WO2022016100A2 - Gene editing to improve joint function - Google Patents
Gene editing to improve joint function Download PDFInfo
- Publication number
- WO2022016100A2 WO2022016100A2 PCT/US2021/042048 US2021042048W WO2022016100A2 WO 2022016100 A2 WO2022016100 A2 WO 2022016100A2 US 2021042048 W US2021042048 W US 2021042048W WO 2022016100 A2 WO2022016100 A2 WO 2022016100A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- guide rna
- exon
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14145—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14171—Demonstrated in vivo effect
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- OA is a complex disease characterized by a progressive course of disability. Systemic inflammation is associated with OA and with OA disease progression. Inflammation is driven by increased levels of pro-inflammatory cytokines. New methods and compositions to treat this disease are acutely needed. Disclosed herein are compositions and methods useful for treating OA as well as other inflammatory joint disorders. BRIEF SUMMARY [0005] The present disclosure provides compositions and methods for treating joint disorders that are characterized by an inflammatory component.
- compositions and methods are to prevent the progression of osteoarthritis and other arthritides and to treat osteoarthritis and other arthritides in a mammalian joint.
- at least a portion of the joint synovial cells and/or synoviocytes, chondrocytes, synovial macrophages, or synovial fibroblasts are gene-edited to reduce the expression of inflammatory cytokines.
- the joint synovial cells and/or synoviocytes, chondrocytes, synovial macrophages, or synovial fibroblasts are gene-edited to reduce the expression of IL-1 ⁇ , IL-1 ⁇ , or both IL-1 ⁇ , IL-1 ⁇ .
- the gene-editing causes expression of one or more cytokine and/or growth factor genes to be silenced or reduced in at least a portion of the cells comprising a mammalian joint.
- the cells are synovial cells.
- the cells are synovial fibroblasts.
- the cells are synoviocytes.
- the cells are chondrocytes.
- the cells are synovial macrophages.
- the one or more cytokine and/or growth factor genes is/are selected from the group comprising IL-1 ⁇ , and IL-1 ⁇ .
- the gene-editing comprises the use of a programmable nuclease that mediates the generation of a double-strand or single-strand break at said one or more cytokine and/or growth factor genes.
- the gene-editing comprises one or more methods selected from a CRISPR method, a TALE method, a zinc finger method, and a combination thereof.
- the gene-editing comprises a CRISPR method.
- the CRISPR method is a CRISPR-Cas9 method.
- the gene-editing comprises a TALE method.
- the gene-editing comprises a zinc finger method.
- the gene-editing causes expression of one or more cytokine and/or growth factor genes to be silenced or reduced in at least a portion of the cells comprising the joint.
- the portion of cells edited are synoviocytes.
- the portion of cells edited are synovial fibroblasts.
- the portion of cells edited are synoviocytes.
- the portion of cells edited are chondrocytes.
- the portion of cells edited are synovial macrophages.
- an adeno-associated virus (AAV) delivery system is used to deliver the gene-editing system.
- the AAV delivery system is injected into a joint.
- Some aspects of the present disclosure provide a pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene-editing system and a pharmaceutically acceptable carrier.
- the gene-editing system comprises one or more nucleic acids targeting one or more genetic locus selected from the group consisting of IL-1 ⁇ , IL-1 ⁇ , TNF- ⁇ , IL-6, IL-8, and IL-18.
- An embodiment provides a method of treating canine lameness, the method comprising administering a gene-editing composition, wherein the composition causes expression of IL-1 ⁇ and IL-1 ⁇ to be silenced or reduced in a portion of a lame joint’s synoviocytes, chondrocytes, synovial macrophages, or synovial fibroblasts.
- the above method further comprises one or more features recited in any of the methods and compositions described herein.
- Fig.1A illustrates an agarose gel electrophoresis analysis of 100 ng mouse DNA (gBlocks, Integrated DNA Technologies) designed against the Mus musculus Il1a and Il1b genes, cleaved by 0.5 ⁇ g SpyCas9 (TrueCut TM Cas9 protein v2, ThermoFisher Scientific) and 200 ng Phosphorothioate-modified single guide (sg)RNAs targeted against the Il1a gene (#43-46) and Il1b gene (#47-50) in vitro.
- SpyCas9 TrueeCut TM Cas9 protein v2, ThermoFisher Scientific
- Fig.1B illustrates an agarose gel electrophoresis analysis of 100 ng mouse DNA (gBlocks, Integrated DNA Technologies) designed against the Mus musculus Il1a and Il1b genes , cleaved by 0.5 ⁇ g SauCas9 (GeneSnipper TM Cas9, BioVision) and 200 ng Phosphorothioate-modified guide sgRNAs against the Il1a (#51-53) and IL1b (#54-56) genes.
- Figs.2A, 2B, 2C, and 2D collectively illustrate graphs displaying editing efficiencies of SpyCas9 and SauCas9 used with a range of guide RNA’s in J774.2 (“J”) and NIH3T3 (“N”) cells;
- Fig.2A in vivo cleavage of Il1a, edited with 4 x sgRNAs (Spy Cas9) in two separate pools (Pool 1 and 2), across two cell lines, NIH 3T3 (“N”), and J774.2 (“J”);
- Fig.2A in vivo cleavage of Il1a, edited with 4 x sgRNAs (Spy Cas9) in two separate pools (Pool 1 and 2), across two cell lines, NIH 3T3 (“N”), and J774.2 (“J”);
- FIG. 2B in vivo cleavage ofIl1b, edited with 4 x sgRNAs (Spy Cas9) in two separate pools (Pool 1 and 2), across two cell lines, NIH 3T3 (“N”), and J774.2 (“J”);
- Fig.2C in vivo cleavage of Il1a, edited with 3 x sgRNAs (Sau Cas9) in two separate pools (Pool 1 and 2), across two cell lines, NIH 3T3 (“N”), and J774.2 (“J”);
- Fig.2D in vivo cleavage of Il1b, edited with 3 x sgRNAs (saCas9) in two separate pools (Pool 1 and 2), across two cell lines, NIH 3T3 (“N”), and J774.2 (“J”); editing efficiencies determined using deconvolution of Sanger sequencing traces (ICE tool, Synthego) of each pool.
- Fig.3 illustrates GFP expression measured using the IVIS system. Flux values were based on a region of interest centred on the animal’s injected knee joint. Data are presented as mean (SD) for four specimens per group.
- Fig.4 illustrates the design of a study as described in Example 5 of the present disclosure.
- Fig.5 illustrates the in-life outcome measurements obtained in a study as described in Example 5 of the present disclosure.
- Fig.6 illustrates the change in body weight of mice treated with an intra-articular (IA) injection of PBS, AAV-6 with a scambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with a scambled vector, or AAV-5 with CRISPR-Cas guides 1 and 2 in a study as described in Example 5 of the present disclosure.
- IA intra-articular
- FIGs.7A and 7B collectively illustrate (A) change in knee caliper measurements from baseline of mouse joints over time, and (B) mean difference in ankle caliper measurements with AUC in mice treated with an intra-articular (IA) injection of PBS, AAV-6 with a scambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with a scambled vector, or AAV-5 with CRISPR-Cas guides 1 and 2 in a study as described in Example 5 of the present disclosure.
- IA intra-articular
- Figs.8A and 8B collectively illustrate (A) change in von Frey measurements, and (B) mean absolute threshold in von Frey measurements obtained from mice treated with an intra- articular (IA) injection of PBS, AAV-6 with a scambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with a scambled vector, or AAV-5 with CRISPR-Cas guides 1 and 2 in a study as described in Example 5 of the present disclosure.
- IA intra- articular
- Figs.9 illustrate results of a qPCR assay for IL-1 ⁇ expression in synovial fluid obtained from mice treated with an intra-articular (IA) injection of PBS, AAV-6 with a scambled vector, AAV-6 with CRISPR-Cas guides 1 and 2, AAV-5 with a scambled vector, or AAV-5 with CRISPR-Cas guides 1 and 2 in a study as described in Example 5 of the present disclosure.
- Figs.10A, 10B, 10C, and 10D collectively illustrate immunohistochemistry for murine IL-1 ⁇ in synovial tissue of MSU injected animals (A, B) pre-treated with PBS, and (C, D) treated with CRISPR.
- Figures 10B and 10D show isotype controls for each of Figures 10A and 10C, respectively.
- Figures 11A, 11B, and 11C collectively illustrate an alignment between the mouse, human, equine, feline, and canine IL-1 alpha genes.
- Figures 12A, 12B, 12C, and 12D collectively illustrate an alignment between the mouse, human, equine, feline, and canine IL-1 beta genes.
- Figures 13A, 13B, 13C, and 13D collectively illustrate example CRISPR/Cas9 crRNA sequences designed for editing the human IL-1 alpha gene.
- Figures 14A, 14B, 14C, 14D, and 14E collectively illustrate example CRISPR/Cas9 crRNA sequences designed for editing the human IL-1 beta gene.
- Figures 15A, 15B, and 15C collectively illustrate example CRISPR/Cas9 crRNA sequences designed for editing the canine IL-1 alpha gene.
- Figures 16A and 16B collectively illustrate example CRISPR/Cas9 crRNA sequences designed for editing the canine IL-1 beta gene.
- Figures 17A, 17B, 17C, and 17D collectively illustrate the results of cell-based and in-silico gene editing analysis of crRNA sequences targeting the human IL-1 alpha gene (Fig.
- Figures 18A, 18B, 18C, and 18D collectively illustrate canine IL-1 alpha ( Figures 18A and 18B) and canine IL-1 beta ( Figures 18C and 18D) release from non-edited (control) and double IL-1 ⁇ /IL-1 ⁇ KO (edited) canine chondrocytes 6 hours ( Figures 18A and 18C) and 24 hours ( Figures 18B and 18D) after exposure to PBS or LPS, as described in Example 9.
- Figures 19A, 19B, 19C, and 19D collectively illustrate human IL-1 alpha ( Figures 19A and 19B) and canine IL-1 beta ( Figures 19C and 19D) release from non-edited (control) and double IL-1 ⁇ /IL-1 ⁇ KO (edited) canine chondrocytes 6 hours ( Figures 19A and 19C) and 24 hours ( Figures 19B and 19D) after exposure to PBS or LPS, as described in Example 9.
- Figures 19A, 19B, 19C, and 19D collectively illustrate human IL-1 alpha ( Figures 19A and 19B) and canine IL-1 beta ( Figures 19C and 19D) release from non-edited (control) and double IL-1 ⁇ /IL-1 ⁇ KO (edited) canine chondrocytes 6 hours ( Figures 19A and 19C) and 24 hours ( Figures 19B and 19D) after exposure to PBS or LPS, as described in Example 9.
- compositions and methods for improving joint function and treating joint disease are provided to gene-edit synovial fibroblasts, synoviocytes, chondrocytes, or synovial macrophages to reduce expression of inflammatory cytokines, for example, IL-1 ⁇ , IL-1 ⁇ , TNF- ⁇ , IL-6, IL-8, IL-18, one or more matrix metalloproteinases (MMPs), or one or more component of the NLRP3 inflammasome.
- MMPs matrix metalloproteinases
- Embodiments are used for treating osteoarthritis and other inflammatory joint diseases. Embodiments are further useful for treating canine lameness due to osteoarthritis. Embodiments are further useful for treating equine lameness due to joint disease. Embodiments are also useful for treating post-traumatic arthritis, gout, pseudogout, and other inflammation-mediated or immune-mediated joint diseases. Definitions [0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this disclosure belongs. All patents and publications referred to herein are incorporated by reference in their entireties. [0043] The term “in vivo” refers to an event that takes place in a subject’s body.
- in vitro refers to an event that takes places outside of a subject’s body.
- in vitro assays encompass cell-based assays in which cells alive or dead are employed and may also encompass a cell-free assay in which no intact cells are employed.
- ex vivo refers to an event which involves treating or performing a procedure on a cell, tissue and/or organ which has been removed from a subject’s body. Aptly, the cell, tissue and/or organ may be returned to the subject’s body in a method of surgery or treatment.
- IL-1 refers to the pro-inflammatory cytokine known as interleukin-1, and includes all forms of IL-1, including IL1- ⁇ and IL-1 ⁇ , human and mammalian forms, conservative amino acid substitutions, glycoforms, biosimilars, and variants thereof.
- IL-1 ⁇ and IL-1 ⁇ bind to the same receptor molecule, which is called type I IL-1 receptor (IL-1RI).
- IL-1RI type I IL-1 receptor
- IL-1Ra Interleukin 1 receptor antagonist
- IL-1Ra Interleukin 1 receptor antagonist
- IL-1 is described, e.g., in Dinarello, Cytokine Growth Factor Rev.8:253-65 (1997), the disclosures of which are incorporated by reference herein.
- IL-1 encompasses human, recombinant forms of IL-1. Table 1. Amino acid sequences of interleukins.
- NLRP3 inflammasome refers to the multiprotein complex responsible for the activation of some inflammatory responses.
- the NMRP3 inflammasome promotes the production of functional pro-inflammatory cytokines, for example, IL-1 ⁇ and IL-18.
- Core components of the NLRP3 inflammasome are NLRP3, ASC (apoptosis-associated speck-like protein containing a CARD), and caspase-1, as described by Lee et al., Lipids Health Dis. 16:271 (2017) and Groslambert and Py, J. Inflamm. Res.11:359-374 (2016).
- matrix metalloproteinase and “MMP” are defined to be any one of the members of the matrix metalloproteinase family of zinc-endopeptidaes, for example, as characterized by Fanjul-Fernandez et al., Biochem. Biophys. Acta 1803:3-19 (2010).
- family members are frequently referred to as archetypical MMPs, gelatinases, matrilysins, and/or furin-activatable MMPs.
- the “matrix metalloproteinase” and “MMP” encompass the entire MMP family, including, but not limited to MMP-1, MMP- 2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13, MMP-14, MMP-15, MMP-16, MMP-17, MMP-18, MMP-19, MMP-20, MMP-21, MMP-23, MMP-25, MMP-26, MMP-27 and MMP-28.
- co-administration encompass administration of two or more active pharmaceutical ingredients (in a preferred embodiment of the present disclosure, for example, at least one anti-inflammatory compound in combination with a viral vector functionally engineered to deliver a gene- editing nucleic acid as described herein) to a subject so that both active pharmaceutical ingredients and/or their metabolites are present in the subject at the same time.
- Co- administration includes simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present.
- an effective amount refers to that amount of a composition or combination of compositions as described herein that is sufficient to effect the intended application including, but not limited to, disease treatment.
- a therapeutically effective amount may vary depending upon the intended application (in vitro or in vivo), or the subject and disease condition being treated (e.g., the weight, age and gender of the subject), the severity of the disease condition, or the manner of administration.
- the term also applies to a dose that will induce a particular response in target cells (e.g., the reduction of platelet adhesion and/or cell migration).
- treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
- the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.
- a composition, method, or system of the present disclosure may be administered as a prophylactic treatment to a subject that has a predisposition for a given condition (e.g., arthritis).
- a prophylactic treatment covers any treatment of a disease in a mammal, particularly in a human, canine, feline, or equine, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development or progression; and (c) relieving the disease, i.e., causing regression of the disease and/or relieving one or more disease symptoms.
- Treatment is also meant to encompass delivery of an agent in order to provide for a pharmacologic effect, even in the absence of a disease or condition.
- treatment encompasses delivery of a composition that can elicit an immune response or confer immunity in the absence of a disease condition, e.g., in the case of a vaccine. It is understood that compositions and methods of the present disclosure are applicable to treat all mammals, including, but not limited to human, canine, feline, equine, and bovine subjects.
- heterologous when used with reference to portions of a nucleic acid or protein indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship to each other in nature.
- the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source, or coding regions from different sources.
- a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
- nucleic acid refers to all forms of nucleic acid, oligonucleotides, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
- Polynucleotides include genomic DNA, cDNA and antisense DNA, and spliced or unspliced mRNA, rRNA, tRNA, lncRNA, RNA antagomirs, and inhibitory DNA or RNA (RNAi, e.g., small or short hairpin (sh)RNA, microRNA (miRNA), aptamers, small or short interfering (si)RNA, trans-splicing RNA, or antisense RNA).
- RNAi inhibitory DNA or RNA
- sh small or short hairpin
- miRNA microRNA
- aptamers small or short interfering (si)RNA, trans-splicing RNA, or antisense RNA
- Polynucleotides also include non-coding RNA, which include for example, but are not limited to, RNAi, miRNAs, lncRNAs, RNA antagomirs, aptamers, and any other non-coding RNAs known to those of skill in the art.
- Polynucleotides include naturally occurring, synthetic, and intentionally altered or modified polynucleotides as well as analogues and derivatives.
- the term “polynucleotide” also refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof, and is synonymous with nucleic acid sequence.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
- the term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment as described herein encompassing a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
- Polynucleotides can be single, double, or triplex, linear or circular, and can be of any length. In discussing polynucleotides, a sequence or structure of a particular polynucleotide may be described herein according to the convention of providing the sequence in the 5’ to 3’ direction.
- the term “gene” or “nucleotide sequence encoding a polypeptide” refers to the segment of DNA involved in producing a polypeptide chain. The DNA segment may include regions preceding and following the coding region (leader and trailer) involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons).
- a gene includes a polynucleotide containing at least one open reading frame capable of encoding a particular protein or polypeptide after being transcribed and translated.
- the term “homologous” in terms of a nucleotide sequence includes a nucleotide (nucleic acid) sequence that is either identical or substantially similar to a known reference sequence.
- the term “homologous nucleotide sequence” is used to characterize a sequence having nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a known reference sequence.
- Heterologous means derived from a genotypically distinct entity from the rest of the entity to which it is being compared to.
- a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide.
- heterologous is not always used herein in reference to polynucleotides, reference to a polynucleotide even in the absence of the modifier “heterologous” is intended to include heterologous polynucleotides in spite of the omission.
- sequence identity refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity.
- percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.
- Suitable programs to determine percent sequence identity include for example the BLAST suite of programs available from the U.S. Government’s National Center for Biotechnology Information BLAST web site. Comparisons between two sequences can be carried using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or MegAlign, available from DNASTAR, are additional publicly available software programs that can be used to align sequences.
- ClustalW and ClustalX may be used to produce alignments, Larkin et al., Bioinformatics 23:2947-2948 (2007); Goujon et al., Nucleic Acids Research, 38 Suppl:W 695-9 (2010); and, McWilliam et al., Nucleic Acids Research 41(Web Server issue):W 597-600 (2013).
- One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software. In certain embodiments, the default parameters of the alignment software are used.
- the term “variant” encompasses but is not limited to antibodies or fusion proteins which comprise an amino acid sequence which differs from the amino acid sequence of a reference antibody by way of one or more substitutions, deletions and/or additions at certain positions within or adjacent to the amino acid sequence of the reference antibody.
- the variant may comprise one or more conservative substitutions in its amino acid sequence as compared to the amino acid sequence of a reference antibody. Conservative substitutions may involve, e.g., the substitution of similarly charged or uncharged amino acids.
- the variant retains the ability to specifically bind to the antigen of the reference antibody.
- the term variant also includes pegylated antibodies or proteins.
- “Joint disease” is defined as measurable abnormalities in the cells or tissues of the joint that could lead to illness, for example, metabolic and molecular derangements triggering anatomical and/or physiological changes in the joint. Including, but not limited to, radiographic detection of joint space narrowing, subchondral sclerosis, subchondral cysts, and osteophyte formation.
- “Joint illness” is defined in human subjects as symptoms that drive the subject to seek medical intervention, for example, subject reported pain, stiffness, swelling, or immobility.
- “joint illness” is defined, for example, as lameness, observable changes in gait, weight bearing, allodynia, or exploratory behavior.
- a sgRNA single guide RNA
- a sgRNA is a RNA, preferably a synthetic RNA, composed of a targeting sequence and scaffold. It is used to guide Cas9 to a specific genomic locus in genome engineering experiments.
- the sgRNA can be administered or formulated, e.g., as a synthetic RNA, or as a nucleic acid comprising a sequence encoding the gRNA, which is then expressed in the target cells.
- various tools may be used to design and/or optimize the sequence of a sgRNA, for example to increase the specificity and/or precision of genomic editing.
- candidate sgRNAs may be designed by identifying a sequence within the target region that has a high predicted on-target efficiency and low off-target efficiency based on any of the available web-based tools.
- Candidate sgRNAs may be further assessed by manual inspection and/or experimental screening.
- web-based tools include, without limitation, CRISPR seek, CRISPR Design Tool, Cas-OFFinder, E-CRISP, ChopChop, CasOT, CRISPR direct, CRISPOR, BREAKING-CAS, CrispRGold, and CCTop. See, e.g., Safari, et al. Current Pharma. Biotechol. (2017) 18(13), which is incorporated by reference herein in its entirety for all purposes.
- Cas9 refers to CRISPR Associated Protein; the Cas9 nuclease is the active enzyme for the Type II CRISPR system.
- nCas9 refers to a Cas9 that has one of the two nuclease domains inactivated, i.e., either the RuvC or HNH domain.
- nCas9 is capable of cleaving only one strand of target DNA (a “nickase”).
- the term “Cas9” refers to an RNA- guided double-stranded DNA-binding nuclease protein or nickase protein, or a variant thereof.
- “Cas9” refers to both naturally-occurring and recombinant Cas9s. Wild- type Cas9 nuclease has two functional domains, e.g., RuvC and HNH, that cut different DNA strands.
- Cas9 enzymes described herein can comprise a HNH or HNH-like nuclease domain and/or a RuvC or RuvC-like nuclease domain.
- Cas9 can induce double-strand breaks in genomic DNA (target locus) when both functional domains are active.
- the Cas9 enzyme can comprise one or more catalytic domains of a Cas9 protein derived from bacteria belonging to the group consisting of Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, and Campylobacter.
- the two catalytic domains are derived from different bacteria species.
- PAM refers to a Protospacer Adjacent Motif and is necessary for Cas9 to bind target DNA, and immediately follows the target sequence.
- the Cas9 can be administered or formulated, e.g., as a protein (e.g., a recombinant protein), or as a nucleic acid comprising a sequence encoding the Cas9 protein, which is then expressed in the target cells.
- Naturally occurring Cas9 molecules recognize specific PAM sequences (e.g., the PAM recognition sequences for S. pyogenes, S. thermophilus, S. mutans, S. aureus and N.
- a Cas9 molecule has the same PAM specificities as a naturally occurring Cas9 molecule. In other embodiments, a Cas9 molecule has a PAM specificity not associated with a naturally occurring Cas9 molecule. In other embodiments, a Cas9 molecule’s PAM specificity is not associated with the naturally occurring Cas9 molecule to which it has the closest sequence homology. For example, a naturally occurring Cas9 molecule can be altered such that the PAM sequence recognition is altered to decrease off target sites, improve specificity, or eliminate a PAM recognition requirement.
- a Cas9 molecule may be altered (e.g., to lengthen a PAM recognition sequence, improve Cas9 specificity to high level of identity, to decrease off target sites, and/or increase specificity).
- the length of the PAM recognition sequence is at least 4, 5, 6, 7, 8, 9, 10 or 15 amino acids in length.
- a Cas9 molecule may be altered to ablate PAM recognition.
- An “expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell.
- An expression cassette or vector may be part of a plasmid, viral genome, or nucleic acid fragment.
- an expression cassette or vector includes a polynucleotide to be transcribed, operably linked to a promoter.
- promoter is used herein to refer to an array of nucleic acid control sequences that direct transcription of a nucleic acid.
- a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
- a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
- operably linked refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.
- an “isolated” plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components present where the substance or a similar substance naturally occurs or from which it is initially prepared.
- an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this disclosure are increasingly more isolated.
- An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.
- An “AAV vector” as used herein refers to an AAV vector nucleic acid sequence encoding for various nucleic acid sequences, including in some embodiments a variant or chimeric capsid polypeptide (i.e., the AAV vector comprises a nucleic acid sequence encoding for a variant or chimeric capsid polypeptide).
- AAV vectors can also comprise a heterologous nucleic acid sequence not of AAV origin as part of the nucleic acid insert.
- This heterologous nucleic acid sequence typically comprises a sequence of interest for the genetic transformation of a cell.
- the heterologous nucleic acid sequence is flanked by at least one, and generally by two AAV inverted terminal repeat sequences (ITRs).
- ITRs AAV inverted terminal repeat sequences
- a Cas sequence, a guide RNA sequence, and any other genetic element may be on the same AAV vector or on two or more different AAV vectors when administered to a subject.
- a Cas sequence, a guide RNA sequence, and any other genetic element may be on two or more different AAV vectors when administered to a subject, and the AAV may be the same serotype, or the AAV may be two or more different serotypes (e.g., AAV5 and AAV6).
- An “AAV virion” or “AAV virus” or “AAV viral particle” or “AAV vector particle” refers to a viral particle composed of at least one AAV capsid polypeptide and an encapsidated polynucleotide AAV transfer vector. If the particle comprises a heterologous nucleic acid (i.e.
- AAV vector particle a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a cell
- AAV vector particle a polynucleotide other than a wild-type AAV genome, such as a transgene to be delivered to a cell
- production of AAV virion or AAV particle necessarily includes production of AAV vector as such a vector is contained within an AAV virion or AAV particle.
- Carrier or “vehicle” as used herein refer to carrier materials suitable for drug administration.
- Carriers and vehicles useful herein include any such materials known in the art, e.g., any liquid, gel, solvent, liquid diluent, solubilizer, surfactant, or the like, which is nontoxic and which does not interact with other components of the composition in a deleterious manner.
- pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
- pharmaceutically acceptable carrier or “pharmaceutically acceptable excipient” are intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inert ingredients.
- pharmaceutically acceptable carriers or pharmaceutically acceptable excipients for active pharmaceutical ingredients is well known in the art. Except insofar as any conventional pharmaceutically acceptable carrier or pharmaceutically acceptable excipient is incompatible with the active pharmaceutical ingredient, its use in the therapeutic compositions of the disclosure is contemplated. Additional active pharmaceutical ingredients, such as other drugs, can also be incorporated into the described compositions and methods.
- the term “pharmaceutically acceptable excipient” is intended to include vehicles and carriers capable of being co-administered with a compound to facilitate the performance of its intended function.
- the use of such media for pharmaceutically active substances is well known in the art.
- examples of such vehicles and carriers include solutions, solvents, dispersion media, delay agents, emulsions and the like. Any other conventional carrier suitable for use with the multi-binding compounds also falls within the scope of the present disclosure.
- the term “a”, “an”, or “the” generally is construed to cover both the singular and the plural forms.
- the terms “about” and “approximately” mean within a statistically meaningful range of a value.
- Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, more preferably still within 10%, and even more preferably within 5% of a given value or range.
- the allowable variation encompassed by the terms “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art. Moreover, as used herein, the terms “about” and “approximately” mean that compositions, amounts, formulations, parameters, shapes and other quantities and characteristics are not and need not be exact, but may be approximate and/or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art.
- a dimension, size, formulation, parameter, shape or other quantity or characteristic is “about” or “approximate” whether or not expressly stated to be such. It is noted that embodiments of very different sizes, shapes and dimensions may employ the described arrangements. [0076]
- the term “substantially” as used herein can refer to a majority of, or mostly, as in at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more.
- compositions, methods, and kits described herein that embody the present disclosure can, in alternate embodiments, be more specifically defined by any of the transitional terms “comprising,” “consisting essentially of,” and “consisting of.” [0078] A subject treated by any of the methods or compositions described herein can be of any age and can be an adult, infant or child.
- the subject is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 years old, or within a range therein (e.g., without limitation, between 2 and 20 years old, between 20 and 40 years old, or between 40 and 90 years old).
- a range therein e.
- the subject can be a human or non-human subject.
- a particular class of subjects that can benefit from the compositions and methods of the present disclosure include subjects over the age of 40, 50, or 60 years.
- Another class of subjects that can benefit from the compositions and methods of the present disclosure are subjects that have arthritis (e.g., osteoarthritis).
- Any of the compositions disclosed herein can be administered to a non-human subject, such as a laboratory or farm animal.
- Non-limiting examples of a non-human subject include laboratory or research animals, pets, wild or domestic animals, farm animals, etc., e.g., a dog, a goat, a guinea pig, a hamster, a mouse, a pig, a non-human primate (e.g., a gorilla, an ape, an orangutan, a lemur, a baboon, etc.), a rat, a sheep, a horse, a cow, or the like.
- the present disclosure provides compositions useful for treating joint disorders with an inflammatory component.
- the compositions are useful to prevent the progression of osteoarthritis and to treat osteoarthritis in a mammalian joint.
- the pharmaceutical composition comprises a gene-editing system, wherein the gene-editing system causes expression the at least one genetic locus related to joint function to be silenced or reduced in at least a portion of the cells comprising the joint.
- the pharmaceutical composition comprises a gene-editing system, wherein the gene-editing system targets one or more of IL-1 ⁇ , and IL-1 ⁇ .
- the pharmaceutical composition comprises a gene-editing system, wherein the gene-editing system targets one or more of TNF- ⁇ , IL-6, IL-8, IL-18, a matrix metalloproteinase (MMP), or components of the NLRP3 inflammasome.
- MMP matrix metalloproteinase
- the pharmaceutical composition comprises a gene-editing system, wherein the gene-editing comprises the use of a programmable nuclease that mediates the generation of a double-strand or single-strand break at the at least one locus related to joint function.
- the gene-editing system reduces the gene expression of the targeted locus or targeted loci.
- the at least one locus related to joint tissue is silenced or reduced in at least a portion of the cells comprising the joint.
- the cells comprising the joint are synoviocytes.
- the cells are synovial macrophages.
- the cells are synovial fibroblasts.
- the pharmaceutical composition targets the one or more cytokine and/or growth factor genes is/are selected from the group comprising IL-1 ⁇ , IL-1 ⁇ , TNF- ⁇ , IL-6, IL- 8, IL-18, a matrix metalloproteinase (MMP), or a component of the NLRP3 inflammasome.
- the component of the NLRP3 inflammasome comprises NLRP3, ASC (apoptosis-associated speck-like protein containing a CARD), caspase-1, and combinations thereof.
- compositions are also provided, wherein the gene-editing causes expression of one or more cytokine and/or growth factor genes to be enhanced in at least a portion of the cells comprising the joint, the cytokine and/or growth factor gene(s) being selected from the group comprising IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.
- the pharmaceutical composition provides for gene-editing, wherein the gene-editing comprises the use of a programmable nuclease that mediates the generation of a double-strand or single-strand break at said one or more cytokine and/or growth factor genes.
- the gene-editing comprises one or more methods selected from a CRISPR method, a TALE method, a zinc finger method, and a combination thereof.
- the gene-editing comprises a CRISPR method.
- the CRISPR method is a CRISPR-Cas9 method.
- the Cas9 is mutated to enhance function.
- the DMM model mimics clinical meniscal injury, a known predisposing factor for the development of human OA, and permits the study of structural and biological changes over the course of the disease.
- Mice are an attractive model organism, because mouse strains with defined genetic backgrounds may be used. Additionally, knock-out or other genetically manipulated mouse strains may be used to evaluate the importance of various molecular pathways in the response to various OA treatment modalities and regimens. For example, STR/ort mice have features that make the strain particularly susceptible to developing OA, including, increased levels of the inflammatory cytokine IL1 ⁇ , Bapat et al., Clin Transl Med. 7:36 (2018).
- mice commonly develop OA in knee, ankle, elbow, and temporo- mandibular joints, Jaeger et al., Osteoarthritis Cartilage 16:607–614 (2008).
- Other useful mutant strains of mice are known to the skilled artisan, for example, Col9a1( ⁇ / ⁇ ) mice, Allen et al., Arthritis Rheum, 60:2684–2693 (2009).
- Another commonly used surgical model for OA is anterior cruciate ligament transection (ACLT) model. Little and Hunter, Nat Rev Rheumatol., 9(8):485–497 (2013). The subject’s ACL is surgically transected causing joint destabilization.
- the anterior drawer test with the joint flexed is used to confirm that transection of the ligament has occurred.
- other ligaments such as the posterior cruciate ligament, medial collateral ligament, lateral collateral ligament, and/or either meniscus may be transected.
- a variety of mouse strains may be used to investigate various molecular pathways.
- animals of varying size may be selected for use. Rodents are useful because of the short time needed for skeletal maturity and consequently shorter time to develop OA following surgical or other technique to induce OA. Larger animals are particularly useful to evaluate therapeutic interventions.
- Embodiments of the present disclosure are directed to methods for gene-editing synovial cells (synoviocytes), the methods comprising one or more steps of gene-editing at least a portion of the synoviocytes in a joint to treat osteoarthritis or other joint disorder.
- gene-editing refers to a type of genetic modification in which DNA is permanently modified in the genome of a cell, e.g., DNA is inserted, deleted, modified or replaced within the cell’s genome.
- gene- editing causes the expression of a DNA sequence to be silenced (sometimes referred to as a gene knockout) or inhibited/reduced (sometimes referred to as a gene knockdown).
- gene-editing causes the expression of a DNA sequence to be enhanced (e.g., by causing over-expression).
- gene-editing technology is used to reduce the expression or silence pro-inflammatory genes and/or to enhance the expression of regenerative genes.
- gene-editing methods of the present disclosure may be used to increase the expression of certain interleukins, such as one or more of IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-6, IL-8, IL-9, IL-10, IL-13, IL-18, and TNF- ⁇ .
- certain interleukins have been demonstrated to augment inflammatory responses in joint tissue and are linked to disease progression.
- Expression Constructs [0096] Expression constructs encoding one or both of guide RNAs and/or Cas9 editing enzymes can be administered in any effective carrier, e.g., any formulation or composition capable of effectively delivering the component gene to cells in vivo.
- Approaches include, for example, electroporation and/or insertion of the gene in viral vectors, including recombinant retroviruses, adenovirus, adeno-associated virus, lentivirus, and herpes simplex virus-1, or recombinant bacterial or eukaryotic plasmids.
- Viral vectors transfect cells directly; plasmid DNA can be delivered naked or with the help of, for example, cationic liposomes (lipofectamine) or derivatized (e.g., antibody conjugated), polylysine conjugates, gramacidin S, artificial viral envelopes or other such intracellular carriers, as well as direct injection of the gene construct or CaPO4 precipitation carried out in vivo.
- a preferred approach for in vivo introduction of nucleic acid into a cell is by use of a viral vector containing nucleic acid, e.g., a cDNA.
- Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid.
- molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector are expressed efficiently in cells that have taken up viral vector nucleic acid.
- Retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells.
- the transferred nucleic acids are stably integrated into the chromosomal DNA of the host.
- stable integration into the host DNA may be a rare event, resulting into episomal expression of the transgene and transient expression of the transgene.
- a replication defective retrovirus can be packaged into virions, which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include ⁇ Crip, ⁇ Cre, ⁇ 2 and ⁇ Am.
- Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see, e.g., Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci.
- Another viral gene delivery system useful in the present methods utilizes adenovirus-derived vectors.
- the genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle.
- Suitable adenoviral vectors may be derived from any strain of adenovirus (e.g., Ad2, Ad3, Ad5, or Ad7 etc.), including Adenovirus serotypes from other species (e.g., mouse, dog, human, etc.) that are known to those skilled in the art.
- Ad2, Ad3, Ad5, or Ad7 etc. adenovirus serotypes from other species (e.g., mouse, dog, human, etc.) that are known to those skilled in the art.
- the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity.
- introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA).
- the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol.57:267 (1986).
- Helper-dependent (HDAd) vectors can also be produced with all adenoviral sequences deleted except the origin of DNA replication at each end of the viral DNA along with packaging signal at 5-prime end of the genome downstream of the left packaging signal.
- HDAd vectors are constructed and propagated in the presence of a replication-competent helper adenovirus that provides the required early and late proteins necessary for replication.
- AAV adeno-associated virus
- Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle.
- An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol.5:3251-3260 (1985) can be used to introduce DNA into cells.
- a variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol.4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol.51:611-619 (1984); and Flotte et al., J. Biol. Chem.
- nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex are entrapped in liposomes bearing positive charges on their surface (e.g., lipofectins), which can be tagged with antibodies against cell surface antigens of the target cells,.
- the gene delivery systems for the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex can be introduced into a subject by any of a number of methods, each of which is familiar in the art.
- a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g., by intravenous injection, and specific transduction of the protein in the target cells will occur predominantly from specificity of transfection, provided by the gene delivery vehicle, cell-type or tissue- type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.
- initial delivery of the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex is more limited, with introduction into the subject being quite localized.
- the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex can be introduced by intra-articular injection into a joint exhibiting joint disease (e.g., osteoarthritis).
- the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex are administered during or after surgery; in some embodiments, a controlled-release hydrogel comprising the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex is administered at the conclusion of surgery before closure to prevent reduce or eliminate osteoarthritis by providing a steady dose of the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex over time.
- a pharmaceutical preparation of the nucleic acids encoding a CRISPR IL-1 ⁇ or IL-1 ⁇ gene editing complex can consist essentially of the gene delivery system (e.g., viral vector(s)) in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is embedded.
- the pharmaceutical preparation can comprise one or more cells, which produce the gene delivery system.
- the CRISPR IL-1 ⁇ or IL-1 ⁇ editing complex is specific, i.e., induces genomic alterations preferentially at the target site (IL-1 ⁇ or IL-1 ⁇ ), and does not induce alterations at other sites, or only rarely induces alterations at other sites.
- the CRISPR IL-1 ⁇ or IL-1 ⁇ editing complex has an editing efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%.
- the sgRNAs for use in the CRISPR/Cas system for HR typically include a guide sequence (e.g., crRNA) that is complementary to a target nucleic acid sequence (target gene locus) and a scaffold sequence (e.g., tracrRNA) that interacts with a Cas nuclease (e.g., Cas9 polypeptide) or a variant or fragment thereof.
- a single guide RNA (sgRNA) can include a crRNA and a tracrRNA.
- Exemplary target sequences for inducing genomic alterations in the IL-1 ⁇ or IL-1 ⁇ gene by the CRISPR-Cas editing complex are provided in Tables 2 and 12.
- Exemplary guide RNAs for use with the compositions, methods, and systems of the present disclosure are provided in Tables 3 and 13.
- the sequence of a guide RNA may be modified to increase editing efficiency and/or reduce off-target effects.
- the sequence of a guide RNA may vary from the target sequence by about 1 base, about 2 bases, about 3 bases, about 4 bases, about 5 bases, about 5 bases, about 6 bases, about 7 bases, about 8 bases, about 9 bases, about 10 bases, about 15 bases, or greater than about 15 bases.
- the sequence of a guide RNA may vary from the target sequence by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, or greater than about 20%.
- variation form a target sequence may refer to the degree of complementarity.
- a guide RNA used with a composition, method or system of the present disclosure is identical to a sequence as shown in any one of SEQ ID NO.: 21- 34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present disclosure is at least about 95% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 90% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 85% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present disclosure is at least about 80% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 75% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 70% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present disclosure is at least about 65% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 60% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 55% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present disclosure is at least about 50% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 45% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 40% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present disclosure is at least about 35% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present disclosure is at least about 35% identical to a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. [00111] In certain embodiments, a guide RNA used with a composition, method or system of the present has 1 base substitution in a sequence as shown in any one of SEQ ID NO.: 21- 34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present has 2 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 3 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 4 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present has 4 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 6 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 7 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present has 8 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 9 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 10 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present has 11 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 12 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 13 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297.
- a guide RNA used with a composition, method or system of the present has 14 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. In certain embodiments, a guide RNA used with a composition, method or system of the present has 15 base substitutions in a sequence as shown in any one of SEQ ID NO.: 21-34 and SEQ ID NO.: 168-297. [00112] In certain embodiments, a guide RNA of the present disclosure is designed to and/or capable of knocking down an expression of a target gene as shown in any one of SEQ ID NO.: 7-20 and SEQ ID NO.: 37-167.
- a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the human IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the human IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 8 of the human IL-1 ⁇ gene. [00113] In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the human IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the human IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the human IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the human IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the human IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to and/or capable of knocking down an expression of a target gene as shown in any one of SEQ ID NO.: 7-20 and SEQ ID NO.: 37-167.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the canis familiaris IL-1 ⁇ gene. [00115] In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the canis familiaris IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the canis familiaris IL-1 ⁇ gene by binding to at least a portion of Exon 8 of the canis familiaris IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to and/or capable of knocking down an expression of a target gene as shown in any one of SEQ ID NO.: 7-20 and SEQ ID NO.: 37-167.
- a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the equus caballus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the equus caballus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the equus caballus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the equus caballus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the equus caballus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the equus caballus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the equus caballus IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the equus caballus IL-1 ⁇ gene. [00118] In certain embodiments, a guide RNA of the present disclosure is designed to and/or capable of knocking down an expression of a target gene as shown in any one of SEQ ID NO.: 7-20 and SEQ ID NO.: 37-167.
- a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the mus musculus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the mus musculus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 8 of the mus musculus IL-1 ⁇ gene. [00119] In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 1 of the mus musculus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 2 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 3 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 4 of the mus musculus IL-1 ⁇ gene.
- a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 5 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 6 of the mus musculus IL-1 ⁇ gene. In certain embodiments, a guide RNA of the present disclosure is designed to or capable of knocking down the mus musculus IL-1 ⁇ gene by binding to at least a portion of Exon 7 of the mus musculus IL-1 ⁇ gene.
- the sgRNA is introduced into a cell (e.g., an in vitro cell such as a primary cell for ex vivo therapy, or an in vivo cell such as in a patient) with a recombinant expression vector comprising a nucleotide sequence encoding a Cas nuclease (e.g., Cas9 polypeptide) or a variant or fragment thereof.
- a cell e.g., an in vitro cell such as a primary cell for ex vivo therapy, or an in vivo cell such as in a patient
- a recombinant expression vector comprising a nucleotide sequence encoding a Cas nuclease (e.g., Cas9 polypeptide) or a variant or fragment thereof.
- the sgRNA is complexed with a Cas nuclease (e.g., a Cas9 polypeptide) or a variant or fragment thereof to form a ribonucleoprotein (RNP)-based delivery system for introduction into a cell (e.g., an in vitro cell such as a primary cell for ex vivo therapy, or an in vivo cell such as in a patient).
- a Cas nuclease e.g., a Cas9 polypeptide
- RNP ribonucleoprotein
- the sgRNA is introduced into a cell (e.g., an in vitro cell such as a primary cell for ex vivo therapy, or an in vivo cell such as in a patient) with an mRNA encoding a Cas nuclease (e.g., Cas9 polypeptide) or a variant or fragment thereof.
- a cell e.g., an in vitro cell such as a primary cell for ex vivo therapy, or an in vivo cell such as in a patient
- an mRNA encoding a Cas nuclease e.g., Cas9 polypeptide
- Any heterologous or foreign nucleic acid e.g., target locus-specific sgRNA and/or polynucleotide encoding a Cas9 polynucleotide
- the nucleic acid sequence of the sgRNA can be any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence (e.g., target DNA sequence) to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence.
- a target polynucleotide sequence e.g., target DNA sequence
- the degree of complementarity between a guide sequence of the sgRNA and its corresponding target sequence when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
- Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman- Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g.
- a guide sequence is about 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 75 nucleotides,
- a guide sequence is about 20 nucleotides in length. In other instances, a guide sequence is about 15 nucleotides in length. In other instances, a guide sequence is about 25 nucleotides in length.
- the ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence.
- cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions.
- the nucleic acid sequence of a sgRNA can be selected using any of the web-based software described above. Considerations for selecting a DNA-targeting RNA include the PAM sequence for the Cas nuclease (e.g., Cas9 polypeptide) to be used, and strategies for minimizing off-target modifications.
- Tools can provide sequences for preparing the sgRNA, for assessing target modification efficiency, and/or assessing cleavage at off-target sites.
- Another consideration for selecting the sequence of a sgRNA includes reducing the degree of secondary structure within the guide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. Examples of suitable algorithms include mFold (Zuker and Stiegler, Nucleic Acids Res, 9 (1981), 133-148), UNAFold package (Markham et al, Methods Mol Biol, 2008, 453:3-31) and RNAfold form the ViennaRNa Package.
- the sgRNA can be about 10 to about 500 nucleotides, e.g., about 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 210 nucleotides, 220 nucleo
- the sgRNA is about 20 to about 500 nucleotides, e.g., 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleotides
- the sgRNA is about 20 to about 100 nucleotides, e.g., about 20 nucleotides, e.g., 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides,
- the scaffold sequence can be about 10 to about 500 nucleotides, e.g., about 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 210 nucleotides, 220 nucleotides
- the scaffold sequence is about 20 to about 500 nucleotides, e.g., 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides 110 nucleotides, 115 nucleotides, 120 nucleotides, 125 nucleotides, 130 nucleotides, 135 nucleotides, 140 nucleotides, 145 nucleotides, 150 nucleotides, 155 nucleotides, 160 nucleotides, 165 nucleotides, 170 nucleotides, 175 nucleo
- the scaffold sequence is about 20 to about 100 nucleotides, e.g., about 20 nucleotides, e.g., 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleot
- the nucleotides of the sgRNA can include a modification in the ribose (e.g., sugar) group, phosphate group, nucleobase, or any combination thereof.
- the modification in the ribose group comprises a modification at the 2' position of the ribose.
- the nucleotide includes a 2'fluoro-arabino nucleic acid, tricycle-DNA (tc-DNA), peptide nucleic acid, cyclohexene nucleic acid (CeNA), locked nucleic acid (LNA), ethylene-bridged nucleic acid (ENA), a phosphodiamidate morpholino, or a combination thereof.
- Modified nucleotides or nucleotide analogues can include sugar- and/or backbone- ribonucleotides (i.e., include modifications to the phosphate-sugar backbone).
- the phosphodiester linkages of a native or natural RNA may be to include at least one of a nitrogen or sulfur heteroatom.
- the phosphoester group connecting to adjacent ribonucleotides may be replaced by a group, e.g., of phosphothioate group.
- the 2' moiety is a group selected from H, OR, R, halo, SH, SR, H2, HR, R2or ON, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, CI, Br, or I.
- the nucleotide contains a sugar modification.
- Non- limiting examples of sugar modifications include 2'-deoxy-2'-fluoro-oligoribonucleotide (2'- fluoro-2'- deoxycytidine-5 '-triphosphate, 2'-fluoro-2'-deoxyuridine-5 '-triphosphate), 2'-deoxy- 2'- deamine oligoribonucleotide (2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-amino-2'- deoxyuridine-5 '-triphosphate), 2'-O-alkyl oligoribonucleotide, 2'-deoxy-2'-C-alkyl oligoribonucleotide (2 '-O-methylcytidine-5 '-triphosphate, 2'-methyluridine-5 '-triphosphate), 2'-C-alkyl oligoribonucleotide, and isomers thereof (2'-aracytidine-5 '-triphosphate, 2'- arauridine
- the sgRNA contains one or more 2'-fluro, 2'-amino and/or 2'-thio modifications.
- the modification is a 2'-fluoro-cytidine, 2'- fluoro- uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'- amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, 5-amino-allyl- uridine, 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and/or 5-fluoro-uridine.
- nucleoside modifications found on mammalian RNA. See, e.g., Limbach et al., Nucleic Acids Research, 22(12):2183-2196 (1994).
- the preparation of nucleotides and nucleotides and nucleosides are well- known in the art and described in, e.g., U.S. Patent Nos.4,373,071, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5, 132,418, 5, 153,319, 5,262,530, and 5,700,642. Numerous nucleosides and nucleotides that are suitable for use as described herein are commercially available.
- the nucleoside can be an analogue of a naturally occurring nucleoside.
- the analogue is dihydrouridine, methyladenosine, methylcytidine, methyluridine, methylpseudouridine, thiouridine, deoxycytodine, and deoxyuridine.
- the sgRNA described herein includes a nucleobase- ribonucleotide, i.e., a ribonucleotide containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase.
- nucleobases which can be incorporated into nucleosides and nucleotides include m5C (5-methylcytidine), m5U (5 - methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2'-O-methyluridine), mlA (1-methyl adenosine), m2A (2- methyladenosine), Am (2-1-O-methyladenosine), ms2m6A (2-methylthio-N6- methyladenosine), i6A (N6-isopentenyl adenosine), ms2i6A (2- methylthio- N6isopentenyladenosine), io6A (N6-(cis-hydroxyisopentenyl) adenosine), ms2io6A (2- methylthio-N6-(cis-hydroxyisopentenyl)adenosine),
- the sgRNA can be synthesized by any method known by one of ordinary skill in the art.
- the sgRNA is chemically synthesized.
- Modified sgRNAs can be synthesized using 2'-O-thionocarbamate-protected nucleoside phosphoramidites. Methods are described in, e.g., Dellinger et al., J.American Chemical Society, 133, 11540-11556 (2011); Threlfall et al., Organic & Biomolecular Chemistry, 10, 746-754 (2012); and Dellinger et al, J. American Chemical Society, 125, 940-950 (2003).
- Modified sgRNAs are commercially available from, e.g., TriLink BioTechnologies (San Diego, CA). [00134] Additional detailed description of useful sgRNAs can be found in, e.g., Hendel et al., Nat Biotechnol, 2015, 33(9): 985-989 and Dever et al., Nature, 2016, 539: 384-389, the disclosures are herein incorporated by reference in their entirety for all purposes. [00135] A person having skill in the art will appreciate that a guide RNA as disclosed in the present disclosure may be used in combination with any Cas protein known in the art (e.g., any Cas type, from any suitable organism or bacterial species.
- the Cas protein may be a type I, type II, type III, type IV, type V, or type VI Cas protein.
- the Cas protein may comprise one or more domains.
- domains include, a guide nucleic acid recognition and/or binding domain, nuclease domains (e.g., DNase or RNase domains, RuvC, HNH), DNA binding domain, RNA binding domain, helicase domains, protein-protein interaction domains, and dimerization domains.
- the guide nucleic acid recognition and/or binding domain may interact with a guide nucleic acid.
- the nuclease domain may comprise catalytic activity for nucleic acid cleavage.
- the nuclease domain may lack catalytic activity to prevent nucleic acid cleavage.
- the Cas protein may be a chimeric Cas protein that is fused to other proteins or polypeptides.
- the Cas protein may be a chimera of various Cas proteins, for example, comprising domains from different Cas proteins.
- Non-limiting examples of Cas proteins include c2c1, C2c2, c2c3, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, Cas1O, Cas1Od, CasF, CasG, CasH, Cpf1, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr
- the Cas protein may be from any suitable organism.
- Non-limiting examples include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis rougevillei, Streptomyces pristinae spiralis, Streptomyces viridochromo genes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, AlicyclobacHlus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcos
- the organism is Streptococcus pyogenes (S. pyogenes). In some aspects, the organism is Staphylococcus aureus (S. aureus). In some aspects, the organism is Streptococcus thermophilus (S. thermophilus).
- the Cas protein may be derived from a variety of bacterial species including, but not limited to, Veillonella atypical, Fusobacterium nucleatum, Filifactor alocis, Solobacterium moorei, Coprococcus catus, Treponema denticola, Peptoniphilus duerdenii, Catenibacterium mitsuokai, Streptococcus mutans, Listeria innocua, Staphylococcus pseudintermedius, Acidaminococcus intestine, Olsenella uli, Oenococcus kitaharae, Bifidobacterium bifidum, Lactobacillus rhamnosus, Lactobacillus gasseri, Finegoldia magna, Mycoplasma mobile, Mycoplasma gallisepticum, Mycoplasma ovipneumoniae, Mycoplasma canis, Mycoplasma synoviae, Eubacterium rectale, Streptoc
- Torquens Ilyobacter polytropus, Ruminococcus albus, Akkermansia muciniphila, Acidothermus cellulolyticus, Bifidobacterium longum, Bifidobacterium dentium, Corynebacterium diphtheria, Elusimicrobium minutum, Nitratifractor salsuginis, Sphaerochaeta globus, Fibrobacter succinogenes subsp.
- Jejuni Helicobacter mustelae, Bacillus cereus, Acidovorax ebreus, Clostridium perfringens, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria meningitidis, Pasteurella multocida subsp. Multocida, Sutterella wadsworthensis, proteobacterium, Legionella pneumophila, Parasutterella excrementihominis, Wolinella succinogenes, and Francisella novicida.
- the term, “derived,” in this instance, is defined as modified from the naturally-occurring variety of bacterial species to maintain a significant portion or significant homology to the naturally-occurring variety of bacterial species.
- a significant portion may be at least 10 consecutive nucleotides, at least 20 consecutive nucleotides, at least 30 consecutive nucleotides, at least 40 consecutive nucleotides, at least 50 consecutive nucleotides, at least 60 consecutive nucleotides, at least 70 consecutive nucleotides, at least 80 consecutive nucleotides, at least 90 consecutive nucleotides or at least 100 consecutive nucleotides.
- Significant homology may be at least 50% homologous, at last 60% homologous, at least 70% homologous, at least 80% homologous, at least 90% homologous, or at least 95% homologous.
- the derived species may be modified while retaining an activity of the naturally-occurring variety.
- embodiments of the present disclosure provide compositions and methods to treat joint disorders, wherein a portion of the joint cells are genetically modified via gene-editing to treat a joint disorder.
- Embodiments of the present disclosure embrace genetic editing through nucleotide insertion (RNA or DNA), or recombinant protein insertion, into a population of synoviocytes for both promotion of the expression of one or more proteins and inhibition of the expression of one or more proteins, as well as combinations thereof.
- embodiments of the present disclosure also provide methods for delivering gene-editing compositions to joint cells, and in particular delivering gene-editing compositions to synoviocytes.
- a method of genetically modifying joint cells includes the step of stable incorporation of genes for production of one or more proteins.
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of retroviral transduction.
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of lentiviral transduction. Lentiviral transduction systems are known in the art and are described, e.g., in Levine, et al., Proc. Nat’l Acad.
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of gamma-retroviral transduction.
- Gamma-retroviral transduction systems are known in the art and are described, e.g., Cepko and Pear, Cur. Prot. Mol.
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of transposon-mediated gene transfer.
- Transposon-mediated gene transfer systems are known in the art and include systems wherein the transposase is provided as DNA expression vector or as an expressible RNA or a protein such that long-term expression of the transposase does not occur in the transgenic cells, for example, a transposase provided as an mRNA (e.g., an mRNA comprising a cap and poly-A tail).
- Suitable transposon-mediated gene transfer systems including the salmonid-type Tel- like transposase (SB or Sleeping Beauty transposase), such as SB10, SB11, and SB100x, and engineered enzymes with increased enzymatic activity, are described in, e.g., hackett, et al., Mol. Therapy 2010, 18, 674-83 and U.S. Patent No.6,489,458, the disclosures of each of which are incorporated by reference herein.
- viral vectors or systems are used to introduce a gene-editing system into cells comprising a joint.
- the cells are synovial fibroblasts.
- the viral vectors are an AAV vector.
- the AAV vector comprises a serotype selected from the group consisting of: AAV1, AAV1(Y705+731F+T492V), AAV2(Y444+500+730F+T491V), AAV3(Y705+731F), AAV4, AAV5, AAV5(Y436+693+719F), AAV6, AAV6 (VP3 variant Y705F/Y731F/T492V), AAV-7m8, AAV8, AAV8(Y733F), AAV9, AAV9 (VP3 variant Y731F), AAV10(Y733F), AAV-ShH10, and AAV-DJ/8.
- the AAV vector comprises a serotype selected from the group consisting of: AAV1, AAV5, AAV6, AAV6 (Y705F/Y731F/T492V), AAV8, AAV9, and AAV9 (Y731F).
- the viral vector is a lentivirus.
- the lentivirus is selected from the group consisting of: human immunodeficiency-1 (HIV-1), human immunodeficiency-2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana Disease Virus (JDV), equine infectious anemia virus (EIAV), and caprine arthritis encephalitis virus (CAEV).
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of stable incorporation of genes for production or inhibition (e.g., silencing) of one or more proteins.
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of liposomal transfection.
- Liposomal transfection methods such as methods that employ a 1:1 (w/w) liposome formulation of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) and dioleoyl phophotidylethanolamine (DOPE) in filtered water, are known in the art and are described in Rose, et al., Biotechniques 1991, 10, 520-525 and Felgner, et al., Proc. Natl. Acad. Sci.
- DOTMA cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride
- DOPE dioleoyl phophotidylethanolamine
- a method of genetically modifying a portion of a joint’s synoviocytes includes the step of transfection using methods described in U.S. Patent Nos.5,766,902; 6,025,337; 6,410,517; 6,475,994; and 7,189,705; the disclosures of each of which are incorporated by reference herein.
- the gene-editing process may comprise the use of a programmable nuclease that mediates the generation of a double-strand or single-strand break at one or more immune checkpoint genes.
- programmable nucleases enable precise genome editing by introducing breaks at specific genomic loci, i.e., they rely on the recognition of a specific DNA sequence within the genome to target a nuclease domain to this location and mediate the generation of a double-strand break at the target sequence.
- a double-strand break in the DNA subsequently recruits endogenous repair machinery to the break site to mediate genome editing by either non-homologous end-joining (NHEJ) or homology-directed repair (HDR).
- NHEJ non-homologous end-joining
- HDR homology-directed repair
- the repair of the break can result in the introduction of insertion/deletion mutations that disrupt (e.g., silence, repress, or enhance) the target gene product.
- Major classes of nucleases that have been developed to enable site-specific genomic editing include zinc finger nucleases (ZFNs), transcription activator-like nucleases (TALENs), and CRISPR-associated nucleases (e.g., CRISPR-Cas9).
- Non-limiting examples of gene-editing methods that may be used in accordance with the methods of the present disclosure include CRISPR methods, TALE methods, and ZFN methods, which are described in more detail below.
- a pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene-editing system, wherein said gene-editing system targets at least one locus related to joint function, wherein the gene-editing at least a portion of a joint’s synoviocytes by a CRISPR method (e.g., CRISPR-Cas9, CRISPR-Cas13a, or CRISPR/Cpf1 (also known as CRISPR-Cas12a).
- a CRISPR method e.g., CRISPR-Cas9, CRISPR-Cas13a, or CRISPR/Cpf1 (also known as CRISPR-Cas12a.
- the use of a CRISPR method to gene-edit joint synoviocytes causes expression of one or more immune checkpoint genes to be silenced or reduced in at least a portion of the joint’s synoviocytes.
- CRISPR stands for “Clustered Regularly Interspaced Short Palindromic Repeats.”
- a method of using a CRISPR system for gene editing is also referred to herein as a CRISPR method.
- CRISPR systems which incorporate RNAs and Cas proteins, and which may be used in accordance with the present disclosure: Types II, V, and VI.
- Type II CRISPR (exemplified by Cas9) is one of the most well-characterized systems.
- CRISPR technology was adapted from the natural defense mechanisms of bacteria and archaea (the domain of single-celled microorganisms).
- CRISPR- derived RNA and various Cas proteins including Cas9
- Cas9 CRISPR- derived RNA and various Cas proteins, including Cas9
- a CRISPR is a specialized region of DNA with two distinct characteristics: the presence of nucleotide repeats and spacers. Repeated sequences of nucleotides are distributed throughout a CRISPR region with short segments of foreign DNA (spacers) interspersed among the repeated sequences.
- spacers are integrated within the CRISPR genomic loci and transcribed and processed into short CRISPR RNA (crRNA).
- crRNAs anneal to trans-activating crRNAs (tracrRNAs) and direct sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins.
- Target recognition by the Cas9 protein requires a “seed” sequence within the crRNA and a conserved dinucleotide- containing protospacer adjacent motif (PAM) sequence upstream of the crRNA-binding region.
- PAM protospacer adjacent motif
- the CRISPR-Cas system can thereby be retargeted to cleave virtually any DNA sequence by redesigning the crRNA.
- the crRNA and tracrRNA in the native system can be simplified into a single guide RNA (sgRNA) of approximately 100 nucleotides for use in genetic engineering.
- the CRISPR-Cas system is directly portable to human cells by co- delivery of plasmids expressing the Cas9 endo-nuclease and the necessary crRNA and tracrRNA (or sgRNA)components.
- Different variants of Cas proteins may be used to reduce targeting limitations (e.g., orthologs of Cas9, such as Cpf1).
- the CRISPR-Cas system for homologous recombination includes a Cas nuclease (e.g., Cas9 nuclease) or a variant or fragment thereof, a DNA-targeting RNA (e.g., single guide RNA (sgRNA)) containing a guide sequence that targets the Cas nuclease to the target genomic DNA and a scaffold sequence that interacts with the Cas nuclease, and a donor template.
- a Cas nuclease e.g., Cas9 nuclease
- a DNA-targeting RNA e.g., single guide RNA (sgRNA)
- the CRISPR-Cas system can be utilized to create a double-strand break at a desired target gene locus in the genome of a cell, and harness the cell's endogenous mechanisms to repair the induced break by homology-directed repair (HDR).
- HDR homology-directed repair
- the CRISPR-Cas9 nuclease can facilitate locus-specific chromosomal integration of exogenous DNA delivered by AAV vectors.
- the size of the exogenous DNA e.g., transgene, expression cassette, and the like
- the size of the exogenous DNA e.g., transgene, expression cassette, and the like
- an AAV vector which is about 4.0 kb.
- a single AAV vector can only deliver less than about 3.7 kb of exogenous DNA.
- the method described herein allows for the delivery of exogenous DNA that is 4 kb or longer by splitting the nucleotide sequence between two different AAV vectors.
- the donor templates are designed for sequential homologous recombination events that can integrate and fuse the two parts of the nucleotide sequence.
- Homologous recombination of the present disclosure can be performed using an engineered nuclease system for genome editing such as, but not limited to, CRISPR-Cas nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), engineered mega-nucleases.
- a CRISPR-Cas-based nuclease system is used.
- useful nuclease system can be found, e.g., in Gaj et al., Trends Biotechnol, 2013, Jul: 31(7):397-405.
- Any suitable CRISPR/Cas system may be used for the methods and compositions disclosed herein.
- the CRISPR/Cas system may be referred to using a variety of naming systems. Exemplary naming systems are provided in Makarova, K. S. et al, “An updated evolutionary classification of CRISPR-Cas systems,” Nat Rev Microbiol (2015) 13:722-736 and Shmakov, S. et al, “Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems,” Mol Cell (2015) 60:1-13.
- the CRISPR/Cas system may be a type I, a type II, a type III, a type IV, a type V, a type VI system, or any other suitable CRISPR/Cas system.
- the CRISPR/Cas system as used herein may be a Class 1, Class 2, or any other suitably classified CRISPR/Cas system.
- the Class 1 CRISPR/Cas system may use a complex of multiple Cas proteins to effect regulation.
- the Class 1 CRISPR/Cas system may comprise, for example, type I (e.g., I, IA, IB, IC, ID, IE, IF, IU), type III (e.g., III, IIIA, IIIB, IIIC, IIID), and type IV (e.g., IV, IVA, IVB) CRISPR/Cas type.
- the Class 2 CRISPR/Cas system may use a single large Cas protein to effect regulation.
- the Class 2 CRISPR/Cas systems may comprise, for example, type II (e.g., II, IIA, IIB) and type V CRISPR/Cas type. CRISPR systems may be complementary to each other, and/or can lend functional units in trans to facilitate CRISPR locus targeting.
- a nucleotide sequence encoding the Cas nuclease is present in a recombinant expression vector.
- the recombinant expression vector is a viral construct, e.g., a recombinant adeno-associated virus construct, a recombinant adenoviral construct, a recombinant lentiviral construct, etc.
- viral vectors can be based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, and the like.
- a retroviral vector can be based on Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, mammary tumor virus, and the like.
- Useful expression vectors are known to those of skill in the art, and many are commercially available.
- vectors are provided by way of example for eukaryotic host cells: pXTl, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40.
- any other vector may be used if it is compatible with the host cell.
- useful expression vectors containing a nucleotide sequence encoding a Cas9 enzyme are commercially available from, e.g., Addgene, Life Technologies, Sigma- Aldrich, and Origene.
- Host cells are necessary for generating infectious AAV vectors as well as for generating AAV virions based on the disclosed AAV vectors.
- Various host cells are known in the art and find use in the methods of the present disclosure.
- the host cell for use in generating infectious virions can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells.
- prokaryotic e.g., bacterial
- eukaryotic cells including, insect cells, yeast cells and mammalian cells.
- mammalian cells including, e.g., murine cells, and primate cells (e.g., human cells) can be used.
- Particularly desirable host cells are selected from among any mammalian species, including, without limitation, cells such as A549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, CHO, 293, Vero, NIH 3T3, PC12, Huh-7 Saos, C2C12, RAT1, Sf9, L cells, HT1080, human embryonic kidney (HEK), human embryonic stem cells, human adult tissue stem cells, pluripotent stem cells, induced pluripotent stem cells, reprogrammed stem cells, organoid stem cells, bone marrow stem cells, HLHepG2, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals including human, monkey, mouse, rat, rabbit, and hamster.
- cells such as A549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC
- the preparation of a host cell according to the disclosure involves techniques such as assembly of selected DNA sequences. This assembly may be accomplished utilizing conventional techniques. Such techniques include cDNA and genomic cloning, which are well known and are described in Sambrook et al., cited above, use of overlapping oligonucleotide sequences of the adenovirus and AAV genomes, combined with polymerase chain reaction, synthetic methods, and any other suitable methods for providing the desired nucleotide sequence.
- the host cell can contain sequences to drive expression of the AAV capsid polypeptide (in the host cell and rep (replication) sequences of the same serotype as the serotype of the AAV Inverted Terminal Repeats (ITRs) found in the AAV vector, or a cross-complementing serotype.
- the AAV capsid and rep (replication) sequences may be independently obtained from an AAV source and may be introduced into the host cell in any manner known to one of skill in the art or as described herein.
- the sequences encoding each of the essential rep (replication) proteins may be supplied by AAV8, or the sequences encoding the rep (replication) proteins may be supplied by different AAV serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, and/or AAV9).
- the host cell stably contains the capsid protein under the control of a suitable promoter.
- the capsid protein is supplied to the host cell in trans.
- the capsid protein When delivered to the host cell in trans, the capsid protein may be delivered via a plasmid containing the sequences necessary to direct expression of the selected capsid protein in the host cell.
- the vector encoding the capsid protein when delivered to the host cell in trans, also carries other sequences required for packaging the AAV, e.g., the rep (replication) sequences.
- the host cell stably contains the rep (replication) sequences under the control of a suitable promoter.
- the rep (replication) proteins are supplied to the host cell in trans.
- the rep (replication) proteins When delivered to the host cell in trans, the rep (replication) proteins may be delivered via a plasmid containing the sequences necessary to direct expression of the selected rep (replication) proteins in the host cell.
- the vector encoding the capsid protein also carries other sequences required for packaging the AAV vector, e.g., the rep (replication) sequences.
- the rep (replication) and capsid sequences may be transfected into the host cell on a single nucleic acid molecule and exist stably in the cell as an unintegrated episome.
- the rep (replication) and capsid sequences are stably integrated into the chromosome of the cell.
- a useful nucleic acid molecule for such transfection comprises, from 5’ to 3’, a promoter, an optional spacer interposed between the promoter and the start site of the rep (replication) gene sequence, an AAV rep (replication) gene sequence, and an AAV capsid gene sequence.
- the molecule(s) providing rep (replication) and capsid can exist in the host cell transiently (i.e., through transfection), in some embodiments, one or both of the rep (replication) and capsid proteins and the promoter(s) controlling their expression be stably expressed in the host cell, e.g., as an episome or by integration into the chromosome of the host cell.
- the methods employed for constructing embodiments of the disclosure are conventional genetic engineering or recombinant engineering techniques such as those described in the references above.
- a variety of methods of generating AAV virions are known in the art and can be used to generate AAV virions comprising the AAV vectors described herein.
- an AAV vector of the disclosure inserts or transducing an AAV vector of the disclosure into a host cell capable of packaging the AAV vector into and AAV virion. Exemplary methods are described and referenced below; however, any method known to one of skill in the art can be employed to generate the AAV virions of the disclosure.
- An AAV vector comprising a heterologous nucleic acid (e.g., a donor template) and used to generate an AAV virion can be constructed using methods that are well known in the art. See, e.g., Koerber et al. (2009) Mol. Ther., 17:2088; Koerber et al. (2008) Mol Ther., 16: 1703-1709; as well as U.S. Pat.
- heterologous sequence(s) can be directly inserted into an AAV genome with the major AAV open reading frames (“ORFs”) excised therefrom.
- ORFs major AAV open reading frames
- Other portions of the AAV genome can also be deleted, so long as a sufficient portion of the ITRs remain to allow for replication and packaging functions.
- Such constructs can be designed using techniques well known in the art. See, e.g., U.S. Pat. Nos.5,173,414 and 5,139,941; International Publication Nos. WO 92/01070 (published Jan.23, 1992) and WO 93/03769 (published Mar.4, 1993); Lebkowski et al. (1988) Molec. Cell.
- transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197.
- Particularly suitable transfection methods include calcium phosphate co-precipitation (Graham et al. (1973) Virol.52:456-467), direct micro-injection into cultured cells (Capecchi, M. R. (1980) Cell 22:479-488), electroporation (Shigekawa et al.
- any of a number of transcription and translation control elements including promoter, transcription enhancers, transcription terminators, and the like, may be used in the expression vector.
- Useful promoters can be derived from viruses, or any organism, e.g., prokaryotic or eukaryotic organisms.
- Suitable promoters include, but are not limited to, the SV40 early promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter, adenovirus major late promoter (Ad MLP), a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter (such as the CMV immediate early promoter region; CMVIE), a rous sarcoma virus (RSV) promoter, a human U6 small nuclear promoter (U6), an enhanced U6 promoter, and a human HI promoter (HI), etc.
- LTR mouse mammary tumor virus long terminal repeat
- Ad MLP adenovirus major late promoter
- HSV herpes simplex virus
- CMV cytomegalovirus
- RSV rous sarcoma virus
- U6 small nuclear promoter U6 small
- polynucleotide encoding a Cas nuclease can be used in the present disclosure.
- a polynucleotide e.g., mRNA
- a Cas nuclease e.g., Cas9 polypeptide
- a Cas nuclease e.g., Cas9 polypeptide
- a sgRNA e.g., Cas9 ribonucleoprotein
- the molar ratio of Cas nuclease to sgRNA can be any range that facilitates sequential homologous recombination of the targeting AAV vectors and target genetic locus.
- the molar ratio of Cas9 polypeptide to sgRNA is about 1:5; 1:4; 1:3; 1:2.5; 1:2; or 1:1.
- the molar ratio of Cas9 polypeptide to sgRNA is about 1:2 to about 1:3.
- the molar ratio of Cas9 polypeptide to sgRNA is about 1:2.5.
- the Cas nuclease and variants or fragments thereof can be introduced into a cell (e.g., a cell isolated from a subject, or an in vivo cell such as in a subject) as a Cas polypeptide or a variant or fragment thereof, an mRNA encoding a Cas polypeptide or a variant or fragment thereof, a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide or a variant or fragment thereof, or a Cas ribonucleoprotein.
- a cell e.g., a cell isolated from a subject, or an in vivo cell such as in a subject
- a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide or a variant or fragment thereof, or a Cas ribonucleoprotein.
- Non-limiting examples of such methods include electroporation, nucleofection, transfection, lipofection, transduction, microinjection, electroinjection, electrofusion, nanoparticle bombardment, transformation, conjugation, and the like.
- Non-limiting examples of genes that may be silenced or inhibited by permanently gene-editing synoviocytes via a CRISPR method include IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, and TNF- ⁇ .
- Non-limiting examples of genes that may be enhanced by permanently gene-editing synoviocytes via a CRISPR method include IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, and TNF- ⁇ .
- genetic modifications of at least a portion of a joint’s synoviocytes may be performed using the CRISPR-Cpf1 system as described in U.S. Patent No. US 9,790,490, the disclosure of which is incorporated by reference herein.
- genetic modifications of at least a portion of a joint’s synoviocytes, as described herein may be performed using a CRISPR-Cas system comprising single vector systems as described in U.S. Patent No.9,907,863, the disclosure of which is incorporated by reference herein.
- a pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene-editing system, wherein said gene-editing system targets at least one locus related to joint function, wherein the method further comprises gene-editing at least a portion of joint synoviocytes by a TALE method.
- a TALE method to target at least one locus related to joint function, wherein the gene- editing at least a portion of a joint’s synoviocytes.
- TALE Transcription Activator-Like Effector proteins, which include TALENs (“Transcription Activator-Like Effector Nucleases”).
- a method of using a TALE system for gene editing may also be referred to herein as a TALE method.
- TALEs are naturally occurring proteins from the plant pathogenic bacteria genus Xanthomonas, and contain DNA-binding domains composed of a series of 33–35-amino-acid repeat domains that each recognizes a single base pair. TALE specificity is determined by two hypervariable amino acids that are known as the repeat-variable di-residues (RVDs). Modular TALE repeats are linked together to recognize contiguous DNA sequences. A specific RVD in the DNA-binding domain recognizes a base in the target locus, providing a structural feature to assemble predictable DNA-binding domains.
- RVDs repeat-variable di-residues
- TALE Transcription activator-like effector
- the DNA binding domains of a TALE are fused to the catalytic domain of a type IIS FokI endonuclease to make a targetable TALE nuclease.
- two individual TALEN arms separated by a 14- 20 base pair spacer region, bring FokI monomers in close proximity to dimerize and produce a targeted double-strand break.
- TALE repeats can be combined to recognize virtually any user-defined sequence. Custom-designed TALE arrays are also commercially available through Cellectis Bioresearch (Paris, France), Transposagen Biopharmaceuticals (Lexington, KY, USA), and Life Technologies (Grand Island, NY, USA).
- Non-limiting examples of genes that may be silenced or inhibited by permanently gene-editing synoviocytes via a TALE method include IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, and TNF- ⁇ .
- Non-limiting examples of genes that may be enhanced by permanently gene-editing synoviocytes via a TALE method include IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, and TNF- ⁇ .
- TALE method examples include IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, and TNF- ⁇ .
- a pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a gene-editing system, wherein said gene-editing system targets at least one locus related to joint function, wherein the method further comprises gene-editing at least a portion of joint synoviocytes by a zinc finger or zinc finger nuclease method.
- a zinc finger method during to target at least one locus related to joint function, wherein the gene-editing at least a portion of a joint’s synoviocytes to cause expression of at least one locus related to joint function genes to be enhanced in at least a portion of the joint synoviocytes.
- An individual zinc finger contains approximately 30 amino acids in a conserved ⁇ configuration. Several amino acids on the surface of the ⁇ -helix typically contact 3 bp in the major groove of DNA, with varying levels of selectivity. Zinc fingers have two protein domains. The first domain is the DNA binding domain, which includes eukaryotic transcription factors and contain the zinc finger.
- the second domain is the nuclease domain, which includes the FokI restriction enzyme and is responsible for the catalytic cleavage of DNA.
- the DNA-binding domains of individual ZFNs typically contain between three and six individual zinc finger repeats and can each recognize between 9 and 18 base pairs. If the zinc finger domains are specific for their intended target site then even a pair of 3-finger ZFNs that recognize a total of 18 base pairs can, in theory, target a single locus in a mammalian genome.
- One method to generate new zinc-finger arrays is to combine smaller zinc-finger “modules” of known specificity.
- the most common modular assembly process involves combining three separate zinc fingers that can each recognize a 3 base pair DNA sequence to generate a 3-finger array that can recognize a 9 base pair target site.
- selection-based approaches such as oligomerized pool engineering (OPEN) can be used to select for new zinc-finger arrays from randomized libraries that take into consideration context-dependent interactions between neighboring fingers.
- Engineered zinc fingers are available commercially; Sangamo Biosciences (Richmond, CA, USA) has developed a propriety platform (CompoZr®) for zinc-finger construction in partnership with Sigma–Aldrich (St. Louis, MO, USA).
- Non-limiting examples of genes that may be silenced or inhibited by permanently gene-editing synoviocytes via a zinc finger method include IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, TNF- ⁇ . IL-6, IL-8, IL-18, a matrix metalloproteinase (MMP), or a component of the NLRP3 inflammasome.
- the component of the NLRP3 inflammasome comprises NLRP3, ASC (apoptosis-associated speck-like protein containing a CARD), caspase-1, and combinations thereof.
- Non-limiting examples of genes that may be enhanced by permanently gene-editing synoviocytes via a zinc finger method include group comprising IL-1Ra, TIMP-1, TIMP-2, TIMP-3, TIMP-4, and combinations thereof.
- the disclosure provides compositions for up-regulation of anti-inflammatory cytokines.
- cells may be gene-edited ex vivo, wherein the gene-editing targets one or more anti-inflammatory cytokine locus.
- the cells are non-synovial cells.
- the cells are mesenchymal stem cells.
- the cells are macrophages.
- the present disclosure provides for a pharmaceutical composition for the treatment or prevention of a joint disease or condition comprising a population of gene-edited cells, wherein said gene-edited cells are edited by a gene-editing system targeting at least one locus related to joint function.
- the population of gene-edited cells are injected into a synovial joint.
- the present disclosure provides a pharmaceutical composition for the treatment or prevention of a joint disease or condition, the composition including a therapeutically effective amount of one or more nucleic acids encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) gene-editing system.
- the system includes a CRISPR Associated Protein 9 (Cas9) protein, and at least one guide RNA targeting an IL-1 ⁇ or IL-1 ⁇ gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) sequence for the Cas9 protein.
- Cas9 Clustered Regularly Interspaced Short Palindromic Repeats
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 2 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 of the IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 4 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 of the IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 6 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 7 of the IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 3 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 7 of the IL-1 ⁇ gene. [00200] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 4 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00206] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00208] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 298- 387. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 298-387.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:301.
- the crRNA sequence has at least 95% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence is SEQ ID NO:301. [00211] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:309.
- the crRNA sequence is SEQ ID NO:309.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 388- 496. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 388-496.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 of the IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 2 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 2 of the human IL-1 ⁇ gene. [00214] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 3 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no mismatches with the target sequence in exon 3 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 4 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 4 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 of the IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 5 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 5 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 6 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 6 of the human IL-1 ⁇ gene. [00218] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 7 of the IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 7 of the human IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 7 of the human IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 3 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 7 of the IL-1 ⁇ gene. [00220] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 4 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00226] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00228] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:462.
- the crRNA sequence has at least 80% identity to SEQ ID NO:462.
- the crRNA sequence has at least 85% identity to SEQ ID NO:462.
- the crRNA sequence has at least 90% identity to SEQ ID NO:462.
- the crRNA sequence has at least 95% identity to SEQ ID NO:462.
- the crRNA sequence is SEQ ID NO:462.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:391.
- the crRNA sequence has at least 80% identity to SEQ ID NO:391.
- the crRNA sequence has at least 85% identity to SEQ ID NO:391.
- the crRNA sequence has at least 90% identity to SEQ ID NO:391.
- the crRNA sequence has at least 95% identity to SEQ ID NO:391.
- the crRNA sequence is SEQ ID NO:391.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:393.
- the crRNA sequence has at least 80% identity to SEQ ID NO:393.
- the crRNA sequence has at least 85% identity to SEQ ID NO:393.
- the crRNA sequence has at least 90% identity to SEQ ID NO:393.
- the crRNA sequence has at least 95% identity to SEQ ID NO:393.
- the crRNA sequence is SEQ ID NO:393.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:388.
- the crRNA sequence has at least 80% identity to SEQ ID NO:388.
- the crRNA sequence has at least 85% identity to SEQ ID NO:388.
- the crRNA sequence has at least 90% identity to SEQ ID NO:388.
- the crRNA sequence has at least 95% identity to SEQ ID NO:388.
- the crRNA sequence is SEQ ID NO:388.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:389.
- the crRNA sequence has at least 80% identity to SEQ ID NO:389.
- the crRNA sequence has at least 85% identity to SEQ ID NO:389.
- the crRNA sequence has at least 90% identity to SEQ ID NO:389.
- the crRNA sequence has at least 95% identity to SEQ ID NO:389.
- the crRNA sequence is SEQ ID NO:389.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 522- 590.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 522-590.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:552.
- the crRNA sequence has at least 95% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence is SEQ ID NO:552. [00236] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:554.
- the crRNA sequence is SEQ ID NO:554.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:578.
- the crRNA sequence has at least 80% identity to SEQ ID NO:578.
- the crRNA sequence has at least 85% identity to SEQ ID NO:578.
- the crRNA sequence has at least 90% identity to SEQ ID NO:578.
- the crRNA sequence has at least 95% identity to SEQ ID NO:578.
- the crRNA sequence is SEQ ID NO:578.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:579.
- the crRNA sequence has at least 80% identity to SEQ ID NO:579.
- the crRNA sequence has at least 85% identity to SEQ ID NO:579.
- the crRNA sequence has at least 90% identity to SEQ ID NO:579.
- the crRNA sequence has at least 95% identity to SEQ ID NO:579.
- the crRNA sequence is SEQ ID NO:579.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 497- 551.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 497-551.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:498.
- the crRNA sequence has at least 95% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence is SEQ ID NO:498.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:506.
- the crRNA sequence is SEQ ID NO:506.
- the pharmaceutical composition includes one or more viral vectors, as described herein, collectively comprising the one or more nucleic acids.
- the one or more viral vectors include a recombinant virus selected from a retrovirus, an adenovirus, an adeno-associated virus, a lentivirus, and a herpes simplex virus-1.
- the one of more viral vectors include a recombinant adeno- associated virus (AAV).
- the recombinant AAV is of serotype 5 (AAV5).
- the recombinant AAV is of serotype 6 (AAV6).
- the one of more viral vectors include a first viral vector comprising a first nucleic acid, in the one or more nucleic acids, encoding the Cas9 protein, and a second viral vector comprising a second nucleic acid, in the one or more nucleic acids, encoding the at least one guide RNA.
- the one of more viral vectors comprise a viral vector comprising a single nucleic acid, wherein the single nucleic acid encodes the Cas9 protein and the at least one guide RNA.
- the composition includes one or more liposomes collectively comprising the one or more nucleic acids. In some embodiments, the one or more nucleic acids are present in a naked state.
- the Cas9 protein is an S. pyogenes Cas9 polypeptide. In some embodiments, the Cas9 protein is an S. aureus Cas9 polypeptide.
- the composition is formulated for parenteral administration. In some embodiments, the composition is formulated for intra-articular injection within a joint of a subject. [00247] In another aspect, the disclosure provides a method for the treatment or prevention of a joint disease or condition in a subject in need thereof.
- the method includes administering, to a joint of the subject, a pharmaceutical composition comprising a pharmaceutically effective amount of a composition comprising one or more nucleic acids encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) gene- editing system.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- the system includes a CRISPR Associated Protein 9 (Cas9) protein, and at least one guide RNA targeting an IL-1 ⁇ or IL-1 ⁇ gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) sequence for the Cas9 protein.
- Cas9 CRISPR Associated Protein 9
- PAM protospacer adjacent motif
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 298-387.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 298- 387. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 298-387.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:301.
- the crRNA sequence has at least 95% identity to SEQ ID NO:301. In some embodiments, the crRNA sequence is SEQ ID NO:301. [00250] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:309. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:309.
- the crRNA sequence is SEQ ID NO:309.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 388-496.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 388- 496. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 388-496.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:462.
- the crRNA sequence has at least 95% identity to SEQ ID NO:462. In some embodiments, the crRNA sequence is SEQ ID NO:462. [00253] In some embodiments, the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:391. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:391.
- the crRNA sequence is SEQ ID NO:391.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:393.
- the crRNA sequence has at least 80% identity to SEQ ID NO:393.
- the crRNA sequence has at least 85% identity to SEQ ID NO:393.
- the crRNA sequence has at least 90% identity to SEQ ID NO:393.
- the crRNA sequence has at least 95% identity to SEQ ID NO:393.
- the crRNA sequence is SEQ ID NO:393.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:388.
- the crRNA sequence has at least 80% identity to SEQ ID NO:388.
- the crRNA sequence has at least 85% identity to SEQ ID NO:388.
- the crRNA sequence has at least 90% identity to SEQ ID NO:388.
- the crRNA sequence has at least 95% identity to SEQ ID NO:388.
- the crRNA sequence is SEQ ID NO:388.
- the at least one guide RNA targets a human IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:389.
- the crRNA sequence has at least 80% identity to SEQ ID NO:389.
- the crRNA sequence has at least 85% identity to SEQ ID NO:389.
- the crRNA sequence has at least 90% identity to SEQ ID NO:389.
- the crRNA sequence has at least 95% identity to SEQ ID NO:389.
- the crRNA sequence is SEQ ID NO:389.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 522- 590.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 522-590. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 522-590.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:552.
- the crRNA sequence has at least 95% identity to SEQ ID NO:552. In some embodiments, the crRNA sequence is SEQ ID NO:552. [00259] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:554. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:554.
- the crRNA sequence is SEQ ID NO:554.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:578.
- the crRNA sequence has at least 80% identity to SEQ ID NO:578.
- the crRNA sequence has at least 85% identity to SEQ ID NO:578.
- the crRNA sequence has at least 90% identity to SEQ ID NO:578.
- the crRNA sequence has at least 95% identity to SEQ ID NO:578.
- the crRNA sequence is SEQ ID NO:578.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:579.
- the crRNA sequence has at least 80% identity to SEQ ID NO:579.
- the crRNA sequence has at least 85% identity to SEQ ID NO:579.
- the crRNA sequence has at least 90% identity to SEQ ID NO:579.
- the crRNA sequence has at least 95% identity to SEQ ID NO:579.
- the crRNA sequence is SEQ ID NO:579.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 2 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene. [00263] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 3 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 4 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 5 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene. [00266] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 6 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 7 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 7 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 3 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL- 1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 7 of the IL-1 ⁇ gene. [00269] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 4 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL- 1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL- 1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL- 1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 6, or exon 7 of the IL-1 ⁇ gene. [00273] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00275] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00277] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.
- the crRNA sequence has at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 497- 551.
- the crRNA sequence has at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.
- the crRNA sequence has at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551.
- the crRNA sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 497-551. In some embodiments, the crRNA sequence is selected from the group consisting of SEQ ID NOs: 497-551. [00279] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:498.
- the crRNA sequence has at least 95% identity to SEQ ID NO:498. In some embodiments, the crRNA sequence is SEQ ID NO:498.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence having at least 75% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 80% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 85% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 90% identity to SEQ ID NO:506. In some embodiments, the crRNA sequence has at least 95% identity to SEQ ID NO:506.
- the crRNA sequence is SEQ ID NO:506.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 2 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 2 of the canine IL-1 ⁇ gene. [00282] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 3 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no mismatches with the target sequence in exon 3 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 4 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 4 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 5 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 5 of the canine IL-1 ⁇ gene. [00285] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 6 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no mismatches with the target sequence in exon 6 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 7 of the IL-1 ⁇ gene.
- the crRNA sequence forms no more than 5 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 4 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene.
- the crRNA sequence forms no more than 3 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 2 mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no more than 1 mismatch with the target sequence in exon 7 of the canine IL-1 ⁇ gene. In some embodiments, the crRNA sequence forms no mismatches with the target sequence in exon 7 of the canine IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 3 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2 or exon 7 of the IL-1 ⁇ gene. [00288] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 4 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5 or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 6 or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 4 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 5 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00294] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 5 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. [00296] In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 6 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 5, exon 6, or exon 6 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 6, or exon 7 of the IL-1 ⁇ gene. In some embodiments, the at least one guide RNA targets a canine IL-1 ⁇ gene, and includes a crRNA sequence that is complementary to a target sequence in exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the IL-1 ⁇ gene.
- the crRNA sequences described herein may include one or more nucleotide substitutions, e.g., relative to the reverse complement of the target sequence.
- Guidance for making nucleotide substitutions can be found, for example, in Jiang et al.and Doudna (Jiang and Doudna, Annu. Rev. Biophys., 46:505–29 (2017)), the content of which is incorporated herein by reference, in its entirety, for all purposes.
- Jiang and Doudna considers molecular structures generated for many different confirmations of the CRISPR/Cas9 system, ranging from apo Cas9 protein ( Figure 3) to Cas9-sgRNA complexes bound to the target strand of an invaded double-stranded DNA molecule ( Figures 5 and 7), to arrive at a detailed molecule model of CRISPR/Cas9 binding and cleavage in Figure 6. From these molecular models, the person of ordinary skill in the art would know which nucleotide positions in the crRNA sequence would be more tolerant of mismatches with the target sequence.
- Jiang teaches that the PAM-proximal 10-12 nucleotides, also known as the ‘seed region’ of the crRNA targeting sequence, are most critical for robust CRISPR/Cas9 binding. Specifically, Jiang discloses that mismatches in the seed region “severely impair or completely abrogate target DNA binding and cleavage, whereas close homology in the seed region often leads to off-target binding events even with many mismatches elsewhere,” i.e., in the PAM-distal 8-10 nucleotides. Jiang at 512.
- a crRNA sequence used in the compositions and/or methods of the disclosure include one or more nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the PAM-distal 8-10 nucleotides.
- a crRNA sequence includes one nucleotide substitution, e.g., relative to any of SEQ ID NOs: 298-590, within the PAM-distal 8-10 nucleotides. In some embodiments, a crRNA sequence includes two nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the PAM-distal 8-10 nucleotides. In some embodiments, a crRNA sequence includes three nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the PAM-distal 8-10 nucleotides.
- a crRNA sequence includes four nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the PAM-distal 8-10 nucleotides. In some embodiments, a crRNA sequence includes five nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the PAM-distal 8-10 nucleotides. [00300] Accordingly, in some embodiments, a crRNA sequence used in the compositions and/or methods of the disclosure include one or more nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 8 positions of the crRNA sequence.
- a crRNA sequence includes one nucleotide substitution, e.g., relative to any of SEQ ID NOs: 298-590, within the first 8 positions of the crRNA sequence. In some embodiments, a crRNA sequence includes two nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 8 positions of the crRNA sequence. In some embodiments, a crRNA sequence includes three nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 8 positions of the crRNA sequence.
- a crRNA sequence includes four nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 8 positions of the crRNA sequence. In some embodiments, a crRNA sequence includes five nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 8 positions of the crRNA sequence. [00301] Similarly, in some embodiments, a crRNA sequence used in the compositions and/or methods of the disclosure include one or more nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 10 positions of the crRNA sequence.
- a crRNA sequence includes one nucleotide substitution, e.g., relative to any of SEQ ID NOs: 298-590, within the first 10 positions of the crRNA sequence. In some embodiments, a crRNA sequence includes two nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 10 positions of the crRNA sequence. In some embodiments, a crRNA sequence includes three nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 10 positions of the crRNA sequence.
- a crRNA sequence includes four nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 10 positions of the crRNA sequence. In some embodiments, a crRNA sequence includes five nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within the first 10 positions of the crRNA sequence. [00302] Further, Jiang and Doudna postulates that base pairing of PAM-distal nucleotides at positions 14-17 of the crRNA targeting sequence are important for cleavage activity, following binding to the target sequence.
- a crRNA sequence used in the compositions and/or methods of the disclosure include one or more nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8-10 of the crRNA sequence.
- a crRNA sequence includes one nucleotide substitution, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8-10 of the crRNA sequence.
- a crRNA sequence includes two nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8-10 of the crRNA sequence. In some embodiments, a crRNA sequence includes three nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8-10 of the crRNA sequence. In some embodiments, a crRNA sequence includes four nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298- 590, within nucleotide positions 1-3 and 8-10 of the crRNA sequence.
- a crRNA sequence includes five nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8-10 of the crRNA sequence.
- a crRNA sequence used in the compositions and/or methods of the disclosure includes one or more nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8 of the crRNA sequence.
- a crRNA sequence includes one nucleotide substitution, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8 of the crRNA sequence. In some embodiments, a crRNA. In some embodiments, a crRNA sequence includes two nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8 of the crRNA sequence. In some embodiments, a crRNA.
- a crRNA sequence includes three nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, within nucleotide positions 1-3 and 8 of the crRNA sequence. In some embodiments, a crRNA. In some embodiments, a crRNA sequence includes four nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298- 590, within nucleotide positions 1-3 and 8 of the crRNA sequence. In some embodiments, a crRNA.
- a crRNA sequence used in the compositions and/or methods of the disclosure include one or more nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, throughout the entire sequence of the crRNA, e.g., as determined through experimentation.
- a crRNA sequence used in the compositions and/or methods of the disclosure includes one nucleotide substitution, e.g., relative to any of SEQ ID NOs: 298-590, throughout the entire sequence of the crRNA, e.g., as determined through experimentation.
- a crRNA sequence used in the compositions and/or methods of the disclosure includes two nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, throughout the entire sequence of the crRNA, e.g., as determined through experimentation.
- a crRNA sequence used in the compositions and/or methods of the disclosure includes three nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, throughout the entire sequence of the crRNA, e.g., as determined through experimentation.
- a crRNA sequence used in the compositions and/or methods of the disclosure includes four nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, throughout the entire sequence of the crRNA, e.g., as determined through experimentation.
- a crRNA sequence used in the compositions and/or methods of the disclosure includes five nucleotide substitutions, e.g., relative to any of SEQ ID NOs: 298-590, throughout the entire sequence of the crRNA, e.g., as determined through experimentation.
- the joint disease or condition is arthritis. In some embodiments, the arthritis is osteoarthritis.
- the administering includes intra-articular injection of the pharmaceutical composition into the joint of the subject.
- the pharmaceutical composition is administered during surgery.
- the pharmaceutical composition is administered after surgery.
- the pharmaceutical composition is a controlled release pharmaceutical composition.
- the pharmaceutical composition includes one or more viral vectors, as described herein, collectively comprising the one or more nucleic acids.
- the one or more viral vectors include a recombinant virus selected from a retrovirus, an adenovirus, an adeno-associated virus, a lentivirus, and a herpes simplex virus-1.
- the one of more viral vectors include a recombinant adeno- associated virus (AAV). In some embodiments, the recombinant AAV is of serotype 5 (AAV5). In some embodiments, the recombinant AAV is of serotype 6 (AAV6). [00309] In some embodiments, the one of more viral vectors include a first viral vector comprising a first nucleic acid, in the one or more nucleic acids, encoding the Cas9 protein, and a second viral vector comprising a second nucleic acid, in the one or more nucleic acids, encoding the at least one guide RNA.
- AAV recombinant adeno- associated virus
- AAV5 serotype 5
- AAV6 serotype 6
- the one of more viral vectors include a first viral vector comprising a first nucleic acid, in the one or more nucleic acids, encoding the Cas9 protein, and a second viral vector comprising a second nucle
- the one of more viral vectors comprise a viral vector comprising a single nucleic acid, wherein the single nucleic acid encodes the Cas9 protein and the at least one guide RNA.
- the composition includes one or more liposomes collectively comprising the one or more nucleic acids.
- the one or more nucleic acids are present in a naked state.
- the Cas9 protein is an S. pyogenes Cas9 polypeptide.
- the Cas9 protein is an S. aureus Cas9 polypeptide.
- compositions and methods described herein can be used in a method for treating diseases. In an embodiment, they are for use in treating inflammatory joint disorders. They may also be used in treating other disorders as described herein and in the following paragraphs. In an aspect, the compositions and methods are used to treat osteoarthritis (OA).
- OA osteoarthritis
- the present disclosure provides a method for the treatment or prevention of a joint disease or condition the method comprising introducing a gene-editing system, wherein the gene-editing system targets at least one locus related to joint function.
- the joint disease is osteoarthritis.
- the method is used to treat a canine with osteoarthritis.
- the method is used to treat a mammal with degenerative joint disease.
- the method is used to treat a canine or an equine with a joint disease.
- the method is used to treat osteoarthritis, post-traumatic arthritis, post-infectious arthritis, rheumatoid arthritis, gout, pseudogout, auto-immune mediated arthritides, inflammatory arthritides, inflammation-mediated and immune-mediated diseases of joints.
- the method further comprises gene-editing a portion of a the joint synoviocytes to reduce or silence the expression of one or more of IL-1 ⁇ , IL-1 ⁇ , IL-4, IL-9, IL-10, IL-13, and TNF- ⁇ .
- the method further comprises gene-editing a portion of a the joint synoviocytes to reduce or silence the expression of one or more of IL- 1 ⁇ , IL-1 ⁇ .
- the method further comprises gene-editing, wherein the gene-editing comprises one or more methods selected from a CRISPR method, a TALE method, a zinc finger method, and a combination thereof.
- the method further comprises delivering the gene-editing using an AAV vector, a lentiviral vector, or a retroviral vector.
- the method further comprises delivering the gene-editing using AAV1, AAV1(Y705+731F+T492V), AAV2(Y444+500+730F+T491V), AAV3(Y705+731F), AAV5, AAV5(Y436+693+719F), AAV6, AAV6 (VP3 variant Y705F/Y731F/T492V), AAV-7m8, AAV8, AAV8(Y733F), AAV9, AAV9 (VP3 variant Y731F), AAV10(Y733F), and AAV-ShH10.
- the AAV vector comprises a serotype selected from the group consisting of: AAV1, AAV5, AAV6, AAV6 (Y705F/Y731F/T492V), AAV8, AAV9, and AAV9 (Y731F).
- Pharmaceutical Compositions and Methods of Administration [00317] The methods described herein include the use of pharmaceutical compositions comprising CRISPR gene (e.g., IL-1 ⁇ and/or IL-1 ⁇ ) editing complexes as an active ingredient.
- CRISPR gene e.g., IL-1 ⁇ and/or IL-1 ⁇
- pharmaceutical dosage forms come in several types. These include many kinds of liquid, solid, and semisolid dosage forms.
- a liquid pharmaceutical dosage form is the liquid form of a dose of a chemical compound used as a drug or medication intended for administration or consumption.
- a composition of the present disclosure can be delivered to a subject subcutaneously (e.g., intra-articular injection), dermally (e.g., transdermally via patch), and/or via implant.
- Exemplary pharmaceutical dosage forms include, e.g., pills, osmotic delivery systems, elixirs, emulsions, hydrogels, suspensions, syrups, capsules, tablets, orally dissolving tablets (ODTs), gel capsules, thin films, adhesive topical patches, lollipops, lozenges, chewing gum, dry powder inhalers (DPIs), vaporizers, nebulizers, metered dose inhalers (MDIs), ointments, transdermal patches, intradermal implants, subcutaneous implants, and transdermal implants.
- DPIs dry powder inhalers
- MDIs metered dose inhalers
- “dermal delivery” or “dermal administration” can refer to a route of administration wherein the pharmaceutical dosage form is taken to, or through, the dermis (i.e., layer of skin between the epidermis (with which it makes up the cutis) and subcutaneous tissues).
- “Subcutaneous delivery” can refer to a route of administration wherein the pharmaceutical dosage form is to or beneath the subcutaneous tissue layer.
- solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfate; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
- a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents
- antibacterial agents such as benzyl alcohol or methyl parabens
- antioxidants
- compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
- Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
- Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- nucleic acid agents can be administered by any method suitable for administration of nucleic acid agents, such as a DNA vaccine.
- methods include gene guns, bio injectors, and skin patches as well as needle-free methods such as the micro-particle DNA vaccine technology disclosed in U.S. Pat. No.6,194,389, and the mammalian transdermal needle-free vaccination with powder-form vaccine as disclosed in U.S. Pat. No.6,168,587.
- intranasal delivery is possible, as described in, inter alia, Hamajima et al., Clin. Immunol. Immunopathol., 88(2), 205-10 (1998).
- Liposomes e.g., as described in U.S. Pat.
- Therapeutic compounds can be prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as collagen, ethylene vinyl acetate, polyanhydrides (e.g., poly[1,3-bis(carboxyphenoxy)propane-co-sebacic-acid] (PCPP-SA) matrix, fatty acid dimer-sebacic acid (FAD-SA) copolymer, poly(lactide-co-glycolide)), polyglycolic acid, collagen, polyorthoesters, polyethyleneglycol-coated liposomes, and polylactic acid.
- PCPP-SA poly[1,3-bis(carboxyphenoxy)propane-co-sebacic-acid]
- FAD-SA fatty acid dimer-sebacic acid
- polyglycolic acid collagen
- collagen polyorthoesters
- polyethyleneglycol-coated liposomes and polylactic acid
- Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No.4,522,811. Semisolid, gelling, soft-gel, or other formulations (including controlled release) can be used, e.g., when administration to a surgical site is desired. Methods of making such formulations are known in the art and can include the use of biodegradable, biocompatible polymers. See, e.g., Sawyer et al., Yale J Biol Med.2006 December; 79(3-4): 141-152.
- mice are treated as follows: Group 1: Direct injection into the OA joint a CRISPR AAV vector engineered to target IL-1 ⁇ and IL-1 ⁇ , and silence or reduce the expression of IL-1 protein.
- Group 2 Direct injection into the OA joint a CRISPR AAV vector engineered with a “nonsense” payload that will not affect an IL-1 production; a negative control.
- Group 3 Direct injection into the OA joint a CRISPR AAV vector engineered to target IL-1Ra, and silence or reduce the expression of IL-1Ra protein.
- Group 4 Direct injection into the OA joint sterile buffered saline; a control for the injection process.
- mice are monitored before and after treatment to assess effects on their locomotion, and exploratory activities. Mechanical sensitivity and changes to the gait are also monitored. Allodynia and hind limb grip force may also be monitored. [00330] After about eight weeks, the animals are sacrificed and the OA joint tissue assessed for gross histopathology, and IL-1 expression by IHC. Biomarkers of inflammation are also assessed, for example, MMP-3 expression in the OA joint.
- mice treated with a CRISPR AAV vector engineered to target IL-1 ⁇ and IL-1 ⁇ , and silence or reduce the expression of IL-1 protein, will show reduced levels of IL-1 by IHC, tissue regeneration by histopathology, and lower levels of inflammation biomarkers than any of the three other Groups.
- Group 3 mice will show relatively higher levels of inflammation biomarker than any of the other three groups.
- EXAMPLE 2
- CRISPR guide RNA Phosphorothionate-modified sgRNA, Table 3
- Il1a-201 ENSMUST00000028882.1 and Il1b-201 ENSMUST00000028881.13 were designed against Exon 4 of Il1a and Exon 4 of Il1b(Il1a-201 ENSMUST00000028882.1 and Il1b-201 ENSMUST00000028881.13; see Table 2 for target sequences on Exon 4 of Il1a and Exon 4 of Il1b).
- Il1a primer fwd CATTGGGAGGATGCTTAGGA (SEQ ID NO:620), Il1a primer rev: GGCTGCTTTCTCTCCAACAG (SEQ ID NO:621), Il1b primer fwd: AGGAAGCCTGTGTCTGGTTG (SEQ ID NO:622), Il1b primer rev: TGGCATCGTGAGATAAGCTG (SEQ ID NO:623). Amplicons were PCR purified (QiaQuick PCR purification kit cat#28106).
- Guide cutting efficiency was determined using an in vitro cleavage assay using 100 ng purified PCR product, 200 ng modified guide RNA (Sigma Aldrich) and 0.5 ⁇ g TrueCut Spy Cas9 protein V2 (Invitrogen A36498) or 0.5 ⁇ g Gene Snipper NLS Sau Cas9 (BioVision Cat#M1281-50-1).
- the two types of Cas9, S. pyogenes Cas9 and S. aureus Cas9, were compared for their editing capabilities.
- a 2% agarose gel was used for a qualitative readout of the cleavage assay.
- CRISPR guide RNA Phosphorothionate-modified sgRNA, Table 2
- Exon 4 of Il1a and Exon 4 of Il1b Il1a-201 ENSMUST00000028882.1 and Il1b-201 ENSMUST00000028881.13
- Guide RNA cutting efficiency was determined in a pool of J774.2 and NIH3T3 cells using Sanger sequencing and Synthego ICE (see, e.g., Inference of CRISPR Edits from Sanger Trace Data, Hsiau T, Maures T, Waite K, Yang J et al.
- the cells were electroporated (Amaxa 4D Nucleofector unit, Lonza) with 5 ⁇ g TrueCut Spy Cas9 protein V2 (Invitrogen A36498) or 5 ⁇ g EnGen Sau Cas9 protein (NEB M0654T) with 100 pmol modified guide RNA (Sigma Aldrich).
- SF nucleofector solution and programme CM139 was used for J774.2 cells and SG nucleofector solution and programme EN158 was used for NIH3T3 cells.
- a cell pellet was taken 3 days’ post electroporation and gDNA was extracted from each pool (Qiagen, DNeasy blood and tissue kit, 69506).
- Exon 4 of Il1aor Il1b was amplified in the appropriate pool by PCR (Phusion High-Fidelity DNA polymerase, NEB, cat#M0530S).
- Il1a primer fwd TGGTTTCAGGAAAACCCAAG (SEQ ID NO:624)
- Il1a primer rev GCAGTATGGCCAAGAAAGGA (SEQ ID NO:625)
- Il1b primer fwd AGGAAGCCTGTGTCTGGTTG (SEQ ID NO:622)
- Il1b primer rev CTGGGCAAGAACATTGGATT (SEQ ID NO:626).
- Amplicons were subjected to Sanger sequencing, and analyzed using either the Synthego ICE or TIDE web tools to determine the absence of wild type sequence in each clone and the presence of indels resulting in a frameshift in the cDNA sequence.
- Each cRNA (see, e.g., Table 3) was synthesized as a single guide RNA consisting of the cRNA sequences above fused to the tracrRNA sequences below (see, e.g., SEQ ID Nos: 35-36).
- an A ⁇ >U flip is used to increase guide RNA activity.
- Fig.1A illustrates agarose gel electrophoresis analysis of 100 ng mouse DNA, cleaved by 0.5 ⁇ g Spy Cas9 and 200 ng modified guide RNA’s 43-46 for Il1a gene and 47-50 for IL1B. DNA is cut at a specific site by the cas9 using the guide RNA to create a predictable band pattern on the agarose gel compared to the uncut control (without wishing to be bound by any particular theory, the agarose gel electrophoresis for sg8* appears to show a failed synthesis).
- Fig.1B illustrates agarose gel electrophoresis analysis of 100 ng mouse DNA, cleaved by 0.5 ⁇ g Sau Cas9 and 200 ng modified guide RNA’s 51-53 for Il1a gene and 54-56 for Il1b. DNA is cut at a specific site by the Cas9 using the guide RNA to create a predictable band pattern on the agarose gel compared to the uncut control.
- Editing Cell Lines [00343] Genomic DNA was extracted from the edited pools and the Il1a or Il1b exon 4 was PCR amplified in the appropriate pools. The PCR products were sent for sanger sequencing and then deconvoluted using TIDE or Synthego ICE software.
- Synthego ICE was used to deconvolute the Spy Cas9 pools.
- the software can determine the patterns of editing in each pool based on the guide RNA sequence and PAM site. It can distinguish between editing which has caused an in frame deletion that could lead to a truncated functional protein, and editing which has causes a frameshift mutation which will lead to a true knockout.
- the SauCas9 pools were analysed with TIDE because Synthego ICE software cannot deconvolute SauCas9 editing.
- TIDE analysis works in a similar way to ICE by determining patterns of editing in a pool based on the guide RNA and PAM site. However, rather than giving a true knockout score, it gives an editing efficiency score, which cannot distinguish between in frame and frameshift editing patterns.
- SpyCas9 is the standard protein used in CRISPR gene editing. However, it is 4101bp compared to Sau Cas9 which is 3156bp. Due to the size limitations of packaging some viruses, such as AAV, it was decided to compare the editing capabilities of SauCas9 and SpyCas9 to see whether the smaller Sau Cas9 could be used in the vector being designed for this project.
- Figs.2A – 2D illustrate graphs displaying editing efficiencies of Spy Cas9 (Figs.2A and 2B) and SauCas9 (Figs.2C and 2D) used with a range of guide RNA’s in J774.2 (“J”) and NIH3T3 (“N”) cells. Editing efficiencies were determined using Synthego ICE or TIDE sanger deconvolution software.
- Fig.2A knock out efficiency of Il1a using guide RNA 43-46 with SpyCas9 in J774.2 and NIH3T3. Synthego ICE was used to deconvolute the sanger sequence trace and determine knock out efficiency.
- Fig.2B knock out efficiency of Il1b using guide RNA 47-50 with SpyCas9 in J774.2 and NIH3T3; without wishing to be bound by any particular theory, the data for sgRNA8 appears to show a failed synthesis.
- Synthego ICE was used to deconvolute the sanger sequence trace and determine knock out efficiency.
- Fig.2C knock out efficiency of Il1a using guide RNA 51-53 with saCas9 in J774.2 and NIH3T3. TIDE was used to deconvolute the sanger sequence trace and determine the editing efficiency.
- Fig.2D knock out efficiency of Il1b using guide RNA 54-56 with Sau Cas9 in J774.2 and NIH3T3.
- TIDE was used to deconvolute the sanger sequence trace and determine the editing efficiency.
- EXAMPLE 3 Reducing IL-1 ⁇ expression by CRISPR Gene-engineering in a Mouse Uric Acid Model. [00345] Time Course Experiment to determine Optimal Pre-Treatment Time [00346] A pilot experiment is performed to determine optimal pre-treatment time of mice with virus prior to challenging the mice with uric acid. Mice are injected with GFP-labeled AAV5 vector into the knee joint. Viral load is then quantified by PCR and location of viral infection is quantified by histology at 3, 5, and 7 days after infection.
- a treatment time that yields robust expression of virus inside the joint is selected as the optimal lead time for injecting viral vectors into the mice for the experiments to determine the reduction of IL-1b in a mouse uric acid model by a CRISPR AAV vector engineered to target IL-1b and silence or reduce expression of IL-1b.
- mice are selected and distributed into three groups: Group 1: mice injected with a CRISPR AAV vector (AAV-spCas9) engineered to target IL-1b, and silence or reduce expression of IL-1 protein, Group 2: mice injected with “scrambled” guide RNA / Cas9 (AAV-spCas9), a CRISPR AAV vector engineered with a payload that will not affect IL-1 production, and Group 3: mice injected with saline.
- Group 1 mice injected with a CRISPR AAV vector (AAV-spCas9) engineered to target IL-1b, and silence or reduce expression of IL-1 protein
- Group 2 mice injected with “scrambled” guide RNA / Cas9 (AAV-spCas9), a CRISPR AAV vector engineered with a payload that will not affect IL-1 production
- Group 3 mice injected with saline.
- mice are then challenged with uric acid after an optimal pre-treatment time.
- the animals are sacrificed and the joint tissue is analyzed for cytokine expression (e.g., assessed for IL-1 expression by IHC).
- the joint tissue may also be assessed for gross histopathology and for expression of biomarkers of inflammation.
- Group 1 mice treated with a CRISPR AAV vector engineered to target IL-1b, and silence or reduce the expression of IL-1 protein, will show reduced levels of IL-1 by IHC and lower levels of inflammation biomarkers than any of the two other groups.
- EXAMPLE 4 Time Course Study of Intra-Articular Injection of AAV in Mice.
- AAV- particles were shipped on dry ice and were stored at ⁇ 80 °C immediately upon receipt. Just prior to dosing, the AAV- particles were reconstituted in phosphate buffered saline (PBS without calcium and magnesium: Corning, lot No.11419005) for IA dosing at 10 ⁇ L per knee. See the study protocol (Appendix A) for additional details of test article preparation, storage, and handling.
- mice were acclimated for 4 days prior to being paced in the study. An attending veterinarian was on site or on call during the live phase of the study. No concurrent medications were given. [00357] During the acclimation and study periods, the animals were housed in a laboratory environment with temperatures ranging 19 °C to 25 °C and relative humidity of 30% to 70%. Automatic timers provided 12 hours of light and 12 hours of dark. The animals were allowed access ad libitum to Envigo Teklad 8640 diet and fresh municipal tap water. [00358] Experimental Design - On study day 0, the mice were randomized by body weight into treatment groups. Following randomization, the animals were dosed by intra-articular (IA) injection as indicated in Table 4.
- IA intra-articular
- mice Animal body weights were measured as described in section 8.5.1. The mice were euthanized for necropsy and tissue collection at 3 time points (days 3, 5, and 7) as described below in the section titled ‘Necropsy Specimens’. Table 4. Group and Treatment Information [00359] Observations, Measurements, and Specimens [00360] Body Weight Measurements - The mice were weighed for randomization on study day 0 and again on days 1, 3, 5, and 7. Body weight measurements can be found in Table 6. [00361] Necropsy Specimens - The mice were necropsied on study days 3, 5, and 7 as indicated in Table 5. Table 5.
- mice were bled to exsanguination via cardiac puncture followed by cervical dislocation.
- Right and left knees were harvested from all animals. The skin and muscle were removed from the joints while keeping the joint capsule intact. Joints were flash-frozen separately in 15-mL conical tubes labeled with only mouse number, day of collection, and right or left leg. Knee joints were stored frozen at - 80 °C for shipment.
- Animal Disposition - Animal carcasses were disposed of according to BBP SOPs.
- Specimen and Raw Data Storage - Specimens (right and left knee joints), study data, and reports were delivered during or at the completion of the study.
- PROTOCOL [00371] Test System Number of animals: 33 (30 + 3 extra) Species/Strain or Breed: C57BL/6 Vendor: Jackson Age/Wt at Arrival: 8-10 weeks old ( ⁇ 20 grams) Gender: Male Age/Wt Range at Study Initiation: At least 9 weeks by study initiation Acclimation: Will be acclimated for at least 3 days after arrival at BBP Housing: 3-5 animals/cage Study Calendar [00372] Materials [00373] Test Article and Vehicle Information [00374] Unformulated Test Article Storage Conditions - GFP-tagged AAV5 (Group 1): - 80C; GFP-tagged AAV6 (Group 1): - 80 °C.
- Vehicle Information - GFP-tagged AAV5 (Group 1): PBS (w/o Ca & Mg); GFP- tagged AAV6 (Group 1): PBS (w/o Ca & Mg).
- Test Article Formulation Instructions & Calculations - GFP-tagged AAV5 (Group 1): Dilute stock to appropriate concentration using PBS; GFP-tagged AAV6 (Group 1): Dilute stock to appropriate concentration using PBS.
- Dosing Formulations and Vehicle Storage & Stability - GFP-tagged AAV5 (Group 1): Dilute just prior to injecting; GFP-tagged AAV6 (Group 1): Dilute just prior to injecting.
- MIA monoiodoacetate
- MIA model does not involve surgical incision of the joint capsule, making it much more relevant to the capsules of human patients with OA.
- Injection of MIA crystals in rodents reproduces OA-like lesions and functional impairment that can be analyzed and quantified by techniques such as behavioral testing and objective lameness assessment.
- MIA is an inhibitor of glyceraldehyde-3-phosphatase and the resulting alterations in cellular glycolysis eventual cause the death of cells within the joint, including chondrocytes. Chondrocyte death manifests as cartilage degeneration and alterations in proteoglycan staining.
- mice injected with MIA usually exhibit pain-like behavior within 72 hours, and cartilage loss by around 4 weeks post-injection. Increases in IL-1 expression have been documented within 2-3 days of injection in rats and in mice.
- Study Design - Mice are injected unilaterally with either MIA or the saline vehicle control (one joint per animal). Within each group, half of the animals are pre-treated with the AAV-CRISPR-Cas9 vector targeting the mouse IL-1 beta gene, and the other half are injected with an AAV-CRISPR-Cas9 scrambled control.
- mice from both groups will be taken off study at one of two time points: an early time point of 48 hours, to allow for assessment of the impact of therapy on the levels of IL-1 within the synovial fluid, and a late time point of 4 weeks to allow for assessment of the impact of therapy on cartilage breakdown and histological evidence of osteoarthritis.
- Methods [00390] Experimental Animals - A total of 80 mice are used in this study. The experimental procedures are reviewed and approved by the local IACUC. Mice are housed in micro-isolator cages, fed a standard laboratory animal diet, and allowed access to water ad libitum.
- mice are acclimated for a period of 7 days ahead of the study. On the first day of the study, mice are anaesthetized with an inhaled mixture of isoflurane in oxygen. Once a surgical plane of anesthesia has been confirmed, the right hind limb is clipped and the skin scrubbed with a surgical antiseptic.40 mice (Treated) receive an intra-articular injection of the AAV- CRISPR-Cas9 vector targeting IL-1, and the remaining 40 animals (Control) are injected intra-articularly with the AAV-CRISPR-Cas9 scrambled control.
- mice in each group are injected in the same joint with MIA and half with the saline vehicle. This leads to the establishment of four study groups: Group 1: Treated-MIA (20 mice) Group 2: Control-MIA (20 mice) Group 3: Treated-Vehicle (20 mice) Group 4: Control-Vehicle (20 mice) [00392] Ten mice per group are euthanised 48 hours after the MIA challenge in order to document IL-1 levels in the knee joint. The remaining animals will be housed for 4 weeks in order to evaluate the effects of therapy on pain behavior (behavioral testing, including von Frey testing), lameness (limb use), joint swelling (caliper measurement) and joint pathology (histopathology).
- Gouty arthritis is characterized by increased serum urate concentration and deposits of monosodium urate crystals (MSU) in and around the joints, leading to swollen joints and severe pain (Sabina EP, Chandel S, and Rasool MK. Inhibition of monosodium urate crystal-induced inflammation by withaferin A. J Pharm Pharmaceut Sci.2008; 11(4):46-55, which is incorporated by reference herein in its entirety for all purposes).
- Current treatments include nonsteroidal anti- inflammatory drugs (NSAIDs), steroids, or colchicine.
- AAV adeno-associated virus
- MSU monosodium urate
- mice were given injections into right knee (same joint as treatment) with MSU crystals (25 mg/mL: 250 ⁇ g in 10 ⁇ L PBS). The mice were euthanized for necropsy approximately 6 hours post-MSU injection on study day 7. Efficacy evaluation was based on animal body weights, von Frey testing, and knee caliper measurements.
- Area under the curve (AUC) calculations for von Frey assessments did not differ statistically across groups. Animal body weight gain and knee swelling did not differ statistically across groups (Table 7). All animals survived to study termination. Table 7.
- AAV vectors were pre-formulated as a viral particle suspension (>5 x 10 12 virus genome [vg] copies per mL) in frozen aliquots. The aliquots were stored at ⁇ 80°C and reconstituted in diluent (sterile filtered PBS [Corning, lot No.01420007]) immediately before use. Standard biosafety level 2 (BSL-2) handling was used by personnel handling the AAV vectors prior to injection.
- BSL-2 standard biosafety level 2
- the AAV scramble controls were prepared in sterile PBS to form working stocks containing 1 x 10 12 vg/mL for IA injection at 10 ⁇ L/knee to deliver 1 x 10 10 vg of the scramble control into the knee joint.
- the active AAV vectors were prepared by mixing equal parts of each of the two active AAV-5 or AAV-6 constructs with sterile PBS to form working stocks containing 5 x 10 11 vg/mL for each of the two guides.
- the active AAV formulations were injected IA at 10 ⁇ L/knee to deliver 5 x 10 9 vg of each of the two guides into the knee joint. See the study protocol (Appendix B) for further details of test article preparation, storage, and handling.
- MSU Monosodium urate
- PBS without Ca or Mg: Corning, catalogue No.21-031-CV, lot No.31719003
- mice weighed approximately 20 to 29 grams (mean of approx.25 g) at enrollment on study day ⁇ 1.
- Animals were identified by color-coded dots at the base of the tail delineating animal number. After enrollment, all cages were labeled with protocol number, group number, and animal numbers.
- Environment and Husbandry [00413] Upon arrival, the animals were housed 3 to 5 per cage in polycarbonate cages with corncob bedding and suspended food and water bottles. The mice were housed in individually ventilated pie cages (passive airflow, approximately 0.045-0.048 m2 floor space).
- MSU crystals were prepared at a concentration of 25mg/mL in sterile PBS. Crystals did solubilize, and injection preparation was carefully mixed prior to use.10uL of MSU crystal solution was injected into the right knee joint. [00420] Body Weight Measurements and Live Phase Sampling [00421] The mice were weighed on study day ⁇ 1 (pre-injection) for randomization, and body weights were measured again on study days 2 and 6. Animal body weight measurements can be found in Table 9.
- Body Weight and Dose Calculation Data (MGA-UCM-2) Table 9 (continued).
- Body Weight and Dose Calculation Data (MGA-UCM-2 [00422] Von Frey Methods [00423] Von Frey analysis was performed on right hind paws at 5 time points: baseline (day ⁇ 1), 6 hours post-dose (day 0), 24 hours post-dose (day 1), pre-MSU injection (0 h, day 7), and 6 hours post-MSU injection (day 7). The groups were blinded to the researcher during von Frey testing.
- the von Frey method evaluates mechanical allodynia (pain due to a stimulus that does not normally provoke pain) based on the response of animals to the application of calibrated filaments (Bioseb, Vitrolles, France) to the foot.
- the filaments are identified by a number representing log10 of the force in milligrams ⁇ 10.
- the animals are habituated to the testing rack three times (45 to 60 minutes) prior to baseline evaluation.
- the von Frey hair is placed on the surface of the hind paw and pushed smoothly until the hair has a significant bend in it; the hair is pressed against the paw for six seconds. Responses are recoded as either a 0 (no response) or a 1 (response).
- a response is defined as lifting the hind paw away from the hair, jerking the leg away, walking away from the hair, etc.
- the starting hair is 3.22, if the animal responds the tester moves down to 2.83, if there is no response to the 3.22 hair then the tester moves up to 3.61; the tester continues to test hairs based on the response and moves up or down, as appropriate.
- the hair increments are as follows: 1.65, 2.36, 2.44, 2.83, 3.22, 3.61, 3.84, 4.08, 4.17.
- Each paw is tested 5 times, moving up and down between hairs until the final filament is reached. Data is entered into a spreadsheet and used to translate the response rate into a paw withdraw threshold.
- Results of testing are converted to an absolute threshold (50% response rate) in grams, using the formula 10(x + yz)/10000, where x equals the log unit value of the final tested filament, y equals the tabular value for the response pattern from Dixon’s up-and-down method for small samples (Dixon, 1965), and z equals the average interval between filament values.
- Testing is done on the hind portions of the hind paw as the heel tends to give a more reliable and sensitive response. The testers monitor the animals for hyper-responding or freezing, in which case the animals are left alone until calm. Von Frey data can be found in Table 10.
- AAV Preparation [00444] Standard Operating Procedure for Preparing Virus for Injection [00445] Create a working stock that contains 5 x 10 ⁇ 11 vg per ml for each construct (Guide 1, Guide 2). Note that for equivalence, the scramble control group needs to be injected with a total of 1 x 10 ⁇ 10 copies of the scrambled vector. Diluent (PBS) will be used in the vehicle control group.
- PBS Diluent
- Group 1 AAV-6 Scramble Control - Aliquot 400 microliters of sterile-filtered Ca- and Mg-free PBS into a sterile Eppendorf tube. Add 100 microliters (equivalent to 5 x 10 ⁇ 11 vg) of the stock AA06-CCPCTR01-AD01-200. This results in a 0.5 ml volume of working stock containing 1 x 10 ⁇ 12 vg/ml of the AAV-5 scramble control. Injection of 10 microliters of this solution into the knee joint delivers 1 x 10 ⁇ 10 vg of the AAV-6 scramble control.
- Group 2 Active AAV-6 Guide 1+2 - Aliquot 800 microliters of sterile-filtered Ca- and Mg-free PBS into a sterile Eppendorf tube. Add 100 microliters (equivalent to 5 x 10 ⁇ 11 vg) of each of the two active AAV-6 constructs – this means 100 microliters (equivalent to 5 x 10 ⁇ 11 vg) of AA06-MCP001682-AD01-2-200-a and 100 microliters (equivalent to 5 x 10 ⁇ 11 vg) of the stock AA06-MCP001682-AD01-2-200-b.
- Group 3 PBS - The sterile-filtered Ca- and Mg-free PBS used to dilute the virus stock served as the vehicle control for this study. It was dosed at 10 microliters per knee joint.
- Group 4 AAV-5 Scramble Control - Aliquot 400 microliters of sterile-filtered Ca- and Mg-free PBS into a sterile Eppendorf tube.
- Group 5 Active AAV-6 Guide 1+2 - Aliquot 800 microliters of sterile-filtered Ca- and Mg-free PBS into a sterile Eppendorf tube.
- AUC calculations for von Frey assessments did not differ statistically across groups. Animal body weight gain and knee swelling did not differ statistically across groups. All animals survived to study termination. EXAMPLE 6.
- Guide RNAs targeting human IL-1 ⁇ and IL-1 ⁇ were designed according to the following procedure: 1. Identify appropriate genome assembly and gene model (Tools: Ensemble, UCSC Genome Browser); 2. Identify key functional domains to map out targeting window (Tools: Ensemble; Literature); 3. Generate list of all possible guide RNAs across key exons (Tools: Ensemble, UCSC, InDelphi); 4. Rank guides based on ML-predicted frameshifting score and exclude poor performers; 5. Exclude guides ⁇ 5bp from intron:exon boundaries and with homopolynucleotide tracts of 6 x T’s or greater; 6.
- RNAs targeting cat, dog, or horse IL-1 ⁇ and IL-1 ⁇ were designed according to the following procedure: 1. Identify appropriate genome assembly and gene model (Tools: Ensemble, UCSC Genome Browser) 2. Identify key functional domains to map out targeting window (Tools: Ensemble; Literature) 3. Retrieve coding sequence from appropriate exons and relevant flanking intronic sequences (Tools: Ensemble. APE) 4.
- EXAMPLE 7 Immunohistochemistry for Murine IL-1 ⁇
- Immunohistochemistry was performed on Murine synovial tissue to detect IL-1 ⁇ according to the following protocol: [00465] Reagents & Preparation 1.10X PBS with 0.5% (v/v) Tween-20 2. Sterile PBS 3. IHC buffer 4. Primary antibody (goat anti-mouse IL-1; AF-401-NA, R&D Systems, Inc.) reconstituted to a final concentration of 0.2 mg/ml in sterile PBS. a. Short-term storage at +4C b. Long-term storage at -20 to -70C 5.
- control antibody normal goat IgG; AB-108-C, R&D Systems Inc.
- control antibody normal goat IgG; AB-108-C, R&D Systems Inc.
- Peroxidase block BLOXALL reagent, Vector Laboratories
- DAB chromogen [00466] Method [00467] Antigen retrieval was performed for 1 hour (manual or automated, user preference), and then samples were transferred to PBS for short-term storage. Peroxidase block was performed for 10 minutes at room temperature, and samples were subsequently washed in IHC buffer for 5 mins. Samples were blocked with control horse serum for 60 minutes at room temperature, and exposed to primary antibody (1:100 or 1:200 diluted in 1 x PBS- Tween) for 2 hours at room temperature. Samples were washed in IHC buffer twice for 5 mins (each wash).
- FIG. 13A-13D show a ranked list of crRNA sequences identified from exons 2-7 of the human IL-1 ⁇ gene.
- Figures 14A-14E show a ranked list of crRNA sequences identified from exons 2-7 of the human IL-1 ⁇ gene.
- Figures 15A-15C show crRNA sequences identified from exons 3-5 of the canine IL-1 ⁇ gene.
- Figures 16A-16B show a crRNA sequences identified from exons 3-5 of the canine IL-1 ⁇ gene.
- Single gRNAs were ranked according to maximal on-target editing using Azimuth 2.0 model (10.1038/nbt.3437) and minimal off-target editing using Cutting Frequencing Determination (CFD) (10.1038/nbt.3437) and the specificity score from Hsu et al. (10.1038/nbt.2647). 3. Highly ranked sgRNA with high frameshift frequencies (>75%) and uniform DNA repair outcomes (>0.48) as predicted by inDelphi (10.1038/s41586-018-0686-x) were selected for in vitro synthesis. [00472] Using this selection criteria, crRNA guide sequences targeting different exons of the respective target genes were selected for further investigation.
- CFD Cutting Frequencing Determination
- sg235 SEQ ID NO:301
- sg236 SEQ ID NO:309 target exons 3 and 4 of the human IL-1 ⁇ gene were selected.
- sg237 SEQ ID NO:462
- sg238 SEQ ID NO:391
- sg248 SEQ ID NO:393
- sg249 SEQ ID NO:388
- sg250 SEQ ID NO:389
- sg239 SEQ ID NO:552
- sg240 SEQ ID NO:554
- sg251 SEQ ID NO:578
- sg252 SEQ ID NO:579
- sg241 SEQ ID NO:498
- sg242 SEQ ID NO:506
- sgRNAs Single guide RNAs
- Synthego Single guide RNAs
- Primers for genotyping were designed to be at least 200 bp from the target site and generate PCR amplicons ⁇ 1.5kb and synthesized (Merck).
- the nucleocuvette was placed into the 37°C / 5% CO2 incubator for 10 min for the cells to recover from the electrical voltage. Afterwards, 80 ⁇ l growth medium was added to the nucleocuvette well and cells transferred into 6-well dishes with prewarmed growth medium. [00475] Between two- and eleven-days post-electroporation, genomic DNA was extracted from 50-200K cells using DNeasy Blood & Tissue kit (Qiagen, Catalog 69506). Single gRNA target (and off-target) regions were amplified by PCR.
- PCR products were size-verified by gel electrophoresis, purified using QIAquick PCR purification kit (Qiagen, Catalog 28106) and submitted for Sanger sequencing at Source BioScience.
- Sanger traces (ab1) were deconvoluted using ICE version 1.2 (found online at the URL github.com/synthego-open/ice) to infer CRISPR edits.
- machine- learning predictions of gene editing using the selected probes was generated using inDelphi.
- the predicted off-target sites were analysed through direct sequencing to verify whether gRNA facilitates off-target editing.
- Results of the empirical experiments and machine-learning prediction of gene editing using the selected guide sequences is shown in Figure 17.
- EXAMPLE 9 Effect of selected CRISPR/Cas9 RNA guides on canine and human interleukin-1 alpha (IL-1 ⁇ ) and interleukin-1 beta (IL-1 ⁇ ) release.
- the gRNA with the highest knockout (KO) scores from Example 8 i.e., the highest frameshift frequency
- KO knockout
- human chondrocytes were edited to achieve >99% IL-1 ⁇ KO using crRNA sequence CAGAGACAGAUGAUCAAUGG (SEQ ID NO:301) and 67% IL-1 ⁇ KO using crRNA sequence GUGCAGUUCAGUGAUCGUAC (SEQ ID NO:389).
- Canine chondrocytes were edited to achieve 97% IL-1 ⁇ KO using crRNA sequence GACAUCCCAGCUUACCUUCA (SEQ ID NO:554) and 99% IL-1 ⁇ KO using crRNA sequence ACUCUUGUUACAGAGCUGGU (SEQ ID NO:506).
- Canine chondrocytes (Catalog Cn402K-05), human chondrocytes (Catalog 402-05a) and human fibroblast-like synovial cells (Catalog 408-05a) were purchased as frozen stocks (5 x 10 ⁇ 5 cells) from Cell Applications, Inc., San Diego, CA.
- Chondrocytes were cultured in growth medium consisting of DMEM/Ham’s F12 (Gibco, Catalog 21331-020) supplemented with 20% (v/v) untreated FBS (Gibco, Catalog 10270-106) and 1x GlutaMAX (Gibco, Catalog 35050-038).
- Synovial cells were cultured in growth medium consisting of DMEM (Gibco, Catalog 11960-044), 10% non-treated FBS (Gibco, Catalog 10270-106) and 1x GlutaMAX (Gibco, Catalog 35050-038). Cells were confirmed as being negative for Mycoplasma spp. and subjected to STR profiling prior to use.
- IL-1 alpha and IL-1 beta release The concentration of IL-1 alpha and IL-1 beta in culture medium was measured with species-specific commercial assays, following the manufacturer’s instructions. Prior to measurement, frozen media were thawed and then centrifuged (1,500 g for 2 mins) in order to remove cellular debris.
- P3 primary cell nucleofection reagents and nucleocuvette strips were purchased from Lonza (Slough, UK).
- Cas9 nuclease (Catalog A36499) was purchased from Thermo Fisher Scientific.
- Lipopolysaccharide (LPS) from E. coli O55:B5 (Catalog L6529) was purchased from Merck.
- ELISA kits for human IL-1 alpha (Catalog ab214025) and human IL-1 beta (Catalog ab100560), canine IL-1 alpha (Catalog A4270) and canine IL-1 beta (Catalog ab273170) were purchased from Abcam (Cambridge, UK).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Endocrinology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Epidemiology (AREA)
- Peptides Or Proteins (AREA)
- Immunology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Rheumatology (AREA)
- Physical Education & Sports Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063052881P | 2020-07-16 | 2020-07-16 | |
| US63/052,881 | 2020-07-16 | ||
| US202063055808P | 2020-07-23 | 2020-07-23 | |
| US63/055,808 | 2020-07-23 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2022016100A2 true WO2022016100A2 (en) | 2022-01-20 |
| WO2022016100A3 WO2022016100A3 (en) | 2022-03-17 |
Family
ID=79555038
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/042048 Ceased WO2022016100A2 (en) | 2020-07-16 | 2021-07-16 | Gene editing to improve joint function |
| PCT/US2021/042100 Ceased WO2022016121A2 (en) | 2020-07-16 | 2021-07-16 | Gene editing to improve joint function |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/042100 Ceased WO2022016121A2 (en) | 2020-07-16 | 2021-07-16 | Gene editing to improve joint function |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US20230257779A1 (https=) |
| EP (1) | EP4182461A4 (https=) |
| JP (1) | JP2023535351A (https=) |
| KR (1) | KR20230041729A (https=) |
| CN (1) | CN116113696A (https=) |
| AU (1) | AU2021308079A1 (https=) |
| BR (1) | BR112023000738A2 (https=) |
| CA (1) | CA3186119A1 (https=) |
| IL (1) | IL299846A (https=) |
| MX (1) | MX2023000671A (https=) |
| WO (2) | WO2022016100A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024215959A3 (en) * | 2023-04-11 | 2024-12-12 | Orthobio Therapeutics, Inc. | Lipid nanoparticles for gene editing systems |
| WO2025024814A3 (en) * | 2023-07-26 | 2025-03-06 | Orthobio Therapeutics, Inc. | Transmembrane receptor gene editing |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117448379A (zh) * | 2023-12-22 | 2024-01-26 | 上海元戊医学技术有限公司 | iPSC来源的IL-10蛋白过表达MSC细胞株的构建方法及其应用 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9711040D0 (en) * | 1997-05-29 | 1997-07-23 | Duff Gordon W | Prediction of inflammatory disease |
| WO2005077333A2 (en) * | 2004-02-10 | 2005-08-25 | University Of Florida Research Foundation, Inc. | Gel-based delivery of recombinant adeno-associated virus vectors |
| US20160279202A1 (en) * | 2013-10-31 | 2016-09-29 | Ramot At Tel-Aviv University Ltd. | Interleukin-1 (il-1) inhibitors for treating fertility disorders |
| US20170240901A1 (en) * | 2014-02-26 | 2017-08-24 | The University Of Liverpool | Nucleic acids, and uses therof |
| US20170335331A1 (en) * | 2014-10-31 | 2017-11-23 | The Trustees Of The University Of Pennsylvania | Altering Gene Expression in CART Cells and Uses Thereof |
| WO2017223107A1 (en) * | 2016-06-20 | 2017-12-28 | Unity Biotechnology, Inc. | Genome modifying enzyme therapy for diseases modulated by senescent cells |
| WO2018031950A1 (en) * | 2016-08-12 | 2018-02-15 | Caribou Biosciences, Inc. | Protein engineering methods |
-
2021
- 2021-07-16 EP EP21842178.2A patent/EP4182461A4/en active Pending
- 2021-07-16 CN CN202180054064.8A patent/CN116113696A/zh active Pending
- 2021-07-16 BR BR112023000738A patent/BR112023000738A2/pt unknown
- 2021-07-16 US US18/005,544 patent/US20230257779A1/en active Pending
- 2021-07-16 KR KR1020237004715A patent/KR20230041729A/ko active Pending
- 2021-07-16 JP JP2023502921A patent/JP2023535351A/ja active Pending
- 2021-07-16 CA CA3186119A patent/CA3186119A1/en active Pending
- 2021-07-16 MX MX2023000671A patent/MX2023000671A/es unknown
- 2021-07-16 WO PCT/US2021/042048 patent/WO2022016100A2/en not_active Ceased
- 2021-07-16 WO PCT/US2021/042100 patent/WO2022016121A2/en not_active Ceased
- 2021-07-16 IL IL299846A patent/IL299846A/en unknown
- 2021-07-16 AU AU2021308079A patent/AU2021308079A1/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024215959A3 (en) * | 2023-04-11 | 2024-12-12 | Orthobio Therapeutics, Inc. | Lipid nanoparticles for gene editing systems |
| WO2025024814A3 (en) * | 2023-07-26 | 2025-03-06 | Orthobio Therapeutics, Inc. | Transmembrane receptor gene editing |
Also Published As
| Publication number | Publication date |
|---|---|
| IL299846A (en) | 2023-03-01 |
| JP2023535351A (ja) | 2023-08-17 |
| US20230257779A1 (en) | 2023-08-17 |
| WO2022016100A3 (en) | 2022-03-17 |
| MX2023000671A (es) | 2023-05-16 |
| BR112023000738A2 (pt) | 2023-03-21 |
| CN116113696A (zh) | 2023-05-12 |
| AU2021308079A8 (en) | 2023-03-16 |
| WO2022016121A3 (en) | 2022-03-10 |
| EP4182461A4 (en) | 2025-03-19 |
| KR20230041729A (ko) | 2023-03-24 |
| WO2022016121A2 (en) | 2022-01-20 |
| AU2021308079A1 (en) | 2023-03-02 |
| EP4182461A2 (en) | 2023-05-24 |
| CA3186119A1 (en) | 2022-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xu et al. | CRISPR-mediated genome editing restores dystrophin expression and function in mdx mice | |
| Salmon et al. | Safety profile of recombinant adeno-associated viral vectors: focus on alipogene tiparvovec (Glybera®) | |
| US20200131539A1 (en) | Crispr/cas 9-mediated integration of polynucleotides by sequential homologous recombination of aav donor vectors | |
| US20230257779A1 (en) | Gene editing to improve joint function | |
| JP2020508685A (ja) | サプレッサーtRNA及びデアミナーゼによる変異のRNAターゲティング | |
| US20240299579A1 (en) | Gene editing to improve joint function | |
| KR20210096088A (ko) | 전이유전자 전달용 조성물 및 방법 | |
| Liu et al. | Allele-specific gene-editing approach for vision loss restoration in RHO-associated retinitis pigmentosa | |
| US12419968B2 (en) | Gene editing to improve joint function | |
| US20230235321A1 (en) | Gene editing to improve joint function | |
| HK40120118A (zh) | 用於改善关节功能的基因编辑 | |
| US20230303990A1 (en) | Pyruvate kinase deficiency (pkd) gene editing treatment method | |
| CN116323941A (zh) | 通过诱导抗肌萎缩蛋白相关蛋白调节元件内的突变增强细胞中抗肌萎缩蛋白相关蛋白表达及其治疗用途 | |
| WO2021168216A1 (en) | Crispr/cas9 correction of mutations in dystrophin exons 43, 45 and 52 | |
| HK40063149A (en) | Gene editing to improve joint function | |
| WO2024238584A1 (en) | Engineered constructs with cassette arrangements for increased transcription of rna payloads |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21843415 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 21843415 Country of ref document: EP Kind code of ref document: A2 |