WO2022019372A1 - 산소 내성 및 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도 - Google Patents
산소 내성 및 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도 Download PDFInfo
- Publication number
- WO2022019372A1 WO2022019372A1 PCT/KR2020/011468 KR2020011468W WO2022019372A1 WO 2022019372 A1 WO2022019372 A1 WO 2022019372A1 KR 2020011468 W KR2020011468 W KR 2020011468W WO 2022019372 A1 WO2022019372 A1 WO 2022019372A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- carbon monoxide
- dehydrogenase
- monoxide dehydrogenase
- amino acid
- increased oxygen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D53/00—Separation of gases or vapours; Recovering vapours of volatile solvents from gases; Chemical or biological purification of waste gases, e.g. engine exhaust gases, smoke, fumes, flue gases, aerosols
- B01D53/34—Chemical or biological purification of waste gases
- B01D53/74—General processes for purification of waste gases; Apparatus or devices specially adapted therefor
- B01D53/84—Biological processes
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D53/00—Separation of gases or vapours; Recovering vapours of volatile solvents from gases; Chemical or biological purification of waste gases, e.g. engine exhaust gases, smoke, fumes, flue gases, aerosols
- B01D53/34—Chemical or biological purification of waste gases
- B01D53/74—General processes for purification of waste gases; Apparatus or devices specially adapted therefor
- B01D53/86—Catalytic processes
- B01D53/864—Removing carbon monoxide or hydrocarbons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/02—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with a cytochrome as acceptor (1.2.2)
- C12Y102/02004—Carbon-monoxide dehydrogenase (cytochrome b-561)(1.2.2.4)
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D2255/00—Catalysts
- B01D2255/80—Type of catalytic reaction
- B01D2255/804—Enzymatic
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D2257/00—Components to be removed
- B01D2257/50—Carbon oxides
- B01D2257/502—Carbon monoxide
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D2258/00—Sources of waste gases
- B01D2258/06—Polluted air
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D2259/00—Type of treatment
- B01D2259/45—Gas separation or purification devices adapted for specific applications
- B01D2259/4508—Gas separation or purification devices adapted for specific applications for cleaning air in buildings
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
- B01D—SEPARATION
- B01D2259/00—Type of treatment
- B01D2259/45—Gas separation or purification devices adapted for specific applications
- B01D2259/4566—Gas separation or purification devices adapted for specific applications for use in transportation means
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/20—Air quality improvement or preservation, e.g. vehicle emission control or emission reduction by using catalytic converters
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/59—Biological synthesis; Biological purification
Definitions
- It relates to a carbon monoxide dehydrogenase having excellent oxygen tolerance and/or enzyme activity, and a use thereof.
- CO dehydrogenase CO dehydrogenase
- CODH carbon monoxide dehydrogenase
- CO dehydrogenase known to date has the advantage of having a fairly high unit activity of the enzyme, it is extremely vulnerable to oxygen molecules in the air, so there is a problem in that the activity of the enzyme is rapidly reduced.
- Most of the waste gas containing carbon monoxide contained oxygen even at a small concentration, and in an attempt to oxidatively convert CO contained in waste gas using CO dehydrogenase, the activity of CO dehydrogenase is reduced by the oxygen molecules contained in the waste gas. It decreased sharply and did not successfully achieve the desired purpose.
- the present inventors have developed a CO dehydrgenase having excellent oxygen tolerance as well as excellent enzymatic activity.
- One aspect is to provide carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a polynucleotide encoding a carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzymatic activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a vector expressing carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a microorganism expressing carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a method for producing carbon monoxide dehydrogenase, comprising culturing a microorganism expressing a polynucleotide encoding a carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzymatic activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a method of removing carbon monoxide, comprising the step of contacting carbon monoxide with carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a method for producing carbon dioxide, comprising the step of contacting carbon monoxide with carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a carbon monoxide removal device comprising a carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- Another aspect is to provide a filter comprising carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- CO dehydrogenase carbon monoxide dehydrogenase
- the oxygen tolerance means the ability of the carbon monoxide dehydrogenase to maintain its activity even in the presence of oxygen, and specifically, it can be confirmed by first contacting the enzyme with oxygen at a specific concentration and then measuring the activity of the carbon monoxide dehydrogenase.
- the oxygen resistance is 20 to 80%, 20 to 70%, 20 to 60%, 30 to 80%, 30 to 70%, 30 to 60%, 40 to 80%, 40 to 70 compared to the initial activity of the enzyme. % or by measuring the maximum oxygen concentration maintaining 40 to 60%.
- the carbon monoxide dehydrogenase has an oxygen tolerance of 1 to 200 times, 1 to 150 times, 1 to 125 times, 50 to 200 times, 50 to 150 times, 50 to 125 times compared to the wild type. , 75 to 200 times, 75 to 150 times, or 75 to 125 times may be increased.
- the enzyme activity refers to the activity of the carbon monoxide dehydrogenase catalyzing the reaction of Scheme 1:
- the activity of the carbon monoxide dehydrogenase can be confirmed by measuring carbon dioxide, hydrogen ions, or electrons generated by contacting carbon monoxide and water with the carbon monoxide dehydrogenase.
- the carbon monoxide dehydrogenase has an activity of 1 to 200 times, 1 to 150 times, 1 to 125 times, 50 to 200 times, 50 to 150 times, 50 to 125 times compared to the wild type. , 75 to 200 times, 75 to 150 times, or 75 to 125 times may be increased.
- the carbon monoxide dehydrogenase may be derived from nature or may be obtained by various protein synthesis methods well known in the art. As an example, it may be prepared using polynucleotide recombination and a protein expression system, or synthesized in vitro through chemical synthesis such as protein synthesis, or prepared by a cell-free protein synthesis method. Also, as an example, the carbon monoxide dehydrogenase may be a peptide, an extract of a plant-derived tissue or cell, or a product obtained by culturing a microorganism (eg, bacteria or fungi, and particularly yeast).
- a microorganism eg, bacteria or fungi, and particularly yeast
- protein refers to a polymer composed of two or more amino acids linked by amide bonds (or peptide bonds).
- the carbon monoxide dehydrogenase is an amino acid sequence of carbon monoxide dehydrogenase and about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 92% or more, about 95% or more, about 97, respectively % or greater, about 98% or greater, or about 99% or greater sequence homology.
- the carbon monoxide dehydrogenase may be an isoenzyme of the carbon monoxide dehydrogenase.
- the carbon monoxide dehydrogenase is Murella thermoacetica ( Moorella thermoacetica ), Rhodospirillum rubrum ), Carboxydothermus hydrogenoformans (Carboxydothermus hydrogenoformans), Methanococcus vannielii ( Methanococcus vannielii ), Methanosarcina barkeri ( Methanosarcina barkeri ), Methanothermobacter thermautotrophicus ( Methanothermobacter thermautotrophicus ), Clostridium pasteurianum ( Clostridium pasteurianum ), Oligotropha carboxidovorans ( Oligotropha carboxidovorans ), Erpyrum pernix ( Aeropyrum pernix ), Ferroglobus placidus ( Ferroglobus placidus ), Clostridium autoethanogenum ( Clostridium autoethanogenum ), Clostridium ragsdalei ), Clostridium ljungdahlii ), Clostridium
- Clostridium thermocellum C thermocellum
- Clostridium kluyveri C. kluyveri
- Clostridium botulinum C. botulinum
- It may be a derived carbon monoxide dehydrogenase, and specifically, a carbon monoxide dehydrogenase derived from Carboxydothermus hydrogenoformans ( Carboxydothermus hydrogenoformans ) may be, and more specifically, in the case of carbon monoxide dehydrogenase-2 (CODH-2) derived from wild-type Carboxydothermus hydrogenoformans , a protein encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1
- CODH-4 carbon monoxide dehydrogenase-4 (CODH-4) derived from wild-type Carboxydothermus hydrogenoformans
- it may be a protein encoded by a polynucleotide consisting of the nucle
- the carbon monoxide dehydrogenase is carbon monoxide dehydrogenase-1 (CODH-1), carbon monoxide dehydrogenase-2 (CODH-2), carbon monoxide dehydrogenase-3 (CODH-3) and carbon monoxide dehydrogenase-4 (CODH-4) It may be one carbon monoxide dehydrogenase selected from the group consisting of, specifically, carbon monoxide dehydrogenase-2 (CODH-2) or carbon monoxide dehydrogenase-4 (CODH-4), and more specifically, SEQ ID NO: 1 or It may be a protein encoded by a polynucleotide consisting of two nucleotide sequences.
- homology is intended to indicate a degree of similarity with a wild-type amino acid sequence, and the comparison of such homology can be performed using a comparison program well known in the art, and the homology between two or more sequences is It can be calculated as a percentage (%).
- a protecting group may be bonded to the C-terminus.
- the protecting group may be an acetyl group, a fluorenyl methoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group or polyethylene glycol (PEG), but the modification of the carbon monoxide dehydrogenase, particularly the stability of the carbon monoxide dehydrogenase As long as it is a component that can enhance the effect, it may be included without limitation.
- PEG polyethylene glycol
- stability may mean not only in vivo stability that protects the carbon monoxide dehydrogenase from attack by in vivo protein cleaving enzymes, but also storage stability (eg, room temperature storage stability).
- the carbon monoxide dehydrogenase may additionally include an amino acid sequence prepared for a specific purpose for a targeting sequence, a tag, and a labeled residue, specifically, His- expressed in pET-28 (SEQ ID NO: 3) plasmid It may be in a form bound to the protein at the end of the tag.
- the carbon monoxide dehydrogenase is the 82nd amino acid, the 559th amino acid, the 565th amino acid, the 578th amino acid, the 580th amino acid, the 586th amino acid, the 593th amino acid, the 597th amino acid and the 610th amino acid of the carbon monoxide dehydrogenase At least one amino acid selected from the group consisting of amino acids may be modified.
- the modification may be at least one selected from the group consisting of deletion, addition and substitution, one amino acid may be modified, and two or more amino acids may be modified.
- the 82nd amino acid of the carbon monoxide dehydrogenase is leucine
- the 559th amino acid of the carbon monoxide dehydrogenase is alanine
- the 565th amino acid of the carbon monoxide dehydrogenase is valine
- the 578th amino acid of the carbon monoxide dehydrogenase is Threonine
- the 580th amino acid of the carbon monoxide dehydrogenase is Isoleucine
- the 586th amino acid of the carbon monoxide dehydrogenase is isoleucine
- the 593th amino acid of the carbon monoxide dehydrogenase may be threonine
- the 597th amino acid of the carbon monoxide dehydrogenase may be threonine
- the 610th amino acid of the carbon monoxide dehydrogenase may be valine.
- the substituted amino acid is tryptophan, tyrosine, serine, histidine, aspartic acid, glutamic acid ), asparagine, alanine, threonine, glutamine, leucine, and valine may be at least one amino acid selected from the group consisting of.
- leucine which is the 82nd amino acid of the carbon monoxide dehydrogenase
- leucine which is the 82nd amino acid of the carbon monoxide dehydrogenase
- Alanine which is the 559th amino acid of the carbon monoxide dehydrogenase, is tryptophan, tyrosine, serine, histidine, aspartic acid, glutamic acid, and asparagine.
- Threonine may be substituted with Threonine or Glutamine;
- the 565th amino acid valine of the carbon monoxide dehydrogenase may be substituted with alanine, serine, or leucine;
- Threonine which is the 578th amino acid of the carbon monoxide dehydrogenase, may be substituted with serine;
- Isoleucine which is the 580th amino acid of the carbon monoxide dehydrogenase, may be substituted with leucine;
- Isoleucine which is the 586th amino acid of the carbon monoxide dehydrogenase, may be substituted with serine;
- Threonine which is the 593th amino acid of the carbon monoxide dehydrogenase, may be substituted with serine;
- Threonine which is the 597th amino acid of the carbon monoxide dehydrogenase, may be substituted with serine;
- Valine which is the 610th amino acid of the carbon monoxide de
- the carbon monoxide dehydrogenase may be a protein encoded by a polynucleotide consisting of one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 24 to 43.
- Another aspect provides a polynucleotide encoding a carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzymatic activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- the polynucleotide means that a plurality of nucleotides are continuously linked, and the polynucleotide may express carbon monoxide dehydrogenase.
- the term 'expression' refers to the process by which a polypeptide is produced from a structural gene. The process involves the transcription of a gene (polynucleotide) into mRNA and the translation of such mRNA into polypeptide (protein)(s).
- polynucleotide encoding an enzyme refers to a polynucleotide encoding an enzyme, or a polynucleotide further comprising additional coding and/or non-coding sequences.
- carbon monoxide dehydrogenase is carbon monoxide dehydrogenase-2 (CODH-2) derived from wild-type carboxydothermus hydrogenoformans
- CODH-2 carbon monoxide dehydrogenase-2
- it may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1
- wild-type carboxydo In the case of carbon monoxide dehydrogenase-4 (CODH-4) derived from Summer Hydrogenoformans (Carboxydothermus hydrogenoformans), it may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2.
- the polynucleotide encoding the carbon monoxide dehydrogenase having increased oxygen tolerance and/or enzymatic activity may be a polynucleotide consisting of one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 24 to 43.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- vector refers to a means for expressing a gene of interest in a host cell.
- the vector replicates DNA and can be reproduced independently in a host cell.
- Viral vectors such as, for example, plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors are included.
- the vector expressing the carbon monoxide dehydrogenase may be a recombinant vector, and a vector that can be used as a recombinant vector is a plasmid often used in the art (eg, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8).
- a plasmid often used in the art eg, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8.
- pUC6, pBD9 pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series (including pET-28 and pUC19, etc.), phage or virus (e.g., SV40, etc.), Specifically, it may be pET-28 (SEQ ID NO: 3).
- the term 'recombinant vector' includes any cloning or expression vector containing the cloned gene(s) of interest.
- the term 'recombinant' refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, heterologous peptide or protein encoded by the heterologous nucleic acid.
- the recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in either the sense or antisense form.
- recombinant cells can express genes found in cells in a natural state, but the genes are modified and re-introduced into the cell by artificial means.
- the polynucleotide encoding the enzyme may be operably linked to a promoter.
- operatively linked refers to a functional linkage between a nucleotide expression control sequence (eg, a promoter sequence) and another nucleotide sequence.
- a nucleotide expression control sequence eg, a promoter sequence
- Such regulatory sequences may be "operatively linked” to control the transcription and/or translation of other nucleotide sequences.
- the recombinant vector can typically be constructed as a vector for cloning or a vector for expression.
- the expression vector may be a conventional vector used to express a foreign protein in plants, animals, or microorganisms in the art.
- the recombinant vector can be constructed through various methods known in the art.
- the recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host.
- a prokaryotic cell is used as a host, a strong promoter (eg, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) , a ribosome binding site for initiation of translation and a transcription/translation termination sequence.
- a strong promoter eg, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.
- the replication origin operating in the eukaryotic cell contained in the vector includes the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the adeno origin of replication, the AAV origin of replication and the BBV origin of replication. It is not limited.
- promoters derived from the genome of mammalian cells eg, metallotionine promoter
- mammalian viruses eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV
- the recombinant vector may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and in the case of carbon monoxide dehydrogenase-4 (CODH-4) derived from wild-type Carboxydothermus hydrogenoformans, the recombinant vector is SEQ ID NO: It may be a polynucleotide consisting of a nucleotide sequence of 5.
- Another aspect provides a microorganism expressing carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance or enzymatic activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- the microorganism may be a recombinant microorganism, and the microorganism may be obtained by introducing the recombinant vector into an appropriate host microorganism.
- the microorganism can use any host cell known in the art as a cell capable of cloning or expressing the recombinant vector stably and continuously, and as a prokaryotic cell, for example, E. coli JM109, E. coli BL21 , E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E.
- coli W3110 Bacillus subtilis, Bacillus genus strains such as Bacillus thuringiensis, and Salmonella typhimurium, Serratia
- enterobacteriaceae and strains such as Marcescens and various Pseudomonas species, and in the case of transformation into eukaryotic cells, as a host cell, yeast (Saccharomyce cerevisiae), insect cells, plant cells and animal cells, for example, Sp2/0, Chinese hamster ovary (CHO) K1, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines may be used, and specifically, E. coli BL21 days can
- Another aspect provides a method for producing carbon monoxide dehydrogenase, comprising culturing a microorganism expressing a polynucleotide encoding a carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzymatic activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- the culture may be a known conventional culture method, and specifically, may further include introducing a plasmid expressing a protein that labels carbon monoxide dehydrogenase to the microorganism into the microorganism.
- the preparation method may further include treating a material capable of promoting the expression of carbon monoxide dehydrogenase and isolating and purifying the protein.
- the carbon monoxide dehydrogenase prepared by the above preparation method may exhibit excellent enzymatic activity even in the presence of oxygen.
- Another aspect provides a method of removing carbon monoxide, comprising the step of contacting carbon monoxide with carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- carbon monoxide reacts with water and is transformed into carbon dioxide, hydrogen ions, and electrons, so that carbon monoxide can be removed, and carbon dioxide can be removed with excellent efficiency even in the presence of oxygen.
- Another aspect provides a method for producing carbon dioxide, comprising the step of contacting carbon monoxide with carbon monoxide dehydrogenase (CO dehydrogenase) having increased oxygen tolerance and/or enzyme activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- carbon monoxide reacts with water and is transformed into carbon dioxide, hydrogen ions, and electrons, so that carbon dioxide can be produced, and carbon dioxide can be produced with excellent efficiency even in the presence of oxygen.
- Another aspect provides a carbon monoxide removal device comprising a carbon monoxide dehydrogenase (CO dehydrogenase) with increased oxygen tolerance and/or enzymatic activity.
- CO dehydrogenase carbon monoxide dehydrogenase
- oxygen tolerance may be within the aforementioned range.
- the carbon monoxide dehydrogenase included in the device reacts carbon monoxide with water to transform it into carbon dioxide, hydrogen ions, and electrons, so that carbon monoxide can be removed, and carbon dioxide can be removed with excellent efficiency even in the presence of oxygen.
- the device is an industrial site requiring hazardous gas treatment technology, sterilization/removal purification technology and system of harmful substances in the air, treatment facility and related technology for indoor air quality management in transportation means such as vehicles and trains, and technology for ventilation efficiency and economic ventilation and indoor air purification devices such as devices, air purifiers, air conditioners, and fans.
- Another aspect provides a filter comprising carbon monoxide dehydrogenase with increased oxygen tolerance and/or enzyme activity.
- oxygen tolerance may be within the aforementioned range.
- the carbon monoxide dehydrogenase included in the filter reacts carbon monoxide with water to transform it into carbon dioxide, hydrogen ions, and electrons, so that carbon monoxide can be removed, and carbon monoxide can be removed with excellent efficiency even in the presence of oxygen.
- the filter can be applied to various filters in places where carbon monoxide is generated, such as cigarette filters and air purifier filters, and furthermore, industrial sites that require hazardous gas treatment technology, sterilization/removal purification technology and systems for harmful substances in the air, moving vehicles, trains, etc. It may be included in treatment facilities and related technologies for indoor air quality management in Sudan, technologies and devices for ventilation efficiency and economical ventilation, and indoor air purification devices such as air purifiers, air conditioners, and fans.
- Carbon monoxide dehydrogenase according to an aspect has increased oxygen resistance and/or enzyme activity, and the carbon monoxide dehydrogenase easily oxidizes toxic carbon monoxide at room temperature and pressure and converts it to carbon dioxide. Carbon monoxide can be effectively oxidized even in the gas. Furthermore, it is possible to remove large amounts of carbon monoxide from industries such as petrochemical and steel industry, cigarette combustion, household cooking appliances, and various boilers through cigarette filters, air purifiers, household cooking appliances suction filters, gas boilers, etc. It is possible to use
- 1 is a schematic diagram of the CO dehydrogenase enzyme protein sequence.
- Figure 2 is a diagram showing a comparison of the sequence of the CO dehydrogenase enzyme protein.
- CODH carbon monoxide dehydrogenase
- ChCODH-II derived from Carboxydothermus hydrogenoformans , which is more than 100 times more active than ChCODH-IV, which is known to have oxygen tolerance, but is known to lose its activity very quickly in the presence of oxygen due to lack of resistance to oxygen. .
- CODH carbon monoxide dehydrogenase
- L82 Leucine82
- A559 Alignin559
- V565 Valine565)
- T578 Threonine578
- I580 Isoleucine580
- CO dehydrogenase CO dehydrogenase, CODH
- CODH oxygen-resistant CO dehydrogenase
- C. hydrogenoforman (GenBank no. NC_007503) for use as a template for mutations in oxygen-resistant CO dehydrogenase.
- Genes encoding the derived ChCODH-2 and ChCODH-4 proteins (SEQ ID NOs: 1 and 2) were artificially synthesized by GenScript (Piscataway, NJ, USA).
- the synthesized C. hydrogenoforman- derived ChCODH-2 or ChCODH-4 gene was digested with Nde I/ Bam HI or Nde I/Xho I restriction enzymes (New England BioLabs Inc., US) at 37°C for 20 minutes, It was cloned into expression vector pET-28 (Novagen, USA, SEQ ID NO: 3) using SolGentTM T4 DNA Ligase.
- the vector (SEQ ID NOs: 4 and 5) containing the CO dehydrogenase gene was introduced into Escherichia coli BL21 by heat shock (heat chock, 42° C., 1 minute) to prepare a recombinant microorganism containing wild-type CO dehydrogenase.
- pET-28 (SEQ ID NO: 3) was synthesized as an expression vector containing a His-tag terminal mutant CO dehydrogenase using an expression vector.
- the synthesized mutant CO dehydrogenase expression vector was introduced into Escherichia coli BL21 containing the pRKISC (J. Biochem. 126:917, 1999) plasmid to complete the final recombinant microorganism, and each was cultured to form a His-tag terminal protein. The expression was induced to purify the CO dehydrogenase.
- the culture is TB medium containing 50 ⁇ g/mL kanamycin, 10 ⁇ g/mL tetracycline, 0.02 mM nickel chloride (NiCl 2 ), 0.1 mM ferrous sulfate (FeSO 4 ), and 2 mM L-cysteine (l-cysteine).
- NiCl 2 nickel chloride
- FeSO 4 ferrous sulfate
- l-cysteine 2 mM L-cysteine
- the CO oxidation activity of the CO dehydrogenase was measured by the oxidation-reduction reaction of ethyl viologen (EV) by the enzyme by a spectrophotometer (578 nm) in a reaction buffer saturated with carbon monoxide at 30 °C.
- EV ethyl viologen
- the reaction used a screw cap cuvette having a carbon monoxide headspace, and the reaction solution (2 mL) contained 20 mM ethyl viologen oxide and 50 mM HEPES/NaOH buffer (pH 8) saturated with carbon monoxide, and the reaction was performed by enzyme injection. was started and measured for 2 minutes.
- 1 unit of CO dehydrogenase activity is defined as the amount of enzyme required for the reduction reaction of 1 mmol oxidized ethyl viologen at a temperature of 30° C. and pH 8.
- the oxygen stability of CO dehydrogenase was measured by first reacting the enzyme with oxygen at a concentration of 0 - 250 mM for 1 minute, and then measuring the residual activity of the enzyme by spectrophotometry (578 nm) as in Example 5. The oxidation-reduction reaction of ethyl viologen (EV) was measured.
- Table 2 shows the results of measuring the activity and oxygen tolerance of wild species and mutants of ChCODH-II derived from Carboxydothermus hydrogenoformans. Oxygen tolerance was expressed as the maximum oxygen concentration at which the activity of the enzyme maintained 50% of the initial activity.
- ChCODH-II A559W and A559H showed significantly excellent increasing properties in terms of activity and oxygen resistance. Therefore, in a subsequent study, a study was conducted to increase oxygen tolerance by introducing additional mutant residues into them.
- Table 3 shows the results of measuring the activity and oxygen tolerance of wild species and mutants of ChCODH-II derived from Carboxydothermus hydrogenoformans. Oxygen tolerance indicated the maximum oxygen concentration at which the activity of the enzyme maintained 50% of the initial activity.
- the oxygen tolerance was twice higher than that of ChCODH-II A559H, which had the best oxygen tolerance among the one-site mutants.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Environmental & Geological Engineering (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Business, Economics & Management (AREA)
- Emergency Management (AREA)
- Analytical Chemistry (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
일 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)에 관한 것으로, 구체적으로, 아미노산 잔기를 돌연변이시켜 산소 내성 및/또는 효소 활성이 증가된 돌연변이 일산화탄소 탈수소효소를 제공한다. 상기 일산화탄소 탈수소효소는 상온, 상압에서 독성이 있는 일산화탄소를 쉽게 산화시켜 이산화탄소로 전환시킴으로써 무독화할 수 있으며, 산소 등이 포함된 가스 중에도 일산화탄소를 효과적으로 산화시킬 수 있다. 나아가, 석유화학, 철강산업 등의 산업체, 담배 연소, 가정용 취사기구, 각종 보일러 연소 시 다량 배출되는 일산화탄소를 담배필터, 공기정화기, 가정용 취사기구 흡입필터, 가스보일러 등을 통해 제거가 가능한 바, 다양한 활용이 가능하다.
Description
산소 내성 및/또는 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도에 관한 것이다.
가정이나 산업현장에서 탄소의 불완전한 연소에 의하여 상당히 많은 양의 일산화탄소가 발생하고 있다. 일산화탄소는 산소에 비하여 매우 높은 친화력을 가지고 혈중 적혈구 세포의 헤모글로빈 단백질에 결합하는 특성을 보인다. 이로 인하여 일산화탄소가 일정 농도 이상이 포함된 공기를 흡입할 경우 산소 부족현상으로 인하여 심장 박동수 증가로 인한 혈압 증가로 인한 혈관 손상 및 최악의 경우 의식불명, 사망에까지 이를 수 있다. 따라서 공기 중에 포함된 독성의 일산화탄소를 상온상압하에서 간단히 산화하여 무해한 이산화탄소로 전환할 필요가 있다.
특히 담배의 경우 흡연자가 흡입하는 기체 중에 이산화탄소가 9 ~ 14% (45 ~ 65 mg / 담배 1개비)를 차지한다면 일산화탄소는 2.8 ~ 4.6% (14 ~ 23 mg / 담배 1개비)를 차지할 정도로 매우 높은 비율로 일산화탄소가 발생하고 흡입되어 흡연자 및 간접흡연자들의 건강을 치명적으로 위협하는 요인이 되고 있다. 담배필터에는 활성탄 등의 흡착제가 있으나 일산화탄소를 흡착할 정도의 특이성과 성능을 가지지 못하는 단점이 있어 일산화탄소를 효과적으로 제거하지 못하는 형편이다.
한편, 일산화탄소 탈수소효소(Carbon monoxide dehydrogenase, CO dehydrogenase: CODH)는 미생물 내에서 대사 효소 중 하나로서, 독성이 높은 일산화탄소 가스를 상온 및 상압에서 산화시켜 이산화탄소로 전환시킬 수 있는 효소이다(하기 반응식 1 참조). 이 때, 산소를 전자수용체로 사용하는 것이 아니고 물 분자를 전자수용체로 사용하는 것이 독특한 특성이며, 일산화탄소 산화에 있어서 산소 분자가 필요한 것이 아니고 물 분자가 필요하다.
[반응식 1]
CO + H2O ↔ CO2 + 2H+ + 2e-
현재까지 알려진 CO dehydrogenase는 상당히 효소의 단위 활성이 높은 장점이 있는 반면, 공기 중의 산소 분자에 극히 취약하여 효소의 활성이 급격히 감소하는 문제가 있었다. 일산화탄소가 포함된 폐가스 등에는 적은 농도라 할지라도 산소가 포함된 경우가 대부분이었고, CO dehydrogenase를 이용하여 폐가스 중에 포함된 CO를 산화 전환하려는 시도는 폐가스 중에 포함된 산소 분자에 의하여 CO dehydrogenase의 활성이 급격하게 감소하여 성공적으로 원하는 목적을 달성하지 못 하였었다.
이에 본 발명자들은 산소 내성이 우수할 뿐만 아니라 효소 활성도 우수한 CO dehydrgenase를 개발하기에 이르렀다.
일 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 제공하는 것이다.
다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 코딩하는 폴리뉴클레오티드를 제공하는 것이다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 발현하는 벡터를 제공하는 것이다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 발현하는 미생물을 제공하는 것이다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 코딩하는 폴리뉴클레오티드를 발현하는 미생물을 배양하는 단계를 포함하는 일산화탄소 탈수소효소의 제조 방법을 제공하는 것이다.
또 다른 양상은 일산화탄소에 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 접촉시키는 단계를 포함하는 일산화탄소의 제거 방법을 제공하는 것이다.
또 다른 양상은 일산화탄소에 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 접촉시키는 단계를 포함하는 이산화탄소의 제조 방법을 제공하는 것이다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 포함하는 일산화탄소 제거 장치를 제공하는 것이다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 포함하는 필터를 제공하는 것이다.
일 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 제공한다.
상기 산소 내성은 산소 존재 하에서도 상기 일산화탄소 탈수소효소가 활성을 유지할 수 있는 능력을 의미하며, 구체적으로는 특정 농도의 산소와 효소를 먼저 접촉시킨 후 상기 일산화탄소 탈수소효소의 활성을 측정함으로써 확인할 수 있다.
또한 상기 산소 내성은 효소의 활성이 초기 활성 대비 20 내지 80%, 20 내지 70%, 20 내지 60%, 30 내지 80%, 30 내지 70%, 30 내지 60%, 40 내지 80%, 40 내지 70% 또는 40 내지 60%를 유지하는 최대 산소 농도를 측정함으로써 확인할 수 있다.
일 실시예에 있어서, 상기 일산화탄소 탈수소효소는 야생형(Wild type)에 비해 산소 내성이 1 내지 200배, 1 내지 150배, 1 내지 125배, 50 내지 200배, 50 내지 150배, 50 내지 125배, 75 내지 200배, 75 내지 150배 또는 75 내지 125배 증가된 것일 수 있다.
상기 효소 활성은 상기 일산화탄소 탈수소효소가 하기 반응식 1의 반응을 촉매하는 활성을 의미하는 것이다:
[반응식 1]
CO + H2O ↔ CO2 + 2H+ + 2e-.
상기 일산화탄소 탈수소효소의 활성은 일산화탄소 및 물을 상기 일산화탄소 탈수소효소에 접촉시켜 발생되는 이산화탄소, 수소이온 또는 전자를 측정함으로써 확인할 수 있다.
일 실시예에 있어서, 상기 일산화탄소 탈수소효소는 야생형(Wild type)에 비해 그 활성이 1 내지 200배, 1 내지 150배, 1 내지 125배, 50 내지 200배, 50 내지 150배, 50 내지 125배, 75 내지 200배, 75 내지 150배 또는 75 내지 125배 증가된 것일 수 있다.
상기 일산화탄소 탈수소효소는 천연으로부터 유래될 수도 있고, 당해 분야에서 널리 공지된 다양한 단백질 합성 방법으로 획득할 수 있다. 일례로서, 폴리뉴클레오티드 재조합과 단백질 발현 시스템을 이용하여 제조하거나 단백질 합성과 같은 화학적 합성을 통하여 시험관 내에서 합성하는 방법 및 무세포 단백질 합성법 등으로 제조될 수 있다. 또한, 일례로서, 상기 일산화탄소 탈수소효소는 펩티드, 식물 유래 조직이나 세포의 추출물, 미생물(예를 들어 세균류 또는 진균류, 그리고 특히 효모)의 배양으로 얻어진 생산물일 수 있다.
용어 "단백질(Protein)”는 아마이드 결합 (또는 펩티드 결합)으로 연결된 2개 이상의 아미노산으로 이루어진 폴리머를 의미한다.
상기 일산화탄소 탈수소효소는 일산화탄소 탈수소효소의 아미노산 서열과 각각 약 70% 이상, 약 75% 이상, 약 80% 이상, 약 85%이상, 약 90% 이상, 약 92% 이상, 약 95% 이상, 약 97% 이상, 약 98% 이상, 또는 약 99% 이상의 서열 상동성을 갖는 단백질을 포함할 수 있다. 예를 들어, 상기 일산화탄소 탈수소효소는 일산화탄소 탈수소효소의 동질효소일 수 있다. 구체적으로 상기 일산화탄소 탈수소효소는 무렐라 써모아세티카(Moorella thermoacetica), 로도스피릴룸 루브룸(Rhodospirillum rubrum), 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans), 메타노코쿠스 바니엘리(Methanococcus vannielii), 메타노사르시나 바커리(Methanosarcina barkeri), 메타노써모박터 써마우토트로피커스(Methanothermobacter thermautotrophicus), 클로스티리듐 파스튜리아늄(Clostridium pasteurianum), 올리고트로파 카르복시도보란스(Oligotropha carboxidovorans), 에르피룸 페르닉스(Aeropyrum pernix), 페로글로버스 플라씨더스(Ferroglobus placidus), 클로스티리듐 아우토에타노게눔(Clostridium autoethanogenum), 클로스트리듐 라그스달레이(Clostridium ragsdalei), 클로스티리듐 리융달리(Clostridium ljungdahlii), 클로스티리듐 스카톨로게네스(Clostridium scatologenes), 클로스티리듐 아세토뷰틸리쿰(Clostridium acetobutylicum), 클로스티리듐 베이예린키(Clostridium beijerinckii), 클로스티리듐 페르프린겐스(C. perfringens), 클로스티리듐 써모셀룸(C. thermocellum), 클로스티리듐 클루이베리(C. kluyveri), 클로스티리듐 보툴리늄(C. botulinum) 유래 일산화탄소 탈수소효소일 수 있고, 구체적으로 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소일 수 있고, 보다 구체적으로, 야생형의 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소-2(CODH-2)인 경우 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드가 코딩하는 단백질일 수 있고, 야생형의 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소-4(CODH-4)인 경우, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드가 코딩하는 단백질일 수 있다.
또한, 상기 일산화탄소 탈수소효소는 일산화탄소 탈수소효소-1(CODH-1), 일산화탄소 탈수소효소-2(CODH-2), 일산화탄소 탈수소효소-3(CODH-3) 및 일산화탄소 탈수소효소-4(CODH-4)로 이루어진 군에서 선택되는 하나의 일산화탄소 탈수소효소일 수 있으며, 구체적으로 일산화탄소 탈수소효소-2(CODH-2) 또는 일산화탄소 탈수소효소-4(CODH-4)일 수 있으며, 보다 구체적으로는 서열번호 1 또는 2의 염기 서열로 이루어진 폴리뉴클레오티드가 코딩하는 단백질일 수 있다.
용어 "상동성(Homology)"은 야생형 아미노산 서열과의 유사한 정도를 나타내기 위한 것으로서, 이러한 상동성의 비교는 당업계에서 널리 알려진 비교 프로그램을 이용하여 수행할 수 있으며, 2개 이상의 서열간 상동성을 백분율(%)로 계산할 수 있다.
또한, 보다 나은 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 상기 일산화탄소 탈수소효소의 N- 또는 C-말단에 보호기가 결합되어 있을 수 있다. 상기 보호기는 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜(PEG)일 수 있으나, 상기 일산화탄소 탈수소효소의 개질, 특히 일산화탄소 탈수소효소의 안정성을 증진시킬 수 있는 성분이라면, 제한없이 포함할 수 있다.
상기 용어 "안정성"은 생체 내 단백질 절단 효소의 공격으로부터 상기 일산화탄소 탈수소효소를 보호하는 인 비보(in vivo) 안정성뿐만 아니라, 저장 안정성(예컨대, 상온 저장 안정성)도 의미하는 것일 수 있다.
아울러, 상기 일산화탄소 탈수소효소는 표적화 서열, 태그 (tag), 표지된 잔기를 위한 특정 목적으로 제조된 아미노산 서열도 추가적으로 포함할 수 있고, 구체적으로 pET-28(서열번호 3) 플라스미드에서 발현되는 His-tag 말단의 단백질과 결합된 형태일 수 있다.
일 실시예에 있어서, 상기 일산화탄소 탈수소효소는 상기 일산화탄소 탈수소효소의 82번째 아미노산, 559번째 아미노산, 565번째 아미노산, 578번째 아미노산, 580번째 아미노산, 586번째 아미노산, 593번째 아미노산, 597번째 아미노산 및 610번째 아미노산으로 이루어진 군에서 선택되는 적어도 하나의 아미노산이 변형된 것일 수 있다.
또한, 일 실시예에 있어서, 상기 변형은 결실, 추가 및 치환으로 이루어진 군에서 선택되는 적어도 하나일 수 있고, 하나의 아미노산이 변형된 것일 수 있고, 두 개 이상의 아미노산이 변형된 것일 수 있다.
일 실시예에 있어서, 상기 일산화탄소 탈수소효소의 82번째 아미노산은 류신(Leucine)이고, 상기 일산화탄소 탈수소효소의 559번째 아미노산은 알라닌(Alanine)이고, 상기 일산화탄소 탈수소효소의 565번째 아미노산은 발린(Valine)이고, 상기 일산화탄소 탈수소효소의 578번째 아미노산은 트레오닌(Threonine)이고, 상기 일산화탄소 탈수소효소의 580번째 아미노산은 이소류신(Isoleucine)이고, 상기 일산화탄소 탈수소효소의 586번째 아미노산은 이소류신(Isoleucine)이고, 상기 일산화탄소 탈수소효소의 593번째 아미노산은 트레오닌(Threonine)이고, 상기 일산화탄소 탈수소효소의 597번째 아미노산은 트레오닌(Threonine)이고, 상기 일산화탄소 탈수소효소의 610번째 아미노산은 발린(Valine)일 수 있다.
또한, 일 실시예에 있어서, 상기 변형이 치환인 경우, 치환된 아미노산은 트립토판(Tryptophan), 티로신(Tyrosine), 세린(Serine), 히스티딘(Histidine), 아스파르트산(Aspartic acid), 글루탐산(Glutamic acid), 아스파라긴(Asparagine), 알라닌(Alanine), 트레오닌(Threonine), 글루타민(Glutamine), 류신(Leucine) 및 발린(Valine)으로 이루어진 군에서 선택되는 적어도 하나의 아미노산일 수 있다.
구체적으로, 상기 일산화탄소 탈수소효소의 82번째 아미노산인 류신(Leucine)은 세린(Serine) 또는 발린(Valine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 559번째 아미노산인 알라닌(Alanine)은 트립토판(Tryptophan), 티로신(Tyrosine), 세린(Serine), 히스티딘(Histidine), 아스파르트산(Aspartic acid), 글루탐산(Glutamic acid), 아스파라긴(Asparagine), 트레오닌(Threonine) 또는 글루타민(Glutamine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 565번째 아미노산인 발린(Valine)은 알라닌(Alanine), 세린(Serine) 또는 류신(Leucine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 578번째 아미노산인 트레오닌(Threonine)은 세린(Serine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 580번째 아미노산인 이소류신(Isoleucine)은 류신(Leucine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 586번째 아미노산인 이소류신(Isoleucine)은 세린(Serine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 593번째 아미노산인 트레오닌(Threonine)은 세린(Serine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 597번째 아미노산인 트레오닌(Threonine)은 세린(Serine)으로 치환될 수 있고; 상기 일산화탄소 탈수소효소의 610번째 아미노산인 발린(Valine)은 알라닌(Alanine) 또는 세린(Serine)으로 치환될 수 있으며, 상기 치환은 하나의 아미노산이 치환된 것일 수 있고, 두 개 이상의 아미노산이 치환된 것일 수 있다.
보다 구체적으로, 상기 일산화탄소 탈수소효소는 서열번호 24 내지 43의 염기 서열로 이루어진 군에서 선택되는 하나의 염기 서열로 이루어진 폴리뉴클레오티드가 코딩하는 단백질일 수 있다.
다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 코딩하는 폴리뉴클레오티드를 제공한다.
상기 "산소 내성", "효소 활성" 또는 "일산화탄소 탈수소효소" 등은 전술한 범위 내일 수 있다.
상기 폴리뉴클레오티드는 복수의 뉴클레오티드가 연속적으로 연결된 것을 의미하며, 상기 폴리뉴클레오티드는 일산화탄소 탈수소효소를 발현할 수 있다.
용어 '발현(expression)'은 폴리펩티드(polypeptide)이 구조 유전자로부터 생산되는 과정을 지칭한다. 상기 과정은 유전자(폴리뉴클레오티드)의 mRNA로의 전사, 및 이러한 mRNA의 폴리펩티드(단백질)(들)로의 해독을 포함한다.
용어 '효소를 코딩하는 폴리뉴클레오티드'는 효소를 코딩하는 폴리뉴클레오티드(polynucleotide), 또는 부가적인 코딩 및/또는 넌-코딩(non-coding) 서열을 더 포함하는 폴리뉴클레오티드를 말한다.
상기 일산화탄소 탈수소효소가 야생형의 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소-2(CODH-2)인 경우 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있고, 야생형의 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소-4(CODH-4)인 경우, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있다.
또한, 구체적으로 상기 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소를 코딩하는 폴리뉴클레오티드는 서열번호 24 내지 43의 염기 서열로 이루어진 군에서 선택되는 하나의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 발현하는 벡터를 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소" 또는 "발현" 등은 전술한 범위 내일 수 있다.
용어 "벡터(vector)"는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단을 의미한다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 예를 들어, 플라스미드 벡터, 코즈미드 벡터 및 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터와 같은 바이러스 벡터를 포함한다.
상기 일산화탄소 탈수소효소를 발현하는 벡터는 재조합 벡터일 수 있고, 재조합 벡터로 사용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드 (예를 들면, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈(pET-28 포함) 및 pUC19 등), 파지 또는 바이러스 (예를 들면, SV40 등)를 조작하여 제작될 수 있고, 구체적으로, pET-28(서열번호 3)일 수 있다.
용어 '재조합 벡터'는 목적하는 클로닝된 유전자(들)를 함유하는 임의의 클로닝 또는 발현 벡터를 포함한다.
용어 '재조합'은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 코딩된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로써 인위적인 수단에 의해 세포 내 재도입된 것이다.
상기 재조합 벡터에서 상기 효소를 코딩하는 폴리뉴클레오티드는 프로모터에 작동적으로 연결될 수 있다.
용어 "작동 가능하게 연결된(operatively linked)"은 뉴클레오티드 발현 조절 서열(예를 들어, 프로모터 서열)과 다른 뉴클레오티드 서열 사이의 기능적인 결합을 의미한다. 상기 조절 서열은 "작동 가능하게 연결(operatively linked)"됨으로써 다른 뉴클레오티드 서열의 전사 및/또는 해독을 조절할 수 있다.
상기 재조합 벡터는, 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 상기 발현용 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 단백질을 발현하는 데 사용되는 통상의 것을 사용할 수 있다. 상기 재조합 벡터는 당업계에 공지된 다양한 방법을 통해 구축될 수 있다.
상기 재조합 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 사용되는 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예를 들어, CMV 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵 세포를 숙주로 하는 경우에는, 벡터에 포함되는 진핵 세포에서 작동하는 복제원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 및 BBV 복제원점 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터(예를 들어, 메탈로티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예를 들어, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터 및 HSV의 tk프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.
일 실시예에 있어서, 상기 재조합 벡터에 도입된 일산화탄소 탈수소효소를 코딩하는 유전자가 야생형의 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소-2(CODH-2)인 경우, 상기 재조합 벡터는 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있고, 야생형의 카르복시도써머스 하이드로게노포르만스(Carboxydothermus hydrogenoformans) 유래 일산화탄소 탈수소효소-4(CODH-4)인 경우, 상기 재조합 벡터는 서열번호 5의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있다.
또 다른 양상은 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 발현하는 미생물을 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소" 또는 "발현" 등은 전술한 범위 내일 수 있다.
상기 미생물은 재조합 미생물일 수 있고, 상기 미생물은 상기 재조합 벡터를 적절한 숙주 미생물에 도입시킴으로써 얻어진 것일 수 있다. 상기 미생물은 상기 재조합 벡터를 안정되면서 연속적으로 클로닝 또는 발현시킬 수 있는 세포로서 당업계에 공지된 어떠한 숙주 세포도 이용할 수 있으며, 원핵 세포로는, 예를 들어, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 그리고 살모넬라 티피무리움, 세라티아 마르세슨스 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있으며, 진핵 세포에 형질 전환시키는 경우에는 숙주 세포로서, 효모(Saccharomyce cerevisiae), 곤충 세포, 식물 세포 및 동물 세포, 예를 들어, Sp2/0, CHO(Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN, MDCK 세포주 등이 이용될 수 있고, 구체적으로, E. coli BL21일 수 있다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 코딩하는 폴리뉴클레오티드를 발현하는 미생물을 배양하는 단계를 포함하는 일산화탄소 탈수소효소의 제조 방법을 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소", "발현" 또는 "미생물" 등은 전술한 범위 내일 수 있다.
상기 배양은 공지된 통상의 배양 방법일 수 있고, 구체적으로 상기 미생물에 일산화탄소 탈수소효소를 표지하는 단백질을 발현하는 플라스미드를 상기 미생물에 도입하는 단계를 더 포함할 수 있다.
일 실시예에 있어서, 상기 제조 방법은 일산화탄소 탈수소효소의 발현을 촉진할 수 있는 물질을 처리하는 단계 및 단백질을 분리 및 정제하는 단계를 더 포함할 수 있다.
상기 제조 방법에 의해 제조된 일산화탄소 탈수소효소는 산소 존재 하에서도 우수한 효소 활성을 나타낼 수 있다.
또 다른 양상은 일산화탄소에 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 접촉시키는 단계를 포함하는 일산화탄소의 제거 방법을 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소" 또는 "발현" 등은 전술한 범위 내일 수 있다.
상기 접촉을 통해 일산화탄소는 물과 반응하여 이산화탄소, 수소이온, 전자로 변형되는 바, 일산화탄소가 제거될 수 있으며, 산소 존재 하에서도 우수한 효율로 이산화탄소가 제거될 수 있다.
또 다른 양상은 일산화탄소에 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 접촉시키는 단계를 포함하는 이산화탄소의 제조 방법을 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소" 또는 "발현" 등은 전술한 범위 내일 수 있다.
상기 접촉을 통해 일산화탄소는 물과 반응하여 이산화탄소, 수소이온, 전자로 변형되는 바, 이산화탄소가 제조될 수 있으며, 산소 존재 하에서도 우수한 효율로 이산화탄소가 제조될 수 있다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 포함하는 일산화탄소 제거 장치를 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소" 또는 "발현" 등은 전술한 범위 내일 수 있다.
상기 장치에 포함된 일산화탄소 탈수소효소는 일산화탄소를 물과 반응시켜 이산화탄소, 수소이온, 전자로 변형시키는 바, 일산화탄소가 제거될 수 있으며, 산소 존재 하에서도 우수한 효율로 이산화탄소를 제거시킬 수 있다.
상기 장치는 유해 가스 처리 기술이 필요한 산업 현장, 공기 내 유해 물질 살균/제거 정화기술 및 시스템, 차량, 열차 등 이동수단 내 실내 공기질 관리를 위한 처리시설 및 관련기술, 환기효율 및 경제적 환기를 위한 기술 및 장치, 공기청정기, 에어컨, 환풍기 등과 같은 실내공기 정화장치 등에 포함될 수 있다.
또 다른 양상은 산소 내성 및/또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 포함하는 필터를 제공한다.
상기 "산소 내성", "효소 활성", "일산화탄소 탈수소효소" 또는 "발현" 등은 전술한 범위 내일 수 있다.
상기 필터에 포함된 일산화탄소 탈수소효소는 일산화탄소를 물과 반응시켜 이산화탄소, 수소이온, 전자로 변형시키는 바, 일산화탄소가 제거될 수 있으며, 산소 존재 하에서도 우수한 효율로 일산화탄소를 제거시킬 수 있다.
상기 필터는 담배 필터, 공기청정기 필터 등 일산화탄소가 발생되는 장소에서 다양한 필터에 적용될 수 있으며, 나아가 유해 가스 처리 기술이 필요한 산업 현장, 공기 내 유해 물질 살균/제거 정화기술 및 시스템, 차량, 열차 등 이동수단 내 실내 공기질 관리를 위한 처리시설 및 관련기술, 환기효율 및 경제적 환기를 위한 기술 및 장치, 공기청정기, 에어컨, 환풍기 등과 같은 실내공기 정화장치 등에 포함될 수 있다.
일 양상에 따른 일산화탄소 탈수소효소는 산소 내성 및/또는 효소 활성이 증가된 것으로서, 상기 일산화탄소 탈수소효소는 상온, 상압에서 독성이 있는 일산화탄소를 쉽게 산화시켜 이산화탄소로 전환시킴으로써 무독화할 수 있으며, 산소 등이 포함된 가스 중에도 일산화탄소를 효과적으로 산화시킬 수 있다. 나아가, 석유화학, 철강산업 등의 산업체, 담배 연소, 가정용 취사기구, 각종 보일러 연소 시 다량 배출되는 일산화탄소를 담배필터, 공기정화기, 가정용 취사기구 흡입필터, 가스보일러 등을 통해 제거가 가능한 바, 다양한 활용이 가능하다.
도 1은 CO dehydrogenase 효소 단백질 서열에 의한 계통도이다.
도 2는 CO dehydrogenase 효소 단백질 서열 상호 비교를 나타낸 도이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예
1. 일산화탄소 탈수소효소(CODH)의 계통도 작성
현재까지 알려진 CO dehydrogenase의 서열 정보를 바탕으로 하기 도 1과 같은 계통도를 작성하였다.
이 중에서 가장 활성이 높은 CO dehydrogenase는 Carboxydothermus hydrogenoformans 유래 ChCODH-II로서 산소 내성이 있는 것으로 알려진 ChCODH-IV에 비하여 활성이 100 배 이상 높으나 산소에 대한 내성이 없어 산소 존재 하에서는 활성을 매우 빠르게 잃는 것으로 알려져 있다.
2. 다양한 일산화탄소 탈수소효소(CODH)들의 서열 비교
ChCODH-II와 ChCODH-IV를 포함하여 다양한 CO dehydrogenase 효소들의 서열을 상호 비교하여 산소 내성에 주로 관계가 있을 것으로 예상된 핵심 잔기를 결정하였다(도 2).
도 2와 같이 CODH들의 서열 비교를 통하여 ChCODH-II에서 산소 안정성에 관계가 있을 것으로 예상되는 잔기로서 L82(Leucine82), A559(Alanine559), V565(Valine565), T578(Threonine578), I580(Isoleucine580)를 결정하였다. 이 중에서 효소 활성이 측정이 되는 A559가 초기 실험결과 상당히 높은 활성을 보여 우선적으로 돌연변이체를 만들었으며, 이에 더하여 다른 부위를 더하여 추가적인 돌연변이체를 제작하여 실험을 진행하였다.
3. 일산화탄소 탈수소효소(CODH)의 돌연변이체 제작
산소 내성 CO 탈수소효소(CO dehydrogenase, CODH) 및 이를 함유하는 재조합 미생물을 제조하고자 하였다.
(1) 야생형 일산화탄소 탈수소효소
산소 내성 CO 탈수소효소의 유전자 변이 주형(template)으로 이용하기 위해 C. hydrogenoforman (GenBank no. NC_007503) 유래 ChCODH-2 및 ChCODH-4 단백질을 코딩하는 유전자(서열번호 1 및 2)는 GenScript사(Piscataway, NJ, USA)를 통해 인위적으로 합성하였다.
상기 합성된 C. hydrogenoforman 유래 ChCODH-2 혹은 ChCODH-4 유전자는 NdeI/BamHI 혹은 NdeI/XhoI의 제한효소들 (New England BioLabs Inc., US)로 37℃, 20분간 절단한 후, SolGent™ T4 DNA Ligase를 이용하여 발현용 벡터 pET-28(Novagen, USA, 서열번호 3)에 클로닝하였다. 상기 CO 탈수소효소 유전자를 함유하는 벡터(서열번호 4 및 5)를 대장균(Escherichia coli) BL21에 열충격 (heat chock, 42℃, 1분)도입하여 야생형 CO 탈수소효소를 함유하는 재조합 미생물을 제조하였다.
(2) 산소 내성 일산화탄소 탈수소효소
상기 합성된 야생형 ChCODH-2를 주형으로, 단일 혹은 복수의 아미노산 치환(single amino acid substitution)을 위해 부위-지정 돌연변이 유발(site-directed mutagenesis)을 진행하여 다양한 산소 내성 후보 CO 탈수소효소의 변이형들을 합성하였고, 이의 변이형 CO 탈수소효소를 함유하는 벡터는 상기 실시예 3.-(1)에서와 마찬가지로 대장균 BL21에 도입하여 변이형 CO 탈수소효소를 함유하는 재조합 미생물을 제조하였다.
상기 변이형 CO 탈수소효소 합성에서 사용된 프라이머의 정보는 하기 표 1과 같았다.
| 치환 아미노산 | 프라이머 | 삽입벡터 | 서열번호 |
| A559W | F-5'gcgcggcggaatggatgcatgagaaggcggtgg | pET28a | 6 |
| R-5'tctcatgcatccattccgccgcgctcgcaacc | 7 | ||
| A559Y | F-5'gcgcggcggaatacatgcatgagaaggcggtgg | 8 | |
| R-5'tctcatgcatgtattccgccgcgctcgcaacc | 9 | ||
| A559S | F-5'cgcggcggaaagcatgcatgagaaggcggtgg | 10 | |
| R-5'tctcatgcatgctttccgccgcgctcgcaacc | 11 | ||
| A559H | F-5'cgcggcggaacacatgcatgagaaggcggtgg | 12 | |
| R-5'tctcatgcatgtgttccgccgcgctcgcaacc | 13 | ||
| A559D | F-5'cgcggcggaagatatgcatgagaaggcggtgg | 14 | |
| R-5'tctcatgcatatcttccgccgcgctcgcaacc | 15 | ||
| A559E | F-5'cgcggcggaagagatgcatgagaaggcgg | 16 | |
| R-5'tctcatgcatctcttccgccgcgctcgcaa | 17 | ||
| A559N | F-5'gcgcggcggaaaacatgcatgagaaggcggtgg | 18 | |
| R-5'tctcatgcatgttttccgccgcgctcgcaacc | 19 | ||
| V610A | F-5'gctacttcatcgcggaactggacccggagacc | 20 | |
| R-5'ggtccagttccgcgatgaagtagccaccgg | 21 | ||
| V610S | F-5'gctacttcatcagcgaactggacccggagacc | 22 | |
| R-5'ggtccagttcgctgatgaagtagccaccgg | 23 | ||
| A559W/V610A | A559W F&R; V610A F&R | - | |
| A559W/V610S | A559W F&R; V610S F&R | - | |
| A559S/V610A | A559S F&R; V610A F&R | - | |
| A559S/V610S | A559S F&R; V610S F&R | - | |
| A559H/V610A | A559H F&R; V610A F&R | - | |
| A559H/V610S | A559H F&R; V610S F&R | - |
4. 산소 내성 일산화탄소 탈수소효소의 발현과 정제
상기 재조합 미생물 유래 산소 내성 일산화탄소 탈수소효소를 얻기 위해서 pET-28(서열번호 3) 발현벡터를 이용하여 His-tag말단의 변이형 CO 탈수소효소를 함유하는 발현벡터로 합성하였다. 합성된 변이형 CO 탈수소효소 발현벡터는 pRKISC(J. Biochem. 126:917, 1999) 플라스미드가 포함된 대장균 BL21으로 도입하여 최종 재조합 미생물을 완성하였고, 이를 각각 배양하여 His-tag말단의 단백질 형태로 발현을 유도하여 CO 탈수소효소를 정제하였다.
상기 배양은 50 μg/mL 카나마이신, 10 μg/mL 테트라사이클린, 0.02 mM 염화니켈 (NiCl2), 0.1 mM 황산제일철 (FeSO4), 2 mM 엘-시스테인(l-cysteine)이 포함되어 있는 TB medium (400 mL, 2 L 플라스크)에서, 37℃, 225 rpm의 조건으로 재조합 대장균을 호기적으로 배양하였다.
이 후, 효소의 발현 유도(induction)를 위해서 OD(optical density) 600값이 약 0.4 ~ 0.6이 된 후에 질소 치환(N2-fluxing)된 세럼병(serum bottle)에서 0.2 mM 농도의 isopropyl-β-d-thiogalactopyranoside(IPTG)와 0.5 mM 염화니켈(NiCl2), 1 mM 황산제일철(FeSO4), 50 mM 질산칼륨(KNO3)를 각각 추가하였다. 이 때, 온도를 30℃로 낮추었다.
24시간 배양 후, 12,000 rpm에서 30분 간 4℃ 환경에서 원심 분리를 시켜 재조합 대장균을 수득하였으며, 혐기 챔버(anaerobic chamber)내에서 Ni-NTA 레진을 이용하여 효소를 정제하였다.
5. 일산화탄소 탈수소효소의 활성 측정
CO 탈수소효소의 CO 산화 반응 활성은 일산화탄소가 포화된 30℃ 반응 완충액 내에서 분광광도법(spectrophotometer, 578 nm)으로 효소에 의한 에틸바이올로젠(ethyl viologen, EV)의 산화-환원반응으로 측정되었다.
상기 반응은 일산화탄소 헤드스페이스를 가진 스크류캡 큐벳을 이용하였고 이때 반응액(2 mL)은 20 mM 산화 에틸바이올로젠 및 일산화탄소 포화된 50 mM HEPES/NaOH 버퍼(pH 8)를 포함하며 반응은 효소 주입으로 시작되어 2분 간 측정되었다. 여기서 CO 탈수소효소 활성의 1 단위(unit)는 온도 30℃, pH 8에서 1 mmol 산화된 에틸바이올로젠의 환원반응에 필요한 효소의 양으로 정의한다.
6. 일산화탄소 탈수소효소의 산소안정성 측정
CO 탈수소효소의 산소 안정성 측정은 0 - 250 mM 농도의 산소와 효소를 1분 간 먼저 반응시킨 후 효소의 잔류 활성을 실시예 5에서와 같이 분광광도법(578 nm)으로 산소 노출된 효소에 의한 에틸바이올로젠(ethyl viologen, EV)의 산화-환원반응을 측정하였다.
7. 일산화탄소 탈수소효소의 한 부위 돌연변이체 (single mutant)의 활성 및 산소 내성 측정
Carboxydothermus hydrogenoformans 유래 ChCODH-II의 야생종과 돌연변이체의 활성 및 산소 내성을 측정한 결과는 하기 표 2와 같았다. 산소 내성은 효소의 활성이 초기 활성 대비 50%를 유지하는 최대 산소 농도로 표시하였다.
| CODH 종류 | 서열번호 | 활성 (U/mg) | 효소 활성을 유지하는 산소 농도 (mM) |
| 야생종 ChCODH-II | 1 | 1,000 | 1 |
| 야생종 ChCODH-IV | 2 | 100 | 25 |
| ChCODH-II A559W | 24 | 3,000 | 25 |
| ChCODH-II A559Y | 25 | 800 | 20 |
| ChCODH-II A559S | 26 | 1,000 | 50 |
| ChCODH-II A559T | 27 | 0 | 0 |
| ChCODH-II A559N | 28 | 200 | <5 |
| ChCODH-II A559Q | 29 | 400 | <1 |
| ChCODH-II A559H | 30 | 10,000 | 50 |
| ChCODH-II A559D | 31 | 400 | <5 |
| ChCODH-II A559E | 32 | 300 | <5 |
실험 결과, 상기 표 2에서 볼 수 있듯이, ChCODH-II A559W와 A559H가 활성 및 산소 내성 측면에서 상당히 우수한 증가 특성을 나타내었다. 따라서 이 후 연구에서는 이들에 대하여 추가적인 돌연변이 잔기를 도입함으로써 산소 내성을 증가시기키는 연구를 진행하였다.
8. 일산화탄소 탈수소효소의 두 부위 돌연변이체(double mutant)의 활성 및 산소 내성 측정
Carboxydothermus hydrogenoformans 유래 ChCODH-II의 야생종과 돌연변이체의 활성 및 산소 내성을 측정한 결과는 하기 표 3과 같았다. 산소 내성은 효소의 활성이 초기 활성 대비 50%를 유지하는 최대 산소 농도를 표시하였다.
| CODH 종류 | 서열번호 | 활성 (U/mg) | 효소 활성을 유지하는 산소 농도 (mM) |
| 야생종 ChCODH-II | 1 | 1,000 | 1 |
| 야생종 ChCODH-IV | 2 | 100 | 25 |
| ChCODH-II A559W | 24 | 3,000 | 25 |
| ChCODH-II A559W:V565A | 33 | 100 | 0 |
| ChCODH-II A559W:V565S | 34 | 500 | <10 |
| ChCODH-II A559Y:V565L | 35 | 1,500 | <10 |
| ChCODH-II A559W:T578S | 36 | 1,500 | <10 |
| ChCODH-II A559W:L82S | 37 | 2,000 | <50 |
| ChCODH-II A559W:L82V | 38 | 1,000 | <50 |
| ChCODH-II A559Y:I580L | 39 | 500 | 1 |
| ChCODH-II A559H | 30 | 10,000 | 50 |
| ChCODH-II A559H:I586S | 40 | 2,000 | <25 |
| ChCODH-II A559H:T593S | 41 | 3,000 | <25 |
| ChCODH-II A559H:T597S | 42 | 3,000 | <50 |
| ChCODH-II A559H:V610S | 43 | 1,000 | 100 |
실험 결과, 표 3에서 볼 수 있듯이, A559H:V610S double mutant의 경우 효소의 활성이 50%를 유지하는 산소 농도가 100 mM에 달하여 야생종 ChCODH-II에 비해서 약 100배 정도 증가하였고, 여태까지 알려진 가장 산소 내성이 높은 야생종인 야생종 ChCODH-IV에 비해서도 4배 정도 높은 산소 내성을 보여주고 있으며, 야생종 ChCODH-IV에 비해서는 효소 활성이 약 10배 정도 증가한 특성을 보여주고 있다.
또한, 한 부위 돌연변이체 중 가장 산소 내성이 우수하였던 ChCODH-II A559H에 비해서도 2배 높은 산소 내성을 보였다.
Claims (16)
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase).
- 청구항 1에 있어서, 상기 일산화탄소 탈수소효소는 상기 일산화탄소 탈수소효소의 82번째 아미노산, 559번째 아미노산, 565번째 아미노산, 578번째 아미노산, 580번째 아미노산, 586번째 아미노산, 593번째 아미노산, 597번째 아미노산 및 610번째 아미노산으로 이루어진 군에서 선택되는 적어도 하나의 아미노산이 변형된 것인, 일산화탄소 탈수소효소.
- 청구항 2에 있어서, 상기 변형은 결실, 추가 및 치환으로 이루어진 군에서 선택되는 적어도 하나인 것인, 일산화탄소 탈수소효소.
- 청구항 2에 있어서, 상기 일산화탄소 탈수소효소의 82번째 아미노산은 류신(Leucine)이고, 상기 일산화탄소 탈수소효소의 559번째 아미노산은 알라닌(Alanine)이고, 상기 일산화탄소 탈수소효소의 565번째 아미노산은 발린(Valine)이고, 상기 일산화탄소 탈수소효소의 578번째 아미노산은 트레오닌(Threonine)이고, 상기 일산화탄소 탈수소효소의 580번째 아미노산은 이소류신(Isoleucine)이고, 상기 일산화탄소 탈수소효소의 586번째 아미노산은 이소류신(Isoleucine)이고, 상기 일산화탄소 탈수소효소의 593번째 아미노산은 트레오닌(Threonine)이고, 상기 일산화탄소 탈수소효소의 597번째 아미노산은 트레오닌(Threonine)이고, 상기 일산화탄소 탈수소효소의 610번째 아미노산은 발린(Valine)인, 일산화탄소 탈수소효소.
- 청구항 3에 있어서, 상기 변형은 치환이며,치환된 아미노산은 트립토판(Tryptophan), 티로신(Tyrosine), 세린(Serine), 히스티딘(Histidine), 아스파르트산(Aspartic acid), 글루탐산(Glutamic acid), 아스파라긴(Asparagine), 알라닌(Alanine), 트레오닌(Threonine), 글루타민(Glutamine), 류신(Leucine) 및 발린(Valine)으로 이루어진 군에서 선택되는 적어도 하나의 아미노산인, 일산화탄소 탈수소효소.
- 청구항 1에 있어서, 상기 일산화탄소 탈수소효소는 서열번호 24 내지 43의 염기 서열로 이루어진 군에서 선택되는 하나의 염기 서열로 이루어진 폴리뉴클레오티드가 코딩하는 단백질인, 일산화탄소 탈수소효소.
- 청구항 1에 있어서, 상기 산소 내성은 야생형(Wild type)에 비해 1 내지 200배 증가된 것인, 일산화탄소 탈수소효소.
- 청구항 1에 있어서, 상기 효소 활성은 야생형(Wild type)에 비해 1 내지 200배 증가된 것인, 일산화탄소 탈수소효소.
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 코딩하는 폴리뉴클레오티드.
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 발현하는 벡터.
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 발현하는 미생물.
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 코딩하는 폴리뉴클레오티드를 발현하는 미생물을 배양하는 단계를 포함하는 일산화탄소 탈수소효소의 제조 방법.
- 일산화탄소에 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 접촉시키는 단계를 포함하는 일산화탄소의 제거 방법.
- 일산화탄소에 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 접촉시키는 단계를 포함하는 이산화탄소의 제조 방법.
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 포함하는 일산화탄소 제거 장치.
- 산소 내성 또는 효소 활성이 증가된 일산화탄소 탈수소효소(CO dehydrogenase)를 포함하는 필터.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/006,563 US12509664B2 (en) | 2020-07-24 | 2020-08-27 | Carbon monoxide dehydrogenase having excellent oxygen resistance and enzyme activity, and use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020200092551A KR102393114B1 (ko) | 2020-07-24 | 2020-07-24 | 산소 내성 및 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도 |
| KR10-2020-0092551 | 2020-07-24 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022019372A1 true WO2022019372A1 (ko) | 2022-01-27 |
Family
ID=79728771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2020/011468 Ceased WO2022019372A1 (ko) | 2020-07-24 | 2020-08-27 | 산소 내성 및 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US12509664B2 (ko) |
| KR (1) | KR102393114B1 (ko) |
| WO (1) | WO2022019372A1 (ko) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102906878B1 (ko) * | 2022-11-02 | 2026-01-05 | 서강대학교산학협력단 | 호기 조건에서 카복시도써머스 하이드로게노포먼스 유래 가용성 일산화탄소 탈수소효소 대량생산 방법 |
| KR20250103852A (ko) * | 2023-12-28 | 2025-07-08 | 울산과학기술원 | 대기 조건하에서 산소 내성 및 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130055048A (ko) * | 2011-11-16 | 2013-05-28 | 한국과학기술원 | 이산화탄소 고정능을 가지는 재조합 미생물 및 이를 이용한 유용물질의 제조 방법 |
| KR20170036789A (ko) * | 2014-08-11 | 2017-04-03 | 란자테크 뉴질랜드 리미티드 | 변경된 일산화탄소 탈수소효소(codh) 활성을 가지는 유전자 조작된 박테리아 |
| KR20180005712A (ko) * | 2016-01-06 | 2018-01-16 | 주식회사 씨원켐 | Co 수화효소 및 이를 이용한 개미산의 제조방법 |
| KR101826207B1 (ko) * | 2016-11-09 | 2018-02-06 | 주식회사 씨원켐 | 대장균 내 과발현 가능한 Pantoea species YR343 유래 호기성 일산화탄소-탈수소효소(carbon monoxide dehydrogenase, PsCODH)를 코딩하는 재조합 벡터, 재조합 PsCODH의 과발현 방법 및 PsCODH를 이용하여 철강 제조 공정에서 발생한 CO(carbon monoxide) 포함 폐가스를 전환하는 방법 |
-
2020
- 2020-07-24 KR KR1020200092551A patent/KR102393114B1/ko active Active
- 2020-08-27 WO PCT/KR2020/011468 patent/WO2022019372A1/ko not_active Ceased
- 2020-08-27 US US18/006,563 patent/US12509664B2/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20130055048A (ko) * | 2011-11-16 | 2013-05-28 | 한국과학기술원 | 이산화탄소 고정능을 가지는 재조합 미생물 및 이를 이용한 유용물질의 제조 방법 |
| KR20170036789A (ko) * | 2014-08-11 | 2017-04-03 | 란자테크 뉴질랜드 리미티드 | 변경된 일산화탄소 탈수소효소(codh) 활성을 가지는 유전자 조작된 박테리아 |
| KR20180005712A (ko) * | 2016-01-06 | 2018-01-16 | 주식회사 씨원켐 | Co 수화효소 및 이를 이용한 개미산의 제조방법 |
| KR101826207B1 (ko) * | 2016-11-09 | 2018-02-06 | 주식회사 씨원켐 | 대장균 내 과발현 가능한 Pantoea species YR343 유래 호기성 일산화탄소-탈수소효소(carbon monoxide dehydrogenase, PsCODH)를 코딩하는 재조합 벡터, 재조합 PsCODH의 과발현 방법 및 PsCODH를 이용하여 철강 제조 공정에서 발생한 CO(carbon monoxide) 포함 폐가스를 전환하는 방법 |
Non-Patent Citations (1)
| Title |
|---|
| CHOI EUN SIL, MIN KYOUNGSEON, KIM GEUN-JOONG, KWON INCHAN, KIM YONG HWAN: "Expression and characterization of Pantoea CO dehydrogenase to utilize CO-containing industrial waste gas for expanding the versatility of CO dehydrogenase", SCIENTIFIC REPORTS, vol. 7, no. 1, 1 May 2017 (2017-05-01), XP055888235, DOI: 10.1038/srep44323 * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20230323313A1 (en) | 2023-10-12 |
| KR20220013234A (ko) | 2022-02-04 |
| KR102393114B1 (ko) | 2022-05-02 |
| US12509664B2 (en) | 2025-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nair et al. | Expression of plasmid-encoded aad in Clostridium acetobutylicum M5 restores vigorous butanol production | |
| Raj et al. | Cloning and characterization of the Zymobacter palmae pyruvate decarboxylase gene (pdc) and comparison to bacterial homologues | |
| Armengaud et al. | A functional 4-hydroxysalicylate/hydroxyquinol degradative pathway gene cluster is linked to the initial dibenzo-p-dioxin pathway genes in Sphingomonas sp. strain RW1 | |
| WO2012099396A2 (en) | A microorganism having enhanced l-amino acids productivity and process for producing l-amino acids using the same | |
| WO2022019371A1 (ko) | 전자전달체에 대한 친화도 및 반응 속도가 우수한 일산화탄소 탈수소효소 및 그의 용도 | |
| JP2025163285A (ja) | 熱安定性が改善したポリエチレンテレフタレート(pet)分解酵素 | |
| US12509664B2 (en) | Carbon monoxide dehydrogenase having excellent oxygen resistance and enzyme activity, and use thereof | |
| WO2015178586A1 (ko) | 세포내 에너지 수준이 향상된 미생물 및 이를 이용하여 l-아미노산을 생산하는 방법 | |
| EP3178922A1 (en) | Bacterial cytochrome p450 protein variant and method of reducing concentration of fluorinated methane in sample using the same | |
| WO2025143342A1 (ko) | 대기 조건하에서 산소 내성 및 효소 활성이 우수한 일산화탄소 탈수소효소 및 그의 용도 | |
| WO2022149651A1 (ko) | 일산화탄소 탈수소효소 및 포름산 탈수소효소를 이용한 개미산의 제조 방법 | |
| Xu et al. | Characterization of type II and III restriction-modification systems from Bacillus cereus strains ATCC 10987 and ATCC 14579 | |
| EP3420078B1 (en) | Beta-lactamase variants | |
| Liu et al. | Reconsideration of the essential role of a histidine residue of L-2-halo acid dehalogenase | |
| EP3990654B1 (en) | Modified monooxygenases for the manufacture of hydroxylated aromatic hydrocarbons | |
| WO2015046978A1 (ko) | 2,3-부탄디올의 생성능이 증강된 재조합 미생물 및 이를 이용한 2,3-부탄디올의 생산 방법 | |
| US10988749B2 (en) | Beta-lactamase variants | |
| CN120608038A (zh) | 一种环氧化物水解酶突变体及其共固定化酶的构建方法和应用 | |
| WO2016036209A1 (ko) | L-쓰레오닌 생산능이 향상된 미생물 및 이를 이용한 l-쓰레오닌 생산방법 | |
| KR20250001938A (ko) | 단백질공학적 개량에 의해 고온 촉매 활성이 향상된 탄산무수화효소 | |
| CN121538205A (zh) | 一种尼龙降解酶的突变体及其应用 | |
| CA3077603A1 (en) | Beta-lactamase variants | |
| WO2024090883A1 (ko) | 피루베이트 인산화효소 2 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법 | |
| CN117487840A (zh) | 一种提高微生物对甲醛耐受性的方法 | |
| WO2024090885A1 (ko) | Dna-결합 전사 제어인자 malt 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20946513 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 20946513 Country of ref document: EP Kind code of ref document: A1 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 18006563 Country of ref document: US |