.
- FIG. 11C DX2 -treated mice showed a relatively lower level of limb deficit.
- FIG. 11D DX2-overexpressed mouse showed improved grooming rate when compared with vehicle control (GFP).
- FIG. 1 IE IE.
- FIGS. 1 IF and 11G The DX2 (FIG. 1 IF) and Bax (FIG. 11G) mRNA expression of the indicated mice brain.
- Naive, GFP, and DX2 indicate saline-treated wild type mice, GFP- injected MPTP -treated mice, and DX2 -injected MPTP -treated mice.
- FIG. 13 represents the cell morphology in bright field microscopy.
- Overexpression of DX2 in AAV-DX2-infected cells inhibits Ap-O-mediated cell death.
- DX2 increases cell viability in AP-O-treated cells.
- SK-SY5Y cells were incubated with AAV-DX2 or AAV-GFP in the absence or presence of 25 pM of Ap-O, after 48 hours, cells death was observed by microscopy.
- Original magnification images X40 (upper panel), XI 00 (lower panel).
- FIG. 14 shows quantification of cell death in FIG. 13.
- White box shows the percentage of cell death and black box indicates the percentage of cell viability.
- FIG. 15 indicates the expression level of p53. DX2 expression plays an important role in neurotoxin-induced p53 expression. * AAV-DX2 (#1) and AAV-DX2 (#2) indicates produced AAV-DX2 virus in different batch.
- FIGS. 16A-16D Mutant SOD1 selectively interacts with KARS1.
- FIG. 16A Binding affinity of Lex-KARSl to B42-SOD1 WT and mutants G85R and G93Awas tested by the yeast two-hybrid assay.
- FIG. 16B HA-SOD1 WT, G85R, and G93A were transfected into HEK 293 cells and immunoprecipitation (IP) was performed with HA antibody. Levels of KARS 1 and SOD1 were determined by immunoblotting.
- FIG. 16C Binding affinity of KARS 1 fragments to SOD1 mutants determined by the yeast two-hybrid assay.
- FIG. 16D N2A cells were transfected with myc-KARSl and SOD1 WT, G93A, G85RA. IP of myc-KARSl was performed and immunoblotted for detection of AIMP2 and 67LR (laminin receptor).
- FIGS. 17A-17F Mutant SOD1 decreased 67 laminin receptor inducing anoikis.
- FIG. 17A SK-N-SH cells were transfected with SOD1 WT and G93A. The cells were harvested and immunblotted for 67 laminin receptor (LR).
- FIG. 17B Neural cells were transfected with S0D1 WT and G93A then seeded on 22x22 cover slip. The cells fixed and then treated with KARS1 or 67LR antibody and then, the images were taken by confocal microscopy. The white arrow indicates stained laminin receptor.
- FIG. 17C The white arrow indicates stained laminin receptor.
- FIG. 17D Neural cells were transfected with SOD1 WT or G93A then treated with Laminin 1(LN1) for 0, 15, 30 and 60 min. The pERK and ERK levels were checked by western blot.
- FIG. 17E Binding affinity of KARS 1 to 67 LR in WT and mutant SOD1 expressed cells determined by the immunoprecipitation.
- FIG. 17F Binding affinity of KARS 1 to 67 LR in WT and mutant SOD1 expressed cells determined by the immunoprecipitation.
- SH- SY5Y cells were seeded transfected with KARS1 for 24 h and then SOD1 WT, G85R, and G93A for 24 h. Then they were seeded in a hema-coated then treated with TNF-a and cycloheximide (CHX) for 6 h. MTT assay was performed to observe cell viability.
- FIGS. 18A-18D The effects of AIMP2-DX2 gene on KARS1 and 67LR.
- FIG. 18A SK-N-SH cells were transfected with SOD1 WT, or G93Athen treated with KARS1 with DX2 or AIMP2. The cells were harvested and western blot was performed.
- FIG. 18B Neuroblastoma cells were transfected with strep-DX2 for 24 h and then SOD1 WT, G93A and G85R for 24 h. The cells were harvested and subcellular fractionation was performed and the samples were immunoblotted.
- FIG. 18C The effects of AIMP2-DX2 gene on KARS1 and 67LR.
- Neural cells were transfected with SOD1 WT, or G93 A and then they were treated with AAV-EV or AAV-DX2. And the cells were treated with laminin 1 (LN1) for 0, 15, 30 and 60 min. The cells werel lysed and then immunblotted for p- ERK and ERK levels.
- FIG. 18D SH-SY5Y cells were transfected with SOD1 WT, or G93A then treated with TNF-a (30 ng/mL) for 24 h. The attachment of cells was measured by iCelligence.
- FIGS. 19A-19B Administration of DX2 rescue mutant SOD1 induced neuronal death.
- FIG. 19A SH-SY5Y cells were transfected with SOD1 WT, G85R and G93 A and treated with TNF-a and cycloheximide (CHX) for 6 h followed by adeno associated virus (AAV) control vector (GFP) or DX2. The cells viability was check by MTT assay.
- FIG. 19B The primary neuronal cells were isolated in each mouse, seeded on 24-well plate, treated with AAV-GFP or AAV-DX2, and MTT assay was performed to check their viability.
- FIG. 20 A A binding assay shows that DX2 binds to PARP-1 more strongly than AIMP2.
- FIG. 20B AIMP2-transfected cells showed significantly increased cleavage of PARP-1 when compared to the expression seen in other transfected cells under oxidative stress conditions. However, PARP-1 cleavage was not observed in DX2 -transfected cells.
- FIG. 20C PARylation of AIMP2 was increased in the presence of H2O2, but the PARlylation of DX2 was not altered.
- FIGS. 21A-21C A comparison of the amino acid sequences of AIMP2-DX2 and variants (FIGS. 21B and 21C are continuations of FIG. 21A).
- FIGS. 22A-22B Inhibition of neuromuscular junction damage.
- the neuromuscular junctions were stained with alpha-Bungarotoxin, and synaptic vesicle and end plate were staining with SV2 and 2H3.
- FIG. 22B the number of innervated endplates was counted and represented.
- AIMP2-DX2 is an alternative, antagonistic splicing variant of AIMP2 (aminoacyl tRNA synthase complex-interacting multifunctional protein 2), which is a multifactorial apoptotic gene.
- AIMP2-DX2 is known to suppress cell apoptosis by hindering the functions of AIMP2.
- AIMP2-DX2 acting as a competitive inhibitor of AIMP2, suppresses TNF-alpha mediated apoptosis through inhibition of ubiquitination/degradation of TRAF2.
- AIMP2-DX2 has been previously identified as a lung cancer-inducing factor.
- AIMP2-DX2 can treat neuronal diseases (US2019/0298858 Al).
- ALS amyotrophic lateral sclerosis
- ALS amyotrophic lateral sclerosis
- the subject has amyotrophic lateral sclerosis (ALS).
- the subject has spinal muscular atrophy (SMA).
- PD Parkinson’s disease
- methods for increasing survival rate or prolonging lifespan of a subject with Parkinson’s disease (PD) comprising administering to the subject a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
- PD Parkinson’s disease
- methods of preventing behavior deficit, restoring a motor symptom, and/or reducing neuronal damage in a subject with Parkinson’s disease comprising administering to the subject a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
- AIMP2-DX2 exon 2-deleted AIMP2 variant
- AIMP2-DX2 amyloid beta oligomer
- NMJ neuromuscular junction
- SMA spinal muscular atrophy
- NMJ neuromuscular junction
- ALS amyotrophic lateral sclerosis
- ALS amyotrophic lateral sclerosis
- PD Parkinson’s disease
- methods of suppressing anoikis, and/or increasing laminin receptor stabilization in a subject with amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD) comprising administering to the subject a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
- ALS amyotrophic lateral sclerosis
- PD Parkinson’s disease
- AIMP2-DX2 exon 2-deleted AIMP2 variant
- the recombinant vector as disclosed herein can further comprise an miR-142 target sequence.
- the vector can further comprise a promoter operably linked to the AIMP2-DX2.
- the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, Synapsin promoter, MeCP2 promoter, CaMKII promoter, Hb9 promoter, or opsin promoter.
- the recombinant vectors comprise an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene and an miR-142 target sequence.
- the miR-142 target sequence can be 3’ to the AIMP2-DX2 gene.
- the vectors described herein can express AIMP2-DX2 in neuronal cells but not in hematopoietic cells, such as leukocytes and lymphoid cells. Thus, the vectors described herein can be useful in specifically targeting neuronal cells for treating neuronal diseases.
- the AIMP2-DX2 polypeptide (SEQ ID NO:2) is a splice variant of AIMP2 (e.g., aa sequence of SEQ ID NO: 12; e.g., nt sequence of SEQ ID NO:3), in which the second exon (SEQ ID NO: 10; nt sequence of SEQ ID NO:4) of AIMP2 is omitted.
- the AIMP2-DX2 gene has a nucleotide sequence set forth in SEQ ID NO: 1
- the AIMP2- DX2 polypeptide has an amino acid sequence set forth in SEQ ID NO:2.
- FIGS. 21A-21C show a comparison of AIMP2 (SEQ ID NO:2) and variants, SEQ ID NO: 13-19, as well as a consensus or core sequence (SEQ ID NO:20).
- the AIMP2-DX2 gene can comprise a nucleotide sequence encoding an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical to SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20, or any ranges of % identity therein.
- the AIMP2-DX2 gene can comprise a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:2, 13, 14, 15, 16, 17, 18, 19, or 20.
- the AIMP2-DX2 gene can comprise a nucleotide sequence at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical to a nucleotide sequence of SEQ ID NO: 1, or any ranges of % identity therein.
- the AIMP2-DX2 gene can comprise a nucleotide sequence of SEQ ID NO: 1.
- the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 10 or 11.
- the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 10 or 11.
- the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:4.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACACTA and a sum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides that are contiguous 5’ or 3’ of ACACTA as shown in SEQ ID NO:5.
- the miR-142 target sequence can comprise a nucleotide sequence at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to a nucleotide sequence of SEQ ID NO:5 (TCCATAAAGTAGGAAACACTACA; miR-142-3pT).
- the miR- 142 target sequence can comprise a nucleotide sequence of SEQ ID NO:5.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACTTTA.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACTTTA and 1- 15 additional contiguous nucleotides of SEQ ID NO:7.
- the miR-142 target sequence can comprise a nucleotide sequence comprising ACTTTA and a sum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additional nucleotides that are contiguous 5’ or 3’ of ACTTTA as shown in SEQ ID NO:7.
- the miR-142 target sequence can comprise a nucleotide sequence at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to a nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG; miR-142-5pT).
- the miR-142 target sequence can comprise a nucleotide sequence of SEQ ID NO:7.
- a mutant sequence refers to one or more regions, e.g., four regions, of core sequences of miR142 3pT that are substituted as follows: (5’- AACACTAC-3’ 5’-CCACTGCA-3’).
- Inhibition of DX2 expression in vector transfected HEK293 cells was observed with the miR142-3p xl repeat (100 pmol) miR142-3p target sequence and as the number of core binding sequence in miR142-3p target seq are increased, miR142-3p inhibition on DX2 expression was also increased.
- the Tseq x3 core sequence containing vector showed significant inhibition, whereas no inhibition was observed for the mutated 3x sequence.
- a microRNA is a non-coding RNA molecule that functions to control gene expression.
- MiRNAs function via base-pairing with complementary sequences within mRNA molecules, i.e., a miRNA target sequences.
- miRNAs can bind to target messenger RNA (mRNA) transcripts of protein-coding genes and negatively control their translation or cause mRNA degradation.
- miRNA messenger RNA
- miRbase databases are publicly available. Many miRNAs are expressed in a tissue-specific manner and have an important roles in maintaining tissue-specific functions and differentiation.
- MiRNA acts at the post-transcription stage of the gene and, in the case of mammals, and it is known that approximately 60% of the gene expression is controlled by miRNA.
- miRNA plays an important role in a diverse range of processes within living body and has been disclosed to have correlation with cancer, cardiac disorders and nerve related disorders.
- miR-142-3p and miR-142-5p exist in miR-142 and any of the target sequences thereof can be used.
- miR-142 or miRNA-142 refers to, e.g., miR-142-3p and/or miR-142- 5p, and can bind to the miR-142 target sequence, e.g., miR-142-3pT or miR-142-5pT.
- the miR-142 target sequence can be 5’ or 3’ to the AIMP2-DX2 gene.
- miR-142-3p can exist in the area at which translocation of its gene occurs in aggressive B cell leukemia and is known to express in hemopoietic tissues (bone marrow, spleen and thymus, etc.).
- miR-142-3p is known to be involved in the differentiation of hemopoietic system with confirmation of expression in the liver of fetal mouse (hemopoietic tissue of mouse).
- the miR-142-3p and/or miR-142-5p target sequence is repeated at least 2-10 times, at least 2-8 times, at least 2-6 times, at least 4 times, or any range or number of times thereof.
- the miR-142-3p e.g., having a nucleotide sequence of SEQ ID NO:23
- a corresponding target sequence e.g., a miR-142-3p target sequence (miR-142-3pT) having a nucleotide sequence of SEQ ID NO:5 but not limited thereto.
- the miR-142-5p e.g., having a nucleotide sequence of SEQ ID NO:24 can have a corresponding target sequence, e.g., a miR-142-5p target sequence (miR-142-5pT) having a nucleotide sequence of SEQ ID NO: 7 but not limited thereto.
- an miR-142-3p can have a nucleotide sequence of SEQ ID NO:23 and an miR-142-5p can have a nucleotide sequence of SEQ ID NO:24.
- recombinant vectors that can control the side effect of overexpression of the AIMP2-DX2 variant in a tumor by inserting an miR-142-3p and/or miR-142- 5p target sequence (miR-142-3pT and/or miR-142-5pT, respectively) into a terminal end of AIMP2-DX2 and controlling suppression of AIMP2-DX2 expression in CD45-derived cells, in particular, the lymphatic system and leukocytes.
- the expression of AIMP2-DX2 variant can be restricted to only in the injected neuronal cells and tissues but not in nonneuronal hematopoietic cells, the major population in the injected tissue areas.
- MiR142-3p is expressed only in hematopoietic cells.
- recombinant vectors containing a target sequence for miR-142-3p and/or miR-142-5p.
- recombinant vectors comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene and miR-142-3p and/or miR-142-5p target sequences as disclosed herein.
- recombinant vector refers to vector that can be expressed as the target protein or RNA in appropriate host cells, and gene construct that contains essential operably linked control factor to enable the inserted gene to be expressed appropriately.
- operably linked refers to functional linkage between the nucleic acid expression control sequence and nucleic acid sequence that codes the targeted protein and RNA to execute general functions. For example, it can affect the expression of nucleic acid sequence that codes promoter and protein or RNA that has been linked for operability of the nucleic acid sequence.
- Operable linkage with recombinant vector can be manufactured by using gene recombinant technology, which is known well in the corresponding technology area, and uses generally known enzymes in the corresponding technology area for the area-specific DNA cutting and linkage.
- the recombinant vectors can further comprise a promoter operably linked to a AIMP2- DX2 as disclosed herein.
- the promoter is a Retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, Synapsin promoter, MeCP2 promoter, CaMKII promoter, Hb9 promoter, or opsin promoter.
- LTR Retrovirus
- CMV cytomegalovirus
- RSV Rous sarcoma virus
- Heterogeneous gene as used herein can include protein or polypeptide with biologically appropriate activation, and encrypted sequence of the targeted product such as immunogen or antigenic protein or polypeptide, or treatment activation protein or polypeptide.
- Polypeptides can supplement deficiency or absent expression of endogenous protein in host cells.
- the gene sequence can be induced from a diverse range of suppliers including DNA, cDNA, synthesized DNA, RNA or its combinations.
- the gene sequence can include genome DNA that contains or does not contain natural intron.
- the genome DNA can be acquired along with promoter sequence or polyadenylated sequence.
- Genome DNA or cDNA can be acquired in various methods, genome DNA can be extracted and purified from appropriate cells through method publicly notified in the corresponding area. Or, mRNA can be used to produce cDNA by reverse transcription or other method by being separated from the cells. Or, polynucleotide sequence can contain sequence that is complementary to RNA sequence, for example, antisense RNA sequence, and the antisense RNA can be administered to individual to suppress expression of complementary polynucleotide in the cells of individuals.
- the heterogeneous gene is an AIMP-2 splicing variant with the loss of exon 2 and miR-142-3p target sequence can be linked to 3’ UTR of the heterogeneous gene.
- the sequence of the AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC0 13630.1) are described in the literatures (312aa version: Nicolaides, N.C., Kinzler, K.W. and Vogelstein, B.
- AIMP2 splicing variant refers to the variant generated due to partial or total loss of exon 2 among exons 1 to 4. As such, the variant signifies interference of the normal function of AIMP2 by forming AIMP2 protein and heterodimer.
- the injected AIMP2-DX2 gene is rarely expressed in tissues other than the injected tissue.
- an miR142 target sequence can be inserted to completely block the possibility of AIMP2-DX2 being expressed in hematopoietic cells, the major population of non-neuronal cells in the injected tissue area.
- the recombinant vector can include SEQ ID NOS: 1 and 5.
- the term “% of sequence homology,” “% identity,” or “% identical” to a nucleotide or amino acid sequence can be, e.g., confirmed by comparing the 2 optimally arranged sequence with the comparison domain and some of the nucleotide sequences in the comparison domain can include addition or deletion (that is, gap) in comparison to the reference sequence on the optimal arrange of the 2 sequences (does not include addition or deletion).
- Protein as disclosed herein not only includes those with its natural type amino acid sequence but also those with variant amino acid sequences.
- Variants of the protein signify proteins with difference sequences due to the deletion, insertion, non-conservative or conservative substitution or their combinations of the natural amino acid sequence and more than 1 amino acid residue. Amino acid exchange in protein and peptide that does not modify the activation of the molecule in overall is notified in the corresponding area (H. Neurath, R.L. Hill, The Proteins, Academic Press, New York, 1979).
- the protein or its variant can be manufactured through natural extraction, synthesis (Merrifield, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or genetic recombination on the basis of the DNA sequence (Sambrook et al, Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2 nd Ed., 1989).
- Amino acid mutations can occur on the basis of the relative similarity of the amino acid side chain substituent such as hydrophilicity, hydrophobicity, electric charge and size, etc.
- amino acid side chain substituent such as hydrophilicity, hydrophobicity, electric charge and size, etc.
- arginine, lysine and histidine are residues with positive charge
- alanine, glycine and serine have similar sizes
- phenylalanine, tryptophan and tyrosine have similar shapes.
- arginine, lysine and histidine alanine, glycine and serine
- phenylalanine, tryptophan and tyrosine can be deemed functional equivalents biologically.
- hydrophobic index of amino acid can be considered. Hydrophobic index is assigned to each amino acid according to hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (- 3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5)
- hydrophobic amino acid index is very important. It is possible to have similar biological activation only if a substitution is made with an amino acid with a similar hydrophobic index. In the event of introducing a mutation by making reference to the hydrophobic index, substitution between amino acids with hydrophobic index differences within ⁇ 2, within ⁇ 1, or within ⁇ 0.5.
- substitutions can be made between amino acids with hydrophilic value differences within ⁇ 2, within ⁇ 1, or within ⁇ 0.5. but not limited thereto.
- Vectors disclosed herein can be constructed as a typical vector for cloning or for expression.
- the vectors can be constructed with prokaryotic or eukaryotic cells as the host. If the vector is an expression vector and prokaryotic cell is used as the host, it is general to include powerful promoter for execution of transcription (for example, tac promoter, lac promoter, lacUV5 promoter, Ipp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosome binding site for commencement of decoding and transcription/decoding termination sequence.
- powerful promoter for execution of transcription for example, tac promoter, lac promoter, lacUV5 promoter, Ipp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.
- vectors that can be used can be more than 1 type, such as a virus vector, linear DNA, or plasmid DNA.
- Virus vector refers to a virus vector capable of delivering gene or genetic substance to the desired cells, tissue and/or organ.
- the virus vectors can include more than 1 species from the group composed of Adenovirus, Adeno-associated virus, Lentivirus, Retrovirus, HIV (Human immunodeficiency virus), MLV (Murine leukemia virus), ASLV (Avian sarcoma/leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus) and Herpes simplex virus, it is not limited thereto.
- the viral vector can be an adeno-associated virus (AAV), adeonovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.
- Retrovirus Although Retrovirus has an integration function for the genome of host cells and is harmless to the human body, it can have characteristic including suppressing the functions of normal cells at the time of integration, ability to infect a diverse range of cells, ease of proliferation, accommodate approximately 1-7 kb of external gene and generate duplication deficient virus.
- Retroviruses can also have disadvantages including difficulties in infecting cells after mitotic division, gene delivery under an in vivo condition and need to proliferate somatic cells under in vitro condition.
- Retroviruses have the risk of spontaneous mutations as it can be integrated into proto-oncogene, thereby presenting the possibility of cell necrosis.
- Adenoviruses have various advantages as a cloning vector including duplication even in nucleus of cells in medium level size, clinically nontoxic, stable even if external gene is inserted, no rearrangement or loss of genes, transformation of eukaryotic organism and stably undergoes expression at high level even when integrated into host cell chromosome.
- Good host cells of Adenoviruses are the cells that are the causes of hemopoietic, lymphatic and myeloma in human.
- proliferation is difficult since it is a linear DNA and it is not easy to recover the infected virus along with low infection rate of virus.
- expression of the delivered gene is most extensive during 1-2 weeks with expression sustained over the 3-4 weeks only in some of the cells. Another issue is that it has high immunoantigenicity.
- Adeno-associated virus has been preferred in recent years since it can supplement the aforementioned problems and has a lot of advantages as gene therapy agent. It is also referred as adenosatellite virus. Diameter of adeno-associated virus particle is 20nm and is known to have almost no harm to human body. As such, its sales as gene therapy agent in Europe were approved.
- AAV is a provirus with single strand that needs auxiliary virus for duplication and AAV genome has 4,680 bp that can be inserted into specific area of the chromosome 19 of the infected cells.
- Trans-gene is inserted into the plasma DNA connected by the 2 inverted terminal repeat (ITR) sequence section with 145bp each and signal sequence section.
- ITR 2 inverted terminal repeat
- Transfection is executed along with other plasmid DNA that expresses the AAV rep and cap sections, and Adenovirus is added as an auxiliary virus.
- AAV has the advantages of wide range of host cells that deliver genes, little immunological side effects at the time of repetitive administration and long gene expression period.
- the Adeno-associated virus is known to have a total of 4 serotypes.
- the serotypes of many Adeno-associated viruses that can be used in the delivery of the target gene the most widely researched vector is the Adeno-associated virus serotype 2 and is currently used in the delivery of clinical genes of cystic fibrosis, hemophilia and Canavan’s disease.
- rAAV recombinant adeno-associated virus
- vectors are expression vectors and use eukaryotic cells as the host
- promoter derived from the genome of mammalian cells example: metallothionein promoter
- promoter derived from mammalian virus example: post-adenovirus promoter, vaccine virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV TK promoter
- telomere a virus that promotes the transcription termination sequence.
- CMV cytomegalovirus
- RSV Rous sarcoma virus
- MT MT promoter
- EF-1 alpha promoter a promoter that promotes the transcription termination sequence.
- UB6 Rous sarcoma virus
- UB6 EF-1 alpha promoter
- UB6 EF-1 alpha promoter
- UB6 EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promoter
- UB6 promoter EF-1 alpha promote
- Vectors disclosed herein can be fused with other sequences as need to make the purification of the protein easier.
- the fused sequence such as glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6xHis (hexahistidine; Quiagen, USA), etc. can be used, for example, it is not limited to these.
- expression vectors can include tolerance gene against antibiotics generally used in the corresponding industry as the selective marker including Ampicillin, Gentamycin, Carbenicillin, Chloramphenicol, Streptomycin, Kanamycin, Geneticin, Neomycin and Tetracycline, as examples.
- gene carriers including the recombinant vector containing a target sequence (miR-142-3pT and/or miR-142-5pT) for miR-142, such as miR- 142-3p and/or miR-142-5p, respectively.
- the term “gene transfer” includes delivery of genetic substances to cells for transcription and expression in general. Its method is ideal for protein expression and treatment purposes. A diverse range of delivery methods such as DNA transfection and virus transduction are announced. It signifies virus-mediated gene transfer due to the possibility of targeting specific receptor and/or cell types through high delivery efficiency and high level of expression of delivered genes, and, if necessary, nature-friendliness or pseudo-typing.
- the gene carriers can be transformed entity that has been transformed into the recombinant vector, and transformation includes all methods of introducing nucleic acid to organic entity, cells, tissues or organs, and as announced in the corresponding area, it is possible to select and execute appropriate standard technology in accordance with the host cells. Although such methods include electroporation, fusion of protoplasm, calcium phosphate (CaPCU) sedimentation, calcium chloride (CaCh) sedimentation, mixing with the use of silicone carbide fiber, agribacteria-mediated transformation, PEG, dextran sulphate and lipofectamin, etc., it is not limited to these.
- the gene carriers are for the purpose of expression of heterogeneous genes in neuron. As such it suppresses the expression of the heterogeneous gene in CD45-derived cells and can increase the expression of heterogeneous gene in brain tissue.
- Majority of the CD45 are transmembrane protein tyrosine phosphatase situated at the hematopoietic cell. Cells can be defined in accordance with the molecules situated on the cell surface and the CD45 is the cell marker for all leukocyte groups and B lymphocytes.
- the gene carrier is not be expressed in the CD45-derived cells, in particular, in lymphoid and leukocyte range of cells.
- the gene carriers can additionally include carrier, excipient or diluent allowed to be used pharmacologically.
- the methods can increase the expression of heterogeneous gene in cerebral tissues and control heterogeneous gene expression in other tissues.
- vectors comprising 1) a promoter; 2) a nucleotide sequence that encodes a target protein linked with the promoter to enable operation; and 3) an expression cassette that includes the nucleotide sequence targeting miR-142-3p inserted into 3’UTR of the nucleotide sequence.
- the vectors can comprise 1) a promoter; 2) a nucleotide sequence that encodes a target protein linked with the promoter to enable operation; and 3) an expression cassette that includes the nucleotide sequence targeting miR-142-5p inserted into 3’UTR of the nucleotide sequence.
- expression cassette refers to the unit cassette that can execute expression for the production and secretion of the target protein operably linked with the downstream of signal peptide as it includes a gene that encodes the target protein and a nucleotide sequence that encodes the promoter and signal peptide.
- Secretion expression cassette of the invention can be used mixed with the secretion system. A diverse range of factors that can assist the efficient production of the target protein can be included in and out of such expression cassette.
- preventive or therapeutic preparations for neurodegenerative diseases that include a nucleotide sequence that encodes AIMP-2 splicing variant with loss of exon 2 and a nucleotide sequence that targets miR-142-3p linked to 3’UTR of the nucleotide sequence.
- the neurodegenerative diseases can be more than 1 of the diseases selected from the group composed of Alzheimer’s disease, Parkinson’s disease, amyotrophic lateral sclerosis (ALS), retinal degeneration, mild cognitive impairment, multi-infarct dementia, frontotemporal dementia, dementia with Lewy bodies, Huntington’s disease, degenerative neural disease, metabolic cerebral disorders, depression, epilepsy, multiple sclerosis, cortico-basal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia, primary lateral sclerosis, spinal muscular atrophy and stroke, it is not limited to these.
- the neuronal disease is ALS.
- the treatment can improve memory, dyskinesia, motor activity, and/or prolong lifespan of the subject with a neuronal disease, e.g., ALS, Alzheimer’s disease, or Parkinson’s disease.
- the treatment can improve motor activity and/or prolong lifespan of the subject with a neuronal disease, e.g., ALS.
- the vectors disclosed herein can effect, but not limited to, apoptosis inhibition, dyskinesia amelioration, and/or oxidative stress inhibition, and thus prevent or treat neuronal diseases.
- treatment includes not only complete treatment of neurodegenerative diseases but also partial treatment, improvement and/or reduction in the overall symptoms of neurodegenerative diseases as results of application of the pharmacological agents disclosed herein .
- prevention signifies prevention of the occurrence of overall symptoms of neurodegenerative diseases in advance by suppressing or blocking the symptoms or phenomenon such as cognition disorder, behavior disorder and destruction of brain nerves by applying pharmacological agents disclosed herein.
- Adjuvants other than the active ingredients can be included additionally to the pharmacological agents disclosed herein. Although any adjuvant can be used without restrictions as long as it is known in the corresponding technical area, it is possible to increase immunity by further including complete and incomplete adjuvant of Freund, for example.
- Pharmacological agents disclosed herein can be manufactured in the format of having mixed the active ingredients with the pharmacologically allowed carrier.
- pharmacologically allowed carrier includes carrier, excipient and diluent generally used in the area of pharmacology.
- Pharmacologically allowed carrier that can be used for the pharmacological agents disclosed herein include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil, but not limited to these.
- Pharmacological agents disclosed herein can be used by being manufactured in various formats including oral administration types such as powder, granule, pill, capsule, suspended solution, emulsion, syrup and aerosol, etc., and external application, suppository drug or disinfection injection solution, etc. in accordance with their respective general manufacturing methods.
- Solid preparations for oral administration include pill, tablet, powder, granule and capsule preparations, and such solid preparations can be manufactured by mixing more than 1 excipient such as starch, calcium carbonate, sucrose, lactose and gelatin with the active ingredients.
- lubricants such as magnesium stearate and talc can also be used in addition to simple excipients.
- Liquid preparations for oral administration include suspended solution, solution for internal use, oil and syrup, etc.
- Preparations for non-oral administration include sterilized aqueous solution, non-aqueous solvent, suspension agent, oil, freeze dried agent and suppository. Vegetable oil such as propylene glycol, polyethylene glycol and olive oil, and injectable esters such as ethylate can be used as non-aqueous solvent and suspension solution.
- Agents for suppository can include witepsol, tween 61, cacao oil, laurine oil and glycerogelatin, etc.
- Pharmacological agents can be administered into a subject or entity through diversified channels. All formats of administration such as oral administration, and intravenous, muscle, subcutaneous and intraperitoneal injection can be used.
- Desirable doses of administration of therapeutic agents disclosed herein differ depending on various factors including preparation production method, administration format, age, weight and gender of the patient, extent of the symptoms of the disease, food, administration period, administration route, discharge speed and reaction sensitivity, etc. Nonetheless, it can be selected appropriately by the corresponding manufacturer.However, for the treatment effects, skilled medical doctor can determine and prescribe effective dose for the targeted treatment.
- the treatment agents include intravenous, subcutaneous and muscle injection, and direction injection into cerebral ventricle or spinal cord by using microneedle.
- the effective dose is 0.05 to 15 mg/kg in the case of vector, 5 X 10 11 to 3.3 X 10 14 viral particle (2.5 X 10 12 to 1.5 X 10 16 IU)/kg in the case of recombinant virus and 5 X 10 2 to 5 X 10 7 cells/kg in the cells.
- the doses are 0.1 to 10 mg/kg in the case of vector, 5 X 10 12 to 3.3 X 10° particles (2.5 X 10 13 to 1.5 XI 0 15 IU)/kg in the case of recombinant virus and 5 XI 0 3 to 5 X 10 6 cells/kg in the case of cells at the rate of 2 to 3 administrations per week.
- the dose is not strictly restricted. Rather, it can be modified in accordance with the condition of the patient and the extent of manifestation of the neural disorders.
- Effective dose for other subcutaneous fat and muscle injection, and direct administration into the affected area is 9 X 10 10 to 3.3 X 10 14 recombinant viral particles with the interval of 10cm and at the rate of 2 ⁇ 3 times per week.
- the dose is not strictly restricted. Rather, it can be modified in accordance with the condition of the patient and the extent of manifestation of the neural disorders.
- pharmacological agent in accordance with the invention includes 1 X IO 10 to 1 X 10 12 vg(virus genome)/mL of recombinant adeno-associated virus and, generally, it is advisable to inject 1 X 10 12 vg once every 2 days over 2 weeks. It can be administered once a day or by dividing the dose for several administrations throughout the day.
- the vectors can be administered in a dose of 0.1 X 10 8 vg to 500 X 10 8 vg, 1 X 10 8 vg to 100 X 10 8 vg, 1 X 10 8 vg to 10 X 10 8 vg, e.g., 5 X 10 8 vg, or any ranges derived therefrom.
- vg can be translated to doses for human based on body weight for IV injection.
- vg can also be translated to doses for humans based on the target cell number and effective MOI (multiplicity of infection).
- the vectors disclosed herein can be injected to a subject by, e.g., subretinal injection, intravitreal injection, or subchoroidal injection.
- the injection can be in the form of a liquid.
- the vectors disclosed herein can be administered to a subject in the form of eye drops or ointment.
- the pharmacological preparations can be produced in a diverse range of orally and non- orally administrable formats.
- the vector disclosed herein can be administered to the brain or spinal cord.
- the vectors disclosed herein can be administered to the brain by stereotaxic injection.
- Orally administrative agents include pills, tablets, hard and soft capsules, liquid, suspended solution, oils, syrup and granules, etc. These agents can include diluent (example: lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine) and glydents (example: silica, talc, and stearic acid and its magnesium or calcium salts, and/ or polyethylene glycol) in addition to the active ingredients.
- diluent example: lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine
- glydents example: silica, talc, and stearic acid and its magnesium or calcium salts, and/ or polyethylene glycol
- the pills can contain binding agents such as magnesium aluminum silicate, starch paste, gelatin, tragacanthin, methyl cellulose, sodium carboxymethyl cellulose and/or polyvinyl pyrrolidine, and, depending on the situation, can contain disintegration agent such as starch, agar, alginic acid or its sodium salt or similar mixture and/or absorbent, coloring, flavor and sweetener.
- binding agents such as magnesium aluminum silicate, starch paste, gelatin, tragacanthin, methyl cellulose, sodium carboxymethyl cellulose and/or polyvinyl pyrrolidine
- disintegration agent such as starch, agar, alginic acid or its sodium salt or similar mixture and/or absorbent, coloring, flavor and sweetener.
- the agents can be manufactured by general mixing, granulation or coating methods.
- injection agents are the representative form of non-orally administered preparations.
- Solvents for such injection agents include water, Ringer’s solution, isotonic physiological saline and suspension.
- Sterilized fixation oil of the injection agent can be used as solvent or suspension medium, and any non-irritating fixation oil including mono- and diglyceride can be used for such purpose.
- the injection agent can use fatty acids such as oleic acid.
- CD45 transmembrane protein tyrosine phosphatase of the hematopoietic cell, which can be used to define the cells in accordance with the molecule on the cell surface.
- CD45 is a marker for all leukocyte groups and B lymphocytes.
- a recombinant vector has been produced that is expressed specifically and only in neurons without being expressed in CD45- derived cells, in particular, lymphoid and leukocyte cells.
- the recombinant vector contains a splicing variant in which exon 2 of the Aminoacyl tRNA Synthetase Complex Interacting Multifunctional Protein 2 (AIMP2) has been deleted and an miRNA capable of controlling the expression of the AIMP2 splicing variant.
- AIMP2 Aminoacyl tRNA Synthetase Complex Interacting Multifunctional Protein 2
- the recombinant vector was produced as above in order to induce specific expression of the AIMP2 splicing variant only in injected neuronal tissues and to completely block the possibility of AIMP2-DX2 being expressed in hematopoietic cells, the major population of non-neuronal cells in the injected tissue area.
- AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARSs) and acts as a multifactorial apoptotic protein.
- ARSs aminoacyl-tRNA synthetase
- cDNA of AIMP2 splicing variant was cloned into pcDNA3.1-myc.
- the sub-cloning in pcDNA3.1-myc was executed by using EcoRl and Xhol after having amplified the AIMP2 splicing variant by using a primer having EcoRl and Xhol linker attached to the H322 cDNA.
- AIMP2 variant having a nucleotide sequence of SEQ ID NO: 1 and an amino acid sequence of SEQ ID NO:2 was used.
- Example 1.2 Sorting of miRNA and selection of its target sequence
- the recombinant vector was produced as above in order to confine the expression of the AIMP2 variant in injected neuronal cells and to completely block the possibility of AIMP2-DX2 being expressed in hematopoietic cells, the major population of non-neuronal cells in the injected tissue area.
- miR-142-3p that is specifically expressed only in hematopoietic cells that generate leukocyte and lymphoid related cells was selected as the target.
- miR-142-3p that is specifically expressed only in hematopoietic cells that generate leukocyte and lymphoid related cells was selected as the target.
- miR-142-3p microarray data of mouse B cells and computer programming of genes targeted by miR'142-3p (mirSVR score) were used.
- the miR- 142-3p is a base sequence indicated with the sequence number of 3.
- the sequence targeting miR-142-3p was indicated with base sequence number of 4 that binds with miR-142-3p complementarily.
- MiR-142-3p target sequence can have a nucleotide sequence of SEQ ID NO:5.
- the miR-142-3p target sequence includes limiting enzyme for cloning (Nhe 1 and Hind III, Bmt 1) site sequence (ccagaagcttgctagc) and limiting enzyme (Hind H) site sequence (aagcttgtag). It includes the nucleotide sequence of SEQ ID NO: 5 that has been repeated 4 times with the linkers (tcac and gatatc) that connects them (FIG. 3; SEQ ID NO:6).
- miR-142-3p target sequence (SEQ ID NO:5) was inserted into 3’UTR of the AIMP2 variant (sequence number of 1). Connecting of the AIMP-2 variant and miR-142-3p target sequence is indicated with nucleotide sequence number of 6, and, specifically, was cut and inserted by using Nhe I and Hind III sites.
- the recombinant vector is shown in FIG. 1.
- Example 2 Confirmation of the nerve cells specific expression of recombinant vector
- Example 2.1 Confirmation of neuron-specific expression effect under in vitro condition
- AIMP2 variant is not expressed in the SHAM and NC vector groups.
- the AIMP2 variant is specifically expressed only in the SH- SY5Y cell strain in the group treated with the recombinant vector (FIG. 2).
- Example 2.2 Confirmation of nerve cell-specific expression effect under in vivo conditions
- N vector void/ control vector processed group
- pscAAV-DX2 single AIMP2 variant vector treated group
- pscAAV-DX2-miR142-3pT group treated with the recombinant vector of the invention
- AIMP2 was confirmed in large intestinal tissues, lung tissues, cerebral tissues, hepatic tissues, renal tissues, thymus tissues, spleen tissues and peripheral blood mononuclear cells (PBMC) after 1 week.
- qPCR was executed by using the primers in the Table 1 below (degeneration for 15 seconds, and annealing and extension over 40 cycles under the temperature of 60°C for 30 seconds).
- hSODl G93A transgenic mice (B6.Cg-Tg(SODl*G93A)lGur/J) used in this study were purchased from the Jackson Laboratories (Bar Harbor, ME, USA). Age matched WT control mice were also used. The animals were housed in individual cages under specific pathogen-free conditions and a constant environment condition (21- 23 °C temperature, 50-60% humidity and 12-h light/dark cycle) in the animal facility of Seoul National University, Republic of Korea. All experimental procedures were performed in accordance with guidelines of the Seoul National University Institutional Animal Care and Use Committee (SNUIACUC, Aug. 7, 2017) and this study was approved by our local ethic committee “SNUIACUC” (Approval No. SNU- 170807-1).
- mice were administrated with AAV-GFP and DX2 vector.
- AAV-DX2 transduction were intrathecally injected by direct lumber puncture.
- Total 8pl (4pl/point) of AAV-GFP or DX2 vector with a Hamilton syringe (Hamilton, Switzerland) was slowly injected (Ipl/min) at two points while the needle was slowly retracted to prevent loss of injected vector.
- miR-142-3p inhibition on DX2 expression could be observed from xl miR-142-3p target sequence.
- the HEK293 cells were transiently transfected with the xl, x2, and x3 repeat miR-142-3p target sequence vectors, and also with 100 pmol miR-142-3p using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hrs. The amount of DX2 mRNA was analyzed by PCR. miR142-3p inhibition on DX2 expression was observed from Tseq xl repeat miR142-3p target seq (FIG. 5B).
- Tseq xl contains 1 core binding sequence
- Tseq x2 contains 2 core binding sequences
- Tseq x3 contains 3 core binding sequences (FIG. 5 A).
- miR142-3p (100 pmol) inhibition on DX2 expression was started to be observed from xl repeat miR142-3p target sequence.
- the HEK293 cells were transiently transfected with the xl, x2, and x3 repeat miR-142-3p T seq vectors, and also with 100 pmol miR-142-3p using lipofectamin 2000 (invitrogen, US), then incubated for 48 h. Amount of DX2 mRNA was analyzed by PCR. When the number of core binding sequence in miR142-3p target seq are increased, miR142-3p inhibition on DX2 expression was also increased. Tseq x3 core sequence containing vector showed significant inhibition (FIG. 5B).
- Example 4.2 Core sequence mutation.
- FIG. 5A Four core sequences were substituted (FIG. 5A).
- the HEK293 cells were transiently transfected with the DX2- miR-142-3p T seq x3 repeated vector (Tseq3x) or with core sequence mutated vector (mut), and with 100 pmol miR-142-3p by using lipofectamin 2000 (Invitrogen, US), and then incubated for 48 hrs.
- Expression of DX2 mRNA was analyzed by PCR.
- Tseq x3 repeated vector which showed significant inhibition of DX2 (FIG. 5B) and DX2 construct were used as control.
- 100 pmol of miR142-3p treatment inhibited Tseq x3 vector significantly but DX2 and mut sequence were not inhibited (FIG. 6).
- Example 4.4 Tissue distribution data in ALS mouse model.
- RNA from the spinal cord was extracted following intrathecal injection of the scAAV2-DX2-miR142-3p. qRT-PCR was performed. DX2 expression should be limited only in the local injection site, the spinal cord. hSODl G93 A transgenic mice, scAAV-DX2 miR142- 3p was expressed with intrathecal injection. Control vehicle injection showed expression only in spinal cord, not brain nor sciatic nerve (FIG. 7).
- Example 5 [0161] In Example 2, HEK293T cells were co-transfected with the three plasmids from Oxgene, UK, that encode all the components necessary to produce recombinant AAV2 particles.
- HEK293T cells were also transfected with only pSF-AAV-ITR-CMV-EGFP-ITR-KanR (Oxgene, UK) with an insertion of AIMP2-DX2 or DX2-miR142 target nucleotide as expression vectors and not for producing AAV particles.
- DX2 coding vector (2ug) and DX2-miR142 target seq coding vector (2ug) were transfected into THP-1 cell (human monocyte, CD45+ cell) and SH-SY5Y (neuronal cell). After 48hrs, the cells were harvested and mRNA was isolated. With the synthesized cDNA, the expression of DX2 was analyzed by real-time PCR.
- DX2 expression level was similar between DX2 coding vector and DX2- miR142 target seq coding vector transfected SH-SY5Y
- DX2 expression was dramatically decreased in DX2-miR142 target seq coding vector transfected THP-1 cells.
- miR142-3p worked only in THP-1 cells (FIG. 8).
- hSODl G93A transgenic mice (B6.Cg-Tg(SODl*G93A)lGur/J) used in this study were purchased from the Jackson Laboratories (Bar Harbor, ME, USA). The animals were housed in individual cages under specific pathogen-free conditions and a constant environment condition (21-23°C temperature, 50-60% humidity and 12-h light/dark cycle). In pre- symptomatic stage, same age, female mice were administrated with AAV2-GFP or AAV2-DX2. AAV2-DX2 transduction were intrathecal injected by direct lumber puncture. Total 8 pl (4 pl/point) of AAV-GFP or DX2 vector with a Hamilton syringe (Hamilton, Switzerland) was slowly injected (1 pl/min) at two points while the needle was slowly retracted to prevent loss of injected virus.
- AAV2-GFP or AAV2-DX2 vector with a Hamilton syringe (Hamilton, Switzerland) was slowly injected (1 pl/min) at two points while
- mice started to lose body weight up to 5-6% from maximum body weight.
- severe symptomatic stages is known to be observed from 12 weeks after birth in SOD1G93A mice, but motor performance deficits began several weeks prior to the onset of overt symptoms (postnatal day 45) (C. R. Hayworth et al. Neuroscience. 2009 December 15; 164(3): 975-985).
- scAAV-GFP or scAAV-DX2 (GO 102) was administered to same age, female mice.
- AAV2-DX2 (GO 102) transduction was achieved via intrathecal injection by direct lumbar puncture.
- FIG. 9A-9C shows that DX2 transgenic mice recover motor symptoms in rotenone- treated mice.
- FIG. 9A shows that TH expression was analyzed with mice brain in the indicated mice. The black dotted square shows TF-stained regions.
- FIG. 9B shows a Rotarod analysis. Latency to fall in rotenone-treated wild type and DX2 transgenic (TG) mice.
- FIG. 9D and 9E show that DX2 improves neuronal damage and behavior in rotenone- induced PD mouse model.
- FIG. 9D shows a pole test. scAAV-DX2 recovered motor coordination and balance in the rotenone-treated PD mouse model.
- Con and “GFP” indicate wild type and rotenone-treated GFP injection mice.
- Dose 1 and “Dose 2” represent the different injection dose of DX2 in rotenone-treated mice.
- FIG. 10A-10H show that DX2 prevents behavioral deficits in the 6-OHDA-induced PD model.
- FIG. 10A demonstrates that scAAV-DX2-treated mouse showed lower levels of contralateral rotation compared to that of saline or vehicle (GFP), indicating that DX2 attenuated damage in dopaminergic neurons.
- FIG. 10B demonstrates that DX2 -treated mice showed increased contralateral forepaw contacts, indicating that AAV-DX2 attenuated unilateral damage in dopaminergic neurons.
- FIG. 10C demonstrates that AAV-DX2 treated mouse showed less right-biased body swing.
- FIG. 10D shows immunofluorescence image of GFP and DX2-injected mice brain.
- the white square box indicates TH positive dopaminergic neuronal cells and the white arrows shows indicated virus injection site.
- FIG. 10E shows the survival rate in each mice group.
- FIGS. 10F and 10G show DX2 and Bax mRNA expression of naive, 6-OHDA and DX2-treated mice. ***P ⁇ 0.001, /-test.
- FIGS. 11 A-l 1G show that DX2 restores motor symptoms in MPTP -induced PD model.
- FIG. 11 A demonstrates scAAV-DX2 -treated mouse showed slightly longer latency to fall in the rotarod test when compared with that of vehicle (scAAV-GFP, GFP) indicating that scAAV- DX2 attenuated damage towards dopaminergic neurons.
- FIG. 11B demonstrates that DX2- treated mouse showed improved locomotor activity based on the SHIRPA test.
- FIG. 11C demonstrates that DX2 -treated mice showed a relatively lower level of limb deficit.
- FIG. 11D demonstrates that DX2-overexpressed mouse showed improved grooming rate when compared with vehicle control (GFP).
- FIG. HE shows that immunofluorescence image of TH-positive cells in the mouse substantia nigra. The white square box indicates the TH expressing regions.
- FIGS. 1 IF and 11G show DX2 (FIG. 1 IF) and Bax (FIG. 11G) mRNA expression of the indicated mice brain. Naive, GFP, and DX2 indicate saline-treated wild type mice, GFP- injected MPTP -treated mice, and DX2 -injected MPTP -treated mice.
- SOD1 transgenic mice were treated with AAV-GFP (GFP) or AAV-DX2 in the spinal canal to explore the effects of DX2 in vivo.
- the onset of the disease was delayed in the DX2- injected mice group compared to the GFP-injected mice group.
- mice in the group in which DX2 was administrated survived significantly longer than those in the GFP injected group.
- the lifespan of the DX2-admini strated mice was prolonged compared to the GFP- injected mice.
- FIGS. 12A and 12B show that administration of DX2 improves the disease onset and prolongs the lifespan of mice in Lou Gehrig's disease model.
- FIG. 12A Disease onset was improved in AAV-DX2 group.
- SK-SY5Y cells human neuroblastoma cell lines, were maintained in RPMI 1640 containing 10% fetal bovine serum, 100 unit/ml penicillin and 100 pg/ml streptomycin.
- RPMI 1640 containing 10% fetal bovine serum, 100 unit/ml penicillin and 100 pg/ml streptomycin.
- AD Alzheimer's disease
- SK-SY5Y cells were seed on 6 well plates at a density of 1 x 10 6 cells/well, and 16 hours later, the culture media were replaced with RPMI 1640 containing 25 pM amyloid P-protein oligomer (AP-O) for 24 hours.
- AD Alzheimer's disease
- AP-O amyloid P-protein oligomer
- SK-SY5Y cells were incubated with AP-0 for 24 hours and then, vehicle (scAAV2-GFP) or overexpressed-DX2 (scAAV2- DX2) virus was used to treat cells for 48 hours in RPMI 1640 growth media. Cell death was analyzed by western blot and microscopy.
- SH-SY5Y cells were lysed in 25 mM Tris-HCl, pH 7.4 containing 150 mM NaCl, 0.5% Triton X-100 and protease inhibitor cocktail. Samples containing 50pg of protein were blotted in 10% polyacrylamide gel and electrophoretically transferred onto membrane. The membrane was blocked with 5% non-fat dry milk in Tris-buffered saline with 20% Tween-20 and incubated with primary antibodies against p53 and actin. The antibodies on membrane were detected with horseradish peroxidase-conjugated secondary mouse anti-goat and anti-rabbit antibodies. The membrane was analyzed by SuperSignal West Dura extended-duration substrate according to manufacturer’s manual (Thermo Fisher Scientific, Waltham, MA, USA).
- AIMP2-DX2 attenuates Ap-O-induced neuronal cell death
- AD Alzheimer’s disease
- AP amyloid P-protein
- p-tau phosphorylated tau
- AD Alzheimer’s disease
- DX2 AIMP2-DX2
- Choi 2011 an inhibitory factor of cell death
- DX2 inhibits AP-O-induced p53 expression
- P53 tumor suppressor protein
- AIMP2 binds to the N-terminal of p53, which is binding domain for Mdm2 and its binding induces the stability of p53 and pro-apoptotic activity.
- DX2 inhibits the apoptotic activity of AIMP2 by interrupting interaction with p53.
- SK-SY5Y cells were incubated with AAV-DX2 or AAV-GFP in the absence or presence of 25 pM AP-O. After 48 hours, total protein lysates were prepared, and the level of p53 protein was analyzed by immunoblot analysis. The level of P-actin was analyzed as a loading control. The red square box indicates increased level of p53 in Ap-O-treated cells.
- HEK 293 cell line was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and Neuro-2A (N2A), SK-N-SH and SH-SY5Y cells were obtained from Korean Cell Line Bank (KCLB, Seoul, KOREA).
- HEK 293 cells and N2A cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (HyClone, Pittsburgh, PA, USA). And SK-N-SH cells were incubated in RPMI-1640 with 10% FBS and 1% antibiotics.
- the transient transfection of myc- tagged KARS, HA-tagged mutant SOD1, GFP-tagged KARS, and GFP-tagged mutant SOD1 were transfected by lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). And 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetra- zolium bromide (MTT) and HEMA (2-hydroxyethyl methacrylate) were from Sigma-Aldrich (St. Louis, MO, USA).
- Cell lysates were harvested and prepared by RIPA buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 150 mMNaCl, 20% glycerol, 1% NP-40, 0.5% sodium deoxycholate, and PMSF). Cell lysates were incubated for 30 minutes on ice followed by collecting supernatant after centrifugation for 10 minute at 12,000g. Anti-HA or anti-Myc agarose beads were added to lysates and incubated overnight at 4 degrees with a rocking platform. Agarose beads bounded proteins were washed three times and collected samples were separated via SDS-PAGE and western blotting analysis was performed.
- RIPA buffer 50 mM Tris-HCl pH 8.0, 1 mM EDTA, 150 mMNaCl, 20% glycerol, 1% NP-40, 0.5% sodium deoxycholate, and PMSF. Cell lysates were incubated for 30 minutes on ice followed by collecting supernatant
- the cells were lysed in 25 mM Tris-HCl, pH 7.4 containing 150 mMNaCl, 0.5% Triton X-100 and protease inhibitor cocktail. Samples containing 50 pg of protein were blotted in 10% polyacrylamide gel and electrophoretically transferred onto membrane. The membrane was blocked with 5% non-fat dry milk in Tris-buffered saline with Tween-20 and incubated with primary antibodies against Myc (Santa Cruz biotechnology, sc-40), HA, GFP, 67 laminin receptor, IKB, Tubulin, P-actin, TRAF2, EPRS, KARS, AIMP2, Erk, phosphorylated Erk.
- the antibodies on membrane were detected with horseradish peroxidase-conjugated secondary mouse anti-goat and anti-rabbit antibodies.
- the membrane was analyzed by SuperSignal West Dura extended-duration substrate according to manufacturer’s manual (Thermo Fisher Scientific, Waltham, MA, USA).
- Migration assay was performed using 8 pm Transwell chamber (Corning INC, Coming, NY, USA). N2A cells in serum free media were seeded on the upper chamber of 24 well migration plate. The lower chamber was filled with 400 pL of DMEM with 10% FBS. After 24 hours, upper chamber was fixed with 10% PFA for 10 min at room temperature followed by staining with crystal violet. And then, migrated cells were counted.
- MTT assay 5 x io 4 cells/well were plated on 96-well plate and were treated for 24 h with specified molecule. After appropriate incubation, 15 pL of 5 mg/mL MTT solution in PBS (pH7.2) was added in each well and incubated for 4 h at 37°C in 5% CO2 atmosphere. The solution was removed and dimethyl sulfoxide (DMSO) was added in each well to dissolve insoluble formazan precipitate and the absorbance was measured at 620 nm by plate reader.
- DMSO dimethyl sulfoxide
- cytosolic and membrane fractions were collected using subcellular fraction kit (Biovision, Milpitas, CA, USA). Briefly, the cells were lysed and centrifuged at 1,000 rpm for 10 min at 4°C, and the supernatant was used as the cytosolic fraction. Then, the pellets were washed and incubated with sodium deoxycholate buffer at 4°C for 10 min and used as the membrane fraction.
- SOD1 G93A and DX2 transfected SH-SY5Y cells were seeded (1.0 x 10 4 cells/mL) to 96 well e-plate (ACEA Biosciences, San Diego, CA, USA) and treated with TNF-a for 24 h to screen for cell adhesion. And then, attached cells were counted by iCELLigence (ACEA Biosciences, San Diego, CA, USA).
- AIMP2 and 67LR bound KARS in the presence of WT SOD1, however, reduced binding of KARS to AIMP2 and 67LR was observed in the presence of mutant SOD1.
- mutant SOD1 decreases binding of KARS to AIMP2 and 67LR through the binding competition of N- terminal of KARS.
- mutant SOD1 G93A had the best binding to KARS, we wanted to investigate its effect on 67LR and explore whether it was correlated to neural cell death.
- mutant SOD1 G93A had the best binding to KARS, we wanted to investigate its effect on 67LR and explore whether it was correlated to neural cell death.
- we transfected mutant SOD1 to SK-N-SH cells we could find that the level of 67LR was decreased (FIG. 17 A).
- mutant SOD1 has an effect on expression of 67LR, we explored its effect on the signaling pathway of laminin and we could confirm that mutant SOD1 highly reduces the pERK activity (FIG. 17D).
- Anoikis is a kind of apoptosis triggered by loss of contact between extracellular matrix (ECM) and cellular membrane protein and resistance of anoikis plays an important role in cell survival. And to induce anoikis, cells were co-transfected with mutant SOD1 and KARS and incubated with or without TNF-alpha/CHX in suspension condition. As a result, we observed that cell death was not restored by overexpression of KARS (FIG. 17F). This result suggested that regulation of cell death by laminin receptors is due to increased downstream signaling through the interaction of laminin receptor and ECM.
- DX2 overexpressing AAV was infected in the primary neural cells extracted from wild type or SOD1 transgenic mice, transfected cells were treated with CHX/TNF-a and the cell death rate was analyzed. It was shown that G93 A primary neural cells were increased cell death in CHX/TNF-a treated condition, while DX2 greatly reduced the cells death in CHX/TNF-a-treated WT and G93A primary neural cells (FIG. 19B).
- PARylation is a post-translational process, regulating biological events such as DNA damage response and apoptosis (Szabo 1996 and Virag (1998).
- PARP-1 is an enzyme that recognizes damaged DNA in the nucleus, forms PAR chains, and induces degradation of damaged proteins through the PARylation.
- PARlylation i.e. the formation of PAR polymers requires the catalytic activity of cleaved PARP-1 (Barkauskaite 2015)
- FIG. 20C the PARylation of AIMP2 was increased in the presence of H2O2, but the PARlylation of DX2 was not altered. Based on these results, we conclude that DX2 is an inhibitory molecule of oxidative stress-induced PARP-1 cleavage.
- the motor neurons are essential for the communication between the brain and the muscles and transmit vital instructions for mobility. When these nerve cells are dysfunctional or damaged, they gradually stop communicating with the muscles, and the brain loses its ability to control and initiate voluntary movements. This results in a progressive weakness, muscle twitches (fasciculations), and atrophy of voluntary skeletal muscles throughout the body. In addition, the degeneration of NMJ, leading to skeletal muscle denervation, is thought to play an essential role in the onset of ALS. Muscle twitching/ fasciculation and respiratory failure typically happen in ALS within 2-3 years from the onset. In the final stages of the disease, this leads to fatal paralysis and death due to respiratory failure.
- the Muscles were fixed in 4% PFA overnight at 4°C.
- the Muscles were dehydrated at 30% sucrose and embedded with the OCT compound for tissue cryosection. All muscle cryosection samples were acquired from the neuromuscular junction containing section with 20 pm thickness.
- Aspirate BSA Sections were incubated overnight with primary antibodies against the neurofliaments (stained green using anti-neurofilament plus anti- 2H3, SV2) and the postsynaptic acetylcholine receptors_ AChRs (stained red using fluorescent a-bungarotoxin conjugates) in blocking solution at room temperature.
- a number of defects can be readily observed, including partially innervated or completely denervated postsynaptic receptor sites, fragmented or shrunken postsynaptic receptors, atrophied axons or terminals, and swollen or dystrophic axons or terminals.
- FIG. 22A the neuromuscular junctions were stained with alpha-Bungarotoxin, and synaptic vesicle and end plate were staining with SV2 and 2H3.
- FIG. 22B the number of innervated endplates was counted and represented.
- GO102 ameliorated the decreased % of innervated endplates (75.6 ⁇ 12.6 vs. 41.0 ⁇ 2.03%) observed in ALS disease model.
- DX2 inhibits neuromuscular junction (NMJ) damage and it is expected that DX2 restores NMJ block-induced respiratory failure and muscle twitching or fasciculation.
- NMJ neuromuscular junction
- Fridovich I (1997) Superoxide anion radical (02-.), superoxide dismutases, and related matters. J Biol Chem 272(30): 18515-18517.
- Alzheimer's Association “2019 Alzheimer's disease facts and figures.” Alzheimer's & Dementia 15.3 (2019): 321-387.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Neurology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Neurosurgery (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Psychiatry (AREA)
- Virology (AREA)
- Hospice & Palliative Care (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Psychology (AREA)
- Epidemiology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MA71714A MA71714A (fr) | 2020-09-30 | 2021-09-30 | Méthodes de traitement de maladies neuronales à l'aide d'aimp2-dx2 et éventuellement d'une séquence cible de mir-142 et compositions associées |
| CA3192710A CA3192710A1 (en) | 2020-09-30 | 2021-09-30 | Methods of treating neuronal diseases using aimp2-dx2 and optionally a target sequence for mir-142 and compositions thereof |
| US18/246,575 US20230374092A1 (en) | 2020-09-30 | 2021-09-30 | METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF |
| CN202180066844.4A CN116507370A (zh) | 2020-09-30 | 2021-09-30 | 使用AIMP2-DX2和任选地miR-142的靶序列及其组合物治疗神经元疾病的方法 |
| JP2023519464A JP2023544141A (ja) | 2020-09-30 | 2021-09-30 | AIMP2-DX2および必要に応じてmiR-142の標的配列ならびにその組成物を使用した神経系疾患を処置する方法 |
| AU2021354996A AU2021354996A1 (en) | 2020-09-30 | 2021-09-30 | METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF |
| KR1020237014841A KR20230079267A (ko) | 2020-09-30 | 2021-09-30 | AIMP2-DX2 및 선택적으로 miR-142에 대한 표적 서열 및 이의 조성물을 이용한 신경질환의 치료방법 |
| EP21874707.9A EP4221759A4 (en) | 2020-09-30 | 2021-09-30 | METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE OF MIR-142 AND RELATED COMPOSITIONS |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063085950P | 2020-09-30 | 2020-09-30 | |
| US63/085,950 | 2020-09-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022070141A1 true WO2022070141A1 (en) | 2022-04-07 |
Family
ID=80949780
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2021/059017 Ceased WO2022070141A1 (en) | 2020-09-30 | 2021-09-30 | METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20230374092A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4221759A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2023544141A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20230079267A (cg-RX-API-DMAC7.html) |
| CN (1) | CN116507370A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2021354996A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3192710A1 (cg-RX-API-DMAC7.html) |
| MA (1) | MA71714A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022070141A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12233134B2 (en) | 2018-03-29 | 2025-02-25 | Generoath Co., Ltd. | Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102248420B1 (ko) * | 2019-03-15 | 2021-05-06 | 주식회사 제너로스 | miR-142-3p의 표적 서열을 포함하는 재조합 벡터 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060110397A1 (en) * | 2004-11-24 | 2006-05-25 | Sunghoon Kim | AIMP2-DX2 and its uses |
| KR20170041363A (ko) * | 2015-10-07 | 2017-04-17 | 원광대학교산학협력단 | 신경질환 예방 또는 치료를 위한 aimp2-dx2를 포함하는 약학 조성물 및 이의 용도 |
| WO2020188472A1 (en) * | 2019-03-15 | 2020-09-24 | Generoath Co., Ltd. | Vectors containing aimp2-dx2 and target nucleic acids for mir-142 and uses thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101067816B1 (ko) * | 2007-11-09 | 2011-09-27 | (주)네오믹스 | Aimp2-dx2의 억제제를 유효성분으로 포함하는 염증성질환 예방 및 치료용 조성물 |
| US10716866B2 (en) * | 2018-03-29 | 2020-07-21 | Generoath Co., Ltd | Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof |
| KR102349061B1 (ko) * | 2019-03-15 | 2022-01-10 | 주식회사 제너로스 | 생착능이 증가된 줄기세포의 제조 방법 |
-
2021
- 2021-09-30 US US18/246,575 patent/US20230374092A1/en active Pending
- 2021-09-30 EP EP21874707.9A patent/EP4221759A4/en active Pending
- 2021-09-30 AU AU2021354996A patent/AU2021354996A1/en not_active Abandoned
- 2021-09-30 JP JP2023519464A patent/JP2023544141A/ja active Pending
- 2021-09-30 KR KR1020237014841A patent/KR20230079267A/ko active Pending
- 2021-09-30 MA MA71714A patent/MA71714A/fr unknown
- 2021-09-30 WO PCT/IB2021/059017 patent/WO2022070141A1/en not_active Ceased
- 2021-09-30 CA CA3192710A patent/CA3192710A1/en active Pending
- 2021-09-30 CN CN202180066844.4A patent/CN116507370A/zh active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060110397A1 (en) * | 2004-11-24 | 2006-05-25 | Sunghoon Kim | AIMP2-DX2 and its uses |
| KR20170041363A (ko) * | 2015-10-07 | 2017-04-17 | 원광대학교산학협력단 | 신경질환 예방 또는 치료를 위한 aimp2-dx2를 포함하는 약학 조성물 및 이의 용도 |
| WO2020188472A1 (en) * | 2019-03-15 | 2020-09-24 | Generoath Co., Ltd. | Vectors containing aimp2-dx2 and target nucleic acids for mir-142 and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| COMLEY LAURA H., NIJSSEN JIK, FROST-NYLEN JOHANNA, HEDLUND EVA: "Cross-disease comparison of amyotrophic lateral sclerosis and spinal muscular atrophy reveals conservation of selective vulnerability but differential neuromuscular junction pathology : Selective Vulnerability in ALS and SMA", THE JOURNAL OF COMPARATIVE NEUROLOGY, WILEY-LISS, NEW YORK, NY, US, vol. 524, no. 7, 1 May 2016 (2016-05-01), US , pages 1424 - 1442, XP055918575, ISSN: 0021-9967, DOI: 10.1002/cne.23917 * |
| KIM BOKYUNG; PARK JUNGHYUNG; CHANG KYU-TAE; LEE DONG-SEOK: "Peroxiredoxin 5 prevents amyloid-beta oligomer-induced neuronal cell death by inhibiting ERK–Drp1-mediated mitochondrial fragmentation", FREE RADICAL BIOLOGY & MEDICINE, ELSEVIER INC, US, vol. 90, 12 November 2015 (2015-11-12), US , pages 184 - 194, XP029371588, ISSN: 0891-5849, DOI: 10.1016/j.freeradbiomed.2015.11.015 * |
| See also references of EP4221759A4 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12233134B2 (en) | 2018-03-29 | 2025-02-25 | Generoath Co., Ltd. | Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3192710A1 (en) | 2022-04-07 |
| CN116507370A (zh) | 2023-07-28 |
| KR20230079267A (ko) | 2023-06-05 |
| AU2021354996A9 (en) | 2023-04-27 |
| US20230374092A1 (en) | 2023-11-23 |
| JP2023544141A (ja) | 2023-10-20 |
| EP4221759A1 (en) | 2023-08-09 |
| MA71714A (fr) | 2025-05-30 |
| AU2021354996A1 (en) | 2023-04-20 |
| EP4221759A4 (en) | 2025-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11471539B2 (en) | Genetic construct | |
| US10369231B2 (en) | MiR-204 and miR-211 and uses thereof | |
| AU2020244321B2 (en) | Vectors containing AIMP2-DX2 and target nucleic acids for miR-142 and uses thereof | |
| US20040175375A1 (en) | Method for treating cancer using p38/JTV-1 and method for screening pharmaceutical composition for treating cancer | |
| Reddy et al. | Emerging role for αB-crystallin as a therapeutic agent: pros and cons | |
| US20230374092A1 (en) | METHODS OF TREATING NEURONAL DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF | |
| US20240050527A1 (en) | METHODS OF TREATING AGE-RELATED MACULAR DISEASES USING AIMP2-DX2 AND OPTIONALLY A TARGET SEQUENCE FOR miR-142 AND COMPOSITIONS THEREOF | |
| US20250281573A1 (en) | Methods of Treating Retinal Degenerative Diseases Using AIMP2-DX2 and Optionally a Target Sequence for miR-142 and Compositions Thereof | |
| US20220033450A1 (en) | Virally expressed inhibitors of pdz domains, such as pick1 and uses thereof | |
| KR102626543B1 (ko) | AIMP2-DX2 및 miR-142의 표적 핵산을 포함하는 재조합 벡터 | |
| US20250092105A1 (en) | Granulin/epithelin modules and combinations thereof to treat neurodegenerative disease | |
| US20130143954A1 (en) | Recombinant vector for suppressing proliferation of human papilloma virus cells including adenylate cyclase activating polypeptide 1 (pituitary) gene and pharmaceutical composition for treating human papilloma virus | |
| EA048975B1 (ru) | Векторы, содержащие aimp2-dx2 и целевые нуклеиновые кислоты для mir-142, и их применение | |
| WO2026062177A1 (en) | Variants of sirtuin 6 for the treatment of muscular diseases | |
| JPWO2012086474A1 (ja) | 中枢神経疾患治療剤 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21874707 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2021354996 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 3192710 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2023519464 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202180066844.4 Country of ref document: CN |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112023005929 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2021354996 Country of ref document: AU Date of ref document: 20210930 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202347029453 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20237014841 Country of ref document: KR Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021874707 Country of ref document: EP Effective date: 20230502 |
|
| ENP | Entry into the national phase |
Ref document number: 112023005929 Country of ref document: BR Kind code of ref document: A2 Effective date: 20230329 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 202390615 Country of ref document: EA |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2021874707 Country of ref document: EP |