WO2022065941A1 - 나노포어를 이용한 rna 표적의 고효율 약물 스크리닝 방법 - Google Patents

나노포어를 이용한 rna 표적의 고효율 약물 스크리닝 방법 Download PDF

Info

Publication number
WO2022065941A1
WO2022065941A1 PCT/KR2021/013103 KR2021013103W WO2022065941A1 WO 2022065941 A1 WO2022065941 A1 WO 2022065941A1 KR 2021013103 W KR2021013103 W KR 2021013103W WO 2022065941 A1 WO2022065941 A1 WO 2022065941A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
target
nanopore
ars
riboswitch
Prior art date
Application number
PCT/KR2021/013103
Other languages
English (en)
French (fr)
Inventor
지승욱
이미경
이동화
오소희
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2022065941A1 publication Critical patent/WO2022065941A1/ko
Priority to US18/191,388 priority Critical patent/US20230304989A1/en

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/483—Physical analysis of biological material
    • G01N33/487—Physical analysis of biological material of liquid biological material
    • G01N33/48707—Physical analysis of biological material of liquid biological material by electrical means
    • G01N33/48721—Investigating individual macromolecules, e.g. by translocation through nanopores
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/483—Physical analysis of biological material
    • G01N33/487—Physical analysis of biological material of liquid biological material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/16—Aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes

Definitions

  • the present invention relates to a method for high-efficiency drug screening of an RNA target using nanopores.
  • RNA ribonucleic acid
  • RNA is known as an intermediate product that expresses DNA information as a protein in the flow of genetic information.
  • the untranslated region (UTR) of mRNA improves the efficiency of mRNA expression as a protein, the stability of the mRNA itself, and the quality of the mRNA. It is known to carry important information for determining location.
  • Most of these mRNA UTR structures have a two-dimensional or three-dimensional structure, and are characterized in shape and nucleotide sequence. In particular, since the three-dimensional structure exhibits its function through specific binding to various RNA-binding proteins in vivo, RNA having a specific structure can be an important target molecule in cells.
  • 16S rRNA A site (A site) of bacteria, TAR (trans-activating region) binding site (binding site) of HIV virus, RRE (REV-response element) binding site (binding site), IRE (iron responsive) element) mRNA, thymidilate synthetase mRNA, and the like are recognized as target molecules.
  • TAR trans-activating region binding site
  • RRE REV-response element binding site
  • IRE iron responsive element
  • Riboswitch is amino acid and its derivatives (lysine, glycine, SAM. SAH), coenzyme (FMN, TPP, coenzyme B12), nucleobase and its derivatives (adenine, guanine, c-di-GMP, c-di- It regulates bacterial gene expression in response to small molecule metabolites and ions, such as AMP, preQ1) and ions (Mg 2+ ).
  • the riboswitch consists of an aptamer domain and an expression platform domain. Binding of the riboswitch aptamer domain to its cognate metabolite induces three-dimensional structural folding, including sequential conformational changes in the expression platform domain.
  • Riboswitches regulate the transcription or translation of genes involved in bacterial metabolism.
  • Riboswitches have evolved to recognize small molecules with high selectivity, and because they exist in non-eukaryotic bacteria, they can specifically target bacteria without cross-reacting. Therefore, targeting the bacterial riboswitch could be a promising strategy for overcoming antibiotic resistance, especially in superbacteria.
  • RNA-mediated diseases Despite the importance of disease-associated RNA as a therapeutic target, efficient drug screening of small molecule drugs against them requires large amounts of RNA, low sensitivity of surface plasma resonance for detection of small molecule drugs binding to RNA, and fluorescence-based assays. It is limited by methods such as the need for chemical labeling of RNA. Accordingly, the development of high-efficiency new drug screening technology will promote drug discovery for various RNA-mediated diseases.
  • Nanopore sensing is a novel technology for single-molecule analysis of biomolecules. Movement of a charged analyte through a single nanopore channel at an applied voltage induces a transient blockage of ionic current, which is measured as current amplitude and transit or dwell time. After the nanopore-based detection of homouridine RNA fragment (PolyU) using protein nanopores, various nanopore-based approaches have been used to detect nucleic acids. Among protein nanopores, ⁇ -hemolysin ( ⁇ HL), a toxin secreted by Staphylococcus aureus, is mainly used for nucleic acid analysis.
  • ⁇ HL ⁇ -hemolysin
  • a protein monomer composed of 293 amino acids self-assembles in the lipid bilayer to form stable heptamer pores, including channels with a length of ⁇ 10 nm.
  • ⁇ HL nanopores are a suitable platform for the detection of single molecules, especially nucleic acids, due to their sophisticated geometry and narrow constriction of 1.4 nm diameter.
  • the technology for applying protein nanopores to the screening of small molecule drugs targeting RNA is still insignificant.
  • One object of the present invention is to provide a method for screening RNA-targeting drugs using nanopores.
  • Another object of the present invention is to provide a kit for drug screening of an RNA target containing nanopores.
  • One aspect of the present invention provides a method for screening an RNA-targeted drug using nanopores.
  • Another aspect of the present invention provides a kit for drug screening of an RNA target comprising nanopores.
  • One aspect of the present invention relates to a drug screening method for an RNA target using nanopores.
  • the drug screening method of the RNA target of the present invention comprises the steps of (a) measuring an electrical signal generated while the target RNA passes through the nanopore; (b) treating the target RNA with a candidate material expected to bind to the target RNA, and measuring an electrical signal generated while the target RNA passes through the nanopores; and (c) comparing the electrical signals measured in steps (a) and (b) and selecting the candidate material as a drug that specifically binds to the target RNA when a change in the electrical signal appears.
  • nanopore refers to a structure capable of passing ions and/or charged low-molecular substances from one compartment to another.
  • nano of nanopores is meant a size of less than about 1 ⁇ m and greater than or equal to about 0.1 nm.
  • the diameter of the nanopores is specifically about 0.5 nm to about 25 nm, about 0.5 nm to about 10 nm, about 0.5 nm to about 8 nm, about 0.5 nm to about 6 nm, about 0.5 nm to about 5 nm, about 1 nm to about 3 nm, or about 1.5 nm.
  • the nanopore may be a protein nanopore having a narrow constriction, for example, ⁇ -hemolysin, ClyA, aerolysine, lysenin, CsgG, FhuA, FraC, MspA, PlyAB, Phi29, PA63 and OmpG, etc. may be .
  • the ⁇ -hemolysin protein may include both wild-type and mutants.
  • the ⁇ -hemolysin protein nanopore monomer forms heptameric pores containing long and narrow ⁇ -barrels (about 10 nm in length and 1.4 nm in diameter) in a planar lipid bilayer.
  • the ⁇ -hemolysin protein nanopores can have a voltage connected to both ends of the nanopores, so that molecules can pass from the first compartment to the second compartment, and different electrical signals can be generated according to charge characteristics. Therefore, ⁇ -hemolysin protein nanopores can be usefully utilized as high-sensitivity sensors for detecting biomolecules at the level of single molecules.
  • the “target RNA” is a disease-related RNA, and may be an mRNA involved in the transcriptional regulation of a disease-related gene.
  • the target RNA itself may form at least one stem-loop or triplex structure, and binding of a ligand as an RNA having a specific two-dimensional or three-dimensional structure If the two-dimensional structure is stabilized or the three-dimensional structure change occurs by the , it may be included without limitation, for example, it may have a partial duplex structure.
  • disease target RNAs of a stem-loop structure known to date, there are MicroRNAs (eg, miR-21, miR-96), and MALAT1 RNA is known as an anticancer target having a triplex structure. All of these are promising targets for the treatment of RNA-mediated diseases because they induce various structural changes by binding to drugs.
  • the target RNA may include a region capable of regulating the expression of a gene necessary for survival of bacteria, and specifically may be all or part of a riboswitch region derived from bacteria, and a ligand binding It may be included without limitation as long as it includes an aptamer domain capable of doing so, for example, it may include a nucleotide sequence represented by any one selected from the group consisting of SEQ ID NOs: 1 to 3.
  • the “riboswitch” refers to a regulatory region of mRNA that can specifically bind to a small molecule substance such as a specific metabolite in a cell, and the riboswitch senses the concentration of the specific metabolite and is located downstream Acts as a biosensor that regulates the expression level of genes encoded by mRNA. That is, the degree of protein synthesis from the mRNA is controlled depending on whether a specific substance (eg, a metabolite) is bound to the riboswitch.
  • the riboswitch is conceptually largely divided into an aptamer domain and an expression platform domain.
  • the aptamer domain is a site that directly binds to a specific substance, and the expression platform domain is a change in the aptamer domain. It is a site where structural changes occur in response to
  • the riboswitch may be, for example, a purine riboswitch including an adenine riboswitch and a guanine riboswitch, a lysine riboswitch, a cyclic di-GMP riboswitch, a glmS riboswitch, a TPP riboswitch, and an FMN riboswitch. .
  • the target RNA may be all or a part of a conserved sequence among viral RNAs, for example, may include the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
  • the conserved sequence may be a promoter sequence, and since it is highly conserved even in various variants of an epidemic virus, it is possible to screen for a drug that targets it and initiates or regulates transcription.
  • RNA-targeting drugs refers to drugs that target RNA, and specifically binds to the target RNA and causes a two-dimensional or three-dimensional structural change of the target RNA to function of the target RNA It may be included without limitation as long as it inhibits, for example, any one molecule selected from the group consisting of nucleic acids, proteins, peptides and compounds.
  • the RNA-targeting drug is to treat RNA-mediated diseases by regulating the transcription of the target RNA, and is used in the treatment of a number of RNA-mediated diseases, including microbial infectious diseases, cancer, metabolic diseases, degenerative diseases, cardiovascular diseases, lung diseases, and immune diseases.
  • RNA-mediated diseases including microbial infectious diseases, cancer, metabolic diseases, degenerative diseases, cardiovascular diseases, lung diseases, and immune diseases.
  • drugs targeting MALAT1 RNA known as anticancer targets
  • the RNA-targeting drug may be an anticancer agent, a metabolic disease agent, a degenerative disease agent, a cardiovascular disease agent, a lung disease agent, an immune disease agent, an antibacterial agent, an antibiotic, or an antiviral agent.
  • the drug binding to the RNA target may be a small molecule compound capable of binding to the aptamer region of a bacterial riboswitch.
  • the small molecule compound may regulate the functions of transcription and translation by binding to a target riboswitch, and may be, for example, a ligand targeting a riboswitch found in bacteria.
  • the ligand is a ligand that binds to a riboswitch present in an antibiotic-resistant strain, it can be a new antibiotic candidate that can overcome the antibiotic resistance.
  • the RNA-targeting drug may be a small molecule compound that binds to a conserved sequence of an RNA virus.
  • the small molecule compound binds to a promoter of an RNA virus and regulates transcription and translation functions to treat RNA virus-mediated diseases.
  • the term “candidate substance” refers to any substance expected to bind to a target RNA, and may be, for example, any molecule such as a low molecular weight compound, protein, oligopeptide, polysaccharide, polynucleotide, and the like. These candidates include both natural as well as synthetic materials.
  • RNA-ligand complex or “RNA-drug complex” refers to a complex formed by binding to a target RNA and its ligand or target drug, and is used interchangeably in the present specification as an equivalent meaning, and forming a complex It is included without limitation as long as it has an electric charge without limitation in the method or position of the bonding, the size of the complex, and the like.
  • the RNA-drug complex in the present invention exhibits a characteristic nanopore event form having a single or double current blocking intensity peak and a substantially increased residence time, the detection of a drug binding to a target RNA by analyzing such a nanopore event It has been confirmed that this is possible. Therefore, it can be usefully utilized for screening drugs targeting disease-related RNA through the RNA-targeted drug screening method of the present invention.
  • the “electrical signal” is generated by the passage of ions and/or low-molecular-weight substances with electric charge from one compartment separated by a membrane to another, for example, from the first compartment to the second compartment, and the flow of ions is obstructed. It means a signal, and specifically, it may be an open pore current ( I 0 ), a magnitude of a current drop ( ⁇ I ), a dwell time, a nanopore event conformation, and the like.
  • the open pore current is a current in a state in which only nanopores exist without an analyte, and refers to a basal level.
  • the “residence time” means the time required for the analyte to pass through the nanopore, or the time it takes to stay inside and/or at the entrance to the nanopore.
  • nanopore event type refers to the shape of a current peak that appears while the analyte passes through the nanopore, and may be expressed as, for example, the shape of the peak, the rate of occurrence of the peak, or a combination thereof.
  • the "screening” refers to a process of extracting, isolating, and identifying a compound having a desired sensitivity or activity from among samples or candidate substances through the minimum possible steps, and specifically screening and discovering a drug that binds to a target RNA aim to
  • the method of screening the drug that binds to the target RNA may be to detect the presence of an RNA-drug complex formed by binding the target RNA to the drug.
  • the detection of the RNA-drug complex is to detect a two-dimensional or three-dimensional structural change and/or a kinetic change, including a temporary structural change, of RNA that appears when a drug is bound to a target RNA by measuring and comparing it with an electrical signal.
  • a change in electrical signal appears before and after the reaction between the target RNA and the candidate substance, it can be determined that the RNA-drug complex has been formed.
  • the "when a change in the electrical signal appears” means a case in which the dwell time and/or nanopore event conformation before and after the reaction of the target RNA and the candidate material is changed, specifically, nanopore retention It may mean that the time increases after the treatment of the candidate material, or that a new nanopore event form appears after the treatment of the candidate material.
  • the increase in the residence time may be 1.1 times or more, 1.3 times or more, 1.5 times or more, 1.8 times or more, 2 times or more, 3 times or more, 5 times or more, or 8 times or more, compared with before the reaction, and the new The appearance of the nanopore event form may be a change from a single-level electrical signal to a double-level electrical signal after candidate material processing.
  • the candidate substance is a drug that binds to the target RNA
  • it binds to the target RNA to form an RNA-drug complex
  • the RNA-drug complex is structurally stabilized and does not directly pass through the nanopores. Since it takes time to be captured in the lumen and then unzipping, it will take a long time to stay in the nanopore, so after the reaction by measuring the dwell time of the nanopore before and after reacting the candidate material with the target RNA When the residence time is increased, it can be determined that the candidate substance is a drug that specifically binds to the target RNA.
  • the candidate material is a drug that binds to the target RNA
  • it binds to the target RNA to form an RNA-drug complex
  • the RNA-drug complex does not directly pass through the nanopore and enters the lumen of the nanopore.
  • the structure is changed as it is captured and then unzipping, and a current level is generated according to such a change in structure. appears, it can be determined that the candidate substance is a drug that specifically binds to the target RNA.
  • RNA-derived from bacteria when RNA-derived from bacteria is present alone, only a single-stage type-I event form appears, but when present as an RNA-drug complex, a type having a two-stage current level as well as the above type-I event -II event form appears together, and even in the case of nanopore retention time, it was confirmed that the nanopore retention time of the RNA-drug complex increased by more than 2 times compared to the RNA alone state, thereby targeting specific RNA using nanopores and target RNA It was confirmed that the drug can be discovered ( FIGS. 2 and 3 ).
  • the nanopore residence time increases by about 2 to 8 times or more depending on the type and concentration of the drug when the virus-derived RNA exists as an RNA-drug complex than when it exists alone. It was confirmed that a drug targeting a specific RNA can be discovered using nanopores and target RNA ( FIGS. 13 and 14 ).
  • the present invention relates to a screening method for an antibacterial agent, antibiotic or antiviral agent using nanopores.
  • the screening method of the antibacterial agent, antibiotic or antiviral agent of the present invention comprises the steps of (a) measuring an electrical signal generated while a target RNA passes through a nanopore; (b) treating the target RNA with a candidate material expected to bind to the target RNA, and measuring an electrical signal generated while the target RNA passes through the nanopore; and (c) comparing the electrical signals measured in steps (a) and (b) and selecting the candidate material as a riboswitch-target material when a change in the electrical signal appears.
  • RNA-targeted drug candidate”, “nanopore”, “electrical signal” and “screening” of the present invention are the same as described above.
  • 40 candidate substances are first selected from 766 natural product libraries through in silico screening, and as a result of nanopore-based drug screening, more than 10% of type-II migration events are The three groups observed were selected. After that, three new RNA-targeted drugs were discovered through individual nanopore screening, and the discovered 3,4-dicaffeoylquinic acid and 4,5-dicaffeoylquinic acid (4 ,5-dicaffeoylquinic acid) and luteolin-7-glucuronide (luteolin-7-glucuronide) both exhibit type-II migration events and double-level signals, and nanopore retention times that are more than twice that of RNA alone It was confirmed that the
  • the present invention provides a kit for drug screening of an RNA target comprising (i) nanopores, (ii) a target RNA, and (iii) a composition capable of measuring ionic current and residence time.
  • RNA-targeted drug candidate”, “nanopore”, “electrical signal” and “screening” of the present invention are the same as described above.
  • the space in which the nanopores are present is divided into two compartments (eg, a first compartment and a second compartment, or a cis (membrane) containing the nanopores) cis ) and trans ( trans ) compartments) may be provided in a divided state. And, it may be provided in a state in which the target RNA is included in any one of the two compartments.
  • RNA-drug complex When a candidate substance expected to bind to a target RNA is supplied to the kit for drug screening of an RNA target of the present invention provided in this way through a compartment including the target RNA, the candidate substance binds to the target RNA and thus RNA-drug complex is formed, and the RNA-drug complex does not pass directly through the nanopore, but is captured in the lumen of the nanopore and then it takes time to unzipping, so that the time it stays in the nanopore will become longer, so the candidate material By measuring the dwell time of the nanopores before and after reacting with the target RNA, it can be determined that the candidate substance is a drug that specifically binds to the target RNA when the retention time after the reaction is increased.
  • the candidate substance is a drug that specifically binds to the target RNA. That is, if the candidate substance is a drug that specifically binds to the target RNA, the electrical signal changes before and after the treatment of the candidate substance. is not changed, so it is possible to screen for drugs that specifically bind to the target RNA.
  • the kit for drug screening of an RNA target of the present invention may be further provided with a configuration capable of measuring an ionic current, a magnitude of a current drop, an event conformation, or an event duration.
  • the screening method of the present invention it is possible to efficiently screen a drug targeting a specific RNA even with a trace amount of a sample.
  • Drugs discovered by targeting RNA can be used to treat diseases regulated by specific RNA.
  • FIG. 1 shows the results of analyzing the three-dimensional folding of ARS induced by adenine based on NMR:
  • FIG. 1 a shows three molecular states of ARS in the three-dimensional folding process of ARS induced by adenine.
  • 1B is a 1D 1H NMR spectrum of ARS and ARS-adenine complexes released in the presence of 50nM KCl or 1M KCl.
  • Figure 2 shows the results of statistical analysis of nanopore events of ARS and ARS-Mut using ligands:
  • Figure 2a is current drop ( I / I 0 ) and residence time ( t d ) for ARS alone state histogram;
  • Fig. 2b is a histogram of current drop ( I / I 0 ) and residence time ( t d ) for the ARS-adenine complex;
  • Figure 2 c is a scatter plot of the structure of adenine and ARS alone and adenine-coupled ARS;
  • 2 d is a histogram of current drop ( I / I 0 ) and residence time ( t d ) for ARS single-state-Mut;
  • FIG. 1 is current drop ( I / I 0 ) and residence time ( t d ) for ARS alone state histogram
  • Fig. 2b is a histogram of current drop ( I / I 0 ) and residence time ( t
  • FIG. 2E is a current drop ( I / I 0 ) and residence time ( t d ) histogram for ARS-Mut to which adenine is bound;
  • Figure 2 f is a scatter diagram of the nanopore event structure of ARS-Mut with four base mutations (U28G, G42C, U47C and U51C) and ARS single-state-Mut and adenine-coupled ARS-Mut.
  • Figure 3 shows the results of statistical analysis of the nanopore event of the ARS-adenine complex:
  • Figure 3a is two types of current traces for the ARS-adenine complex;
  • Fig. 3b is a histogram of I / I 0 and residence time of type I events;
  • Fig. 3c is a histogram of I / I 0 and residence time of type II events;
  • Fig. 3d is a scatter plot of type I and type II events for complex and ARS alone;
  • 3e is a molecular model proposed for bumping or translocation of ARS alone, intermediates and complexes.
  • Figure 4 shows the nanopore measurement results for the specific interaction of ARS and adenine in the presence of a number of non-binding compounds:
  • Figure 4a is a type of ARS in the absence of adenine in the presence of a mixture of non-binding compounds I / I 0 histogram with t I for I events;
  • Figure 4b is an I / I 0 histogram with t I for type I events of ARS when a mixture of non-binding compounds is with adenine;
  • 4c is an I / I 0 histogram with t II for type II events of ARS in the presence of adenine and MIX-3;
  • FIG. 4 d is a comparison of I/I 0 histograms of type I events and type II events of ARS including MIX-3 only MIX-3 and ARS including adenine;
  • Figure 4e is a schematic model of the nanopore migration of the specific interaction between ARS and adenine.
  • Figure 5 shows a nanopore-based drug screening approach for ARS RNA:
  • Figure 5a is a current trace of nanopore events for ARS in the presence of hit compounds (NC1, NC2 and NC4) ARS with hit compound Representative type II events (marked with asterisks) detected in , are shown in the right column;
  • 5 b to d show the I / I 0 and retention time ( t II ) for the type II event of ARS generated from the binding of each hit compound (NC1 (b), NC2 (c) and NC4 (d)). histogram;
  • FIG. 1 is a current trace of nanopore events for ARS in the presence of hit compounds (NC1, NC2 and NC4) ARS with hit compound Representative type II events (marked with asterisks) detected in , are shown in the right column;
  • 5 b to d show the I / I 0 and retention time ( t II ) for the type II event of ARS generated from the binding of each hit compound (NC1 (b), NC2 (c) and NC4
  • 5E is a 1D CPMG NMR analysis result of a hit compound and an ARS non-binding compound (NC11 and NC12) in the presence of ARS, and the solid and dotted lines indicate 1D CPMG spectra of the natural product in the absence and presence of ARS, respectively.
  • Figure 6 shows the change of the event residence time according to the increase of the applied voltage:
  • Figure 6a is the applied voltage (+100 mV, +120 mV, +140 mV and +160 mV) of the type I event in the ARS alone state residence time according to;
  • 6b is the residence time according to the applied voltage (+80 mV, +100 mV, and +120 mV) of the ARS-adenine complex.
  • Type I and Type II events are indicated by triangles and squares, respectively, and error bars are standard errors. indicates.
  • Figure 7 is a 1D-CPMG analysis of the non-binding ability of a native compound in MIX-3: the solid and dotted lines represent the 1D CPMG spectrum of the compound in the absence and presence of ARS, respectively.
  • Figure 10 shows the nanopore events of TRS alone and TRS-TPP complex: (a) current traces for TRS alone and TRS-TPP complex; (b) Two types of nanopore events.
  • FIG. 11 shows the results of statistical analysis of the nanopore events of TRS alone and TRS-TPP complex: (a) scatter plots of type I events and type II events for TRS alone and TRS-TPP complex; (b) total events for TRS monostate and TRS-TPP complex; (c) histogram of residence time of type I events; (d) Voltage dependence of residence time in type I events of TRS alone and TRS-TPP complexes at an applied potential of 100 to 140 mV. confirm that.
  • Figure 12 shows the statistical analysis results for the type II event of the TRS alone state and the TRS-TPP complex: (a) histogram of the residence time of the type II event; (b) Voltage dependence of residence time in the type II event of TRS alone and TRS-TPP complex at an applied potential of 100 to 140 mV, confirming that the residence time decreased as the applied potential increased in the type II event .
  • Figure 13 shows the detection scheme of nanopore-based RNA-drug complex for IAV RNA using the 5' end leader sequence:
  • A Secondary structure and small molecule 6,7 of IAV RNA with 5' end leader sequence -dimethoxy-2-(1-piperazinyl)-4-quinazolinamine (DPQ)
  • B detection of IAV RNA using DPQ that binds to IAV RNA with a 5' end leader sequence at 100mV
  • C Histograms of retention times and current recordings for 5'L-iav-RNA alone and increased binding ratios of 5'L-iav-RNA/DPQ complexes
  • D Diagrams for detection of IAV RNA and DPQ complexes.
  • RNA-drug complex detection scheme for IAV RNA using a 3'-end leader sequence (3'L-iav-RNA):
  • A 3'L-iav-RNA/DPQ probe
  • B Histograms of retention time and current blockade for 3'L-iav-RNA single-state and 3'L-iav-RNA/DPQ complex (molar ratio 1 to 50)
  • C + It shows nanopore raw data at an applied voltage of 140 mV.
  • RNA Target Riboswitch with Long P1 Stem
  • ⁇ -Hemolysin ( ⁇ HL) protein was purchased from List Biological Laboratories Inc. (Campbell, CA, USA).
  • DPhPC (1,2-diphytanoylsn-glycero-3-phosphocholine) was purchased from Avanti Polar Lipids (Alabaster, AL, USA).
  • ARS adenine-sensing riboswitch
  • ARS regulates the translation of adenosine deaminase (ADD), which is essential for bacterial purine metabolism.
  • the aptamer domain of ARS of Vibrio vulnificus has three helical stems (P1-P3), two hairpin loops (L2 and L3) and three binding sites (J1-2, J3-1 and J2-). 3) (Fig. 1a).
  • ARS is flexible in its free state, but when it binds to adenine, it folds into a tertiary structure like a tuning-fork. Through the intermediate state, the tertiary structure of the complex is stabilized through the formation of a new base triplet at the adenine binding site and hydrogen bonding between the loops L2 and L3 (FIG. 1a).
  • ARS controls the translation of bacterial purine metabolism.
  • NMR analysis showed that binding of adenine to ARS induces a dramatic structural rearrangement and substantially stabilizes the tertiary structure of the complex.
  • ARS detected four characteristic imino proton peaks of the complex, confirming that it binds to adenine even at a high salt concentration (1M KCl) (FIG. 1 b).
  • ⁇ -hemolysin ( ⁇ -HL) nanopores it was confirmed whether the interaction between the riboswitch and the ligand could be detected at the single molecule level.
  • ARS alone free ARS
  • ARS-adenine complex ARS-adenine complex
  • a buffer containing 10mM potassium phosphate (pH 6.2), 2mM MgCl 2 and 1M KCl with a single ⁇ HL nanopore lipid bilayer added to the cis side of
  • a voltage of (+) 100 mV is applied to the nanopores
  • the ARS alone state or the ARS-adenine complex is driven by electrophoresis to block the ion current.
  • the nanopore events of the ARS alone state and the ARS-adenine complex were statistically analyzed ( FIGS. 2 a to c ).
  • the nanopore event of the ARS alone state exhibited two average current cutoffs ( I / I 0 ) of 0.69 and 0.86 with an average dwell time (dwell time, t d ) of 0.38 ms (FIG. 2a).
  • I / I 0 average current cutoffs
  • t d average dwell time
  • nanopore events were measured using an ARS mutation (ARS-Mut) with four base mutations (U28G, G42C, U47C and U51C) to disrupt ARS-adenine binding (Fig. 2d to f).
  • the I / I 0 (0.68 and 0.82) and t d (0.50 ms) values of ARS-Mut were not significantly different from those of ARS alone-Mut (Fig. 2 d to e).
  • the scatter plot of ARS-Mut with adenine showed a very similar distribution to the distribution of ARS alone-Mut (FIG. 2 f).
  • the ARS alone state showed only type I events with a single level of ion current blocking, but in the ARS-adenine complex, type I and type II events were mixed, and double levels of electrical signals were observed (FIG. 3a).
  • Type II events showed a characteristic pattern of two current levels (termed I II1 and I II2 ) with distinct durations ( t II1 and t II2 ), suggesting that they occurred in adenine-bound ARS RNA. indicates.
  • the average I / I 0 value of level 1 ( I II1 ) of type II events is 0.45, which is about 50% of that of level 2 ( I II2 ).
  • Type I and II events of the ARS-adenine complex differed in the mean value of I / I 0 and the retention time (Fig. 3 b to c).
  • the retention time of type II events ( t II , 2.14 ms) was measured longer than that of type I events ( t I , 0.28 ms), showing a significant difference.
  • the scatter plots of type I and II events showed clearly distinct distributions (Fig. 3d).
  • ARS RNA induced by adenine three molecular states (ARS alone, intermediate and ARS-adenine complex) can be generated. It is known that the blunt end A-type RNA duplex does not pass through the ⁇ -HL nanopores because the diameter of the A-type duplex is large. Therefore, ARS single state generates frequent bumping signals due to short average residence time (0.38 ms) and single-level current cutoff (FIG. 2a). Similarly, the ARS-adenine complex with a stable blunt-ended P1 stem, which is the final product of the folding process, cannot enter the pore, so a type I bumping event with an average t I of 0.28 ms occurs (Fig. 3b).
  • partially folded ARS intermediates with flexible terminal stems and metastable secondary structures can pass through nanopores through a two-step process.
  • the first step is to capture the secondary structure of the adenine-binding ARS and unzipping it into a single strand (Fig. 3e).
  • Fig. 3e the secondary structure of the adenine-binding ARS and unzipping it into a single strand.
  • t II1 unzipping occurs in which the helical duplex of adenine-binding ARS is unpaired outside the vestibule of the ⁇ -HL nanopore.
  • the unzipping process of ARS goes through the process of passing through the nanopores in step 2. It is immediately released from the nanopores during the sub-residence time t II2 (Fig. 3e, middle column).
  • the type II event was a result of pore translocation.
  • the type II events occurring in the complex showed a significant decrease in residence time as the applied voltage increased (from +80 mV to +120 mV) ( FIG. 6 ). This indicates that the analyte passes through the nanopores.
  • the type I event of ARS alone and the complex exhibited similar residence times even when the applied voltage was increased.
  • adenine-binding ARS produces a type II migration signal with a two-step ionic current blockade and a residence time (2.14 ms) that is ⁇ 7.64 times longer than that of type I events.
  • This significant time delay may occur as a result of single-stranded separation of the duplex of adenine-binding intermediates using flexible terminal stems, ie, unzipping.
  • single-molecule-based nanopore sensors are a useful platform for detecting transient and partially folded intermediates generated in the ligand binding-coupled RNA folding pathway.
  • the purpose of this study was to determine whether drugs could be screened by detecting the interaction between riboswitch and ligand with nanopores. In addition, it was confirmed that the specific binding of the riboswitch and the ligand can be detected even in the state that natural products of various components are included.
  • MIX-3 ATP, (-)-epicatechin and tramiprosate
  • Fig. 4 a mixture of non-binding compounds
  • MIX-3 generated only type I events and exhibited a relatively short t d (0.31 ms) with mean I / I 0 of 0.69 and 0.87. This means that MIX-3 does not bind to ARS and induce a three-dimensional structural change (FIG. 4a).
  • the non-binding ability of each compound in MIX-3 was further confirmed by 1D CPMG, a ligand observation NMR screening technique ( FIG. 7 ).
  • the characteristic deep current block of type II transit events can be used to identify drug binding to ARS and increase the residence time.
  • the specific binding of adenine to ARS can be detected by nanopores even in a complex sample containing several substances (FIG. 4e).
  • Nanopore-based drug screening was performed using the structural change detection model of Examples 1-5.
  • Nanopore-based drug screening was performed by dividing 40 natural products into 10 groups consisting of 4 natural products, respectively. Three groups having a type II specific translocation event of 10% or more were selected from the nanopore screening results. Thereafter, three new ARS target-natural product hits were finally discovered through subsequent nanopore-based screening for each individual compound in the selected group (FIG. 8).
  • the hit compounds of NC1 (3,4-dicaffeoylquinic acid), NC2 (4,5-dicaffeoylquinic acid) and NC4 (luteolin-7-glucuronide) are all type II migration events and ARS alone states It exhibited a residence time that was 4.1 to 7.3 times greater than that (a to d of FIG. 5).
  • 1D CPMG experiments were performed with three hit compounds in the absence or presence of ARS using NMR spectroscopy to confirm whether the hit natural products bind to ARS.
  • NC1, NC2 and NC4 Unlike natural products (NC11 and NC12) that do not bind ARS, NC1, NC2 and NC4 exhibited dramatic peak line-broadening and/or significant chemical shift changes in 1D CPMG spectra after addition of ARS. It was confirmed that ARS definitely binds to hit natural products (FIG. 5 e).
  • NC1 and NC2 share a common scaffold for novel antibiotic drugs, and it was confirmed that all three hit compounds were derived from herbs with antibacterial or anti-inflammatory activity: Lonicera japonica (NC1 and NC2) and Marchantia berteroana (NC4).
  • the nanopore-based drug screening technology of the present invention can be expanded and applied to various RNA targets related to diseases, and it is possible to screen multi-component natural products with high efficiency and in a short time without the need to pre-classify them into single components. Able to know.
  • RNA Target Riboswitch Target with Short P1 Stem
  • TPP Thiamine pyrophosphate-sensing riboswitch or Thi-box riboswitch
  • TPP Thiamine pyrophosphate
  • TRS directly binds thiamine pyrophosphate (TPP) to regulate gene expression through various mechanisms in bacteria, archaea, fungi and plants.
  • TRS regulates genes involved in the synthesis or transport of thiamine and its phosphorylated derivatives.
  • TRS consists of five helical stems (P1-P5), two hairpin loops (L3 and L5) and three binding sites (J2/4, J3/2 and J4/5).
  • TRS RNA was synthesized by Integrated DNA Technologies (Coralville, IA, USA), and the nucleotide sequence information is shown in Table 2 below. TRS RNA was dialyzed against 10 mM potassium phosphate (pH 6.2) and 50 mM KCl buffer for at least 12 hours. TRS RNA was annealed by heating at 95 °C for 5 minutes, then slowly cooling at room temperature. Nanopore experiments were performed at a concentration of 500 nM.
  • TRS single state was observed as a mixture of a type-I event with single-level ion current interruption and a double-level type II event. This is a phenomenon that occurs because the base pair of the P1 stem is relatively short (6 pairs) and has unstable ends in aqueous solution when TRS is alone.
  • the average value of dwell time in the pore was measured to be 0.26 ms for Type-I events, and the average value of dwell time for Type-II events was 3.39 ms, which is relatively longer than for Type I events. (FIG. 11 c and FIG. 12 a).
  • TRS causes three-dimensional structural change (ligand-dependent folding) as the TPP ligand binds.
  • the pyrimidine portion of TPP forms an intercalation pocket with P2 and P3 helical stems, and P4 and P5, another helical stem, form TPP.
  • P2 and P3 helical stems, and P4 and P5, another helical stem, form TPP. provides a water-lined bond with the pyrophosphate moiety of Therefore, compared to the TRS single structure, the structure of the TRS-TPP complex has a compact and rigid folding structure.
  • the three-dimensional structural change of the TRS by binding to the TPP ligand forms a final TRS-TPP complex through an intermediate state structure.
  • These transient intermediate-state structures can be observed in nanopore-based analysis. Significant changes were observed between the nanopore signals in the structure of the TRS alone state and the intermediate state before the formation of the TRS-TPP complex ( FIG. 9 ).
  • a TRS-TPP complex was added to the cis side of the lipid bilayer with single ⁇ HL nanopores.
  • a (+) voltage is applied to the nanopore, the TRS-TPP complex enters the pore by electrophoresis and the ion current is blocked.
  • the current blocking event of the TRS-TPP complex both type-I and type II events were observed, and active nanopore current traces were confirmed ( FIG. 10 ).
  • the average residence time was 0.22 ms, which was similar to the average residence time of all nanopore events in the TRS alone state (FIG. 11 b).
  • the retention times of the type-I and type-II events observed in the TRS-TPP complex were 0.21 ms and 4.37 ms, respectively ( FIGS. 11c and 12a ).
  • TRS three molecular states
  • the blunt-end TRS alone does not pass through the ⁇ HL nanopores and generates frequent bumping signals with a short average residence time (0.26 ms) and single-level current cutoff.
  • TRS has a flexible end in aqueous solution because the short P1 stem consisting of 6 base pairs is relatively short. Due to this, the P1 stem is unzipping in the passage (vestibule) of the ⁇ HL nanopore, but eventually does not pass through the nanopore and is bumped, resulting in a double-level current cutoff.
  • the TRS-TPP complex with a stabilized structure and P1 stem cannot enter the pores, resulting in a type I bumping event with an average residence time of 0.21 ms.
  • TRS/TPP binding intermediates which are mostly unstable in structure, can cross the nanopore through two steps.
  • the first step is to capture the secondary structure of the TPP-bound TRS and unzipping it into a single strand.
  • the helical structure of TPP-bonded TRS is unzipped, it passes through the nanopores in the second step process. Due to this, a type-II double-level current blocking event occurs in the TRS intermediate formed by TPP binding.
  • the rate of type II events generated by the intermediate was 14.3%, which was confirmed to be significantly increased compared to the TRS alone state (FIG. 11).
  • the single-molecule-based nanopore sensor is a useful platform for detecting transient and partially folded intermediates generated in the TPP binding-coupled RNA folding pathway.
  • the TRS-TPP complex to which TPP is bound also generates a type-I signal that does not pass through the nanopore and bumps because the three-dimensional folding is completed to form a blunt-end structure, and the base pair is further stabilized.
  • the intermediate structure which is an intermediate product that occurs when f-folding occurs by TPP binding of TRS, exhibits a unique type II nanopore signal due to the structural flexibility of RNA.
  • the TRS-TPP complex can be used for the treatment of diseases regulated by the riboswitch by screening the target material for the riboswitch derived from bacteria, especially antibacterial agents Alternatively, it can be seen that it can be applied as a useful development for antibiotic discovery.
  • RNA target molecules having a hairpin structure Construction of RNA target molecules having a hairpin structure
  • RNAs having a hairpin structure by designing and adding an RNA leader sequence at the 5' end or 3' end using the promoter sequence conserved in influenza A virus RNA, new RNA targets 5'L-iav-RNA and 3'L- iav-RNA was synthesized by Integrated DNA Technologies (Coralville, IA, USA). Two RNA samples were dialyzed against a buffer containing 10 mM potassium phosphate (pH 6.2) and 50 mM KCl for more than 12 hours. RNA samples were annealed by heating at 95 °C for 5 min, then slowly cooling at room temperature.
  • ⁇ -hemolysin ( ⁇ -HL) nanopores it was confirmed whether the interaction between RNA and ligand having a hairpin structure could be detected at a single molecule level.
  • 5'L-iav-RNA at a concentration of 500 nM in a buffer containing 10 mM potassium phosphate (pH6.2) and 1 M KCl was added to the cis compartment of the lipid bilayer with single ⁇ HL nanopores.
  • a voltage of +100 mV was applied to the nanopores, 5'L-iav-RNA and the complex were driven by electrophoresis to block the ion flow (FIG. 13b).
  • the average current blocking intensity ( ⁇ I) of the nanopore event was measured to be 76.9 pA, and the average dwell time was 0.58 ms. was measured (Fig. 13c).
  • DPQ 6,7-dimethoxy-2-(1-piperazinyl)-4-quinazolinamine
  • the average current blocking intensity ( ⁇ I ) of the nanopore event was measured to be 78.6 pA in the complex of 1:50 ratio, and The average dwell time was measured to be 1.14 ms. In the 1:100 ratio composite, an average current blocking strength of 75 pA and a dwell time of 1.47 ms were measured.
  • concentration of the DPQ ligand in the 5'L-iav-RNA alone state and the 1:50 1:100 ratio was increased, it was observed that the time for 5'L-iav-RNA to pass through the protein nanopore significantly increased. could (Fig. 13c).
  • neomycin Another target ligand of influenza A virus RNA, neomycin, is known to bind to the phosphate backbone of influenza A virus RNA with an internal loop to stabilize the hairpin structure, a two-dimensional structure of RNA.
  • the two-dimensional hairpin structure of RNA is the pathway of the pore. It is manufactured so that unzipping can occur easily. Due to the binding of the target ligand, the two-dimensional hairpin structure of 5'L-iav-RNA is stabilized, and the process of unzipping the base pair in the passage of the nanopore occurs slowly, so the nanopore residence time of the target ligand-binding RNA complex is increased.
  • the single-molecule-based nanopore sensor is a useful platform for detecting the hairpin structure of RNA stabilized by ligand binding.
  • RNA target (3'L-iav-RNA) was prepared by designing and adding a 24 nucleotide leader sequence at the 3' end so that IAV RNA alone passes the nanopore more efficiently than 5'L-iav-RNA.
  • the leader sequence of 3'L-iav-RNA is poly(AC) 12 nucleotides. was produced using
  • 3'L-iav-RNA at a concentration of 500 nM in a buffer containing 10 mM potassium phosphate (pH6.2) and 1 M KCl was added to the cis compartment of the lipid bilayer with single ⁇ HL nanopores.
  • a voltage of +100 mV was applied to the nanopores, 3'L-iav-RNA and the complex were driven by electrophoresis to block the ion flow (FIG. 15c).
  • the average retention time (7.30 ms) of the nanopores in the 3'L-iav-RNA alone state was significantly increased compared to the average retention time (0.58 ms) of the nanopores in the 5'L-iav-RNA state alone.
  • DPQ ligand and 3'L-iav-RNA were added to the cis compartment of the lipid bilayer with ⁇ HL nanopores after complex formation in a 1:50 ratio.
  • the average nanopore retention time increased to 9.52 ms (FIG. 15 b).
  • the increased residence time of 3'L-iav-RNA was clearly confirmed by DPQ binding in the nanopore current trace (FIG. 15c). This was confirmed to be effective by stabilizing the two-dimensional hairpin structure of influenza A virus RNA by DPQ binding, thereby delaying the process of unzipping the base pair in the nanopore passage.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Nanotechnology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 나노포어 및 표적 RNA 를 이용한 약물 스크리닝 기술에 관한 것이다. 본 발명의 스크리닝 방법에 따르면, 피코몰 수준의 극미량의 시료로도 RNA를 표적으로 하는 약물을 효율적으로 스크리닝 할 수 있다. RNA를 표적으로 하여 발굴된 약물은 RNA에 의해 조절되는 질병의 치료에 사용될 수 있다.

Description

나노포어를 이용한 RNA 표적의 고효율 약물 스크리닝 방법
본 발명은 나노포어를 이용한 RNA 표적의 고효율 약물 스크리닝 방법에 관한 것이다.
현재까지 대부분의 약물은 유전자의 마지막 산물인 단백질을 표적 분자로 사용하고 있는데, 이는 전체 약물의 70~80%를 차지하고 있다. 그러나 유전체(genome)의 산물 중 하나인 RNA(ribonucleic acid) 분자가 약물의 표적 분자가 될 수 있다는 것이 알려지면서, RNA에 결합할 수 있는 화합물을 선별할 수 있는 효율적인 스크리닝 방법에 초점이 모아지고 있다.
RNA는 유전정보의 흐름에서 DNA의 정보를 단백질로 발현시키는 중간 산물로 알려져 있는데 특히 mRNA의 암호화되지 않는 부분(untranslated region, UTR)은 mRNA가 단백질로 발현되는 효율성과, mRNA 자체의 안정성 및 mRNA의 위치를 결정하는 중요한 정보를 지니는 것으로 알려져 있다. 이들 mRNA의 UTR의 구조는 대부분 2차원적 또는 3차원적 구조를 가지고 있으며, 모양과 염기서열에서 특색을 보인다. 특히, 3차원적 구조는 생체 내의 여러가지 RNA 결합 단백질과 특이적인 결합을 통하여 그 기능을 나타내기 때문에, 특이적 구조를 가진 RNA는 세포 내에서 중요한 표적 분자가 될 수 있다. 예를 들어, 박테리아의 16S rRNA A 부위(A site), HIV 바이러스의 TAR (trans-activating region) 결합 부위(binding site), RRE (REV-response element) 결합 부위(binding site), IRE (iron responsive element) mRNA, 티미딜레이트 합성효소(thymidilate synthetase) mRNA 등이 표적 분자로서 인정되고 있다. 또한, 다양한 사이토카인(cytokine), 세포-세포간의 인식과 신호를 전달하는 물질들, 성장인자(growth factor)들과 여러 가지 구형 단백질 등의 mRNA의 UTR의 역할이 규명되기 시작하여 그 중요성이 인식되면서 mRNA의 특이적 염기서열 및 모양이 RNA 표적 분자로 대두될 가능성이 점점 커져가고 있다. 이외에도 질병과 직접 관련이 있는 여러 가지 mRNA의 UTR이 특이적인 모양과 염기서열을 가지고 있으므로 쉽게 표적화 되고 있다.
리보스위치(riboswitch)는 아미노산과 그 유도체(라이신, 글리신, SAM. SAH), 코엔자임(FMN, TPP, coenzyme B12), 핵 염기와 그 유도체(아데닌, 구아닌, c-di-GMP, c-di-AMP, preQ1) 및 이온(Mg2+)과 같은 저분자 대사 산물 및 이온에 대한 반응으로 박테리아의 유전자 발현을 조절한다. 리보스위치는 앱타머 도메인 및 발현 플랫폼 도메인으로 구성된다. 리보스위치 앱타머 도메인의 동족 대사산물에 대한 결합은 발현 플랫폼 도메인에서 순차적인 형태적 변화를 포함하여 3차원 구조 접힘 (folding)을 유도한다. 이러한 구조 재배열을 통해 리보스위치는 박테리아 대사와 관련된 유전자의 전사 또는 번역을 조절한다. 리보스위치는 선택성이 높은 저분자를 인식하도록 진화했으며, 진핵 생물이 아닌 박테리아에 존재하므로 교차 반응 없이 박테리아만을 특정하여 표적화 할 수 있다. 따라서, 세균성 리보스위치를 표적으로 하는 것은 특히 슈퍼 박테리아에서 항생제 내성을 극복하기 위한 유망한 전략이 될 수 있다.
치료적 표적으로서 질병 관련 RNA의 중요성에도 불구하고, 이들에 대한 저분자 약물의 효율적인 약물 스크리닝은 다량의 RNA의 필요성, RNA에 결합하는 저분자 약물의 검출을 위한 표면 플라즈마 공명의 낮은 감도, 형광 기반 분석에서 RNA의 화학적 표지의 필요성 등과 같은 방법에 의해 제한적이다. 이에 고효율의 새로운 약물 스크리닝 기술의 개발은 다양한 RNA 매개 질병에 대한 약물 발굴을 촉진할 것이다.
나노포어 센싱은 생체 분자들의 단일 분자 분석을 위한 새로운 기술이다. 인가된 전압에서 단일 나노포어 채널을 통한 하전된 분석물의 이동은 이온 전류의 일시적인 차단을 유도하며, 이는 전류 세기(current amplitude) 및 통과 또는 체류 시간(dwell time)으로 측정된다. 단백질 나노포어를 이용한 호모유리딘 RNA 단편(PolyU)를 나노포어를 기반으로 검출한 이후, 다양한 나노포어 기반 접근법이 핵산을 감지하는데 사용되었다. 단백질 나노포어 중에서는 황색 포도상구균이 분비하는 독소인 알파-헤몰라이신(α-hemolysin, αHL)이 주로 핵산 분석에 사용된다. 293개 아미노산으로 구성된 단백질 모노머 (monomer)가 지질 이중층에서 자가 조립하여 ~ 10 nm 길이의 채널을 포함하여 안정한 헵타머 (heptamer) 기공을 형성한다. αHL 나노포어는 정교한 기하학적 구조와 1.4nm 직경의 좁은 협착부(constriction)로 인해 단일 분자의 검출, 특히 핵산의 검출에 적합한 플랫폼이다. 그러나, 아직까지 RNA를 표적으로 하는 저분자 약물 스크리닝에 단백질 나노포어를 적용하는 기술은 미미한 실정이다.
이에, 나노포어를 기반으로 RNA를 표적으로 하는 저분자 약물을 극미량의 시료로도 정확하고 효율적으로 스크리닝 하는 기술 개발이 더욱 필요하다.
본 발명의 일 목적은 나노포어를 이용하여 RNA 표적의 약물(RNA-targeting drugs)을 스크리닝하는 방법을 제공하는 것이다.
본 발명의 다른 일 목적은 나노포어를 포함하는 RNA 표적의 약물 스크리닝용 키트를 제공하는 것이다.
본 발명의 일 측면은 나노포어를 이용한 RNA 표적의 약물의 스크리닝 방법을 제공한다.
본 발명의 다른 일 측면은 나노포어를 포함하는 RNA 표적의 약물 스크리닝용 키트를 제공한다.
이하, 본 발명을 상세히 설명한다.
본 발명의 일 측면은 나노포어를 이용한 RNA 표적의 약물 스크리닝 방법에 관한 것이다.
본 발명의 RNA 표적의 약물 스크리닝 방법은 (a) 표적 RNA가 나노포어를 통과하면서 발생하는 전기적 신호를 측정하는 단계; (b) 상기 표적 RNA에 결합할 것으로 기대되는 후보 물질을 표적 RNA에 처리하고, 상기 표적 RNA가 나노포어를 통과하면서 발생하는 전기적 신호를 측정하는 단계; 및 (c) 상기 (a) 및 (b) 단계에서 측정된 전기적 신호를 비교하여 전기적 신호의 변화가 나타나는 경우 상기 후보물질을 표적 RNA에 특이적으로 결합하는 약물로 선별하는 단계;를 포함한다.
상기 "나노포어"는 어느 한 구획에서 다른 구획으로 이온 및/또는 전하를 띠는 저분자 물질을 통과시킬 수 있는 구조물을 의미한다. 나노포어의 "나노(nano)"는 약 1 ㎛ 미만이고 약 0.1 nm 이상의 크기를 의미한다. 상기 나노포어의 직경은 구체적으로 약 0.5 nm 내지 약 25 nm, 약 0.5 nm 내지 약 10 nm, 약 0.5 nm 내지 약 8 nm, 약 0.5 nm 내지 약 6 nm, 약 0.5 nm 내지 약 5 nm, 약 1 nm 내지 약 3 nm, 또는 약 1.5 nm일 수 있다.
상기 나노포어는 좁은 협착부를 가지는 단백질 나노포어일 수 있고, 예컨대, α-헤몰라이신, ClyA, 에어로라이신, 라이세닌, CsgG, FhuA, FraC, MspA, PlyAB, Phi29, PA63 및 OmpG 등 일 수 있다. 상기 α-헤몰리신 단백질은 야생형 및 변이체를 모두 포함할 수 있다. α-헤몰리신 단백질 나노포어 단량체는 평면 지질 이중층에 길고 좁은 β-barrel(약 길이 10nm 및 직경 1.4nm)을 포함하는 칠량체성 기공(heptameric pore)을 형성한다. α-헤몰리신 단백질 나노포어는 나노포어 양단에 전압이 연결되어 제1구획에서 제2구획으로 분자를 통과시킬 수 있으며, 전하 특성에 따라 서로 다른 전기적 신호를 발생시킬 수 있다. 따라서, α-헤몰리신 단백질 나노포어는 단일 분자 수준에서 생체 분자를 검출하기 위한 고감도 센서로 유용하게 활용될 수 있다.
상기 “표적 RNA”는 질병과 관련된 RNA로서, 질병과 관련된 유전자의 전사 조절에 관여하는 mRNA일 수 있다. 또한, 상기 표적 RNA는 자체적으로 적어도 하나 이상의 스템-루프(Stem-Loop) 또는 삼중나선(Triplex) 구조를 형성하는 것일 수 있으며, 특이적인 2차원적 또는 3차원적 구조를 갖는 RNA로서 리간드의 결합에 의해 2차원적 구조가 안정화되거나 3차원적으로 구조 변화가 생기는 것이라면 제한없이 포함될 수 있으며, 예를 들어 부분적인 듀플렉스(duplex) 구조를 가지는 것일 수 있다. 또한, 현재까지 알려진 스템-루프 구조의 질환 표적 RNA들로서 MicroRNA(예를 들어, miR-21, miR-96)가 있고, MALAT1 RNA는 삼중나선(Triplex) 구조를 가진 항암 표적으로 알려져 있다. 이들 모두 약물과 결합하여 다양한 구조변화를 유도하므로 RNA 매개 질환 치료의 유망한 타겟들이다.
구체적인 실시예에서, 상기 표적 RNA는 박테리아의 생존에 필요한 유전자의 발현을 조절할 수 있는 부위를 포함할 수 있고, 구체적으로 박테리아 유래의 리보스위치(riboswitch)의 전부 또는 일부 영역 일 수 있고, 리간드가 결합 할 수 있는 앱타머 도메인을 포함하는 것이라면 제한없이 포함될 수 있으며, 예를 들어 서열번호 1 내지 3으로 이루어진 군에서 선택되는 어느 하나로 표시되는 염기서열을 포함하는 것일 수 있다.
상기 “리보스위치(riboswitch)”는 세포 내에서 특정 대사산물 등의 저분자 물질이 특이적으로 결합할 수 있는 mRNA의 조절부위를 의미하며, 리보스위치는 상기 특정 대사산물의 농도를 감지하여 하류에 위치한 mRNA에 의해 코딩된 유전자의 발현량을 조절하는 생체 센서로 작용한다. 즉, 상기 리보스위치에 특정 물질(예컨대 대사산물)의 결합 여부에 따라 이 mRNA로부터 단백질이 합성되는 정도가 조절된다. 리보스위치는 개념적으로 크게 앱타머 도메인(aptamer domain)과 발현 플랫폼 도메인(expression platform domain)으로 구분되는데, 상기 앱타머 도메인은 특정 물질에 직접 결합하는 부위이고, 상기 발현 플랫폼 도메인은 앱타머 도메인의 변화에 반응하여 구조적 변화가 발생하는 부위이다. 상기 리보스위치는 예를 들어, 아데닌 리보스위치와 구아닌 리보스위치를 포함하는 퓨린 리보스위치, 라이신 리보스위치, 사이클릭 디-GMP 리보스위치, glmS 리보스위치, TPP 리보스위치, 및 FMN 리보스위치 등 일 수 있다.
구체적인 실시예에서, 상기 표적 RNA는 바이러스 RNA 중에서 보존 서열(conserved sequence)의 전부 또는 그 일부 일 수 있고, 예컨대, 서열번호 4 또는 서열번호 5의 염기서열을 포함하는 것일 수 있다. 구체적으로, 상기 보존 서열은 프로모터 서열일 수 있고, 유행성 바이러스의 다양한 변이체에서도 고도로 보존되어 있으므로 이를 표적으로 하여 전사를 개시하거나 조절하는 약물을 스크리닝 할 수 있다.
상기 “RNA 표적의 약물(RNA-targeting drugs)”은 RNA를 표적으로 하는 약물을 의미하고, 표적 RNA에 특이적으로 결합하여 표적 RNA의 2차원적 또는 3차원적 구조 변화를 일으켜 표적 RNA의 기능을 억제하는 것이라면 제한없이 포함될 수 있으며, 예를 들어, 핵산, 단백질, 펩티드 및 화합물로 구성된 군으로부터 선택된 어느 하나의 분자일 수 있다.
상기 RNA 표적의 약물은 표적 RNA의 전사를 조절하여 RNA 매개 질환을 치료하는 것으로, 미생물 감염병, 암, 대사성 질환, 퇴행성 질환, 심혈관 질환, 폐질환, 면역질환을 포함한 다수의 RNA 매개 질환의 치료에 관여할 수 있다. 예를 들어, 항암 표적으로 알려진 MALAT1 RNA를 표적으로 하는 약물은 암의 치료에 관여할 수 있다. 따라서, 상기 RNA 표적의 약물은 항암제, 대사질환 치료제, 퇴행성 질환 치료제, 심혈관 질환 치료제, 폐질환 치료제, 면역질환 치료제, 항균제, 항생제 또는 항바이러스제 일 수 있다.
구체적인 실시예에서, 상기 RNA 표적에 결합하는 약물은 박테리아 리보스위치의 앱타머 영역에 결합할 수 있는 저분자 화합물일 수 있다. 상기 저분자 화합물은 표적 리보스위치에 결합함으로써 전사와 번역의 기능을 조절할 수 있고, 예를 들어 박테리아에서 발견되는 리보스위치를 표적으로 하는 리간드일 수 있다. 상기 리간드가 항생제의 내성 균주에 존재하는 리보스위치와 결합하는 리간드일 경우 항생제의 내성을 극복할 수 있는 새로운 항생제 후보물질이 될 수 있다.
구체적인 실시예에서, 상기 RNA 표적의 약물은 RNA 바이러스의 보존 서열에 결합하는 저분자 화합물 일 수 있다. 상기 저분자 화합물은 RNA 바이러스의 프로모터에 결합하여 전사와 번역 기능을 조절함으로써 RNA 바이러스 매개 질환을 치료할 수 있다.
본 발명의 용어, ”후보 물질”은 표적 RNA에 결합할 것으로 예상되는 모든 물질을 의미하며, 예를 들어 저분자 화합물, 단백질, 올리고펩티드, 다당류, 폴리뉴클레오티드 등의 임의의 분자일 수 있다. 이러한 후보물질은 천연 물질뿐만 아니라 합성 물질을 모두 포함한다.
본 발명에서 “RNA-리간드 복합체” 또는 “RNA-약물 복합체”는 표적 RNA 및 이의 리간드 또는 표적 약물이 서로 결합하여 형성된 복합체를 의미하고, 본 명세서에서는 동등한 의미로 상호교환적으로 사용되며, 복합체 형성시 결합의 방법이나 위치, 복합체의 크기 등의 제한없이 전하를 가지는 것이라면 제한없이 포함된다.
본 발명에서 RNA-약물 복합체는 단일 또는 이중 전류 차단 세기 피크 및 실질적으로 증가된 체류 시간을 갖는 특징적인 나노포어 이벤트 형태를 나타내므로, 이와 같은 나노포어 이벤트를 분석하여 표적 RNA에 결합하는 약물의 검출이 가능함이 확인되었다. 따라서, 본 발명의 RNA 표적의 약물 스크리닝 방법을 통하여 질병과 관련된 RNA를 표적으로 하는 약물을 스크리닝 하는데 유용하게 활용될 수 있다
상기 “전기적 신호”는 막에 의해 분리된 어느 한 구획에서 다른 구획으로, 예컨대 제1 구획에서 제2 구획으로 이온 및/또는 전하를 띠는 저분자 물질이 통과하면서 이온의 흐름이 방해가 되어 발생되는 신호를 의미하고, 구체적으로 열린 포어 전류(open pore current: I 0), 전류 하강의 크기(ΔI), 체류 시간(dwell time), 나노포어 이벤트 형태(event conformation) 등일 수 있다. 상기 열린 포어 전류는 분석물은 존재하지 않고 나노포어만 존재하는 상태의 전류로써, 기본 수준(basal level)을 의미한다.
상기 “전류 하강의 크기(ΔI)”는 나노포어를 통한 전류 차단 세기(current blockade)로도 칭할 수 있고, 구체적으로, "전류 하강의 크기(ΔI =I-I 0)"는 분석물에 대한 전류 차단 세기(I)에서 열린 포어 전류에 대한 전류 차단 세기(I 0)의 차이를 의미한다.
상기 “체류 시간”은 분석물이 나노포어를 통과하는데 소요되는 시간, 또는 나노포어 입구 및/또는 내부에 체류하는 시간을 의미한다.
상기 “나노포어 이벤트 형태”는 분석물이 나노포어를 통과하면서 나타나는 전류 피크의 형태를 의미하고, 예컨대, 피크의 형태, 피크의 발생 비율 또는 이들의 조합으로 표현될 수 있다.
상기 “스크리닝”은 샘플들 또는 후보물질들 중에서 바람직한 감수성 또는 활성을 갖는 화합물을 가능한 최소의 단계를 거쳐 추출, 분리 및 확인하는 프로세스를 의미하고, 구체적으로 표적 RNA에 결합하는 약물을 스크리닝하여 발굴하는 것을 목적으로 한다.
상기 표적 RNA에 결합하는 약물을 스크리닝하는 방법은 표적 RNA가 약물과 결합하여 형성된 RNA-약물 복합체의 존재 여부를 검출하는 것일 수 있다.
상기 RNA-약물 복합체의 검출은 표적 RNA에 약물이 결합되어 나타나는 RNA의 2차원적 또는 3차원적 구조 변화 및/또는 일시적인 구조 변화를 포함하는 동역학적 변화를 전기적 신호로 측정 및 비교하여 검출하는 것일 수 있다. 구체적으로 상기 표적 RNA와 후보 물질의 반응 전후에 전기적 신호의 변화가 나타나는 경우 RNA-약물 복합체가 형성된 것으로 판단할 수 있다.
상기 “전기적 신호의 변화가 나타나는 경우”는 상기 표적 RNA와 후보 물질의 반응 전후의 체류 시간(dwell time) 및/또는 나노포어 이벤트 형태(event conformation)가 달라지는 경우를 의미하고, 구체적으로 나노포어 체류 시간이 후보 물질의 처리 후에 증가하거나, 후보 물질 처리 후에 새로운 나노포어 이벤트 형태가 나타나는 것을 의미할 수 있다. 상기 체류 시간의 증가는 구체적으로 반응 전과 비교하여 1.1배 이상, 1.3 배 이상, 1.5배 이상, 1.8배 이상, 2배 이상, 3배 이상, 5배 이상 또는 8배 이상의 증가일 수 있고, 상기 새로운 나노포어 이벤트 형태가 나타나는 것은 후보 물질 처리 후에 단일 레벨의 전기적 신호가 이중 레벨의 전기적 신호로 변화하는 것일 수 있다.
본 발명의 스크리닝 방법은, 후보 물질이 표적 RNA에 결합하는 약물이면 표적 RNA와 결합하여 RNA-약물 복합체를 형성하게 되고, 상기 RNA-약물 복합체는 구조적으로 안정화되어 곧바로 나노포어를 통과하지 못하고 나노포어 내강에 캡쳐된 다음 언지핑(unzipping) 되는데 시간이 소요되어 나노포어에 체류하는 시간이 길어지게 될 것이므로, 후보 물질을 표적 RNA와 반응시키기 전과 후의 나노포어 체류 시간(dwell time)을 측정하여 반응 후 체류 시간이 증가할 때 상기 후보 물질이 표적 RNA에 특이적으로 결합하는 약물인 것으로 판단할 수 있다.
또한, 본 발명의 스크리닝 방법은, 후보 물질이 표적 RNA에 결합하는 약물이면 표적 RNA와 결합하여 RNA-약물 복합체를 형성하게 되고, 상기 RNA-약물 복합체는 곧바로 나노포어를 통과하지 못하고 나노포어 내강에 캡쳐된 다음 언지핑(unzipping) 되면서 구조가 변하게 되고, 이와 같은 구조의 변화에 따라 전류 레벨이 발생하게 되므로, 후보 물질을 표적 RNA에 처리하기 전과 후의 전기적 신호를 측정하여 반응 후 새로운 타입의 이벤트 형태가 나타나면 상기 후보 물질이 표적 RNA에 특이적으로 결합하는 약물인 것으로 판단할 수 있다.
본 발명의 일 실시예에서는 박테리아 유래의 RNA가 단독상태로 존재할 때는 단일단계의 타입-I 이벤트 형태만 나타났지만, RNA-약물 복합체로 존재할 때는 위 타입-I 이벤트뿐만 아니라 2단계 전류 레벨을 갖는 타입-II 이벤트 형태가 함께 나타나고, 나노포어 체류 시간의 경우에도 RNA 단독상태 보다 RNA-약물 복합체의 나노포어 체류 시간이 2배 이상 증가하는 것을 확인함으로써 나노포어 및 표적 RNA를 이용하여 특정 RNA를 표적으로 하는 약물을 발굴 할 수 있음을 확인하였다(도 2 및 3).
본 발명의 다른 실시예에서는 바이러스 유래의 RNA가 단독상태로 존재할 때 보다 RNA-약물 복합체로 존재 할 때 나노포어 체류 시간이 약물의 종류 및 농도에 따라 약 2배 내지 8배 이상 증가하는 것을 확인함으로써 나노포어 및 표적 RNA를 이용하여 특정 RNA를 표적으로 하는 약물을 발굴 할 수 있음을 확인하였다(도 13 및 14).
다른 측면에서, 본 발명은 나노포어를 이용한 항균제, 항생제 또는 항바이러스제의 스크리닝 방법에 관한 것이다.
본 발명의 항균제, 항생제 또는 항바이러스제의 스크리닝 방법은 (a) 표적 RNA가 나노포어를 통과하면서 발생하는 전기적 신호를 측정하는 단계; (b) 상기 표적 RNA에 결합할 것으로 기대되는 후보물질을 표적 RNA에 처리하고, 상기 표적 RNA가 나노포어를 통과하면서 발생하는 전기적 신호를 측정하는 단계; 및 (c) 상기 (a) 및 (b) 단계에서 측정된 전기적 신호를 비교하여 전기적 신호의 변화가 나타나는 경우 상기 후보물질을 리보스위치-표적 물질로 선별하는 단계;를 포함한다.
본 발명의 용어, “표적 RNA”, “RNA 표적의 약물”, “후보물질”, “나노포어”, “전기적 신호” 및 “스크리닝”은 상기에서 설명한 바와 같다.
본 발명의 일 실시예에서는 In silico 스크리닝을 통해 766개의 천연물 라이브러리로부터 40개의 후보물질을 1차적으로 선별하고, 이들에 대해 나노포어 기반의 약물 스크리닝을 수행한 결과 10% 이상의 타입-II 이동 이벤트가 관찰된 3개의 그룹을 선별하였다. 그 후 개별적인 나노포어 스크리닝을 통해 3개의 새로운 RNA 표적의 약물을 발굴하였으며, 발굴된 3,4-디카페오일퀴닉산(3,4-dicaffeoylquinic acid), 4,5-디카페오일퀴닉산(4,5-dicaffeoylquinic acid) 및 루테올린-7-글루쿠로니드(luteolin-7-glucuronide)은 모두 타입-II의 이동 이벤트 및 이중레벨 신호를 나타내고, RNA 단독 상태보다 2배 이상 큰 나노포어 체류 시간을 나타내는 것을 확인하였다.
또 다른 측면에서, 본 발명은 (i) 나노포어, (ii) 표적 RNA 및 (iii) 이온 전류와 체류 시간을 측정할 수 있는 구성을 포함하는 RNA 표적의 약물 스크리닝용 키트를 제공한다.
본 발명의 용어, “표적 RNA”, “RNA 표적의 약물”, “후보물질”, “나노포어”, “전기적 신호” 및 “스크리닝”은 상기에서 설명한 바와 같다.
본 발명의 RNA 표적의 약물 스크리닝용 키트는, 나노포어를 포함는 막(membrane)에 의해 상기 나노포어가 존재하는 공간이 두 개의 구획(compartment)(예컨대, 제1 구획 및 제2 구획, 또는 시스(cis) 구획 및 트랜스(trans) 구획)으로 나뉘어진 상태로 제공될 수 있다. 그리고, 상기 두 개의 구획 중, 어느 한 구획에 표적 RNA가 포함된 상태로 제공될 수 있다. 이렇게 제공되는 본 발명의 RNA 표적의 약물 스크리닝용 키트에, 상기 표적 RNA가 포함된 구획으로 표적 RNA에 결합할 것으로 예상되는 후보 물질을 공급하면, 상기 표적 RNA에 후보 물질이 결합하여 RNA-약물 복합체를 형성하게 되고, 상기 RNA-약물 복합체는 곧바로 나노포어를 통과하지 못하고 나노포어 내강에 캡쳐된 다음 언지핑(unzipping) 되는데 시간이 소요되어 나노포어에 체류하는 시간이 길어지게 될 것이므로, 후보 물질을 표적 RNA와 반응시키기 전과 후의 나노포어 체류 시간(dwell time)을 측정하여 반응 후 체류 시간이 증가할 때 상기 후보 물질이 표적 RNA에 특이적으로 결합하는 약물인 것으로 판단할 수 있다. 또한, 상기 RNA-약물 복합체가 곧바로 나노포어를 통과하지 못하고 나노포어 내강에 캡쳐된 다음 언지핑(unzipping) 되면서 구조가 변하게 될 경우, 이와 같은 구조의 변화에 따라 전류 레벨이 발생하게 되므로, 후보 물질을 표적 RNA에 처리하기 전과 후의 전기적 신호를 측정하여 반응 후 새로운 타입의 이벤트 형태가 나타나면 상기 후보 물질이 표적 RNA에 특이적으로 결합하는 약물인 것으로 판단할 수 있다. 즉, 후보 물질이 표적 RNA에 특이적으로 결합하는 약물이면 후보 물질 처리 전후에 걸쳐 전기적 신호가 변화하게 되고, 후보 물질이 표적 RNA에 특이적으로 결합하는 약물이 아니면 후보 물질 처리 전후에 걸쳐 전기적 신호가 변화하지 않게 되므로 표적 RNA에 특이적으로 결합하는 약물을 스크리닝 할 수 있는 것이다.
본 발명의 RNA 표적의 약물 스크리닝용 키트는 이온 전류, 전류 하강의 크기, 이벤트 입체 형태 또는 이벤트 지속시간을 측정할 수 있는 구성이 추가로 구비될 수 있다.
본 발명의 스크리닝 방법에 따르면, 극미량의 시료로도 특정 RNA를 표적으로 하는 약물을 효율적으로 스크리닝 할 수 있다. RNA를 표적으로 하여 발굴된 약물은 특정 RNA에 의해 조절되는 질병의 치료에 사용될 수 있다.
본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 아데닌에 의해 유도된 ARS의 3차원적 접힘을 NMR을 기반으로 분석한 결과를 나타낸 것이다: 도 1의 a는 아데닌에 의해 유도된 ARS의 3차원적 접힘 과정에서 ARS의 3가지 분자 상태; 도 1의 b는 50nM KCl 또는 1M KCl 존재 하에서 유리된 ARS 및 ARS-아데닌 복합체의 1D 1H NMR 스펙트럼.
도 2는 리간드를 사용하여 ARS 및 ARS-Mut의 나노포어 이벤트에 대한 통계 분석 결과를 나타낸 것이다: 도 2의 a는 ARS 단독상태에 대한 전류 강하 (I/I 0) 및 체류 시간 (t d) 히스토그램; 도 2의 b는 ARS-아데닌 복합체에 대한 전류 강하 (I/I 0) 및 체류 시간 (t d) 히스토그램; 도 2의 c는 아데닌의 구조 및 ARS 단독상태 와 아데닌이 결합된 ARS의 산점도(scatter plot); 도 2의 d는 ARS 단독상태-Mut에 대한 전류 강하 (I/I 0) 및 체류 시간 (t d) 히스토그램; 도 2의 e는 아데닌이 결합된 ARS-Mut에 대한 전류 강하 (I/I 0) 및 체류 시간 (t d) 히스토그램; 도 2의 f는 4개의 염기 돌연변이 (U28G, G42C, U47C 및 U51C)가 있는 ARS-Mut의 구조 및 ARS 단독상태-Mut 및 아데닌이 결합된 ARS-Mut 의 나노포어 이벤트 산점도.
도 3은 ARS-아데닌 복합체의 나노포어 이벤트에 대한 통계 분석 결과를 나타낸 것이다: 도 3의 a는 ARS-아데닌 복합체에 대한 두 가지 타입의 전류 트레이스(current trace); 도 3의 b는 타입 I 이벤트의 I/I 0 및 체류 시간 히스토그램; 도 3의 c는 타입 II 이벤트의 I/I 0 및 체류 시간 히스토그램; 도 3의 d는 복합체 및 ARS 단독상태에 대한 타입 I 및 타입 II 이벤트의 산점도; 도 3의 e는 ARS 단독상태, 중간체 및 복합체의 범핑(Bumping) 또는 통과(Translocation)에 대해 제안된 분자 모델.
도 4는 다수의 비-결합 화합물이 존재할 때 ARS와 아데닌의 특이적 상호작용에 대한 나노포어 측정 결과를 나타낸 것이다: 도 4의 a는 비-결합성 화합물의 혼합물이 아데닌 없이 있는 경우 ARS의 타입 I 이벤트에 대한 t I 가 있는 I/I 0 히스토그램; 도 4의 b는 비-결합성 화합물의 혼합물이 아데닌과 함께있는 경우, ARS의 타입 I 이벤트에 대한 t I 가 있는 I/I 0 히스토그램; 도 4의 c는 아데닌 및 MIX-3의 존재 하에 ARS의 타입 II 이벤트에 대한 t II가 있는 I/I 0 히스토그램; 도 4의 d는 MIX-3만 포함하는 ARS MIX-3 및 아데닌을 포함하는 ARS의 타입 I 이벤트 및 타입 II 이벤트의 I/I0 히스토그램 비교; 도 4의 e는 ARS와 아데닌의 특이적 상호작용의 나노포어 이동에 대한 개략적 모델.
도 5는 ARS RNA에 대한 나노포어 기반 약물 스크리닝 접근 방식을 나타낸 것이다: 도 5의 a는 히트 화합물 (NC1, NC2 및 NC4)이 존재할 경우 ARS에 대한 나노포어 이벤트의 전류 트레이스로 히트 화합물과 함께 ARS에서 감지된 대표적인 타입 II 이벤트(별표 표시됨)가 오른쪽 열에 표시됨; 도 5의 b 내지 d는 각각의 히트 화합물(NC1 (b), NC2 (c) 및 NC4 (d))의 결합에서 생성된 ARS의 타입 II 이벤트에 대한 I/I 0 및 체류 시간 (t II) 히스토그램; 도 5의 e는 ARS 존재 하에서 히트 화합물 및 ARS 비-결합 화합물 (NC11 및 NC12)의 1D CPMG NMR 분석 결과로서 실선 및 점선은 각각 ARS의 부재 및 존재시 천연물의 1D CPMG 스펙트럼을 나타냄.
도 6은 인가 전압의 증가에 따른 이벤트 체류 시간의 변화를 나타낸 것이다: 도 6의 a는 ARS 단독상태의 타입 I 이벤트의 인가 전압(+100 mV, +120 mV, +140 mV 및 +160 mV)에 따른 체류 시간; 도 6의 b는 ARS-아데닌 복합체의 인가 전압 (+80 mV, +100 mV 및 +120 mV)에 따른 체류 시간으로 타입 I 및 타입 II 이벤트는 각각 삼각형과 사각형으로 표시되고, 오차 막대는 표준 오차를 나타냄.
도 7은 MIX-3에서 천연 화합물의 비-결합 능력을 1D-CPMG로 분석한 것이다: 실선 및 점선은 각각 ARS 부재 및 존재시 화합물의 1D CPMG 스펙트럼을 나타냄.
도 8은 실험예 6을 통해 발굴한 ARS 표적 화합물의 화학 구조를 나타낸 것이다.
도 9는 TPP 리보스위치 및 TPP에 의해 유도된 TRS의 3차원적 접힘을 나타낸 것이다.
도 10은 TRS 단독상태 및 TRS-TPP 복합체의 나노포어 이벤트를 나타낸 것이다: (a) TRS 단독상태 및 TRS-TPP 복합체에 대한 전류 트레이스 기록(current trace); (b) 두 가지 형태의 나노포어 이벤트.
도 11은 TRS 단독상태 및 TRS-TPP 복합체의 나노포어 이벤트에 대한 통계 분석 결과를 나타낸 것이다: (a) TRS 단독상태 및 TRS-TPP 복합체에 대한 타입 I 이벤트 및 타입 II 이벤트의 산점도; (b) TRS 단독상태 및 TRS-TPP 복합체에 대한 총 이벤트; (c) 타입 I 이벤트의 체류 시간 히스토그램; (d) 100~140mV의 인가 전위에서 TRS 단독상태 및 TRS-TPP 복합체의 타입 I 이벤트에서 체류 시간의 전압 의존성을 나타낸 것으로, 타입 I 이벤트에서 인가 전위가 증가함에 따라 체류 시간이 거의 동일하거나 증가하는 것을 확인함.
도 12는 TRS 단독상태 및 TRS-TPP 복합체의 타입 II 이벤트에 대한 통계 분석 결과를 나타낸 것이다: (a) 타입 II 이벤트의 체류 시간 히스토그램; (b) 100~140mV의 인가 전위에서 TRS 단독상태 및 TRS-TPP 복합체의 타입 II 이벤트에서 체류 시간의 전압 의존성을 나타낸 것으로, 타입 II 이벤트에서 인가 전위가 증가함에 따라 체류 시간이 감소되는 것을 확인함.
도 13은 5 '말단 리더 서열을 사용하여 IAV RNA에 대한 나노포어 기반 RNA-약물 복합체의 검출 방식을 나타낸 것이다: (A) 5 '말단 리더 서열을 갖는 IAV RNA의 2 차 구조 및 저분자 6,7- 디메톡시-2-(1-피페라지닐)-4-퀴나졸린아민(DPQ), (B) 100mV에서 5 ' 말단 리더 서열을 갖는 IAV RNA에 결합하는 DPQ를 이용한 IAV RNA의 검출, (C) 5'L-iav-RNA 단독상태 및 5'L-iav-RNA/DPQ 복합체의 증가된 결합 비율에 대한 체류 시간 및 전류 기록의 히스토그램, (D) IAV RNA와 DPQ 복합체의 감지를 위한 다이어그램.
도 14는 나노포어를 사용하여 5'L-iav-RNA에 결합한 네오마이신의 검출 방식을 나타낸 것이다: 5'L-iav-RNA 단독상태 및 5'L-iav-RNA/네오마이신 복합체(1:50 비율)에 대한 체류 시간의 산점도 및 히스토그램.
도 15은 3 '말단 리더 서열 (3'L-iav-RNA)을 사용하여 IAV RNA에 대한 나노 포어 기반 RNA-약물 복합체 검출 방식을 나타낸 것이다: (A) 3'L-iav-RNA/DPQ 프로브 복합체 구조 모델 (B) 3'L-iav-RNA 단독상태 및 3'L-iav-RNA/DPQ 복합체에 대한 체류 시간 및 전류 차단(current blockade)의 히스토그램 (몰 비율 1 내지 50) (C) +140 mV의 인가 전압에서 나노포어 로우 데이터(Raw data)를 나타낸 것이다.
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다. 단, 하기 실시예 및 실험예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
[실시예 1]
Class I RNA 표적: Long P1 stem을 가진 리보스위치
<1-1>. ARS RNA 및 단백질 나노포어의 준비
RNA는 Integrated DNA Technologies(Coralville, IA, USA)에서 합성되었다. 염기서열 정보는 아래 표 1에 표기하였다. 모든 RNA 10mM 인산칼륨(pH6.2) 버퍼에 대하여 12시간 이상 투석시켰다. RNA 95℃에서 5분 동안 가열한 후, 얼음에서 빠르게 냉각시켜 어닐링(annealing)하였다. 나노포어 실험은 10 ~ 500 nM RNA 농도에서 수행하였다. α-헤몰리신(α-hemolysin, αHL) 단백질은 List Biological Laboratories Inc.(Campbell, CA, USA)에서 구입하였다. DPhPC(1,2-diphytanoylsn-glycero-3-phosphocholine)는 Avanti Polar Lipids(Alabaster, AL, USA)에서 구입하였다.
이름 염기서열 (5'->3') 길이 서열번호
ARS GGC UUC AUA UAA UCC UAA UGA UAU GGU UUG GGA GUU UCU ACC AAG AGC CUU AAA CUC UUG AUU AUG AAG UC 71 nt 1
ARS-Mut GGC UUC AUA UAA UCC GAA UGA UAU GGU UUC GGA GCU UCC ACC AAG AGC CUU AAA CUC UUG AUU AUG AAG UC 71 nt 2
<1-2>. 리간드에 의해 유도된 ARS의 구조 변화 확인
먼저, NMR 분석을 통해 리간드가 리보스위치에 결합함에 따라 리보스위치의 구조가 3차원적으로 변화하는 것을 아데닌-센싱 리보스위치(Adenine-sensing riboswitch, ARS)와 아데닌을 이용하여 확인하였다.
ARS는 박테리아 퓨린 대사에 필수적인 아데노신 탈아미노화효소(adenosine deaminase, ADD)의 번역을 조절한다. 비브리오 불니피쿠스(Vibrio vulnificus)의 ARS의 앱타머 도메인은 3개의 나선형 줄기 (P1-P3), 2개의 헤어핀 루프 (L2 및 L3) 및 3개의 결합 부위 (J1-2, J3-1 및 J2-3)로 구성된다 (도 1의 a). ARS는 단독상태(free state)에서는 유연하지만 아데닌에 결합하면 튜닝포크(tuning-fork)와 같은 3차 구조로 접힌다. 중간상태(intermediate state)를 통해 복합체의 3차 구조는 아데닌 결합 부위의 새로운 염기 삼중체 형성과 루프 L2와 L3 사이의 수소 결합을 통해 안정화 된다(도 1의 a). ARS는 박테리아 퓨린 대사의 번역을 제어한다.
구체적으로, 아데닌 결합에 의해 유도되는 ARS의 3차원적 접힘(tertiary folding)을 모니터링하기 위해 아데닌이 부재 또는 존재하는 상태에서 ARS로 1D NMR 실험을 수행했다. ARS-아데닌 복합체(ARS-adenine complex)는 ARS가 3차원적으로 접히는 동안 새로운 수소 결합 형성에 의해 생성된 U31, U39, U47 및 U49의 4가지 특징적인 이미노 양성자 피크를 나타냈다. 아데닌 결합시 U31-U39의 비정규 염기쌍이 형성되었으며, 이는 L2와 L3 루프 사이의 장거리 3차 상호 작용에 중요하다(도 1). 또한 새로운 수소가 추가되었다. 아데닌 결합 부위의 결합 네트워크는 U47 및 U49 이미노 양성자 피크를 생성했다. NMR 분석은 ARS에 대한 아데닌의 결합이 극적인 구조적 재배열을 유도하고 복합체의 3차 구조를 실질적으로 안정화시키는 것으로 나타났다. 나노포어 측정에 앞서 ARS는 복합체의 4가지 특징적인 이미노 양성자 피크를 검출하여 높은 염 농도 (1M KCl)에서도 아데닌에 결합함을 확인했다(도 1의 b).
<1-3>. 나노포어를 이용한 ARS 구조 변화 검출가능성 확인
α-헤모라이신(α-hemolysin, α-HL) 나노포어를 사용하여 리보스위치와 리간드의 상호작용을 단일분자 수준에서 검출할 수 있는지 확인하였다.
구체적으로, 10mM 인산칼륨(pH 6.2), 2mM MgCl2 및 1M KCl을 포함하는 버퍼 상에서 ARS 단독상태(free ARS) 또는 ARS-아데닌 복합체(ARS-adenine complex)를 단일의 αHL 나노포어가 있는 지질 이중층의 cis면에 추가했다. 나노포어에 (+) 100mV의 전압을 걸어주면 ARS 단독상태 또는 ARS-아데닌 복합체가 전기 영동으로 구동되어 이온 전류가 차단된다. ARS 단독상태와 ARS-아데닌 복합체의 나노포어 이벤트를 통계적으로 분석했다 (도 2의 a 내지 c). ARS 단독상태의 나노포어 이벤트는 평균 체류 시간 (dwell time, t d)이 0.38 ms인 0.69 및 0.86의 두 가지 평균 전류 차단 (I/I 0 )을 나타냈다(도 2의 a). 특히, ARS-아데닌 복합체는 I/I 0값 (0.69 및 0.87)과 ARS 단독상태보다 유의적으로 증가한 평균 t d d (0.63 ms)를 가진 전류 차단을 생성했다(도 2의 b).
다음으로, 4개의 염기 돌연변이 (U28G, G42C, U47C 및 U51C)가 있는 ARS 돌연변이 (ARS-Mut)를 사용하여 나노포어 이벤트를 측정하여 ARS-아데닌 결합을 방해했다 (도 2의 d 내지 f). ARS-Mut의 I/I 0 (0.68 및 0.82) 및 t d (0.50ms) 값은 ARS 단독상태-Mut의 값과 크게 다르지 않았다 (도 2의 d 내지 e). 또한, 아데닌이 있는 ARS-Mut의 산점도는 ARS 단독상태-Mut의 분포와 매우 유사한 분포를 보여주었다(도 2의 f).
이로부터, ARS-아데닌 복합체에서 관찰된 체류 시간의 유의적인 증가는 ARS와 아데닌의 특이적인 상호작용에 의한 것이며, 이를 나노포어를 이용하여 검출할 수 있음을 알 수 있다.
<1-4>. 부분적으로 접힌 ARS 중간체의 특징적인 나노포어 이벤트 확인
ARS-아데닌 복합체로부터 두 가지 타입의 특징적인 전류 차단 이벤트를 관찰하였다.
구체적으로, ARS 단독상태는 단일레벨의 이온 전류 차단이 있는 타입 I 이벤트만 보였지만 ARS-아데닌 복합체는 타입 I 및 타입 II의 이벤트가 섞여서 이중레벨의 전기신호가 관측되었다(도 3의 a). 타입 II 이벤트는 구별되는 지속시간 (t II1 및 t II2)과 함께 두 가지 전류 레벨 (I II1 및 I II2로 지칭 됨)의 특징적인 패턴을 보였으며, 이는 이들이 아데닌이 결합된 ARS RNA에서 발생했음을 나타낸다. 타입 II 이벤트의 레벨 1 (I II1)의 평균 I/I 0 값은 0.45로 레벨 2 (I II2)의 약 50 %에 해당한다. 이후 복합체의 타입 I 및 II 나노포어 이벤트를 분리한 후 각 타입의 이벤트를 통계적으로 분석했다. ARS-아데닌 복합체의 타입 I 및 II 이벤트는 I/I 0 의 평균 값과 체류 시간에서 차이가 있었다 (도 3의 b 내지 c). 특히, 체류 시간은 타입 II 이벤트(t II, 2.14ms)가 타입 I 이벤트 (t I, 0.28ms) 보다 더 길게 측정되었으며, 현저한 차이를 나타내었다. 또한, 타입 I 및 II 이벤트의 산점도는 명확하게 구별되는 분포를 나타냈다 (도 3의 d).
이로부터, ARS-아데닌 복합체에서 관찰된 특징적인 전류차단 이벤트를 이용하여 리보스위치와 리간드의 상호작용을 나노포어를 이용하여 검출할 수 있음을 알 수 있다.
<1-5>. 나노포어를 이용한 ARS 구조 변화 검출 모델의 구축
실시예 1-3 및 1-4에서 분석한 나노포어 데이터를 기반으로 리보스위치 단독 및 리간드-결합 리보스위치의 나노포어 이벤트에 대한 분자모델을 구축하였다 (도 3e).
아데닌에 의해 유도된 ARS RNA의 3차원적 접힘이 진행되는 동안 3가지 분자 상태 (ARS 단독, 중간체 및 ARS-아데닌 복합체)가 생성될 수 있다. 평활말단(Blunt end) A형 RNA 듀플렉스(Duplex)는 A형 듀플렉스의 직경이 크기 때문에 α-HL 나노포어를 통과하지 못한다는 것이 알려져 있다. 따라서 ARS 단독상태는 짧은 평균 체류 시간 (0.38ms)과 단일레벨 전류 차단으로 빈번한 범핑(Bumping) 신호를 발생시킨다(도 2의 a). 마찬가지로, 접힘 공정의 최종 생성물인 안정된 평활말단의 P1 스템(Stem)을 가진 ARS-아데닌 복합체는 포어에 들어갈 수 없으므로 평균 t I가 0.28ms 인 타입 I 범핑 이벤트가 발생한다 (도 3의 b).
ARS 단독 또는 복합체와는 달리, 유연한 말단 스템과 준안정(Matastable) 상태의 2차 구조를 가지는, 부분적으로 접힌 ARS 중간체는 두 단계 공정을 통해 나노포어를 통과 할 수 있다. 1단계는 아데닌-결합 ARS의 2차 구조를 포착하고 단일 가닥으로 언지핑(unzipping)하는 것이다 (도 3의 e). 서브-체류 시간 t II1 동안, 아데닌-결합 ARS의 나선형 듀플렉스가 α-HL 나노포어의 통로(vestibule) 외부에서 염기쌍이 풀리는 언지핑(unzipping)이 일어난다. ARS의 언지핑 과정이 완료되면 2단계에서 나노포어를 통과하는 과정을 거치게 된다. 서브-체류 시간 t II2 동안 나노포어에서 즉시 방출된다 (도 3의 e, 중간 컬럼). 전압-의존적인 나노포어 검출을 통해 타입 II 이벤트가 포어 통과(translocation)의 결과임을 확인하였다. 복합체에서 발생하는 타입 II 이벤트는 인가 전압이 증가함에 따라(+80mV에서 +120mV으로) 체류 시간이 크게 감소한 것으로 나타났다(도 6). 이는 분석물이 나노포어를 통과함을 나타낸다.
타입 II 나노포어 통과 이벤트(translocation event)와 달리 ARS 단독 및 복합체의 타입 I 이벤트는 인가 전압이 증가해도 유사한 체류 시간을 나타내었다.
종합하면, 아데닌-결합 ARS는 2단계 이온 전류 차단과 타입 I 이벤트 보다 ~ 7.64배 더 긴 체류 시간 (2.14ms)으로 타입 II 이동 신호를 생성한다. 이러한 상당한 시간의 지연은 유연한 말단 스템을 사용하여 아데닌-결합 중간체의 듀플렉스의 단일가닥으로 분리 즉, 언지핑 (Unzipping)의 결과로 발생할 수 있다.
이로부터, 단일 분자 기반 나노포어 센서가 리간드 결합-커플링된 RNA 접힘 경로에서 생성된 일시적이고 부분적으로 접힌 중간체를 감지하는데 유용한 플랫폼임을 알 수 있다.
<1-6>. 나노포어 기반의 약물 스크리닝 가능성 확인
리보스위치와 리간드의 상호작용을 나노포어로 검출함으로써 약물을 스크리닝 할 수 있는지 확인하고자 하였다. 또한, 여러 성분의 천연물이 포함된 상태에서도 리보스위치와 리간드의 특이적 결합을 검출할 수 있음을 확인하였다.
구체적으로, 아데닌의 부재 또는 존재 하에서 ARS에 결합하지 않는 비-결합 화합물 (MIX-3: ATP, (-)-에피카테킨 및 트라미프로세이트)의 혼합물을 이용하여 나노포어 측정을 수행하였다 (도 4). MIX-3은 타입 I 이벤트만 생성했으며 평균 I/I 0 이 0.69 및 0.87이고 상대적으로 짧은 t d (0.31ms)를 나타내었다. 이는 MIX-3이 ARS에 결합하여 삼차원적 구조변화를 유도하지 않음을 의미한다(도 4의 a). MIX-3에서 각 화합물의 비-결합 능력은 리간드 관찰 NMR 스크리닝 기법인 1D CPMG에 의해 추가적으로 확인하였다 (도 7)
그러나 MIX-3에 아데닌을 첨가하면 타입 I 및 타입 II 이벤트가 혼합되어 나타났으며, 후자는 ARS 단독상태 보다 나노포어 체류 시간 (t II, 2.52ms)이 ~ 6.6 배 더 증가하였다 (도 4의 c).
이로부터, 타입 II 통과 이벤트의 특징적인 깊은 전류 차단은 ARS에 대한 약물 결합을 식별하고 체류 시간을 늘리는 데 사용할 수 있음을 알 수 있다. 또한, ARS에 대한 아데닌의 특이적 결합은 여러 물질을 포함하는 복잡한 샘플에서도 나노포어에 의해 검출될 수 있음을 알 수 있다(도 4의 e).
<1-7>. ARS 구조 변화 검출 모델을 이용한 약물 스크리닝
실시예 1-5의 구조 변화 검출 모델을 이용하여 나노포어 기반의 약물 스크리닝을 수행하였다.
구체적으로, Discovery Studio 소프트웨어 내의 LibDock 및 CDOCKER 프로그램을 사용하여 ARS에 대한 항생제 약물의 인 실리코(in silico) 스크리닝을 수행하였다. 766 개의 천연물로 구성된 라이브러리에서 LibDock 및 CDOCKER 계산상의 도킹 점수(docking score)가 가장 높거나 상호작용 에너지가 가장 낮은 40개의 천연물을 1차적으로 선별했다 (표 2).
화합물 LibDock 점수 (kcal/mol) 화합물 CDOCKER 상호작용 에너지 (kcal/mol)
NC1 172.57 NC21 -54.58
NC2 172.57 NC22 -38.16
NC3 161.69 NC23 -36.87
NC4 158.44 NC24 -35.56
NC5 158.18 NC25 -29.35
NC6 155.07 NC26 -28.95
NC7 152.2 NC27 -28.18
NC8 151.41 NC28 -25.3
NC9 148.99 NC29 -25.01
NC10 144.52 NC30 -23.55
NC11 143.68 NC31 -23.51
NC12 143.68 NC32 -22.77
NC13 143.11 NC33 -22.76
NC14 139.99 NC34 -22.02
NC15 139.43 NC35 -21.23
NC16 136.68 NC36 -21.04
NC17 136.68 NC37 -20.41
NC18 134.68 NC38 -20.41
NC19 134.37 NC39 -20.18
NC20 134.37 NC40 -19.66
40개의 천연물들을 각각 4 개의 천연물로 구성된 10 개 그룹으로 나누어 나노포어 기반 약물 스크리닝을 수행하였다. 나노포어 스크리닝 결과에서 10 % 이상의 타입 II 특이적 이동 이벤트(translocation event)를 가진 3 개의 그룹을 선별하였다. 이후 선별된 그룹의 각 개별 화합물에 대한 후속 나노포어 기반 스크리닝을 통해 최종적으로 3개의 새로운 ARS 표적-천연물 히트를 발굴하였다(도 8). NC1 (3,4-디카페오일퀸산), NC2 (4,5-디카페오일퀸산) 및 NC4 (루테올린-7-글루쿠로나이드)의 히트 화합물들은 모두 타입 II의 이동 이벤트와 ARS 단독상태보다 4.1~7.3배 이상 큰 체류 시간을 나타내었다 (도 5의 a 내지 d). 히트 천연물들이 ARS에 결합하는지 확인하기 위하여 NMR 분광법을 사용하여 ARS의 부재 또는 존재 하에 3개의 히트 화합물로 1D CPMG 실험을 수행했다. ARS와 결합하지 않는 천연물(NC11 및 NC12)과 달리 NC1, NC2 및 NC4는 ARS를 추가한 후 1D CPMG 스펙트럼에서 극적인 피크라인 확장(peak line-broadening) 및/또는 상당한 화학적 이동(chemical shift) 변화를 보여 ARS가 히트 천연물들과 확실히 결합함을 확인하였다 (도 5의 e). 특히 NC1과 NC2는 새로운 항생제 약물에 대한 공통 스캐폴드를 공유함을 확인하였고, 3가지 히트 화합물은 모두 항균 활성 또는 항염증 활성을 갖는 약초에서 유래한다는 것을 확인하였다: Lonicera japonica (NC1 및 NC2) 및 Marchantia berteroana (NC4).
이로부터, 본 발명의 나노포어 기반의 약물 스크리닝 기술은 질환과 관련된 다양한 RNA 표적들로 확대하여 적용할 수 있고, 단일 성분으로 사전 분류 할 필요없이 다 성분 천연물을 고효율로 단시간 내에 스크리닝 할 수 있음을 알 수 있다.
[실시예 2]
Class II RNA 표적: Short P1 stem을 가진 리보스위치 표적
<2-1>. TRS RNA의 준비
TPP 리보스위치(Thiamine pyrophosphate-sensing riboswitch 또는 Thi-box riboswitch, TRS)는 티아민 피로인산염(thiamine pyrophosphate, TPP)이 직접적으로 결합하여 박테리아, 고세균류, 곰팡이류 및 식물들에서 다양한 메커니즘을 통해 유전자 발현을 조절하는 인자이다. TRS는 thiamine과 이것의 phosphorylated derivatives의 합성 또는 이동에 연관된 유전자를 조절한다. TRS는 5개의 나선형 줄기 (P1-P5), 2개의 헤어핀 루프 (L3 및 L5) 및 3개의 결합 부위 (J2/4, J3/2 및 J4/5)로 구성된다.
TRS RNA는 Integrated DNA Technologies(Coralville, IA, USA)에서 합성되었으며, 염기서열 정보는 아래 표 2에 표기하였다. TRS RNA 는 10mM 인산칼륨 (pH 6.2), 50 mM KCl 버퍼에 대하여 12시간 이상 투석시켰다. TRS RNA 는 95 °C 에서 5분간 가열한 후, 상온에서 서서히 냉각시켜 어닐링 (annealing) 하였다. 나노포어 실험은 500 nM 농도에서 수행하였다.
이름 염기서열 (5'->3') 길이 서열번호
TRS GCGACU CGGGG UGCCC UUCUG CGUGA AGGCU GAGAA AUACC CGUAU CACCU GAUCU GGAUA AUGCC AGCGU AGGGA AGUCGC 82 nt 3
<2-2>. TRS의 구조 변화 검출 모델 구축
α-hemolysin 나노포어를 사용하여 TRS 단독상태와 리간드의 상호작용을 단일분자 수준에서 검출할 수 있는지 확인하였다.
구체적으로, 10 mM 인산칼륨 (pH 6.2), 2mM MgCl2 및 1M KCl을 포함하는 버퍼상에서 500 nM의 TRS 단독상태 (free TRS) 를 αHL 나노포어가 있는 지질 이중층의 cis 면에 추가했다. 나노포어에 (+) voltage 전압을 걸어주었을 때 TRS가 전기 영동으로 구동되어 이온 전류가 차단 되는 모습을 관측하였다. 이러한 TRS 단독상태의 나노포어 이벤트들을 통계적으로 분석한 결과 평균적으로 포어에 체류하는 시간 (dwell time)은 0.28 ms 로 측정되었다 (도 11의 b).
TRS 단독상태로부터 두 가지 타입의 특징적인 전류 차단 이벤트롤 관찰하였다. TRS 단독 상태는 단일레벨의 이온전류 차단이 있는 타입-Ⅰ이벤트와 이중레벨의 타입 Ⅱ 이벤트가 섞여서 관측되었다. 이는 TRS 단독상태일 때, P1 stem의 염기쌍이 6쌍으로 상대적으로 짧아 수용액 내에서 불안정한 말단을 가지고 있어서 나타나는 현상이다. TRS 단독상태에서 나타나는 전기신호 중 타입-Ⅰ이벤트의 경우 포어에 체류하는 시간의 평균값이 0.26 ms 로 측정되었고, 타입-Ⅱ 이벤트의 체류시간의 평균값은 3.39 ms 로 타입 Ⅰ 이벤트에 비해 상대적으로 길게 측정되었다 (도 11의 c 와 도 12의 a).
TRS는 TPP 리간드가 결합함에 따라 3차원적 구조변화 (ligand-dependent folding)를 일으키는데, TPP의 피리미딘 부분이 P2와 P3 나선형 줄기와 intercalation 포켓을 형성하고, 또 다른 나선형 줄기인 P4와 P5가 TPP의 pyrophosphate 부분과의 water-lined 결합을 제공한다. 따라서, TRS 단독구조에 비해 TRS-TPP 복합체의 구조는 compact 하고 rigid한 접힘 구조를 가진다. 이러한 TRS의 TPP 리간드 결합에 의한 3차원적 구조변화는 중간상태 (intermediate state) 구조를 통해 최종적인 TRS-TPP 복합체를 형성한다. 이러한 transient한 중간상태 구조는 나노포어 기반 분석에서 관찰이 가능하다. TRS 단독상태와 TRS-TPP 복합체 형성 전 단계인 중간상태의 구조에서 나노포어 신호들간의 유의미한 변화가 나타났다 (도 9).
구체적으로, 단일의 αHL 나노포어가 있는 지질 이중층 cis 면에 TRS-TPP 복합체 (TRS-TPP complex)를 추가하였다. 나노포어에 (+) 전압을 인가시키면 TRS-TPP 복합체가 전기영동으로 포어 안으로 들어오면서 이온 전류가 차단된다. TRS-TPP 복합체의 전류 차단 이벤트에서 타입-I 과 타입 Ⅱ 이벤트가 모두 관찰되었고, 활발한 나노포어 전류 트레이스를 확인하였다 (도 10). TRS-TPP 복합체의 나노포어 이벤트의 통계분석에서 평균 체류 시간은 0.22 ms로 TRS 단독상태의 전체 나노포어 이벤트의 평균 체류시간과 비슷하게 측정되었다 (도 11의 b). TRS-TPP 복합체에서 관찰된 타입-Ⅰ 및 타입-Ⅱ 이벤트 각각의 체류시간은 0.21 ms, 4.37 ms 로 측정되었다 (도 11의 c 및 도 12의 a).
TRS 단독상태에서 나타난 두 가지 타입의 특정적인 전류 차단 이벤트들은 전압-의존적인 나노포어 검출을 통해 인가 전압이 증가함에 따라 (+100 mV 에서 +140 mV) 체류시간이 증가하는 것으로 나타났다 (도 11의 d 와 도 12의 b). 이는 분석물이 나노포어를 통과하지 못하고 범핑 (Bumping) 신호를 발생시킴을 나타낸다. 또한, TRS 단독상태에서 나타난 타입 Ⅱ 이벤트의 비율은 전체 이벤트의 8.9 %를 차지하는 것으로 확인하였다. (도 11의 a)
TRS-TPP 복합체의 타입 Ⅰ 이벤트의 경우 전압-의존적인 나노포어 검출을 통해 인가 전압이 증가함에 따라 (+100 mV 에서 +140 mV) 체류시간이 증가하였으므로 분석물이 나노포어를 통과하지 못하고 범핑 (bumping) 신호를 발생시킴을 확인하였다. 그러나, 타입 Ⅱ이벤트에서는 전압이 증가함에 따라 나노포어에 체류하는 시간이 감소하는 경향을 보임에 따라 TRS-TPP 복합체의 타입 Ⅱ 이벤트는 나노포어를 통과함을 확인하였다.
TPP에 의해 유도된 TRS 의 3차원적 접힘이 진행되는 동안 3가지 분자 상태 (TRS 단독, 중간체 및 TRS-TPP 복합체)가 생성될 수 있다. 평활말단 (blunt end) TRS 단독상태는 αHL 나노포어를 통과하지 못하고 짧은 평균 체류시간 (0.26 ms)과 단일레벨 전류 차단으로 빈번한 범핑신호를 발생시킨다. 또한, TRS 는 6쌍의 염기쌍으로 이루어진 짧은 P1 줄기가 상대적으로 짧아 수용액상에서 유연한 말단을 가지고 있다. 이로인해, αHL 나노포어의 통로(vestibule)에서 P1 줄기가 언지핑(unzipping)이 되지만 결국 나노포어를 통과하지 못하고 범핑되는 이중레벨의 전류차단을 발생시킨다. 접힘 공정의 최종 생성물인 안정화된 구조 및 P1 줄기를 가진 TRS-TPP 복합체는 포어에 들어갈 수 없으므로 평균 체류시간이 0.21 ms 인 타입Ⅰ 범핑 이벤트가 발생한다.
TRS 단독 또는 복합체와는 달리, 구조가 대부분 불안정한 TRS/TPP 결합 중간체는 두 단계를 통해 나노포어를 통과 할 수 있다. 1단계는 TPP 결합 TRS의 2차 구조를 포착하고 단일가닥으로 언지핑(unzipping) 하는 것이다. 나선형 구조의 TPP 결합 TRS 가 언지핑이 완료되면 2단계의 공정에서 나노포어를 통과하는 과정을 거치게 된다. 이로 인하여 TPP 결합에 의해 형성된 TRS 중간체가 타입-Ⅱ의 이중레벨 전류차단 이벤트가 발생한다. 중간체에 의해 발생된 타입 Ⅱ 이벤트의 비율은 14.3 % 로 TRS 단독상태에 비해 현저히 증가되는 것을 확인하였다 (도 11). TPP 결합에 의한 중간체로 인해 발생된 타입Ⅱ 이벤트의 경우 TRS 단독상태에서 나타난 타입Ⅱ 이벤트에 비해 약 1.3 배 증가된 체류시간을 나타내었고, 이벤트 비율 또한 1.6 배 증가함을 확인하였다 (도 11 및 도 12).
이로부터, 단일 분자 기반 나노포어 센서가 TPP 결합-커플링된 RNA 접힘 경로에서 생성된 일시적이고 부분적으로 접힌 중간체를 감지하는데 유용한 플랫폼임을 알 수 있다.
분자 메커니즘을 정리하면, 나노포어 측정 데이터를 기반으로 TRS 단독상태의 경우, 평활말단 (blunt end)의 구조로서 나노포어를 통과하지 못하고 범핑 신호가 나타난다. 그러나, P1 줄기가 6쌍의 상대적으로 짧은 염기쌍을 가지기 때문에 말단 부분이 유연하여 αHL의 통로 부분에 진입할 수 있지만, P2, P3, P4 그리고 P5의 s줄기에 의해 완전히 언지핑(unzipping) 되지 못하여 범핑되는 타입-Ⅱ 이벤트 가 관찰된다.
마찬가지로, TPP 가 결합된 TRS-TPP complex 또한 삼차원 접힘이 완결되어 평활말단 구조를 형성시키고, 염기쌍이 더 안정화되기 때문에 나노포어를 통과하지 못하고 범핑되는 타입-Ⅰ 신호를 발생시킨다. 그러나 TRS 의 TPP 결합에 의해 f 접힘이 일어날 때 발생하는 중간산물인 중간체 구조는 RNA의 구조적 유연성으로 인해 고유한 타입Ⅱ 의 나노포어 신호를 나타낸다.
이와 같이, 나노포어 측정을 통해 TRS-TPP complex 에 대한 특이적 신호를 확인함에 따라, 박테리아 유래 리보스위치에 대한 표적 물질의 스크리닝을 하여 리보스위치에 의해 조절되는 질병의 치료에 사용할 수 있고, 특히 항균제 또는 항생제 발굴에 유용한 개발로 적용 가능함을 알 수 있다.
[실시예 3]
Class III RNA 표적: Hairpin 구조를 가진 RNA
<3-1>. 헤어핀(hairpin) 구조를 갖는 RNA 표적 분자의 제작
헤어핀 구조를 가진 RNA 중 인플루엔자 A 바이러스 RNA에 보존된 프로모터 서열을 이용하여 5' 말단 또는 3' 말단에 RNA leader 서열을 설계 및 추가하여 신규 RNA 표적인 5'L-iav-RNA 및 3'L-iav-RNA를 Integrated DNA Technologies (Coralville, IA, USA) 에서 합성하였다. 두 가지 RNA 샘플을 10 mM 인산칼륨(pH6.2) 과 50 mM KCl 이 포함된 버퍼로 12시간 이상 투석시켰다. RNA 샘플들은 95 °C에서 5분 가열한 후, 상온에서 서서히 냉각하여 어닐링하였다.
구분 염기 서열(5'→ 핵산 종류 서열번호
5'L-iav-RNA (A)24AGUAGAAACAAGGCUUCGGCCUGCUUUUGCU ribo 서열번호 4
3'L-iav-RNA AGUAGAAACAAGGCUUCGGCCUGCUUUUGCU(AC)12 ribo 서열번호 5
<3-2>. 5'L-iav-RNA의 구조 변화 검출 모델의 구축
α-헤모라이신(α-hemolysin, αHL) 나노포어를 사용하여 헤어핀(hairpin) 구조를 갖는 RNA와 리간드의 상호작용을 단일분자 수준에서 검출할 수 있는지 확인하였다.
헤어핀 구조를 갖는 5'L-iav-RNA와 이에 대한 표적 약물인 약물인 6,7-dimethoxy-2-(1-piperazinyl)-4-quinazolinamine(DPQ)의 구조를 나타내었다 (도 13의 a).
구체적으로, 10 mM 인산칼륨 (pH6.2) 및 1M KCl을 포함하는 버퍼 상에서500nM 농도의 5'L-iav-RNA를 단일의 αHL 나노포어가 있는 지질 이중층의 cis 구획에 추가했다. 나노포어에 +100 mV 전압을 걸어주었을 때 5'L-iav-RNA 및 복합체가 전기 영동으로 구동되어 이온 흐름이 차단된다 (도 13의 b).
먼저 5'L-iav-RNA 단독 상태의 나노포어 이벤트를 통계적으로 분석한 결과, 나노포어 이벤트의 평균 전류 차단 세기(ΔI)는 76.9pA 으로 측정되었고, 평균 체류시간(dwell time)은 0.58 ms 로 측정되었다 (도 13의 c).
5'L-iav-RNA에 대한 표적 약물인 6,7-dimethoxy-2-(1-piperazinyl)-4-quinazolinamine(DPQ)는 인플루엔자 RNA의 internal loop 부분에 결합함에 따라 RNA의 헤어핀 구조를 안정화 시키는 것으로 알려져 있다(Chem commun (2014), 50(3), 368-370). 이러한 5'L-iav-RNA와 DPQ 리간드간의 안정적인 결합을 나노포어를 이용하여 검출하였을 때, 5'L-iav-RNA 단독 상태와 DPQ 결합에 의한 복합체 간에 나노포어 전류 트레이스에서 유의미한 변화를 확인하였다(도 13의 b).
또한, DPQ 리간드의 결합 비율에 따른 복한체의 나노포어 이벤트들을 통계분석 한 결과, 1:50 비율의 복합체에서는 나노포어 이벤트의 평균 전류 차단 세기(ΔI)는 78.6 pA 으로 측정되었고, 나노포어에 체류하는 평균 시간 (dwell time)은 1.14 ms 으로 측정되었다. 1:100 비율의 복합체에서는 75 pA의 평균 전류 차단 세기와 1.47 ms 의 체류시간(dwell time)이 측정되었다. 최종적으로, 5'L-iav-RNA 단독상태와 1:50, 1:100 비율로 DPQ 리간드의 농도을 증가시킬수록 5'L-iav-RNA 가 단백질 나노포어를 통과하는 시간은 현저히 증가되는 것을 관찰할 수 있었다 (도 13의 c).
인플루엔자 A 바이러스 RNA의 또 다른 표적 리간드인 neomycin은 internal loop을 가진 인플루엔자 A 바이러스 RNA의 인산 골격(phosphate backbone)에 결합하여 RNA의 이차원적 구조인 hairpin 구조를 안정화 시키는 것으로 알려져 있다. Neomycin 결합에 의한 5'L-iav-RNA 복합체의 나노포어 이벤트에 대하여 통계분석을 진행하였을 때, 나노포어 이벤트의 평균 체류시간이 0.43 ms에서 3.48 ms (약 8.1 배)로 현저히 증가하는 것을 확인하였다 (도 14).
결론적으로, 평활말단 (blunt end)을 가진 인플루엔자 A 바이러스 RNA의 5' 말단에 24개의 뉴클레오티드 리더 서열을 추가하여 αHL 나노포어의 통로(vestibule)에 진입 후 RNA의 2차원적 헤어핀 구조가 포어의 통로에서 언지핑(unzipping)이 용이하게 일어날 수 있도록 제작하였다. 표적 리간드 결합으로 인해 5'L-iav-RNA의 이차원적 헤어핀 구조가 안정화되어 나노포어의 통로에서 염기쌍이 언지핑 되는 과정이 천천히 일어나기 때문에 표적 리간드-결합 RNA 복합체의 나노포어 체류시간이 증가하였다.
이로부터, 단일 분자 기반 나노포어 센서가 리간드 결합에 의해 안정화된 RNA의 헤어핀 구조를 감지하는데 유용한 플랫폼임을 알 수 있다.
<3-3>. 3'L-iav-RNA의 구조 변화 검출 모델 구축
IAV RNA 단독상태가 나노포어를 5'L-iav-RNA보다 효율적으로 통과하도록 3' 말단에 24개의 뉴클레오티드 리더서열을 설계 및 추가한 RNA 표적 (3'L-iav-RNA)을 제작하였다.
이때, 폴리(A)24 리더 서열의 부분적인 접힘현상으로 인해 나노포어를 RNA가 통과하는 데 방해가 되는 요인을 제거하기 위하여 3'L-iav-RNA 의 리더 서열은 폴리(AC)12 뉴클레오티드를 사용하여 제작하였다.
구체적으로, 10 mM 인산칼륨 (pH6.2) 및 1M KCl을 포함하는 버퍼 상에서500nM 농도의 3'L-iav-RNA를 단일의 αHL 나노포어가 있는 지질 이중층의 cis 구획에 추가했다. 나노포어에 +100 mV 전압을 걸어주었을 때 3'L-iav-RNA 및 복합체가 전기 영동으로 구동되어 이온 흐름이 차단된다 (도 15의 c). 5'L-iav-RNA 단독상태의 나노포어 평균 체류시간(0.58 ms) 보다 3'L-iav-RNA 단독상태의 나노포어 평균 체류시간(7.30 ms)이 현저히 증가하였다. 5'L-iav-RNA 단독상태의 나노포어 검출에서 폴리(A)24 리더 서열의 부분적 접힘현성으로 인해 나노포어를 통과하는 데 방해가 되어 일부 나노포어를 통과하지 못하고 범핑(bumping) 되는 이벤트가 혼재되어 있어 평균 체류시간이 상대적으로 짧게 나타났다.
DPQ 리간드와 3'L-iav-RNA를 1:50 비율로 복합체 형성 후 αHL 나노포어가 있는 지질 이중층의 cis 구획에 추가했다. 나노포어 이벤트에 대한 통계적 분석에서 9.52 ms로 유의적인 나노포어 평균 체류시간 증가를 확인하였다 (도 15의 b). 또한, 나노포어 전류 트레이스에서도 DPQ결합에 의해 3'L-iav-RNA의 증가된 체류시간을 뚜렷하게 확인하였다(도 15의 c). 이는 DPQ 결합에 의하여 효과적으로 인플루엔자 A 바이러스 RNA의 2차원적 헤어핀 구조를 안정화시켜, 나노포어 통로에서염기쌍이 언지핑 (unzipping) 되는 과정을 지연시키는 것으로 확인하였다.
이로부터 리간드 결합으로 인해 매우 증가된 나노포어 체류시간을 가진 이벤트는 판독이 용이하여, 나노포어 1분 데이터 만으로도 헤어핀 구조를 가지는 인플루엔자 A 바이러스 RNA를 검출 할 수 있으므로 신속한 진단이 가능함을 알 수 있다(도 15).

Claims (10)

  1. (a) 표적 RNA가 나노포어를 통과하면서 발생하는 전기적 신호를 측정하는 단계;
    (b) 상기 표적 RNA에 결합할 것으로 기대되는 후보물질을 표적 RNA에 처리하고, 상기 표적 RNA가 나노포어를 통과하면서 발생하는 전기적 신호를 측정하는 단계; 및
    (c) 상기 (a) 및 (b) 단계에서 측정된 전기적 신호를 비교하여 전기적 신호의 변화가 나타나는 경우, 상기 후보물질을 표적 RNA에 특이적으로 결합하는 약물로 선별하는 단계;를 포함하는 RNA 표적의 약물(RNA-targeting drugs) 스크리닝 방법.
  2. 청구항 1에 있어서,
    상기 단계 (b)에서 표적 RNA에 후보물질이 결합되어 나타나는 표적 RNA의 3차원적 구조 변화를 전기적 신호로 측정하는 것인, RNA 표적의 약물 스크리닝 방법.
  3. 청구항 2에 있어서,
    상기 표적 RNA의 3차원적 구조의 변화가 나노포어를 통과하는 시간을 지연시키는 것인, RNA 표적의 약물 스크리닝 방법.
  4. 청구항 1에 있어서,
    상기 전기적 신호의 변화는 (b)단계에서 측정된 체류 시간이 (a)단계에서 측정된 체류 시간보다 더 길게 측정되는 것 또는 (b) 단계에서 새로운 형태의 나노포어 이벤트가 나타나는 것인, RNA 표적의 약물 스크리닝 방법.
  5. 청구항 1에 있어서,
    상기 표적 RNA는 자체적으로 적어도 하나 이상의 스템-루프(Stem-Loop) 또는 삼중나선(Triplex) 구조를 형성하는 것인, RNA 표적의 약물 스크리닝 방법.
  6. 청구항 5에 있어서,
    상기 표적 RNA는 박테리아 리보스위치 또는 바이러스 RNA 프로모터를 포함하는 것인, RNA 표적의 약물 스크리닝 방법.
  7. 청구항 6에 있어서,
    상기 리보스위치는 퓨린 리보스위치, 라이신 리보스위치, 사이클릭 디-GMP 리보스위치, glmS 리보스위치, TPP 리보스위치, 및 FMN 리보스위치로 구성된 군으로부터 선택된 어느 하나인, RNA 표적의 약물 스크리닝 방법.
  8. 청구항 1에 있어서,
    상기 나노포어를 생성하는 단백질은 α-헤모라이신, ClyA, 에어로라이신, 라이세닌, CsgG, FhuA, FraC, MspA, PlyAB, Phi29, PA63 및 OmpG로 구성된 군에서 선택되는 어느 하나인, RNA 표적의 약물 스크리닝 방법.
  9. 청구항 1에 있어서,
    상기 RNA 표적의 약물은 항암제, 대사질환 치료제, 퇴행성 질환 치료제, 심혈관 질환 치료제, 폐질환 치료제, 면역질환 치료제, 항균제, 항생제 또는 항바이러스제인, RNA 표적의 약물 스크리닝 방법.
  10. (i) 나노포어, (ii) 표적 RNA 및 (iii) 이온 전류와 체류 시간을 측정할 수 있는 구성을 포함하는 RNA 표적의 약물(RNA-targeting drugs) 스크리닝용 키트.
PCT/KR2021/013103 2020-09-28 2021-09-27 나노포어를 이용한 rna 표적의 고효율 약물 스크리닝 방법 WO2022065941A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/191,388 US20230304989A1 (en) 2020-09-28 2023-03-28 High-efficiency screening method for rna-targeting drugs using nanopores

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200126367A KR102309424B1 (ko) 2020-09-28 2020-09-28 나노포어를 이용한 리보스위치-표적 물질의 스크리닝 방법
KR10-2020-0126367 2020-09-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/191,388 Continuation-In-Part US20230304989A1 (en) 2020-09-28 2023-03-28 High-efficiency screening method for rna-targeting drugs using nanopores

Publications (1)

Publication Number Publication Date
WO2022065941A1 true WO2022065941A1 (ko) 2022-03-31

Family

ID=78114501

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/013103 WO2022065941A1 (ko) 2020-09-28 2021-09-27 나노포어를 이용한 rna 표적의 고효율 약물 스크리닝 방법

Country Status (3)

Country Link
US (1) US20230304989A1 (ko)
KR (1) KR102309424B1 (ko)
WO (1) WO2022065941A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100017905A (ko) * 2007-05-29 2010-02-16 예일 유니버시티 리보스위치, 리보스위치의 사용 방법 및 리보스위치를 함유하는 조성물
US20160370358A1 (en) * 2013-03-25 2016-12-22 Katholieke Universiteit Leuven Nanopore biosensors for detection of proteins and nucleic acids

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100017905A (ko) * 2007-05-29 2010-02-16 예일 유니버시티 리보스위치, 리보스위치의 사용 방법 및 리보스위치를 함유하는 조성물
US20160370358A1 (en) * 2013-03-25 2016-12-22 Katholieke Universiteit Leuven Nanopore biosensors for detection of proteins and nucleic acids

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LEE DONG-HWA, OH SOHEE, LIM KYUNGEUN, LEE BOAH, YI GWAN-SU, KIM YOUNG-ROK, KIM KI-BUM, LEE CHONG-KIL, CHI SEUNG-WOOK, LEE MI-KYUNG: "Tertiary RNA Folding-Targeted Drug Screening Strategy Using a Protein Nanopore", ANALYTICAL CHEMISTRY, vol. 93, no. 5, 9 February 2021 (2021-02-09), US , pages 2811 - 2819, XP055914056, ISSN: 0003-2700, DOI: 10.1021/acs.analchem.0c03941 *
MENI WANUNU, SWATI BHATTACHARYA, YUN XIE, YITZHAK TOR, ALEKSEI AKSIMENTIEV, MARIJA DRNDIC: "Nanopore Analysis of Individual RNA/Antibiotic Complexes", ACS NANO, vol. 5, no. 12, 27 December 2011 (2011-12-27), pages 9345 - 9353, XP055201578, ISSN: 1936-0851, DOI: 10.1021/nn203764j *
OH SOHEE, LEE MI-KYUNG, CHI SEUNG-WOOK: "Single-Molecule-Based Detection of Conserved Influenza A Virus RNA Promoter Using a Protein Nanopore", ACS SENSORS, vol. 4, no. 11, 22 November 2019 (2019-11-22), US, pages 2849 - 2853, XP055819414, ISSN: 2379-3694, DOI: 10.1021/acssensors.9b01558 *
SHASHA CAROLYN, HENLEY ROBERT Y., STOLOFF DANIEL H., RYNEARSON KEVIN D., HERMANN THOMAS, WANUNU MENI: "Nanopore-Based Conformational Analysis of a Viral RNA Drug Target", ACS NANO, vol. 8, no. 6, 24 June 2014 (2014-06-24), US , pages 6425 - 6430, XP055824316, ISSN: 1936-0851, DOI: 10.1021/nn501969r *

Also Published As

Publication number Publication date
KR102309424B1 (ko) 2021-10-07
US20230304989A1 (en) 2023-09-28

Similar Documents

Publication Publication Date Title
US10273527B2 (en) Nanopore-facilitated single molecule detection of nucleic acids
Sonnleitner et al. Interplay between the catabolite repression control protein Crc, Hfq and RNA in Hfq-dependent translational regulation in Pseudomonas aeruginosa
US20190300947A1 (en) Dna sequencing by nanopore using modified nucleotides
Lind et al. Structure-based computational database screening, in vitro assay, and NMR assessment of compounds that target TAR RNA
Romero et al. ATP-mediated Erk1/2 activation stimulates bacterial capture by filopodia, which precedes Shigella invasion of epithelial cells
Cheng et al. Identification of a novel Salmonella type III effector by quantitative secretome profiling
KR20140091750A (ko) 표적 단백질에 결합하는 핵산 단편
US11236342B2 (en) Secretory immunoglobulin a (sIgA)-binding nucleic acid molecule, sIgA analysis sensor, and sIgA analysis method
US5698674A (en) Triheterocyclic peptides capable of binding the minor and major grooves of DNA
US20230193253A1 (en) Screening artificial nucleic acids by particle display
WO2022065941A1 (ko) 나노포어를 이용한 rna 표적의 고효율 약물 스크리닝 방법
Chan et al. Analysis of CDPK1 targets identifies a trafficking adaptor complex that regulates microneme exocytosis in Toxoplasma
Jakob et al. The virulence regulator VirB from Shigella flexneri uses a CTP-dependent switch mechanism to activate gene expression
KR101438531B1 (ko) 대장균에 특이적으로 결합하는 단일가닥핵산 앱타머 및 이를 이용한 대장균 검출방법
KR102390925B1 (ko) 나노포어를 이용한 병원성 미생물의 검출 방법 및 검출키트
EP4148042A1 (en) Phenoxy-acetyl-thioureido-benzenesulfonamide derivatives, and their uses
EP3324972B1 (en) New molecules for isolation of polyribosomes, ribosomes, uses and kits thereof
UA78745C2 (en) Imidazoquinoline derivatives
Lazar et al. Chemoproteomics-guided development of SLC15A4 inhibitors with anti-inflammatory activity
Munder et al. Antiproliferative effect of novel aminoacridine-based compounds
JP2005511025A (ja) ハイスループットスクリーニングおよび創薬のための同質遺伝子性ヒト癌細胞の使用方法
KR20110093024A (ko) 탄저 독소 단백질에 특이적으로 결합하는 ｄｎａ 앱타머와 이의 용도
US20240165144A1 (en) Compositions and methods for modulating innate immune signaling pathways
DE4119075A1 (de) Nucleosidtriphosphorsaeureester und deren verwendung
Srinivasan Understanding The Molecular Mechanisms Of The RNA Helicases DHX36 And DDX41

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21872969

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21872969

Country of ref document: EP

Kind code of ref document: A1