Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
  • C12N2310/141—MicroRNAs, miRNAs
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2740/00—Reverse transcribing RNA viruses
  • C12N2740/00011—Details
  • C12N2740/10011—Retroviridae
  • C12N2740/16011—Human Immunodeficiency Virus, HIV
  • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
  • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/20—Vector systems having a special element relevant for transcription transcription of more than one cistron
  • C12N2830/205—Vector systems having a special element relevant for transcription transcription of more than one cistron bidirectional
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

• the present invention relates to genetic constructs and vectors.
• the invention extends to pharmaceutical compositions comprising the genetic constructs and vectors, and to methods of using the genetic constructs and vectors in diagnosis and therapy.
• the invention is particularly, although not exclusively, concerned with diagnosing and treating T-cell acute lymphoblastic leukaemia (T-ALL).
• T-ALL T-cell acute lymphoblastic leukaemia
• T-ALL is an aggressive haematological malignancy frequently associated with poor prognosis factors, such as the infiltration of the central nervous system.
• T-ALL accounts for 15% and 25% of paediatric and adult acute lymphoblastic leukaemia, respectively (2) and, although the outcome of T-ALL patients has improved over recent years, the prognosis of patients with resistant or relapsed disease remains very poor (3, 4).
• MicroRNAs are ⁇ 22 nucleotides small non-coding RNAs that regulate gene expression post-transcriptionally (5) by binding to complementary sequences usually located in 3’ UTR of their target mRNAs (6) (see Figure 1). MicroRNAs regulate several biological processes as well as human diseases including cancer (5).
• microRNAs partake in tumorigenesis acting either as tumour suppressors or as oncogenes (7).
• profiling studies have shown that some microRNAs are expressed in a highly tissue/cell specific fashion (8, 9).
• tissue/cell-type specific microRNA expression has been exploited to negatively regulate transgene expression. Addition of artificial sequences recognized by a specific microRNA to a transgene will induce its post-transcriptional silencing. This concept was first developed by Brown and colleagues (10).
• transgene expression lentiviral vector that incorporates target sequences for a hematopoietic-cell specific microRNA
• the authors built a system that allows transgene expression in non-hematopoietic cells while suppressing its expression in hematopoietic lineages. More recently, this strategy has been explored in different disease settings for therapeutic gene delivery (11-13).
• microRNA expression profiles have also been shown to distinguish tumour from normal cells and to discriminate tumours of different developmental origin and having a differentiation state (8, 9, 14, 15). The inventors, therefore, set out to take advantage of T-ALL-specific microRNA expression profiles, and have developed a recombinant genetic construct, which behaves as a so-called microRNA “detector system”.
• the genetic construct is capable of firstly using the microRNA profile to identify cancerous or tumourous T-ALL cells in a patient and distinguish the leukaemia cells from the patient’s normal, healthy cells, and secondly regulate the expression of a therapeutic gene (e.g. an apoptosis-inducing gene encoding a protein which causes tumour cell death) or a marker gene (e.g. a reporter gene encoding a protein marker) in only the T-ALL cells, and not the healthy cells.
• a therapeutic gene e.g. an apoptosis-inducing gene encoding a protein which causes tumour cell death
• a marker gene e.g. a reporter gene encoding a protein marker
• a genetic construct comprising: (i) a first promoter operably linked to a first nucleic acid sequence encoding a therapeutically active molecule or a reporter molecule, wherein the first nucleic acid sequence comprises at least one microRNA (miRNA) target site; and (ii) a second promoter operably linked to a second nucleic acid sequence encoding an inhibitor of the first promoter and/or the therapeutically active molecule or reporter molecule, and wherein the second nucleic acid sequence comprises at least one miRNA target site, wherein the at least one miRNA target site of the first and second nucleic acid sequences are different.
• miRNA microRNA
• the construct of the invention harnesses the predetermined microRNA profile specific to target and, in a tumour context, kill unhealthy cells in a patient.
• the construct determines whether the cell is an unhealthy cell, in which case, it induces cell death, or whether the cell is a healthy cell, in which case no cell death is induced.
• a positive match between the expression of specific microRNAs inside an unhealthy cell and the construct results in the delivery of a therapeutic gene to target cells, inducing their death (as shown in Figure 2A).
• the construct of the invention has the potential to effectively circumvent the lack of specificity that is associated with standard gene therapy techniques. Furthermore, with the construct of the invention, a therapeutically active molecule can be delivered with high specificity and efficiency, using just one single vector. Additionally, only one construct (i.e.
• the construct of the invention is delivered to the target cell, thereby ensuring co-localisation of (i) the therapeutically active molecule or a reporter molecule, and (ii) the inhibitor of the first promoter and/or the therapeutically active molecule or reporter molecule.
• the at least one miRNA target site of the second nucleic acid sequence is a target site of an miRNA that is different to an miRNA capable of targeting the at least one miRNA target site of the first nucleic acid sequence.
• the construct of the invention therefore, comprises a first expression cassette comprising the first promoter and the first nucleic acid sequence, and a second expression cassette comprising the second promoter and the second nucleic acid sequence.
• the first nucleic acid sequence may comprise more than one species or type of miRNA target sequence.
• the first nucleic acid sequence comprises at least one miRNA target site (or at least one species of miRNA target site).
• the first nucleic acid sequence comprises at least two miRNA target sites (or at least two species of miRNA target site).
• the first nucleic acid sequence comprises at least three miRNA target sites (or at least three species of miRNA target site).
• the first nucleic acid sequence comprises at least four miRNA target sites (or at least four species of miRNA target site).
• the first nucleic acid sequence comprises at least five miRNA target sites (or at least five species of miRNA target site).
• the miRNA target sites present in the first nucleic acid sequence are target sites for different miRNAs species. The more miRNA target sites that are present in the first nucleic acid sequence, then the more tightly regulated gene expression will be.
• each miRNA target site species may comprise at least one duplication of the target site. Accordingly, preferably there is at least one copy of each miRNA target site, i.e. each species. Preferably, there is at least two copies of each miRNA target site, i.e. each species. Preferably, there is at least three copies of each miRNA target site, i.e. each species.
• each miRNA target site there is at least four copies of each miRNA target site, i.e. each species.
• the at least one miRNA target site present in the first nucleic acid sequence is a target site for an miRNA, the expression of which is absent or decreased or down- regulated in a diseased cell when compared to a healthy cell.
• the identification of miRNAs specifically absent or decreased in a cancer cell when compared with a healthy cell may be obtained by the analysis of differential expressed miRNA between the cancer and healthy cells assuming the following criteria: 1) the 5 th , 10 th , 15 th , 20 th ,25th, 30 th or 35th percentile of the higher-expressing group is higher than the 60 th , 65 th , 70 th , 75 th , 80 th , 85 th , 90 th or 95 th percentile of the lower-expressing group, preferably, the 25th, percentile of the higher-expressing group is higher than the 75th, percentile of the lower-expressing group; and 2) miRNA has expression values for at least 60%, 65%, 75%, 80%, 85%, 90% or 95% of all the healthy samples analysed.
• miRNA has expression values for at least at least 75% of all the healthy samples analysed.
• the at least one miRNA target site present in the first nucleic acid sequence is a target site for a miRNA that is not expressed in a diseased cell, or to very low or undetectable levels.
• the at least one miRNA target site present in the first nucleic acid is a target site for a miRNA, which is specifically expressed in healthy cells.
• the at least one miRNA target site present in the first nucleic acid is a target site for a miRNA, which is substantially expressed in healthy cells only.
• the at least one miRNA target site present in the first nucleic acid is a target site for a miRNA, which is ubiquitously expressed in healthy cells.
• Down-regulated or decreased miRNA expression in a diseased cell may be considered to be at least 5%, 10%, 15% or 20% less than occurs in a healthy cell.
• down- regulated or decreased miRNA expression in a diseased cell may be considered to be at least 25%, 30%, 35% or 40% less than occurs in a healthy cell.
• down- regulated or decreased miRNA expression in a diseased cell may be considered to be at least 50%, 55%, 60% or 65% less than occurs in a healthy cell.
• down- regulated or decreased miRNA expression in a diseased cell may be considered to be at least 70%, 75%, 80% or 85% less than occurs in a healthy cell.
• down- regulated or decreased miRNA expression in a diseased cell may be considered to be at least 90%, 95%, 96% , 97%, 98%, 99% or 100 % less than occurs in a healthy cell.
• the diseased cell is a cancer cell. More preferably, the diseased cell is a T-cell acute lymphoblastic leukaemia (T-ALL) cell.
• T-ALL T-cell acute lymphoblastic leukaemia
• miRNA153, miRNA128a, miR-3687, miR-92a-2-5p, miR-20b-3p, miR-6087, miR-106a-3p, miR- 7704, miR-5701, miR-766-5p, miR-3609, miR-3615, and/or miR-4746-5p are up- regulated in T-ALL cells (i.e.
• miRNA29a, miRNA149, miR-539-5p, miR-487a-3p, miR-655-3p, miR-411-3p miR-377- 5p, miR-337-5p, miR-31-3p, miR-214-5p, miR-1185-5p, miR-483-5p, miR-365a-3p, miR-127-3p, miR-574-3p, and/or miR-125b-5p are down-regulated in T-ALL cells (i.e. lower expression levels than in healthy cells).
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miRNA29a, miRNA149, miR-539-5p, miR-487a-3p, miR-655-3p, miR-411-3p miR-377-5p, miR-337-5p, miR-31-3p, miR-214-5p, miR-1185-5p, miR-483- 5p, miR-365a-3p, miR-127-3p, miR-574-3p, and/or miR-125b-5p target site.
• the at least one miRNA target site present in the first nucleic acid sequence comprises at least one, two, three, four or five copies of each of the miRNA29a, miRNA149, miR-539-5p, miR-487a-3p, miR-655-3p, miR-411-3p miR-377-5p, miR- 337-5p, miR-31-3p, miR-214-5p, miR-1185-5p, miR-483-5p, miR-365a-3p, miR-127- 3p, miR-574-3p and miR-125b-5p target sites.
• the at least one miRNA target site present in the first nucleic acid sequence comprises four copies of each of the miRNA29a, miRNA149, miR-539-5p, miR-487a-3p, miR-655-3p, miR-411-3p miR-377- 5p, miR-337-5p, miR-31-3p, miR-214-5p, miR-1185-5p, miR-483-5p, miR-365a-3p, miR-127-3p, miR-574-3p and miR-125b-5p target sites.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miRNA29a target site, which is provided herein as SEQ ID No: 1, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miRNA29a target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 1, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR149 target site, which is provided herein as SEQ ID No: 2, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR149 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 2, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-539-5p target site, which is provided herein as SEQ ID No: 28, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-539-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 28, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-487a-3p target site, which is provided herein as SEQ ID No: 29, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-487a-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 29, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-655-3p target site, which is provided herein as SEQ ID No: 30, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-655-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 30, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-411-3p target site, which is provided herein as SEQ ID No: 31, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-411-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 31, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-377-5p target site, which is provided herein as SEQ ID No: 32, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-377-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 32, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-337-5p target site, which is provided herein as SEQ ID No: 33, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-337-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 33, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-31-3p target site, which is provided herein as SEQ ID No: 34, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-31-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 34, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-214-5p target site, which is provided herein as SEQ ID No: 35, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-214-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 35, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-1185-5p target site, which is provided herein as SEQ ID No: 36, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-1185-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 36, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-483-5p target site, which is provided herein as SEQ ID No: 37, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-483-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 37, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-365a-3p target site, which is provided herein as SEQ ID No: 38, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-365a-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 38, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-127-3p target site, which is provided herein as SEQ ID No: 39, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-127-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 39, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-574-3p target site, which is provided herein as SEQ ID No: 40, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR-574-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 40, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR- 125b-5p target site, which is provided herein as SEQ ID No: 41, as follows:
• the at least one miRNA target site present in the first nucleic acid sequence comprises a miR- 125b-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 41, or a variant or fragment thereof.
• the at least one miRNA target site present in the first nucleic acid sequence comprises SEQ ID Nos: 1,2, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and/or 41 or a variant or fragment thereof.
• the first nucleic acid sequence may comprise additional miRNA target sites and/or more than one copy of each miRNA target site.
• miRNA29a is represented by miR ID No: MIMAT0000086.
• the miRNA29a sequence may be provided herein as SEQ ID No: 6, as follows: Accordingly, preferably miRNA29a comprises or consists of a sequence as substantially set out in SEQ ID No: 6, or a variant or fragment thereof.
• miRNA149 is represented by miR ID No: MIMAT0000450.
• the miRNA149 sequence may be provided herein as SEQ ID No: 7, as follows: Accordingly, preferably miRNA149 comprises or consists of a sequence as substantially set out in SEQ ID No: 7, or a variant or fragment thereof.
• miR-539-5p is represented by miR ID No: MIMAT0003163.
• the miR-539-5p sequence may be provided herein as SEQ ID No: 42, as follows: Accordingly, preferably miR-539-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 42, or a variant or fragment thereof.
• miR-487a-3p is represented by miR ID No: MIMAT0002178.
• the miR-487a-3p sequence may be provided herein as SEQ ID No: 43, as follows: Accordingly, preferably miR-487a-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 43, or a variant or fragment thereof.
• miR-655-3p is represented by miR ID No: MIMAT0003331.
• the miR-655-3p sequence may be provided herein as SEQ ID No: 44, as follows: Accordingly, preferably miR-655-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 44, or a variant or fragment thereof.
• miR-411-3p is represented by miR ID No: MIMAT0004813.
• the miR-411-3p sequence may be provided herein as SEQ ID No: 45, as follows: Accordingly, preferably miR-411-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 45, or a variant or fragment thereof.
• miR-377-5p is represented by miR ID No: MIMAT0004689.
• the miR-377-5p sequence may be provided herein as SEQ ID No: 46, as follows: Accordingly, preferably miR-377-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 46, or a variant or fragment thereof.
• miR-337-5p is represented by miR ID No: MIMAT0004695.
• the miR-337-5p sequence may be provided herein as SEQ ID No: 47, as follows: Accordingly, preferably miR-337-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 47, or a variant or fragment thereof.
• miR-31-3p is represented by miR ID No: MIMAT0004504.
• the miR-31-3p sequence may be provided herein as SEQ ID No: 48, as follows: Accordingly, preferably miR-31-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 48, or a variant or fragment thereof.
• miR-214-5p is represented by miR ID No: MIMAT0004564.
• the miR-214-5p sequence may be provided herein as SEQ ID No: 49, as follows: Accordingly, preferably miR-214-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 49, or a variant or fragment thereof.
• miR-1185-5p is represented by miR ID No: MIMAT0005798.
• the miR-1185-5p sequence may be provided herein as SEQ ID No: 50, as follows: Accordingly, preferably miR-1185-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 50, or a variant or fragment thereof.
• miR-483-5p is represented by miR ID No: MIMAT0004761.
• the miR-483-5p sequence may be provided herein as SEQ ID No: 51, as follows: Accordingly, preferably miR-483-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 51, or a variant or fragment thereof.
• miR-365a-3p is represented by miR ID No: MIMAT0009199.
• the miR-365a-3p sequence may be provided herein as SEQ ID No: 52, as follows: Accordingly, preferably miR-365a-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 52, or a variant or fragment thereof. In one embodiment, miR-127-3p is represented by miR ID No: MIMAT0000446.
• the miR-127-3p sequence may be provided herein as SEQ ID No: 53, as follows: Accordingly, preferably miR-127-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 53, or a variant or fragment thereof. In one embodiment, miR-574-3p is represented by miR ID No: MIMAT0003239.
• the miR-574-3p sequence may be provided herein as SEQ ID No: 54, as follows: Accordingly, preferably miR-574-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 54, or a variant or fragment thereof. In one embodiment, miR-125b-5p is represented by miR ID No: MIMAT0000423.
• the miR-125b-5p sequence may be provided herein as SEQ ID No: 55, as follows: Accordingly, preferably miR-125b-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 55, or a variant or fragment thereof.
• miRNAs comprising or consisting of SEQ ID No: 6, 7, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 and/or 55 or a variant or fragment thereof, target the at least one miRNA target site in the first nucleic acid sequence, and preferably two different miRNA target site in the first nucleic acid sequence.
• the first nucleic acid sequence may comprise more than one species of miRNA target sequence.
• the second nucleic acid sequence comprises at least one miRNA target site (or at least one species of miRNA target site).
• the second nucleic acid sequence comprises at least two miRNA target sites (or at least two species of miRNA target site).
• the second nucleic acid sequence comprises at least three miRNA target sites (or at least three species of miRNA target site).
• the second nucleic acid sequence comprises at least four miRNA target sites (or at least four species of miRNA target site.
• the second nucleic acid sequence comprises at least five miRNA target sites (or at least five species of miRNA target site).
• the miRNA targets sites present in the second nucleic acid are target sites for different miRNAs. The more miRNA target sites that are present in the second nucleic acid sequence, then the more tightly regulated gene expression will be.
• each miRNA target site species may comprise at least one duplication of the target site. Accordingly, preferably, there is at least one copy of each miRNA target site, i.e. each species. Preferably, there is at least two copies of each miRNA target site, i.e. each species. Preferably, there is at least three copies of each miRNA target site, i.e. each species.
• the at least one miRNA target site present in the second nucleic acid sequence is a target site for a miRNA that is expressed in a diseased cell.
• the at least one miRNA target site present in the second nucleic acid is a target site for a miRNA, which is specifically expressed in diseased cells.
• the at least one miRNA target site present in the second nucleic acid is a target site for a miRNA, which is not expressed in a healthy cell, or to very low or undetectable levels.
• the at least one miRNA target site present in the second nucleic acid is a target site for a miRNA, which is ubiquitously expressed in diseased cells.
• Up-regulated or increased miRNA expression in a diseased cell may be considered to be at least 5%, 10%, 15% or 20% more than occurs in a healthy cell.
• up- regulated or increased miRNA expression in a diseased cell may be considered to be at least 25%, 30%, 35% or 40% more than occurs in a healthy cell.
• up- regulated or increased miRNA expression in a diseased cell may be considered to be at least 50%, 55%, 60% or 65% more than occurs in a healthy cell.
• up- regulated or increased miRNA expression in a diseased cell may be considered to be at least 70%, 75%, 80% or 85% more than occurs in a healthy cell.
• up- regulated or increased miRNA expression in a diseased cell may be considered to be at least 90%, 95%, 96% , 97%, 98%, 99% or 100 % more than occurs in a healthy cell.
• the diseased cell is a cancer cell. More preferably, the diseased cell is a T-cell acute lymphoblastic leukaemia (T-ALL) cell.
• T-ALL T-cell acute lymphoblastic leukaemia
• the at least one miRNA target site present in the second nucleic acid comprises a miRNA153, a miR128a, a miR-3687, a miR-92a-2-5p, a miR-20b-3p, a miR-6087, a miR-106a-3p, a miR-7704, a miR-5701, a miR-766-5p, a miR-3609, a miR-3615, and/or a miR-4746-5p target site.
• the at least one miRNA target site present in the second nucleic acid comprises a miRNA153 target site, which is provided herein as SEQ ID No: 3, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miRNA153 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 3, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR128a target site, which is provided herein as SEQ ID No: 4, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR128a target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 4, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-3687 target site, which is provided herein as SEQ ID No: 56, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-3687 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 56, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-92a-2-5p target site, which is provided herein as SEQ ID No: 57, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-92a-2-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 57, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-20b-3p target site, which is provided herein as SEQ ID No: 58, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-20b-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 58, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-6087 target site, which is provided herein as SEQ ID No: 59, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-6087 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 59, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-106a-3p target site, which is provided herein as SEQ ID No: 60, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-106a-3p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 60, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-7704 target site, which is provided herein as SEQ ID No: 61, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-7704 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 61, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-5701 target site, which is provided herein as SEQ ID No: 62, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-5701 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 62, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-766-5p target site, which is provided herein as SEQ ID No: 63, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-766-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 63, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-3609 target site, which is provided herein as SEQ ID No: 64, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-3609 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 64, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-3615 target site, which is provided herein as SEQ ID No: 65, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-3615 target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 65, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid comprises a miR-4746-5p target site, which is provided herein as SEQ ID No: 66, as follows:
• the at least one miRNA target site present in the second nucleic acid sequence comprises a miR-4746-5p target site which comprises or consists of a sequence as substantially set out in SEQ ID No: 66, or a variant or fragment thereof.
• the at least one miRNA target site present in the second nucleic acid sequence comprises SEQ ID Nos: 3, 4, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 and/or 66 or a variant or fragment thereof.
• the second nucleic acid sequence may comprise additional miRNA target sites.
• miRNA153 is represented by miR ID No: MIMAT0026480.
• the miRNA153 sequence may be provided herein as SEQ ID No: 8, as follows: Accordingly, preferably miRNA153 comprises or consists of a sequence as substantially set out in SEQ ID No: 8, or a variant or fragment thereof.
• miR128a is represented by miR ID No: MIMAT0000424.
• the miR128a sequence may be provided herein as SEQ ID No: 9, as follows: Accordingly, preferably miR128a comprises or consists of a sequence as substantially set out in SEQ ID No: 9, or a variant or fragment thereof.
• miR-3687 is represented by miR ID No: MIMAT0018115.
• the miR-3687 sequence may be provided herein as SEQ ID No: 67, as follows: Accordingly, preferably miR-3687 comprises or consists of a sequence as substantially set out in SEQ ID No: 67, or a variant or fragment thereof.
• miR-92a-2-5p is represented by miR ID No: MIMAT0004508.
• the miR-92a-2-5p sequence may be provided herein as SEQ ID No: 68, as follows: Accordingly, preferably miR-92a-2-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 68, or a variant or fragment thereof.
• miR-20b-3p is represented by miR ID No: MIMAT0004752.
• the miR-20b-3p sequence may be provided herein as SEQ ID No: 69, as follows: Accordingly, preferably miR-20b-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 69, or a variant or fragment thereof.
• miR-6087 is represented by miR ID No: MIMAT0023712.
• the miR-6087 sequence may be provided herein as SEQ ID No: 70, as follows: Accordingly, preferably miR-6087 comprises or consists of a sequence as substantially set out in SEQ ID No: 70, or a variant or fragment thereof.
• miR-106a-3p is represented by miR ID No: MIMAT0004517.
• the miR-106a-3p sequence may be provided herein as SEQ ID No: 71, as follows: Accordingly, preferably miR-106a-3p comprises or consists of a sequence as substantially set out in SEQ ID No: 71, or a variant or fragment thereof.
• miR-7704 is represented by miR ID No: MIMAT0030019.
• the miR-7704 sequence may be provided herein as SEQ ID No: 72, as follows: Accordingly, preferably miR-7704 comprises or consists of a sequence as substantially set out in SEQ ID No: 72, or a variant or fragment thereof.
• miR-5701 is represented by miR ID No: MIMAT0022494.
• the miR-5701 sequence may be provided herein as SEQ ID No: 73, as follows: Accordingly, preferably miR-5701 comprises or consists of a sequence as substantially set out in SEQ ID No: 73, or a variant or fragment thereof.
• miR-766-5p is represented by miR ID No: MIMAT0022714.
• the miR-766-5p sequence may be provided herein as SEQ ID No: 74, as follows: Accordingly, preferably miR-766-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 74, or a variant or fragment thereof.
• miR-3609 is represented by miR ID No: MIMAT0017986.
• the miR-3609 sequence may be provided herein as SEQ ID No: 75, as follows: Accordingly, preferably miR-3609 comprises or consists of a sequence as substantially set out in SEQ ID No: 75, or a variant or fragment thereof.
• miR-3615 is represented by miR ID No: MIMAT0017994.
• the miR-3615 sequence may be provided herein as SEQ ID No: 76, as follows: Accordingly, preferably miR-3615 comprises or consists of a sequence as substantially set out in SEQ ID No: 76, or a variant or fragment thereof.
• miR-4746-5p is represented by miR ID No: MIMAT0019880.
• the miR-4746-5p sequence may be provided herein as SEQ ID No: 77, as follows: Accordingly, preferably miR-4746-5p comprises or consists of a sequence as substantially set out in SEQ ID No: 77, or a variant or fragment thereof.
• miRNAs comprising or consisting of SEQ ID No: 8, 9, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76 and/or 77 or a variant or fragment thereof, target the at least one miRNA target site in the second nucleic acid sequence, and preferably two different miRNA target site in the second nucleic acid sequence.
• the delivery of the therapeutic molecule or reporter molecule is regulated both by microRNAs present only (or highly expressed) in a patient’s T-ALL cells (e.g. miRNA153, miRNA128a, miR-3687, miR-92a-2-5p, miR- 20b-3p, miR-6087, miR-106a-3p, miR-7704, miR-5701, miR-766-5p, miR-3609, miR- 3615, and/or miR-4746-5p) and microRNAs specifically absent (or significantly less expressed) in those cells (e.g.
• T-ALL cells e.g. miRNA153, miRNA128a, miR-3687, miR-92a-2-5p, miR- 20b-3p, miR-6087, miR-106a-3p, miR-7704, miR-5701, miR-766-5p, miR-3609, miR- 3615, and/or miR-4746-5p
• the construct of the invention uses the concomitant presence and absence of specific microRNAs to positively regulate the expression of the therapeutic molecule or reporter molecule.
• this dual layer of regulation is achieved by the use of a bidirectional expression vector. It will be appreciated that a negative feedback loop through gene expression provides additional control.
• the first promoter may be any suitable promoter, including a constitutive promoter, an activatable promoter, an inducible promoter, or a tissue-specific promoter.
• the first promoter may be a ubiquitously expressed promoter, or a cancer cell-specific promoter.
• the first promoter is a ubiquitously expressed promoter.
• the first promoter may be selected from the group consisting of elongation factor 1 alpha (EF1 ⁇ ) promoter, EF1 ⁇ short (EFS) promoter, phosphoglycerate kinase (PGK) promoter, cytomegalovirus (CMV) immediate early promoter, spleen focus forming virus (SFFV) promoter, CASI promoter, myeloproliferative sarcoma virus (MPSV) long terminal repeat, murine stem cell virus (MSCV) long terminal repeat (LTR), and the composite CAG promoter, (consisting of the CMV immediate early enhancer and the chicken ⁇ -actin promoter).
• the first promoter extends in a 5’ to 3’ direction.
• the first nucleic acid coding sequence may encode a reporter molecule or a therapeutic molecule.
• the reporter molecule may be an optical reporter, a nuclear medicine reporter or an MRI reporter.
• the optical reporter may be a fluorescent protein or luciferase.
• the nuclear medicine reporter may be herpes simplex virus type 1 [HSV1] thymidine kinase (TK), human mitochondrial TK type 2, dopaminergic receptor, dopamine 2 receptor, sodium iodide symporter, norepinephrine transporter, Somatostatin receptor or oestrogen receptor.
• the MRI reporter may be transferrin receptor, ⁇ -galactosidase, tyrosinase, ferritin or lysine-rich protein (LRP).
• the therapeutically active molecule may be a therapeutic protein and/or a nucleic acid.
• the nucleic acid may be a DNA, RNA or a chimeric DNA/RNA molecule.
• the nucleic acid may be a gene-silencing molecule, examples include an RNAi molecule, including siNA, siRNA, shRNA, miRNA, ribozymes and antisense molecules.
• the nucleic acid may be a guide RNA.
• guide RNA refers to the non-coding RNA component of the CRISPR/Cas system, which binds to complementary target DNA sequences.
• Guide RNA first binds to a Cas enzyme and the gRNA sequence guides the complex via pairing to a specific location on the DNA, where Cas performs its endonuclease activity by cutting the target DNA strand.
• Gene-silencing molecules may be antisense molecules (antisense DNA or antisense RNA) or ribozyme molecules. Ribozymes and antisense molecules may be used to inhibit the transcription of essential genes in the diseased cell.
• Antisense molecules are oligonucleotides that bind in a sequence-specific manner to nucleic acids, such as DNA or RNA.
• the therapeutically active molecule may be therapeutic protein, wherein the first nucleic acid encodes an mRNA molecule that encodes the therapeutic protein.
• the therapeutic protein may be a recombinant protein having therapeutic applications.
• the therapeutic protein may be an endonuclease.
• therapeutic protein may be a CRISPR endonuclease, such as a CRISPR-associated protein (Cas).
• the Cas protein may be Cas9 and/or Cpf1.
• the therapeutic molecule may comprise both components of the CRIPSR/Cas system, including a Cas protein and a guide RNA.
• the construct may comprise an additional promoter for driving expression of the Cas protein.
• the therapeutic protein may be a CAR (Chimeric Antigen Receptor).
• therapeutic protein may be a CAR protein that enables the setup of a CAR-T cell for in vivo T-cell immunotherapy.
• the therapeutic protein may be an effector protein.
• the therapeutic protein may be capable of triggering the apoptosis cascade within a tumour cell.
• the therapeutic protein may be an apoptosis driver protein.
• the apoptosis driver protein may be Bax, Apoptin,E4orf4 and/or Bim.
• the apoptosis driver protein may be Bax, which may be represented by Gene ID No: 581 which is provided herein as SEQ ID No: 16, as follows: Accordingly, preferably Bax comprises or consists of an amino acid sequence as substantially set out in SEQ ID No: 16, or a biologically active variant or fragment thereof.
• Bax may be encoded by a nucleotide sequence which is provided herein as SEQ ID No: 17, as follows:
• the Bax polypeptide or a biologically active variant or fragment thereof may be encoded by a nucleotide sequence substantially as set out in SEQ ID NO: 17, or a variant or fragment thereof.
• the apoptosis driver protein may be Apoptin, which may be represented by Gene ID No: 1494446 which is provided herein as SEQ ID No: 18, as follows:
• Apoptin comprises or consists of an amino acid sequence as substantially set out in SEQ ID No: 18, or a biologically active variant or fragment thereof.
• Apoptin may be encoded by a nucleotide sequence which is provided herein as SEQ ID No: 19, as follows:
• the Apoptin polypeptide or a biologically active variant or fragment thereof may be encoded by a nucleotide sequence substantially as set out in SEQ ID NO: 19, or a variant or fragment thereof.
• the apoptosis driver protein may be E4orf4, which may be represented by Gene ID No: AC_000007.1, which is provided herein as SEQ ID No: 20, as follows:
• E4orf4 comprises or consists of an amino acid sequence as substantially set out in SEQ ID No: 20, or a biologically active variant or fragment thereof.
• E4orf4 may be encoded by a nucleotide sequence which is provided herein as SEQ ID No: 21, as follows:
• the E4orf4 polypeptide or a biologically active variant or fragment thereof may be encoded by a nucleotide sequence substantially as set out in SEQ ID NO: 21, or a variant or fragment thereof.
• the apoptosis driver protein may be Bim (BCL2L11), which may be represented by Gene ID No: 10018 which is provided herein as SEQ ID No: 25, as follows:
• Bim comprises or consists of an amino acid sequence as substantially set out in SEQ ID No: 25, or a biologically active variant or fragment thereof.
• Bim may be encoded by a nucleotide sequence which is provided herein as SEQ ID No: 26, as follows: Hence, preferably the Bim polypeptide or a biologically active variant or fragment thereof may be encoded by a nucleotide sequence substantially as set out in SEQ ID NO: 26, or a variant or fragment thereof.
• the second promoter may be any suitable promoter, including a constitutive promoter, an activatable promoter, an inducible promoter, or a tissue-specific promoter.
• the first promoter is a ubiquitously expressed promoter.
• the second promoter is a different promoter to the first promoter.
• the second promoter may be arranged in the same orientation in the construct as the first promoter.
• the second promoter may extend in a 3’ to 5’ direction. However, preferably the second promoter is arranged in an opposite orientation in the construct to the first promoter. Preferably, the second promoter extends in a 3’ to 5’ direction.
• the promoters are bidirectional.
• the inventor’s use of bidirectional promoters provides the additional advantage of coordinated expression of two genes without the need of either additional genetic elements such as IRES elements, fusion proteins or self-cleaving 2A peptides, which can result in weak co-expression of two genes and which require additional transgene engineering that may affect protein stability and/or biological function.
• the use of bidirectional promoters avoids unidirectional promoter interference issues that may arise, for example when using lentivectors.
• the first expression cassette is arranged in the same direction as the second expression cassette.
• the first expression cassette is arranged in the opposite direction to the second expression cassette.
• the second promoter may be selected from the group consisting of: elongation factor 1 alpha (EF1 ⁇ ) promoter, EF1 ⁇ short (EFS) promoter, phosphoglycerate kinase (PGK) promoter, cytomegalovirus (CMV) immediate early promoter, spleen focus forming virus (SFFV) promoter, CASI promoter, myeloproliferative sarcoma virus (MPSV) long terminal repeat, murine stem cell virus (MSCV) long terminal repeat (LTR), and the composite CAG promoter, (consisting of the CMV immediate early enhancer and the chicken ⁇ -actin promoter).
• EF1 ⁇ elongation factor 1 alpha
• EFS EF1 ⁇ short
• PGK phosphoglycerate kinase
• CMV cytomegalovirus
• the inhibitor encoded by the second nucleic acid sequence is a direct inhibitor of the therapeutically active molecule or a reporter molecule.
• the inhibitor encoded by the second nucleic acid sequence is an inhibitor of the first promoter.
• the inhibitor of the first promoter may be part of the Tetracycline-Controlled Operator System or the Cumate-controlled operator system, such systems are well known to those skilled in the art.
• the inhibitor of the first promoter may be a Lac operon, wherein the second nucleic acid sequence comprises a Lac repressor and the first promoter comprises a Lac operator regulator site.
• the first promoter and first nucleic acid sequence is 5’ to the second promoter sequence and the second nucleic acid sequence.
• the first promoter and first nucleic acid sequence is 3’ to the second promoter sequence and the second nucleic acid sequence.
• the genetic construct may comprise, in this specified order in a 5’ to 3’ orientation, the first promoter sequence operably linked to the first nucleic acid sequence, the first nucleic acid sequence encoding a reporter molecule and/or a therapeutic molecule, the second promoter sequence operably linked to the second nucleic acid sequence, the second nucleic acid sequence encoding an inhibitor of the first promoter.
• the genetic construct may comprise, in this specified order in a 5’ to 3’ orientation, the second promoter sequence operably linked to the second nucleic acid, the second nucleic acid sequence encoding an inhibitor of the first promoter, the first promoter sequence operably linked to the first nucleic acid sequence and the first nucleic acid sequence encoding a reporter molecule and/or a therapeutic molecule.
• 5’ and 3’ indicates that the features are either upstream or downstream, and is not intended to indicate that the features are necessarily terminal features.
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 5, or a fragment or variant thereof.
• Another embodiment of the genetic construct is shown in Figure 8H, and is referred to herein as SEQ ID No: 78, as follows: t t t tt t t t t t t tttt t ttttt t tttt t tttt t t t t tt t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 78, or a fragment or variant thereof.
• FIG. 8D Another embodiment of the genetic construct is shown in Figure 8D and may comprise a Bax encoding sequence and be represented by SEQ ID No: 22, as follows:
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 22, or a fragment or variant thereof.
• Figure 8I Another embodiment of the genetic construct comprising a Bax encoding sequence is shown in Figure 8I and is represented by SEQ ID No: 79, as follows:
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 79, or a fragment or variant thereof.
• Another embodiment of the genetic construct is shown in Figure 8E and may comprise an Apoptin encoding sequence and be represented by SEQ ID No: 23, as follows:
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 23, or a fragment or variant thereof.
• Another embodiment of the genetic construct comprising an Apoptin encoding sequence is shown in Figure 8J and is represented by SEQ ID No: 80, as follows:
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 80, or a fragment or variant thereof.
• Another embodiment of the genetic construct is shown in Figure 8F and may comprise an E4orf4 encoding sequence and be represented by SEQ ID No: 24, as follows: [SEQ ID No: 24]
• the genetic construct comprises a nucleic acid sequence substantially as set out in SEQ ID No: 24, or a fragment or variant thereof.
• FIG. 8K Another embodiment of the genetic construct comprising an E4orf4 encoding sequence is shown in Figure 8K and is represented by SEQ ID No: 81, as follows: tttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggc gagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactc atggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgtggttttactgtcatgccatcc
• FIG. 8G Another embodiment of the genetic construct is shown in Figure 8G and may comprise a Bim encoding sequence and be represented by SEQ ID No: 27, as follows: acgcgtgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaagcaccgtgcatgccgatt ggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatatt gtatttaagtgcctagctcgatacaataaacgggtctctctggttagaccagatctgagcctgggagctctggttagaccagatctgagcctggga
• FIG. 8L Another embodiment of the genetic construct comprising a Bim encoding sequence is shown in Figure 8L and is represented by SEQ ID No: 82, as follows: ⁇ gcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgggACACACCAAGGATA ATTTCTCCCGATACACACCAAGGATAATTTCTCCTCACACACACCAAGGATAATTTCTCCCGATA CACACCAAGGATAATTTCTCCTCACAACTGGATGTCCCTGTATGATTCGATAACTGGATGTCCCTGTATGATTCGATAACTGGATGTCCCTGTATGATTTCCCTGTATGATTTCCCTGTATGATTCGATAACTGGATGTCCCTGTATGATTTCA CAAAGAGGTTAACCATGTATTATCGATAAAGAGGTTAACCATGTATTATTCACAAAGAGGTTAA CCATGTATTATCGATAAAG
• recombinant AAV (rAAV) vector can mean a recombinant AAV-derived nucleic acid containing at least one terminal repeat sequence.
• the vector is a recombinant lentiviral vector.
• the lentiviral vector may be integrative or non-integrative.
• the lentiviral vector is non- integrative.
• the vector of the second aspect is an episomal vector.
• the vector of the second aspect is recombinant.
• Recombinant vectors may also include other functional elements. For example, they may further comprise a variety of other functional elements.
• the vector is capable of autonomously replicating in the nucleus of the host cell or the vector is preferably incapable of autonomously replicating in the nucleus of the host cell.
• elements which induce or regulate DNA replication may be required in the recombinant vector.
• the recombinant vector may be designed such that it integrates into the genome of a host cell.
• DNA sequences which favour targeted integration are envisaged.
• Suitable promoters may include the SV40 promoter, CMV, EF1a, PGK, viral long terminal repeats, as well as inducible promoters, such as the Tetracycline inducible system, as examples.
• the cassette or vector may also comprise a terminator, such as the Beta globin, SV40 polyadenylation sequences or synthetic polyadenylation sequences.
• the recombinant vector may also comprise a regulator or enhancer to control expression of the nucleic acid as required.
• the vector may also comprise DNA coding for a gene that may be used as a selectable marker in the cloning process, i.e. to enable selection of cells that have been transfected or transformed, and to enable the selection of cells harbouring vectors incorporating heterologous DNA. For example, ampicillin, neomycin, puromycin or chloramphenicol resistance is envisaged.
• the selectable marker gene may be in a different vector to be used simultaneously with the vector containing the genetic construct.
• the vector may also comprise DNA involved with regulating expression of the nucleotide sequence, or for targeting the expressed polypeptide to a certain part of the host cell.
• the genetic construct according to the first aspect, or the vector according to the second aspect for use in therapy.
• the genetic construct according to the first aspect, or the vector according to the second aspect for use in treating, preventing or ameliorating cancer.
• a method of treating, preventing or ameliorating cancer in a subject comprising administering, or having administered, to a patient in need of such treatment, a therapeutically effective amount of the genetic construct according to the first aspect, or the vector according to the second aspect.
• the cancer is T-ALL.
• agents may be used in a monotherapy (e.g. the use of the genetic constructor the vector alone), for therapy, preferably for treating, ameliorating or preventing cancer.
• agents according to the invention may be used as an adjunct to, or in combination with, known therapies for therapy, preferably for treating, ameliorating, or preventing cancer.
• the agents according to the invention may be combined in compositions having a number of different forms depending, in particular, on the manner in which the composition is to be used.
• the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposome suspension or any other suitable form that may be administered to a person or animal in need of treatment.
• vehicle of medicaments according to the invention should be one which is well- tolerated by the subject to whom it is given.
• Medicaments comprising agents of the invention may be used in a number of ways. For instance, oral administration may be required, in which case the agents may be contained within a composition that may, for example, be ingested orally in the form of a tablet, capsule or liquid.
• compositions comprising agents and medicaments of the invention may be administered by inhalation (e.g. intranasally).
• Compositions may also be formulated for topical use. For instance, creams or ointments may be applied to the skin.
• Agents and medicaments according to the invention may also be incorporated within a slow- or delayed-release device. Such devices may, for example, be inserted on or under the skin, and the medicament may be released over weeks or even months. The device may be located at least adjacent the treatment site. Such devices may be particularly advantageous when long-term treatment with agents used according to the invention is required and which would normally require frequent administration (e.g. at least daily injection).
• agents and medicaments according to the invention may be administered to a subject by injection into the blood stream or directly into a site requiring treatment.
• Injections may be intravenous (bolus or infusion) or subcutaneous (bolus or infusion), or intradermal (bolus or infusion).
• amount of the genetic construct or the vector (i.e. agent) that is required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physiochemical properties of the agent, and whether it is being used as a monotherapy or in a combined therapy.
• the frequency of administration will also be influenced by the half-life of the agent within the subject being treated.
• Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular agent in use, the strength of the pharmaceutical composition, the mode of administration, and the advancement of the disease being treated, for example cancer. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet, and time of administration. Generally, a daily dose of between 0.001 ⁇ g/kg of body weight and 10mg/kg of body weight of agent according to the invention may be used for therapy, and in particular for treating, ameliorating, or preventing cancer, depending upon which agent.
• the daily dose of agent is between 0.01 ⁇ g/kg of body weight and 1mg/kg of body weight, more preferably between 0.1 ⁇ g/kg and 100 ⁇ g/kg body weight, and most preferably between approximately 0.1 ⁇ g/kg and 10 ⁇ g/kg body weight.
• the dose administered to a subject may be between 0.5x10 7 and 5 x10 12 Transducing Units (TU)/Kg of body weight. More preferably, the dose administered to a subject may be between 0.5x10 8 to 5 x10 11 TU/Kg of body weight. Most preferably, the dose administered to a subject may be between 0.5x10 9 to 5 x10 10 TU/Kg of body weight.
• the agent may be administered before, during or after onset of the cancer.
• Daily doses may be given as a single administration (e.g. a single daily injection).
• the agent may require administration twice or more times during a day.
• agents may be administered as two (or more depending upon the severity of the disease being treated, for example cancer) daily doses of between 0.07 ⁇ g and 700 mg (i.e. assuming a body weight of 70 kg).
• a patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3- or 4-hourly intervals thereafter.
• the agent may require administration once a week for even once a month.
• a slow release device may be used to provide optimal doses of agents according to the invention to a patient without the need to administer repeated doses.
• Known procedures such as those conventionally employed by the pharmaceutical industry (e.g. in vivo experimentation, clinical trials, etc.), may be used to form specific formulations of the agents according to the invention and precise therapeutic regimes (such as daily doses of the agents and the frequency of administration).
• a pharmaceutical composition comprising the genetic construct according to the first aspect, or the vector according to the second aspect, and optionally a pharmaceutically acceptable vehicle.
• the pharmaceutical composition is preferably an anti-cancer composition, i.e.
• a pharmaceutical formulation used in the therapeutic amelioration, prevention or treatment of cancer in a subject and preferably used in the therapeutic amelioration, prevention or treatment of T-ALL in a subject.
• the invention also provides in a seventh aspect, a process for making the pharmaceutical composition according to the sixth aspect, the process comprising combining a therapeutically effective amount of the genetic construct according to the first aspect, or the vector according to the second aspect, with a pharmaceutically acceptable vehicle.
• a “subject” may be a vertebrate, mammal, or domestic animal.
• medicaments according to the invention may be used to treat any mammal, for example livestock (e.g. a horse), pets, or may be used in other veterinary applications. Most preferably, the subject is a human being.
• a “therapeutically effective amount” of the genetic construct or the vector is any amount which, when administered to a subject, is the amount of agent that is needed to treat the disease being treated, for example cancer, or produce the desired effect.
• the therapeutically effective amount of the genetic construct or the vector used may be from about 0.001 ng to about 1 mg, and preferably from about 0.01 ng to about 100 ng. It is preferred that the amount the genetic construct or the vector is an amount from about 0.1 ng to about 10 ng, and most preferably from about 0.5 ng to about 5 ng.
• a “pharmaceutically acceptable vehicle” as referred to herein, is any known compound or combination of known compounds that are known to those skilled in the art to be useful in formulating pharmaceutical compositions.
• the pharmaceutically acceptable vehicle may be a solid, and the composition may be in the form of a powder or tablet.
• a solid pharmaceutically acceptable vehicle may include one or more substances which may also act as flavouring agents, lubricants, solubilisers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, dyes, coatings, or tablet- disintegrating agents.
• the vehicle may also be an encapsulating material.
• the vehicle is a finely divided solid that is in admixture with the finely divided active agents according to the invention.
• the active agent may be mixed with a vehicle having the necessary compression properties in suitable proportions and compacted in the shape and size desired.
• the powders and tablets preferably contain up to 99% of the active agents.
• suitable solid vehicles include, for example calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins.
• the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.
• the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition is in the form of a solution.
• Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions.
• the active agent according to the invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
• a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
• the liquid vehicle can contain other suitable pharmaceutical additives such as solubilisers, emulsifiers, buffers, preservatives, sweeteners, flavouring agents, suspending agents, thickening agents, colours, viscosity regulators, stabilizers or osmo-regulators.
• suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing additives as above, e.g. cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, e.g.
• the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate.
• Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration.
• the liquid vehicle for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
• Liquid pharmaceutical compositions which are sterile solutions or suspensions, can be utilized by, for example, intramuscular, intrathecal, epidural, intraperitoneal, intravenous and particularly subcutaneous injection.
• the agent may be prepared as a sterile solid composition that may be dissolved or suspended at the time of administration using sterile water, saline, or other appropriate sterile injectable medium.
• the agents and compositions of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (for example, enough saline or glucose to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monoleate, polysorbate 80 (oleate esters of sorbitol and its anhydrides copolymerized with ethylene oxide) and the like.
• the agents used according to the invention can also be administered orally either in liquid or solid composition form.
• compositions suitable for oral administration include solid forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixirs, and suspensions.
• forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.
• the genetic construct of the invention may comprise a reporter gene, which may be specifically expressed in diseased cells.
• the genetic construct and vector of the invention may also be used as a robust diagnostic tool.
• the construct of the invention can advantageously be used to detect the miRNA expression profile of a tumour in a patient, identifying the tumour subtype, which can be used to determine a suitable treatment for the patient.
• the construct of the invention can be used to simply detect the presence of a cancer.
• the genetic construct according to the first aspect, or the vector according to the second aspect for use in diagnosis.
• the genetic construct according to the first aspect, or the vector according to the second aspect for use in diagnosing cancer.
• a method of diagnosis or prognosis comprising detecting the reporter molecule of the genetic construct according to the first aspect, or the vector according to the second aspect in the sample obtained from a subject.
• a method of diagnosing or prognosing cancer in a subject comprising detecting the reporter molecule of the genetic construct according to the first aspect, or the vector according to the second aspect in a sample obtained from a subject.
• the cancer is T-ALL.
• Prognosis may relate to determining the therapeutic outcome in a subject that has been diagnosed with a disease, preferably cancer.
• Prognosis may relate to predicting the rate of progression or improvement and/or the duration of disease in a subject, the probability of survival, and/or the efficacy of various treatment regimes. Thus, a poor prognosis may be indicative of disease progression, low probability of survival and reduced efficacy of a treatment regime.
• a favourable prognosis may be indicative of disease resolution, high probability of survival and increased efficacy of a treatment regime.
• the diagnostic method may be performed in vivo.
• the method of diagnosis is preferably performed in-vitro or ex-vivo.
• the method of diagnosis is performed in-vitro.
• the method of diagnosis is performed ex-vivo.
• the invention also provides a kit for diagnosing patients suffering from cancer.
• a kit for diagnosing a subject suffering from cancer, or a pre-disposition thereto, or for providing a prognosis of the subject’s condition the kit comprising the genetic construct according to the first aspect, or the vector according to the second aspect.
• the sample may be a biological sample or an imaging sample.
• the imaging sample may be a PET scan image or an MRI image.
• the sample comprises a biological sample.
• the sample may be any material that is obtainable from a subject.
• the biological sample may be tissue or a biological fluid.
• the sample may be blood, plasma, serum, spinal fluid, urine, sweat, saliva, tears, breast aspirate, breast milk, prostate fluid, seminal fluid, vaginal fluid, stool, cervical scraping, cytes, amniotic fluid, intraocular fluid, mucous, moisture in breath, animal tissue, cell lysates, tumour tissue, hair, skin, buccal scrapings, lymph, interstitial fluid, nails, bone marrow, cartilage, prions, bone powder, ear wax, lymph, granuloma, cerebrospinal fluid, cancer biopsy or combinations thereof.
• the sample may be a liquid aspirate.
• the sample may be bronchial alveolar lavage (BAL), ascites, pleural lavage, or pericardial lavage.
• the sample may comprise blood, urine, tissue etc.
• the biological sample comprises a blood sample.
• the blood may be venous or arterial blood. Blood samples may be assayed immediately. Alternatively, the blood sample may be stored at low temperatures, for example in a fridge or even frozen before the method is conducted. Alternatively, the blood sample may be stored at room temperature, for example between 18 to 22 degrees Celsius, before the method is conducted.
• the blood sample may comprise blood serum.
• the blood sample may comprise blood plasma. Preferably, however, the detection is carried out on whole blood and most preferably the blood sample is peripheral blood.
• the blood sample may comprise circulating tumour cells, such that the construct can be used to detect the miRNA expression profile of the circulating tumour cells and thus identify the best treatment option for the patient.
• the blood may be further processed before the diagnostic method is performed.
• an anticoagulant such as citrate (such as sodium citrate), hirudin, heparin, PPACK, or sodium fluoride may be added.
• the sample collection container may contain an anticoagulant in order to prevent the blood sample from clotting.
• the construct of the invention may be used to detect cancer cells, or to determine cancer subtype, in the cerebrospinal fluid that has been obtained from a patient.
• the biological sample may comprise cerebrospinal fluid
• the invention extends to any nucleic acid or peptide or variant, derivative or analogue thereof, which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including variants or fragments thereof.
• the terms “substantially the amino acid/nucleotide/peptide sequence”, “variant” and “fragment”, can be a sequence that has at least 40% sequence identity with the amino acid/nucleotide/peptide sequences of any one of the sequences referred to herein, for example 40% identity with the sequence identified as SEQ ID Nos: 1-82 and so on.
• amino acid/polynucleotide/polypeptide sequences with a sequence identity which is greater than 65%, more preferably greater than 70%, even more preferably greater than 75%, and still more preferably greater than 80% sequence identity to any of the sequences referred to are also envisaged.
• the amino acid/polynucleotide/polypeptide sequence has at least 85% identity with any of the sequences referred to, more preferably at least 90% identity, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity and, most preferably at least 99% identity with any of the sequences referred to herein.
• the skilled technician will appreciate how to calculate the percentage identity between two amino acid/polynucleotide/polypeptide sequences.
• an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value.
• the percentage identity for two sequences may take different values depending on:- (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g.
• Alternative methods for identifying similar sequences will be known to those skilled in the art.
• a substantially similar nucleotide sequence will be encoded by a sequence which hybridizes to DNA sequences or their complements under stringent conditions.
• the inventors mean the nucleotide hybridises to filter-bound DNA or RNA in 3x sodium chloride/sodium citrate (SSC) at approximately 45oC followed by at least one wash in 0.2x SSC/0.1% SDS at approximately 20-65oC.
• a substantially similar polypeptide may differ by at least 1, but less than 5, 10, 20, 50 or 100 amino acids from the sequences shown in, for example, in those of SEQ ID Nos: 1 to 82 that are amino acid sequences. Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence described herein could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof.
• Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent (synonymous) change.
• Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change.
• small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine.
• Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine.
• the polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine.
• the positively charged (basic) amino acids include lysine, arginine and histidine.
• the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids.
• FIG. 1 shows a schematic representation of miRNA-mediated silencing of a target mRNA. Both mRNAs and miRNAs are transcribed from their gene precursors. The miRNAs then bind to complementary regions of their target mRNAs leading to their degradation.
• Figure 2 shows a schematic representation of one embodiment of the microRNA- detector system and associated genetic construct of the invention for therapeutic gene delivery in T-ALL cells.
• Figure 3 shows microRNA relative expression in T-ALL and non-T-ALL cells determined by RT-qPCR and calculated using the 2 - ⁇ Ct method.
• Figure 4 shows a schematic representation of one embodiment of a pCDH-EF1-MCS- T2A-GFP (PGK-Puro) expression vector from SBI.
• Figure 5 shows a schematic representation of a bidirectional lentiviral expression vector (“bdLV”) modified to express the Lac operon depicting a 2-step approach.
• Figure 6 shows the results from cloning of Lac operator sequences (LacO) downstream of the EF1 promoter.
• A) shows GFP expression of 293T cells transfected with bdLV vector or bdLV_LacO vector.
• B.i) shows GFP expression of 293T cells transfected with bdLV_LacO vector or BdLV_LacO and LacI vectors.
• B.ii) shows GFP expression of 293T cells co-transfected with bdLV_LacO and LacI vectors and treated or not with IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside) for 24 and 48h. Unt.- untransfected.
• Figure 7 shows the results from cloning of the Lac repressor (LacI) downstream of PGK promoter.
• FIG. 8 shows schematic representations of two embodiments of the microRNA detector system (A and B) and associated genetic constructs with the possible combinations of microRNA target sites C, D, E, F G, H, I, J, K and L).
• Figures 9A-9B show the in vitro validation of the efficiency and specificity of the microRNA-detectors with target sequences for miR-29a and miR-149.
• T-ALL (A) and non-T-ALL (B) cells were transduced with the microRNA-detectors BdLV_miR29a_4xT, BdLV_miR149_4xT, and BdLV_miR29a_4xT_miR149_4xT.
• GFP expression was analysed by flow cytometry and used as readout to determine the efficiency of the detectors to repress the reporter gene expression.
• Figures 10A-10B show the in vitro validation of the efficiency and specificity of the microRNA-detectors with target sequences for miR-128a and miR-153.
• T-ALL cells were transduced with the microRNA-detectors BdLV_miR128a_4xT, BdLV_miR153_4xT and BdLV_miR128a_4xT_miR153_4xT.
• GFP expression was analyzed by flow cytometry and used as readout to determine the efficiency of the microRNA-detectors to de-repress the reporter gene promoter through LacI.
• Figure 11 shows in vitro validation of a construct comprising dual miRNA target sites.
• Figure 12 shows the in vitro validation of the efficiency and specificity of the micro- RNA detectors comprising two, three or four miRNA target sites.
• Figure 13 shows the in vitro validation of the efficiency and specificity of the micro- RNA detectors in cultures of T-ALL and non-T-ALL cells transduced with non- integrative lentiviral vectors.
• the recombinant genetic construct of the invention that uses microRNAs to: (1) identify T-ALL cells, and then (2) regulate the expression of a therapeutic gene (an apoptosis-inducing gene) into leukaemia cells.
• a therapeutic gene an apoptosis-inducing gene
• the construct Based on a pre-determined microRNA profile that is specific to T-ALL cells only, when expressed inside a host cell, the construct first determines whether the host cells are leukaemia cells and, if so, the construct then induces cell death.
• a positive match between the expression of specific microRNAs inside a T-ALL cell and the construct results in the delivery of a therapeutic gene to those T-ALL cells, inducing their death but not of the normal healthy cells (see Figure 2A).
• the intrinsic ability of this system to distinguish between a T-ALL cell and a non-T-ALL cell within the body of the patient is, hence, a unique aspect of the invention. This therefore provides the significant advantage over other gene therapy technologies applied to precision oncology, and it has been deliberately designed to provide the best possible efficacy and safety outcomes for patients.
• the delivery of the therapeutic gene is regulated both by microRNAs which are present only (or highly expressed) in T-ALL cells as well as microRNAs which are specifically absent (or significantly less expressed) in those cells.
• microRNAs A and B are absent; and (2) microRNAs C and D are expressed in the same cell (see Figure 2B).
• MicroRNAs have been previously explored to negatively regulate gene expression.
• the present invention uses the concomitant presence and absence of specific microRNAs to positively regulate the expression of the therapeutic gene. This dual layer of regulation is achieved by the use of a bidirectional expression vector and a negative feedback loop.
• the inventors compared the non-T-ALL samples (control group) with the T-ALL samples (T-ALL group).
• the samples analyzed in the control groups varied between studies and included healthy tissue of lung, colon, bladder, brain, kidney, breast, total bone marrow (BM) cells, total thymocytes, hematopoietic CD34+ BM cells, CD4+ T cells, CD8+ T cells and CD4+CD8+CD3+ T-cells.
• the T-ALL groups included T-ALL primary cells and cell lines.
• the minimum expression value of a certain miRNA in that group had to be higher than the maximum expression value of that microRNA in the control group.
• that miRNA was considered down-regulated in the T-ALL samples.
• the inventors were able to identify 12 miRNAs which were down-regulated and up-regulated in the different datasets. Subsequently, the inventors established a further T-ALL-specific microRNA expression profile by bioinformatics analyses of publicly available microRNA data obtained from human T-ALL cells and normal cells and tissues.
• T-ALL cell lines and patient cells encompassed approximately 140 T-ALL cell lines and patient cells and approximately 480 normal tissue samples including brain, liver, kidney, lung, heart, breast, bladder, colon, uterus, skin, ovary, pancreas, prostate, stomach, testis, meninges, thyroid, thymus, bone marrow, spleen, lymph nodes and peripheral blood.
• the hematopoietic and lymphoid organs covered different lineages and different differentiation stages, including hematopoietic stem and precursor cells. This analysis identified 25 microRNAs, as shown in Table 1 below. Table 1
• T-ALL-specific microRNA expression profile was performed by real-time PCR quantification of each microRNA expression, using TaqMan MicroRNA assays (Applied Biosystems). MicroRNA expression was analyzed in T-ALL cell lines corresponding to different differentiation stages (Jurkat, DND4.1, MOLT4, CEM, SUP- T1, HPB-ALL, TALL-1, P12 and Loucy) and several non-T-ALL cell lines such as 293T, A549, MDA231, CaCO2, U2OS, HCT-116, ACHN, A498 and D458.
• T-ALL cell lines were cultured in RPMI-1640 medium with L-glutamine supplemented with 10% of fetal bovine serum (FBS) and 1% penicillin/streptomycin (Pen/Strep).
• Non-T-ALL cell lines were cultured as follows: 293T, A549, MDA231 and CaCO2 in Dulbecco's Modified Eagle's medium supplemented with 10% FBS and 1% Pen/Strep; U2OS; HCT-116 in McCoy's 5A medium with 10% FBS and 1% Pen/Strep; ACHN and A498 in Eagle's Minimum Essential Medium with 10% FBS and 1% Pen/Strep; and D458 in Iscove's Modified Dulbecco's Media with 10% FBS and 1% Pen/Strep.
• microRNA expression quantification was performed using the Applied Biosystems TaqMan MicroRNA Reverse Transcription Kit, in combination with TaqMan miRNA Assays. This is a two-step process that starts with the reverse transcription of microRNA to cDNA using a microRNA RT specific primer. This reaction was followed by real-time PCR amplification of microRNAs, using microRNA- specific TaqMan probes. The PCR reactions were performed using Vii7 Real Time PCR system. MicroRNA expression was normalized using RNU6b and microRNA relative expression calculated using the 2 - ⁇ Ct method.
• MicroRNA-detectors i.e. the constructs of the invention
• PGK-Puro pCDH- EF1-MCS-T2A-GFP
• SBI pCDH- EF1-MCS-T2A-GFP
• This bidirectional promoter expression vector allows the expression of GFP with a constitutive EF1 promoter. In negative orientation, the PGK promoter drives the expression of the puromycin marker.
• GFP was used as a surrogate for the therapeutic gene.
• the inventors started by introducing the Lac operon system into the vector backbone shown in Figure 4, the bidirectional lentiviral expression vector (bdLV).
• STEP 1 Cloning Lac operator sequences (LacO) downstream of the EF1 promoter.
• the inventors amplified the SV40 intron containing three copies of the Lac Operator sequence (SV40intron/3LacO) from the pOPI3CAT (LacSwitch II Inducible Mammalian Expression System from Agilent) and cloned it into the bdLV (bdLV_LacO).
• SV40intron/3LacO was amplified using primers with restriction sites for EcoRI and NotI (Table 3).
• both PCR product and BdLV vector were digested with EcoRI and NotI restriction enzymes (Thermo Scientific).
• the digested SV40intron/3LacO PCR product and the BdLV vector were then ligated using T4 DNA ligase (Fermentas).
• the correct insertion of LacO sequences was confirmed by restriction enzyme diagnostic digestion and Sanger sequencing.
• STEP 2 Cloning the Lac repressor (LacI) downstream of PGK promoter. This step involved the replacement of the puromycin by LacI (in reverse orientation).
• the LacI was PCR-amplified from the pCMVLacI vector (LacSwitch II Inducible Mammalian Expression System from Agilent) and sub-cloned into a smaller vector (pcDNA3.1+) to be obtained in reverse orientation.
• LacI_NLS was amplified using primers with restriction sites for the blunt-end SmaI (Table 3).
• LacI_NLS PCR product and pcDNA3.1+ vector were digested with SmaI (from NEB).
• the digested LacI_NLS fragment and pcDNA3.1+ vector were then ligated using T4 DNA ligase (Fermentas).
• T4 DNA ligase Framas
• the insertion of LacI in the correct orientation was confirmed by restriction enzyme digestion and Sanger sequencing.
• directed mutagenesis QuickChange Lightning Site-Directed Mutagenesis kit from Agilent was used to create the restriction enzymes sites necessary to cut out the puromycin cDNA from the bdLV_LacO vector and replace it by LacI.
• bdLV_LacO size approximately 10 Kb
• the region of the bdLV_LacO vector to be mutated was removed and sub-cloned into pcDNA3.1+ vector. More specifically, the restriction enzymes NotI and EcoRI were used to digest both the bdLV_LacO and pcDNA3.1+ vectors. Puromycin digestion product and digested pcDNA3.1+ were ligated using T4 DNA ligase (Fermentas). This intermediate smaller vector (approximately 6.7 Kb) was used to eliminate one XhoI restriction site and to generate an AvrII restriction site.
• puromycin and flanking regions was amplified using primers with restriction enzymes sites for HpaI and SpeI (Table 3) and cloned back into bdLV vector upon ligation of the PCR product and vector digested with those enzymes. Puromycin was then removed from bdLV_LacO vector using XhoI and AvrII restriction enzymes while, the same enzymes were used to cut out LacI from pcDNA3.1+ vector_LacI. T4 DNA ligase was used to ligate bdLV_LacO vector and LacI, creating bdLV_LacI_LacO vector.
• the correct insertion of LacI in the bdLV_LacO vector was confirmed by restriction enzyme diagnostic digestion and Sanger sequencing.
• the inventors cloned four target sites of miR-29a, miR-149, or miR-29a and miR- 149 (microRNAs specifically absent or down-regulated in T-ALL cells) downstream of the reporter gene promoter, in the bdLV_LacI_LacO construct. To this end, they created a restriction enzyme site for XmaI downstream of GFP.
• Four target sites of each microRNA were synthesized in tandem and introduced into bdLV-LacI_LacO vector upon digestion with XmaI and ligation with T4 DNA ligase.
• the inventors cloned four target sites of miR-128a or miR-153 (microRNAs specifically up-regulated in T-ALL cells) downstream of the repressor of the reporter gene promoter, in the bdLV_LacI_LacO construct.
• four target sites of each microRNA were synthesized in tandem and introduced in the bdLV- LacI_LacO vector upon digestion with the restriction enzyme XhoI and ligation with the T4 DNA ligase.
• References for the methods used 1) Landgraf, P. et al. (2007) Cell 29;129(7):1401-14 2) Rosenfeld, N. et al. (2008) Nat Biotechnol Apr;26(4):462-9 3) Fulci, V.
• microRNAs most likely to be used in the construction of the microRNA detector, 10 specifically down-regulated (miR-539-5p, miR-487a-3p, miR-655-3p, miR-411-3p, miR-377-5p, miR-337-5p, miR- 31-3p, miR-214-5p, miR-1185-5p and miR-483-5p) and 6 specifically up-regulated (miR-3687, miR-92a-2-5p, miR-20b-3p, miR-6087, miR-106a-3p and miR-7704) in T- ALL cells.
• 10 specifically down-regulated miR-539-5p, miR-487a-3p, miR-655-3p, miR-411-3p, miR-377-5p, miR-337-5p, miR- 31-3p, miR-214-5p, miR-1185-5p and miR-483-5p
• 6 specifically up-regulated miR-3687, miR-92a-2-5p, miR-20b-3p, mi
• Example 3 Design and construction of microRNA-detectors/constructs
• the microRNA-detector construct developed by the inventors consists of a bidirectional lentiviral expression vector, in which the therapeutic gene is expressed by one promoter, and a repressor of the therapeutic gene promoter is expressed by the second promoter.
• the Lac operon system is used as the repressor.
• the expression of both mRNAs is regulated by T-ALL-cell-specific microRNAs.
• GFP was used instead of an apoptosis-inducing gene (i.e. GFP expression was used as a surrogate for the therapeutic gene).
• the inventors used the pCDH-EF1-MCS-T2A-GFP (PGK-Puro) expression vector from SBI (referred to as BdLV).
• This bidirectional promoter expression vector allows the expression of GFP with a constitutive EF1 promoter. In negative orientation the PGK promoter drives the expression of the puromycin marker.
• the inventors introduced a Lac operon system in the backbone vector, as shown in Figure 5, which functioned as the repression system.
• the process was divided in two steps: i) Cloning Lac operator sequences (LacO) downstream of the EF1 promoter As shown in Figure 6, the Lac repressor (LacI) binds to Lac Operator (LacO) regulatory sites in the promoter turning off transcription, confirming that the insertion of LacO sequences does not affect the expression of GFP by the EF1 promoter ( Figure 6A). The inventors further confirmed that the LacO was functional. The inventors verified that LacI proteins can bind to Lac operator sequences in bdLV_LacO and repress GFP expression by the EF1 promoter. As shown in Figure 6Bi, transfection of a LacI expression vector in bdLV_LacO expressing cells resulted in decreased GFP expression.
• the inventors further confirmed the ability of LacO to repress EF1 promoter by treating cells co-transfected with LacI and bdLV_LacO vectors with Isopropyl ⁇ -D-1- thiogalactopyranoside (IPTG) for 24 and 48h.
• IPTG Isopropyl ⁇ -D-1- thiogalactopyranoside
• the increase in GFP expression observed when cells are treated with IPTG shows that in the absence of IPTG, LacI binds to Lac operator sequences repressing GFP transcription by the EF1 promoter ( Figure 6Bii).
• ii) Cloning of the Lac repressor (LacI) downstream of PGK promoter This step involved the replacement of the puromycin by LacI (in reverse orientation).
• the LacI was PCR-amplified from the pCMVLac vector (LacSwitch II Inducible Mammalian Expression System from Agilent) and sub-cloned into a smaller vector (pCDN3.1+) to be expressed in the reverse orientation.
• directed mutagenesis was used to create the restriction enzymes sites necessary to cut out the puromycin cDNA from the bdLV_LacO vector and replace it by LacI.
• the inventors confirmed that the LacI proteins expressed by the PGK promoter were functional, binding to the Lac operator sequences in bdLV_LacI_LacO and repressing GFP expression by the EF1 promoter.
• the inventors cloned four target sites of miR-128a or miR-153 (microRNAs specifically up-regulated in T-ALL cells) downstream of the repressor of the reporter gene promoter, in the bdLV_LacI_LacO construct, as shown in Figure 8B.
• Example 4 Testing of the microRNA-detector efficiency and specificity in vitro
• T-ALL ‘A’ of Figures 9A and 9B) or non-T-ALL (‘B’ of Figures 9A and 9B) cells
• BdLV_miR29a_4xT BdLV_miR149_4xT
• BdLV_miR29a_4xT BdLV_miR29a_4xT_miR149_4xT.
• transduction with the BdLV_miR29a_4xT_miR149_4xT detector has an additive effect, inducing a repressive effect on GFP expression higher than the detectors BdLV_miR29a_4xT and BdLV_miR149_4xT (‘B’ of Figures 9A and 9B).
• the inventors then performed cultures of T-ALL cells transduced with the microRNA-detectors BdLV_miR128_4xT,BdLV_miR153_4xT and BdLV_miR128_4xT_miR153_4xT.
• transduction with the microRNA-detectors BdLV_miR128_4xT_miR29a_4xT, BdLV_miR128_4xT_miR149_4xT, BdLV_miR128_4xT_miR29a_4xT_ miR149_4xT and BdLV_miR153_4xT_miR29a_4xT_ miR149_4xT resulted in the efficient repression of the reporter gene (up to 90% of GFP expression repression as compared with BdLV_LacI_LacO transduced cells in the microRNA-detectors containing both miR29a and 149 target sites).
• transduction with the microRNA-detectors BdLV_miR128_4xT_miR29a_4xT, BdLV_miR128_4xT_miR29a_4xT_ miR149_4xT and BdLV_miR153_4xT_miR29a_4xT_ miR149_4xT resulted in the efficient repression of the reporter gene.
• transduction with the construct BdLV_miR128_4xT_miR149_4xT had a small effect on reporter gene expression.
• transduction with the microRNA-detectors BdLV_miR-153_4xT-miR- 29a_4xT_miR-149_4xT, BdLV_miR-128_4xT-miR-29a_4xT_miR-149_4xT and BdLV miR-128_4xT _miR-153_4xT-miR-29a_4xT_miR-149_4xT resulted in the efficient repression of the reporter gene.
• transduction with the microRNA-detectors BdLV_miR-128_4xT-miR-149_4xT, BdLV_miR-153_4xT-miR-149_4xT and BdLV_miR-128_4xT miR-153_4xT-miR-149_4xT resulted in the efficient de- repression of the reporter gene.
• the inventors then performed cultures of T-ALL and non-T- ALL cells transduced with non-integrative lentiviral vectors.
• the inventors have generated compelling proof-of-concept data for the feasibility and effectiveness of microRNA-detectors to modulate GFP expression exclusively in T-ALL cells as a practical example of regulation of the activity of an effector gene in the first nucleic acid sequence encoding a therapeutically active molecule or a reporter molecule of the first aspect of the present invention.
• the inventors anticipate that such a system can be adapted in the future to other cancer types, or even other disease types, with the introduction of the relevant microRNA target sequences to the cancer or disease of interest, thereby paving the way to the use of this gene therapy technology in any disease in which cells display a varied miRNA profile.
• a therapeutic molecule can be delivered with high specificity and efficiency using just one single vector, and it does not require induction with external factors or cues.
• co-localisation of the encoded molecules in the same cell is achieved at lower dosages than would be possible using a multiple construct approach. As such, this results in a much simpler system that is therefore significantly advantageous over previous technologies.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Biomedical Technology (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Virology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)

Priority Applications (3)

Applications Claiming Priority (2)

Publications (1)

Family

ID=72749679

Family Applications (1)

Country Status (5)

Citations (3)

Family Cites Families (8)

• 2020
  • 2020-08-27 GB GBGB2013466.4A patent/GB202013466D0/en not_active Ceased
• 2021
  • 2021-08-25 WO PCT/PT2021/050028 patent/WO2022045912A1/en not_active Ceased
  • 2021-08-25 EP EP21772854.2A patent/EP4204572A1/en active Pending
  • 2021-08-25 JP JP2023513671A patent/JP2023540052A/ja active Pending
  • 2021-08-25 US US18/043,276 patent/US20230313229A1/en active Pending

Patent Citations (3)

Non-Patent Citations (32)

Also Published As

Similar Documents

Legal Events