WO2022015418A1 - Sars-cov-2 inhibitors - Google Patents
Sars-cov-2 inhibitors Download PDFInfo
- Publication number
- WO2022015418A1 WO2022015418A1 PCT/US2021/034069 US2021034069W WO2022015418A1 WO 2022015418 A1 WO2022015418 A1 WO 2022015418A1 US 2021034069 W US2021034069 W US 2021034069W WO 2022015418 A1 WO2022015418 A1 WO 2022015418A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- acid sequence
- polypeptide
- seq
- nos
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
Definitions
- Sequence Listing is contained in the file created on May 25, 2021, having the file name “20- 1074-WO_SeqList_ST25” and is 1,112kb in size.
- Background SARS -CoV-2 infection is thought to often start in the nose, with virus replicating there for several before spreading to the broader respiratory system. Delivery of a high concentration of a viral inhibitor into the nose and into the respiratory system generally could therefore potentially provide prophylactic protection, and therapeutic efficacy early in infection, and could be particularly useful for health care workers and others coming into frequent contact with infected individuals.
- polypeptides comprising an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS:1-17, 19-21, 23-34 and 100-101, wherein the polypeptide
- amino acid substitutions relative to the reference polypeptide amino acid sequence are selected from the exemplary amino acid substitutions provided in Table 1.
- interface residues are identical to those in the reference polypeptide or 5 are conservatively substituted relative to interface residues in the reference polypeptide.
- polypeptides comprise two or more copies of the amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-101.
- the 10 polypeptide comprises the formula Z1-Z2-Z3, wherein: Z1 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164; 15 Z2 comprises an optional amino acid linker; and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164; 20 wherein Z1 and Z3 may be identical or different.
- the polypeptides comprises the formula B1-B2-Z1-Z2-Z3- B3-B4, wherein: Z1, Z2, and Z3 are as defined; B2 and B3 comprise optional amino acid linkers; and 25 one or both of B1 and B4 independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164, wherein one of B1 and B4 may be absent.
- the polypeptides comprise an amino acid sequence at least 50%, 30 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS:47-60, 193-355 and 454-588, and a genus selected from those recited in the right hand column of Table 8 wherein genus positions X1, X2, X3, and X4 may be present or absent, and when present may be any sequence of 1 or more amino acids.
- the polypeptide comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 356-453 and 595-692, and a genus selected from those recited in the middle column of Table 9 wherein genus positions X1, X2, X3, and X4 may be present or absent, and when present may be any sequence of 1 or more amino acids.
- the polypeptide comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 65-96, wherein in embodiments where a secretion signal is present (MARAWIFFLLCLAGRALA; SEQ ID NO:63) it can be replaced with any other secretion signal.
- the disclosure provides nucleic acids encoding the polypeptide of the disclosure, expression vectors comprising the nucleic acids operatively linked to a promoter, host cell comprising a polypeptide, nucleic acid, and/or expression vector of the disclosure, oligomers of the polypeptides of the disclosure, compositions comprising 2, 3, 4, or more copies of the polypeptide any embodiment of the disclosure attached to a support, including but not limited to a polypeptide particle support, and pharmaceutical compositions, comprising a polypeptide, nucleic acid, expression vector, host cell, oligomer, and/or composition of the disclosure, and a pharmaceutically acceptable carrier.
- the disclosure provides methods for treating or limiting development of a severe acute respiratory syndrome (SARS) coronavirus infection (including SARS-Co-V and SARS-CoV-2), comprising administering to a subject in need thereof an amount of the polypeptide, the nucleic acid, the expression vector, the host cell, the oligomer, the composition, and/or the pharmaceutical composition of the disclosure, effective to treat or limit development of the infection.
- SARS severe acute respiratory syndrome
- Figures Figure 1 Designed Minibinder Proteins For the SARS-CoV-2 Spike Receptor Binding Domain Designs for approach 1, and approach 2, were encoded in long oligonucleotides, and screened for binding to fluorescently tagged RBD on the yeast cell surface.
- Deep sequencing identified 3 Ace2 helix scaffolded designs (approach 1), and 150 de novo interface designs (approach 2) that were clearly enriched following FACS sorting for RBD binding. Designs were expressed in E. coli and purified, and many were found to have soluble expression, to bind RBD in biolayer interferometry experiments, and could effectively compete with ACE-2 for binding to RBD (example shown in Figure 2). Based on BLI data (e.g. See Figure 2) the RBD binding affinities of minbinders are: LCB1 ⁇ 1nM, LCB3 ⁇ 1nM.
- SARS-CoV-2 strain 2019 n-CoV/USA_WA1/2020 was obtained from the Centers for Disease Control and Prevention (gift of Natalie Thornburg).
- Virus stocks were produced in Vero CCL81 cells (ATCC) and titrated by focus-forming assay on Vero E6 cells.
- Serial dilutions of mAbs or minibinder were incubated with 102 focus-forming units (FFU) of SARS-CoV-2 for 1 h at 37C.
- FFU focus-forming units
- RBD minibinder (or mAb)-virus complexes were added to Vero E6 cell monolayers in 96-well plates and incubated at 37C for 1 h.
- LCB1-Fc prophylaxis protects against SARS-CoV-2 infection.
- A Molecular surface representation of three LCB1v1.3 miniproteins bound to individual protomers of the SARS-CoV-2 spike protein trimer (left: side view; right: top view).
- B Binding curves of purified LCB1v1.3 and LCB1-Fc to SARS-CoV-2 RBD as monitored by biolayer interferometry (one experiment performed in technical duplicate).
- LCB1-Fc prophylaxis prevents SARS-CoV-2-mediated lung disease.
- B Hematoxylin and eosin staining of lung sections from mice treated at D-1 and collected at 7 dpi with SARS-CoV-2.
- (C-G) Viral RNA levels at 4 or 7 dpi in the lung, heart, spleen, brain, or nasal wash (n 6, two experiments: Mann- Whitney test: ns, not significant, * P ⁇ 0.05, ** P ⁇ 0.01).
- (H) Hematoxylin and eosin staining of lung sections from mice treated at D+1 and collected at 7 dpi with SARS-CoV-2. Images show low (left) and high (right; boxed region from left) magnification. Scale bars for all images, 100 ⁇ m. Representative images from n 3 mice per group.
- LCB1v1.3 protects mice against B.1.1.7 variant and WA1/2020 E484K/N501Y/D614G strains.
- A Neutralization of LCB1v1.3 against B.1.1.7 or WA1/2020 E484K/N501Y/D614G SARS-CoV-2 (EC 50 values: 802 pM and 667 pM, respectively; mean of two experiments, each performed in duplicate).
- Figure 15(A-F) Cryo-EM structures of multivalent minibinders in complex with the SARS-CoV-2 S glycoprotein.
- A Ribbon diagram representations of all three minibinders bound to the RBD.
- B Cryo-EM map of F31-G10 in complex with two RBDs.
- C Cryo-EM map of F231-P24 in complex with three RBDs.
- FIG. D Design model of H2-1 bound to the S glycoprotein.
- E Cryo-EM map of H2-1 in complex with the S glycoprotein in two orthogonal orientations.
- F Cryo-EM map showing the interacting residues of the H2-1 and S glycoprotein interface.
- polypeptides bind with high affinity to the SARS-CoV-2 Spike glycoprotein receptor binding domain (RBD).
- RBD SARS-CoV-2 Spike glycoprotein receptor binding domain
- the percent identity requirement does not include any additional functional domain that may be incorporated in the polypeptide.
- 1, 2, or 3 amino acids may be deleted from the N and/or C terminus.
- the polypeptides have been subjected to extensive mutational analysis as described in the examples that follow, permitting determination of allowable substitutions at each residue within the polypeptide.
- amino acid substitutions relative to the reference polypeptide amino acid sequence are selected from the exemplary amino acid substitutions provided in Table 1.
- LCB1 (SEQ ID NOS:1-10 and 102-136) 1 -- A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y 2 -- A,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y 3 -- A,D,E,F,G,H,K,L,M,N,P,Q,R,S,T,V,W,Y 4 -- A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y 5 -- A,C,D,E,F,G,H,I,K,L,M,N,P,Q,R,S,T,V,W,Y 6 -- A,C,I,L,M,Q,T,V 7 -- A,C,D,E,F,G,H,I,K,
- amino acid residues at the interface residues listed in Table 2 are either identical at that residue to the reference sequence, or may be substituted by a conservative amino acid substitution.
- conservative amino acid substitutions involve replacing a residue by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn).
- Other such conservative substitutions e.g., substitutions of entire regions having similar hydrophobicity characteristics, are known.
- Amino acids can be grouped according to similarities in the properties of their side chains (in A. L.
- Naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe.
- Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
- Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gln or into H is; Asp into Glu; Cys into Ser; Gln into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gln; Ile into Leu or into Val; Leu into Ile or into Val; Lys into Arg, into Gln or into Glu; Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into Ile or into Leu.
- amino acid residues at the interface residues listed in Table 2 are identical at that residue to the reference sequence.
- the polypeptide comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS:1-10, 13-17, 19-21, 33-34, and 100-101.
- the polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS:1-10 and 102-136 (see Table 3).
- Table 3 LCB1 exemplary variants _ _
- the polypeptides may contain a substantial number of mutations while retaining binding activity, as detailed in the examples that follow.
- the polypeptide comprises an amino acid substitution relative to the amino acid sequence of SEQ ID NO:1 at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all 18 residues selected from the group consisting of 2, 4, 5, 14, 15, 17, 18, 27, 28, 32, 37, 38, 39, 41, 42, 49, 52, and 55.
- the substitutions are selected from the substitutions listed in Table 4, either individually (i.e.: any single mutation listed in the Table) or in combinations in a given row.
- Table 4 Exemplary LCB1 substitutions
- polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 13-17, 19-21 and 137-163 (see Table 5).
- Table 5 LCB3 exemplary variants
- polypeptides may contain a substantial number of mutations while retaining binding activity, as detailed in the examples that follow.
- the polypeptide comprises an amino acid substitution relative to the amino acid sequence of SEQ ID NO:13 at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or all 20 residues selected from the group consisting 2, 6, 8, 9, 13, 14, 19, 22, 25, 26, 28, 29, 34, 35, 37, 40, 43, 45, 49, and 62.
- substitutions are selected from the substitutions listed in Table 6, either individually or in combinations in a given row. Table 6: Exemplary LCB3 substitutions
- polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS:33-34 and 100-101 and 164 (see Table 7).
- Table 7 AHB2 exemplary variant
- the polypeptide comprises an amino acid substitution relative to the amino acid sequence of SEQ ID NO:101 at or both residues selected from the group consisting 63 and 75.
- the substitutions comprise R63A and/or K75T.
- the polypeptides may comprise one or more additional functional groups or residues as deemed appropriate for an intended use.
- the polypeptides may further comprise one or more added cysteine residues at the N-terminus and/or C-terminus.
- the polypeptides may further comprise an N-linked glycosylation site (i.e.: NX(S/T), where X is any amino acid).
- the polypeptides may comprise two or more (i.e.: 2, 3, 4, 5, or more) copies of the amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-101.
- 2 or more of the binders are linked.
- the two or more copies of the polypeptide are all identical; in another embodiment, the two or more copies of the polypeptide are not all identical.
- the two or more copies of the polypeptide may be separated by amino acid linker sequences, though such linkers are not required.
- the amino acid linkers may be of any length and amino acid composition as suitable for an intended purpose. In one embodiment, the amino acid linkers are independently between 2-100 or 3-100 amino acids in length. In another embodiment, the amino acid linker sequences comprise Gly-Ser rich (at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% Gly-Ser residues) amino acid linkers. In a further embodiment, the Gly-Ser rich linkers comprise an amino acid sequence selected from the group consisting of GG and SEQ ID NOs:35-46 and 165-171
- the amino acid linker sequences may comprise Pro-rich (at least 15%, 20%, 25%, or greater Pro residues) amino acid linkers.
- Non-limiting and exemplary embodiments may comprise an amino acid sequence selected from the group consisting of SEQ ID NOs:97-98 and 172-176.
- the amino acid linkers may comprise the amino acid sequence selected from the group consisting of SEQ ID NOS: 99 and 177-178.
- the polypeptide comprises the formula Z1-Z2-Z3, wherein: Z1 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164; Z2 comprises an optional amino acid linker; and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164; wherein Z1 and Z3 may be identical or different.
- Z1 and Z3 are identical; in another embodiment Z1 and Z3 are different.
- each may be a variant of a given starting monomer (ex: Z1 comprises the amino acid sequence of SEQ ID NO:1 (LCB1), and Z3 comprises the amino acid sequence of SEQ ID NO: 102-136. Any such combination of the monomers disclosed herein may be used.
- the polypeptides may comprise 2, 3, 4, 5, or more monomers of any embodiment disclosed herein. In embodiments where there are 3 or more monomers, all 3 monomers may be identical; 2 monomers may be identical and one may differ, or all 3 monomers may be different.
- Z1 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10 and 102-136; and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10 and 102-136.
- Z1 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 13-17, 19-21 and 137-163; and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 13-17, 19-21 and 137-163.
- Z1 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 33-34, 100-101, and 164; and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 33-34, 100-101, and 164.
- one of Z1 and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10 and 102-136; and the other of Z1 and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 13-17, 19-21 and 137-163.
- one of Z1 and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10 and 102-136; and the other of Z1 and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 33-34, 100-100, and 164.
- one of Z1 and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting SEQ ID NOS: 13-17, 19-21 and 137-163; and the other of Z1 and Z3 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 33-34, 100-100, and 164.
- the polypeptide comprises at least 3 monomers (i.e.: 3, 4, 5, or more).
- the polypeptide comprises the formula B1-B2-Z1-Z2-Z3-B3-B4, wherein: Z1, Z2, and Z3 are as defined above; B2 and B3 comprise optional amino acid linkers; and one or both of B1 and B4 independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164, wherein one of B1 and B4 may be absent.
- one of B1 and B4 is absent. In another embodiment, both B1 and B4 are present. In one embodiment, B1 and B4 independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-17, 19-21, 23-34 and 100-164. In this embodiment, B1 and B4 may be identical or may be different. In one embodiment, B1 when present and B4 when present, are identical to one or both of Z1 and Z3.
- B1 when present and B4 when present are not identical to either of Z1 and Z3.
- B1 when present, and B4 when present independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10, 13-17, 19-21, 33-34, 100-101, and 102-164.
- B1 when present, and B4 when present independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10 and 102-136.
- B1 when present, and B4 when present independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 13-17, 19-21 and 137-163.
- B1 when present, and B4 when present independently comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 33-34, 100-101, and 164.
- one of B1 and B4 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 1-10 and 102-136, and the other comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 13-17, 19-21 and 137-163; • one of B1 and B4 comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
- the polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS:47-60, 193-355, and 454-588 and a genus selected from those recited in the right hand column of Table 8 wherein genus positions X1, X2, X3, and X4 may be present or absent, and when present may be any sequence of 1 or more amino acids. In all embodiments, any N-terminal methionine residues may be present or absent in the polypeptide.
- any N-terminal methionine residues are absent in the polypeptide.
- Table 8. Daisy Chain Designs 135)-X4 Table 8A
- the polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of a genus selected from those recited in the middle column of Table 8.
- X1, X2, X3 (when recited in the genus), and X4 when recited in the genus
- X1-(SEQ ID NO:4)-X2-(SEQ ID NO:4) the genus in the middle column, first row of sequences in Table 8 is X1-(SEQ ID NO:4)-X2-(SEQ ID NO:4).
- X2 may be present or absent and, when present, may (for example) comprise an amino acid linker of any suitable length and amino acid composition as deemed appropriate.
- X1 may be present or absent, and when present may comprise any amino acid residue or residues as deemed appropriate, including but not limited to a leader sequence, a detectable tag, a purification tag, etc.
- the genus in the middle column, last row of sequences in Table 8 is X1-(SEQ ID NO: 155)-X2-(SEQ ID NO: 164)-X3-(SEQ ID NO: 135)-X4.
- X2 and X3 may be present or absent and, when present, may (for example) comprise an amino acid linker of any suitable length and amino acid composition as deemed appropriate.
- X1 and X4 may be present or absent, and when present may comprise any amino acid residue or residues as deemed appropriate, including but not limited to a leader sequence, a detectable tag, a purification tag, secretion signal etc.
- the optional domain that is present between monomer domains is present and may comprise an amino acid linker.
- the polypeptide may further comprise one or more additional functional peptide domain. Any such additional functional peptide domain may be used as appropriate for an intended purpose.
- the additional functional peptide domain may comprise, for example, a targeting domain, a detectable domain, a scaffold domain, a secretion signal, an Fc domain, or a further therapeutic peptide domain.
- the additional functional domain comprises an Fc domain, including but not limited to an Fc domain comprising an amino acid sequence comprising the amino acid sequence of SEQ ID NO:64.
- Fc domain In another embodiment, the added functional domain may comprise an oligomerization domain. Any oligomerization domain may be used as suitable to generate an oligomer as suitable for an intended purpose. In one non-limiting embodiment, the oligomerization domain may comprise a homotrimerization domain. Exemplary oligomerization domains may comprises an amino acid sequence selected from the group consisting of SEQ ID NOS:179-189 and 589-594.
- the polypeptide comprises an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS 356-453 and 595-692 and a genus selected from those recited in the right hand column of Table 9 wherein genus positions X1, X2, X3, and X4 may be present or absent, and when present may be any sequence of 1 or more amino acids.
- any N- terminal methionine residues may be present or absent in the polypeptide.
- any N-terminal methionine residues are absent in the polypeptide. Table 9. Homotrimer Designs
- the polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of a genus selected from those recited in the middle column of Table 9.
- X1, X2, X3 (when recited in the genus), and X4 may be present or absent, and when present may be any sequence of 1 or more amino acids, as described above for embodiments listed in Table 8.
- the optional domain that is present between monomer domains is present and may comprise an amino acid linker, as described above for embodiments listed in Table 8.
- the polypeptides comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to an amino acid sequence comprising the amino acid sequence selected from the group consisting of SEQ ID NOS:693 to 701, wherein any N-terminal methionine residue may be absent or present, and wherein residues in parentheses may be present or absent (preferably absent) and are not considered in determining percent identity.
- the N-terminal methionine residue is absent and the optional residues are absent.
- Table 9B The polypeptide of any embodiment or combination of embodiments described here may further be linked to a stabilization domain to promote increased residency time upon administration to a subject. Any suitable stabilization domain may be used for an intended purpose. Exemplary stabilization domains include, but are not limited to, polyethylene glycol (PEG), albumin, hydroxyethyl starch (HES), conformationally disordered polypeptide sequence composed of the amino acids Pro, Ala, and/or Ser ('PASylation'), and/or a mucin diffusivity polypeptide composed of amino acids Lys and Ala, with or without Glu.
- PEG polyethylene glycol
- HES hydroxyethyl starch
- 'PASylation' conformationally disordered polypeptide sequence composed of the amino acids Pro, Ala, and/or Ser
- 'PASylation' a mucin diffusivity polypeptide composed of amino acids Lys and Al
- Non-limiting embodiments of such mucin diffusivity polypeptides include, but are not limited to: Exemplary polypeptides of these embodiments may, for example, comprise an amino acid sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence selected from the group consisting of SEQ ID NOS: 65-96, wherein in embodiments where a secretion signal is present (MARAWIFFLLCLAGRALA; SEQ ID NO:63) it can be replaced with any other secretion signal.
- the disclosure further provides oligomers of the polypeptide of any embodiment or combination of embodiments herein.
- the oligomers are oligomers of polypeptides disclosed herein that comprise oligomerization domains.
- the oligomer comprises a trimer, including but not limited to a homotrimer.
- the disclosure provides compositions, comprising 2, 3, 4, or more copies of the polypeptide of any embodiment or combination of embodiments herein attached to a support, including but not limited to a polypeptide particle support, such as a nanoparticle or virus like particle.
- the polypeptides bind to the SARS-CoV-2 Spike glycoprotein, and thus are useful (for example), as therapeutics to treat SARS-CoV-2 infection.
- the polypeptides bind to the SARS-CoV-2 Spike glycoprotein with an affinity of at least 10 nM, measured as described in the attached examples.
- the disclosure provides nucleic acids encoding a polypeptide of the disclosure.
- the nucleic acid sequence may comprise RNA (such as mRNA) or DNA.
- Such nucleic acid sequences may comprise additional sequences useful for promoting expression and/or purification of the encoded protein, including but not limited to polyA sequences, modified Kozak sequences, and sequences encoding epitope tags, export signals, and secretory signals, nuclear localization signals, and plasma membrane localization signals.
- the disclosure provides expression vectors comprising the nucleic acid of any embodiment or combination of embodiments of the disclosure operatively linked to a suitable control sequence.
- “Expression vector” includes vectors that operatively link a nucleic acid coding region or gene to any control sequences capable of effecting expression of the gene product.
- “Control sequences” operably linked to the nucleic acid sequences of the disclosure are nucleic acid sequences capable of effecting the expression of the nucleic acid molecules. The control sequences need not be contiguous with the nucleic acid sequences, so long as they function to direct the expression thereof.
- intervening untranslated yet transcribed sequences can be present between a promoter sequence and the nucleic acid sequences and the promoter sequence can still be considered "operably linked" to the coding sequence.
- Other such control sequences include, but are not limited to, polyadenylation signals, termination signals, and ribosome binding sites.
- Such expression vectors can be of any type known in the art, including but not limited to plasmid and viral- based expression vectors.
- control sequence used to drive expression of the disclosed nucleic acid sequences in a mammalian system may be constitutive (driven by any of a variety of promoters, including but not limited to, CMV, SV40, RSV, actin, EF) or inducible (driven by any of a number of inducible promoters including, but not limited to, tetracycline, ecdysone, steroid-responsive).
- the present disclosure provides cells comprising the polypeptide, the composition, the nucleic acid, and/or the expression vector of any embodiment or combination of embodiments of the disclosure, wherein the cells can be either prokaryotic or eukaryotic, such as mammalian cells.
- the cells may be transiently or stably transfected with the nucleic acids or expression vectors of the disclosure.
- transfection of expression vectors into prokaryotic and eukaryotic cells can be accomplished via any technique known in the art.
- a method of producing a polypeptide according to the invention is an additional part of the invention. The method comprises the steps of (a) culturing a host according to this aspect of the invention under conditions conducive to the expression of the polypeptide, and (b) optionally, recovering the expressed polypeptide.
- the polypeptides may be produced via any other suitable technique, including but not limited to using cell-free protein synthesis (or in vitro transcription and translation).
- compositions/vaccines comprising (a) the polypeptide, the nucleic acid, the expression vector, and/or the host cell of any embodiment or combination of embodiments herein; and (b) a pharmaceutically acceptable carrier.
- the compositions may further comprise (a) a lyoprotectant; (b) a surfactant; (c) a bulking agent; (d) a tonicity adjusting agent; (e) a stabilizer; (f) a preservative and/or (g) a buffer.
- the buffer in the pharmaceutical composition is a Tris buffer, a histidine buffer, a phosphate buffer, a citrate buffer or an acetate buffer.
- the composition may also include a lyoprotectant, e.g. sucrose, sorbitol or trehalose.
- a lyoprotectant e.g. sucrose, sorbitol or trehalose.
- the composition includes a preservative e.g. benzalkonium chloride, benzethonium, chlorohexidine, phenol, m-cresol, benzyl alcohol, methylparaben, propylparaben, chlorobutanol, o-cresol, p-cresol, chlorocresol, phenylmercuric nitrate, thimerosal, benzoic acid, and various mixtures thereof.
- the composition includes a bulking agent, like glycine.
- the composition includes a surfactant e.g., polysorbate-20, polysorbate-40, polysorbate- 60, polysorbate-65, polysorbate-80 polysorbate- 85, poloxamer-188, sorbitan monolaurate, sorbitan monopalmitate, sorbitan monostearate, sorbitan monooleate, sorbitan trilaurate, sorbitan tristearate, sorbitan trioleaste, or a combination thereof.
- the composition may also include a tonicity adjusting agent, e.g., a compound that renders the formulation substantially isotonic or isoosmotic with human blood.
- Exemplary tonicity adjusting agents include sucrose, sorbitol, glycine, methionine, mannitol, dextrose, inositol, sodium chloride, arginine and arginine hydrochloride.
- the composition additionally includes a stabilizer, e.g., a molecule which substantially prevents or reduces chemical and/or physical instability of the nanostructure, in lyophilized or liquid form.
- Exemplary stabilizers include sucrose, sorbitol, glycine, inositol, sodium chloride, methionine, arginine, and arginine hydrochloride.
- the polypeptide, the nucleic acid, the expression vector, and/or the host cell may be the sole active agent in the composition, or the composition may further comprise one or more other agents suitable for an intended use.
- the disclosure provides methods for treating a severe acute respiratory syndrome (SARS) coronavirus infection (including SARS-Co-V and SARS-CoV- 2), comprising administering to a subject in need thereof an amount of the polypeptide, the nucleic acid, the expression vector, the host cell, the oligomer, the composition, and/or the pharmaceutical composition of any of the preceding claims, effective to treat the infection.
- SARS coronavirus comprises SARS-CoV-2.
- the disclosure provides methods for limiting development of a severe acute respiratory syndrome (SARS) coronavirus infection (including SARS-Co-V and SARS-CoV-2), comprising administering to a subject in need thereof an amount of the polypeptide, the nucleic acid, the expression vector, the host cell, the oligomer, the composition, and/or the pharmaceutical composition of any of the preceding claims, effective to treat the infection.
- SARS coronavirus comprises SARS-CoV-2.
- the polypeptide, the nucleic acid, the expression vector, the host cell, and/or the pharmaceutical composition may be administered via any suitable administrative route as deemed appropriate by attending medical personnel.
- the polypeptide, the nucleic acid, the expression vector, the host cell, the oligomer, the composition, and/or the pharmaceutical composition is administered intra-nasally. In another embodiment, the polypeptide, the nucleic acid, the expression vector, the host cell, the oligomer, the composition, and/or the pharmaceutical composition is administered systemically.
- the method comprises treating a SARS coronavirus infection, the one or more polypeptides, nucleic acids, expression vectors, host cells, and/or pharmaceutical compositions are administered to a subject that has already been diagnosed as having a SARS coronavirus infection.
- treat or “treating” means accomplishing one or more of the following: (a) reducing severity of symptoms of the infection in the subject; (b) limiting increase in symptoms in the subject; (c) increasing survival; (d) decreasing the duration of symptoms; (e) limiting or preventing development of symptoms; and (f) decreasing the need for hospitalization and/or the length of hospitalization for treating the infection.
- the method comprises limiting development of SARS coronavirus infection
- the one or more polypeptides, nucleic acids, expression vectors, host cells, and/or pharmaceutical compositions are administered prophylactically to a subject that is not known to have a SARS coronavirus infection, but may be at risk of such an infection.
- limiting means to limit development of a SARS coronavirus infection in subjects at risk of such infection, which may be any subject.
- the subject may be any subject, such as a human subject
- Exemplary symptoms of SARS-CoV-2 infection include, but are not limited to, fever, fatigue, cough, shortness of breath, chest pressure and/or pain, loss or diminution of the sense of smell, loss or diminution of the sense of taste, and respiratory issues including but not limited to pneumonia, bronchitis, severe acute respiratory syndrome (SARS), and upper and lower respiratory tract infections.
- an “effective amount” refers to an amount of the composition that is effective for treating and/or limiting SARS-CoV-2 infection.
- polypeptide, composition, nucleic acid, or composition of any embodiment herein are typically formulated as a pharmaceutical composition, such as those disclosed above, and can be administered via any suitable route, including orally, parentally, by inhalation spray, rectally, or topically in dosage unit formulations containing conventional pharmaceutically acceptable carriers, adjuvants, and vehicles.
- parenteral as used herein includes, subcutaneous, intravenous, intra- arterial, intramuscular, intrasternal, intratendinous, intraspinal, intracranial, intrathoracic, infusion techniques or intraperitoneally.
- Polypeptide compositions may also be administered via microspheres, liposomes, immune-stimulating complexes (ISCOMs), or other microparticulate delivery systems or sustained release formulations introduced into suitable tissues (such as blood). Dosage regimens can be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response).
- a suitable dosage range may, for instance, be 0.1 ⁇ g/kg-100 mg/kg body weight of the polypeptide or nanoparticle thereof.
- the composition can be delivered in a single bolus, or may be administered more than once (e.g., 2, 3, 4, 5, or more times) as determined by attending medical personnel.
- the disclosure also provides methods for designing polypeptides that bind to the receptor binding site (RBD) of SARS-Cov-2, wherein the methods comprise steps as described in the examples that follow.
- Such methods may comprise the steps of polypeptide design (as described in any embodiment or combination of embodiments in the examples), cell-free synthesis, and evaluation for SARS-Cov-2 RBD binding using any suitable technique. Examples Summary Effective therapeutics for SARS-CoV-2 are needed.
- scaffolds with shape complementary to the Ace2 binding site on the RBD using two strategies: first, scaffolds were built around the helix in Ace2 that makes the majority of the interactions with the RBD, and second, diverse de novo designed scaffolds less than 65 residues in length were docked against this region. In both cases, the scaffold residues at the RBD interface were then optimized for high affinity binding and those in the remainder of the protein, for folding to the target structure and stability.
- the 50,000 designs predicted to bind most strongly to the virus were encoded in large oligonucleotide arrays, and screened using yeast surface display for binding to the RBD with fluorescence activated cell sorting; deep sequencing of the population before and after sorting identified hundreds of designs that bind the target.
- the binding modes of the highest affinity (most enriched by sorting) binders were confirmed by high resolution sequence mapping, and the affinities were further increased by combining 1-4 beneficial substitutions.
- the designs blocked infection of vero-6 cells by live virus with IC50’s ranging from 10nM to 20pM.
- the polypeptides are thus useful, for example, in both intra-nasal and systemic SARS-CoV-2 therapeutics, and, more generally, our results demonstrate the power of computational protein design for rapidly generating potential therapeutic candidates against pandemic threats.
- SARS -CoV-2 infection is thought to often start in the nose, with virus replicating there for several before spreading to the broader respiratory system. Delivery of a high concentration of a viral inhibitor into the nose and into the respiratory system generally could therefore potentially provide prophylactic protection, and therapeutic efficacy early in infection, and could be particularly useful for health care workers and others coming into frequent contact with infected individuals.
- a number of monoclonal antibodies are in development as systemic SARS-CoV-2 therapeutics, but these compounds are not ideal for intranasal delivery as antibodies are large and often not extremely stable molecules, and the density of binding sites is low (two per 150Kd antibody); the Fc domain provides little added benefit.
- An advantage of the second approach is that the range of possibilities for design is much larger, and so potentially higher affinity binding modes can be identified.
- the RBD binding affinities of minibinders are: LCB1 ⁇ 1nM, LCB3 ⁇ 1nM.
- Circular dichroism spectra of the designs were consistent with the design models, and the designs retained full binding activity after a number of days at room temperature (Figure 3).
- Table 10 The designed binders have several advantages over antibodies as potential therapeutics. Together, they span a range of binding modes, and in combination viral escape would be quite unlikely.
- Ultrapotent miniproteins targeting the receptor-binding domain protect against SARS- CoV-2 infection and disease Despite the introduction of public health measures and spike protein-based vaccines to mitigate the COVID-19 pandemic, SARS-CoV-2 infections and deaths continue to rise.
- LCB1-Fc modified versions of one lead binder, LCB1
- Systemic administration of LCB1-Fc reduced viral burden, diminished immune cell infiltration and inflammation, and completely prevented lung disease and pathology.
- a single intranasal dose of LCB1v1.3 reduced SARS-CoV-2 infection in the lung even when given as many as five days before or two days after virus inoculation.
- LCB1v1.3 protected in vivo against a historical strain (WA1/2020), an emerging B.1.1.7 strain, and a strain encoding key E484K and N501Y spike protein substitutions. These data support the use of LCB1v1.3 for prevention or treatment of SARS-CoV-2 infection. Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), the cause of the Coronavirus Disease 2019 (COVID-19) pandemic, has resulted in global disease, suffering, and economic hardship. Despite implementation of public health measures, SARS-CoV-2 transmission persists principally through human-to-human spread (Day, 2020; Li et al., 2020; Standl et al., 2020).
- SARS-CoV-2-induced clinical manifestations range from asymptomatic infection to severe pneumonia, multi-organ failure, and death. Although the underlying mechanisms that dictate disease severity are poorly understood, the immunocompromised, the elderly, and those with specific comorbidities (e.g., history of cardiovascular disease, diabetes, or obesity) are at increased risk for poor outcome (Zhou et al., 2020).
- hACE2 human ACE2
- LCB1 a stringent model of SARS-CoV-2 disease pathogenesis in human ACE2 (hACE2)-expressing transgenic mice
- LCB1-Fc an Fc-modified bivalent form
- LCB1- hIgG-Fc9 LCB1-Fc9
- LCB1v1.3 a further optimized, monomeric form of LCB1 lacking an Fc domain
- Intraperitoneal administration of LCB1-Fc at one day pre- or post SARS- CoV-2 exposure conferred substantial protection including an absence of weight loss, reductions in viral burden approaching the limit of detection, and inhibition of lung inflammation and pathology.
- LCB1v1.3 Intranasal delivery of LCB1v1.3 conferred protection as many as five days before or two days after SARS-CoV-2 inoculation. Dosing experiments revealed that LCB1v1.3 retained efficacy at pharmacologically attainable concentrations and was weakly immunogenic. Most importantly, LCB1v1.3 protected animals against the currently emerging B.1.1.7 United Kingdom variant and a SARS-CoV-2 strain encoding key spike substitutions E484K and N501Y present in both the South Africa (B.1.351) and Brazil (B.1.1.248) variants of concern. Overall, these studies establish LCB1-Fc and LCB1v1.3 as possible treatments to prevent or mitigate SARS-CoV-2 disease.
- LCB1v1.3 prophylaxis limits viral burden and clinical disease.
- LCB1v1.3 and LCB1-Fc bound avidly to a single RBD within the S trimer (Fig 5A) with dissociation constants (K D ) of less than 625 and 156 pM, respectively (Fig 5B).
- LCB1v1.3 and LCB1-Fc also potently neutralized an authentic SARS-CoV-2 isolate (2019n-CoV/USA_WA1/2020 [WA1/2020]) (EC 50 of 14.4 and 71.8 pM, respectively; Fig 5C).
- SARS-CoV-2 isolate 2019n-CoV/USA_WA1/2020 [WA1/2020]
- Fig 5C To determine the protective potential of these miniproteins against SARS-CoV-2, we utilized K18 human hACE2-expressing transgenic mice, which develop severe lung infection and disease after intranasal inoculation of SARS-CoV-2 (Golden et al., 2020; Winkler et al., 2020a).
- LCB1-Fc treatment had no effect on viral RNA levels in nasal wash samples obtained at 4 dpi (Fig 5J), results that are similar to a recent study of a neutralizing human antibody in hamsters (Zhou et al., 2021). However, viral RNA levels were reduced at 7 dpi, suggesting that LCB1-Fc treatment accelerated viral clearance or prevented spread in the upper respiratory tract.
- LCB1v1.3 because it can bind an increased number of RBD molecules for a given mass dose, resulting in increased neutralization activity (Fig 5C).
- Fig 5C neutralization activity
- RNA levels of viral RNA were reduced in the nasal washes of animals receiving LCB1v1.3 after treatment at D+1 but not D+2 compared to control binder-treated animals (Fig 7J).
- Intranasal delivery of LCB1v1.3 confers protection against SARS-CoV-2 when administered up to 5 days before infection.
- K18-hACE2 transgenic mice received a single 50 ⁇ g i.n. dose of LCB1v1.3 or the control binder.
- LCB1v1.3 Treatment with as little as 2 ⁇ g (0.1 mg/kg) of LCB1v1.3 prevented SARS-CoV-2-induced weight loss. Doses between 2 and 10 ⁇ g (0.1 to 0.5 mg/kg) of LCB1v1.3 reduced viral RNA levels in the lung, heart, and spleen at 7 dpi relative to control binder-treated animals. Moreover, animals receiving a 50 ⁇ g dose of LCB1v1.3 showed minimal, if any, lung inflammation (Fig 8K). Collectively, these results indicate that even low doses of LCB1v1.3, when administered via an i.n. route prior to exposure, can limit SARS-CoV-2 infection and disease in the stringent K18-hACE transgenic mouse model of pathogenesis.
- LCB1v1.3 is weakly immunogenic and retains protective activity after repeated dosing.
- Fig 9C weight loss
- Fig 9D-H substantial protection against weight loss and viral infection in the lung and other organs was observed in all animals receiving LCB1v1.3
- LCB1v1.3 protects against emerging SARS-CoV-2 variants.
- LCB1v1.3 treatment before challenge with either variant strain protected against weight loss (Fig 10B and 10H) and viral infection in all tissues collected at 6 dpi (Fig 10C-G and 10I-M).
- LCB1v1.3 is effective against both circulating and emerging strains of SARS-CoV-2.
- DISCUSSION using the stringent K18-hACE2 mouse model of SARS-CoV-2 pathogenesis, we show that LCB1-Fc prevented SARS-CoV-2 infection and disease when administered one day before or after virus inoculation. Lung biomechanics of mice treated with LCB1-Fc mirrored those of na ⁇ ve animals in all parameters tested.
- LCB1v1.3 an optimized, monomeric form of LCB1 without an Fc domain.
- a single i.n. dose of LCB1v1.3 reduced viral burden when administered as many as five days before or two days after SARS-CoV-2 infection.
- Our i.n. delivery approach is unique.
- I.n. therapy of SARS-CoV-2 has been reported only with type I interferon in a hamster model of disease (Hoagland et al., 2021) and efficacy was limited.
- the K18-hACE2 mouse model recapitulates several aspects of severe COVID-19, including lung inflammation and reduced pulmonary function (Golden et al., 2020; Winkler et al., 2020a).
- LCB1v1.3 showed efficacy against historical (WA1/2020) and emerging (B.1.1.7 and E484K/N501Y/D614G) SARS-CoV-2 strains. Based on the cryo-EM structure of the parent LCB1 binder in complex with SARS- CoV-2 RBD (Cao et al., 2020), only the N501Y mutation is expected to affect binding. While we observed a decrease in the neutralizing activity of LCB1v1.3 against the emerging variants, EC 50 values were still less than 800 pM, suggesting substantial potency was retained.
- miniproteins Compared to other potential SARS-CoV-2 antibody-based treatments, miniproteins have several benefits: (a) due to their smaller size, they can bind each protomer of a single trimeric spike, resulting in greater potency for a given dose; (b) they can be manufactured cost-effectively; and (c) they can be mixed using linker proteins to generate multimerized constructs that limit resistance.
- Vero E6 CL-1586, American Type Culture Collection (ATCC), Vero CCL81 (ATCC), Vero-furin (Mukherjee et al., 2016), and Vero-hACE2-TMPRSS2 (a gift of A. Creanga and B.
- NIH NIH were cultured at 37°C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES pH 7.3, 1 mM sodium pyruvate, 1 ⁇ non-essential amino acids, and 100 U/ml of penicillin– streptomycin. Additionally, Vero-hACE2-TMPRSS2 cells were cultured in the presence of 5 ⁇ g/mL puromycin. The WA1/202 (2019n-CoV/USA_WA1/2020) isolate of SARS-CoV-2 was obtained from the US Centers for Disease Control (CDC).
- CDC US Centers for Disease Control
- LCB1-Fc was synthesized and cloned by GenScript into pCMVR plasmid, with kanamycin resistance. Plasmids were transformed into the NEB 5- alpha strain of E. coli (New England Biolabs) to recover DNA for transient transfection into Expi293F mammalian cells. Expi293F cells were grown in suspension using Expi293F expression medium (Life Technologies) at 33°C, 70% humidity, and 8% CO 2 rotating at 150 rpm. The cultures were transfected using PEI-MAX (Polyscience) with cells grown to a density of 3 x 10 6 cells per mL and cultivated for 3 days.
- PEI-MAX Polyscience
- LCB1v1.3 with polar mutations (4N, 14K, 15T, 17E, 18Q, 27Q, 38Q) relative to the original LCB1 was cloned into a pet29b vector.
- LCB1v1.3 was expressed in Lemo21(DE3) (NEB) in terrific broth media and grown in 2 L baffled shake flasks. Bacteria were propagated at 37°C to an O.D.600 of ⁇ 0.8, and then induced with 1 mM IPTG.
- Expression temperature was reduced to 18°C, and the cells were shaken for ⁇ 16 h.
- the cells were harvested and lysed using heat treatment and incubated at 80°C for 10 min with stirring. Lysates were clarified by centrifugation at 24,000 ⁇ g for 30 min and applied to a 2.6 ⁇ 10 cm Ni Sepharose TM 6 FF column (Cytiva) for purification by IMAC on an AKTA Avant150 FPLC system (Cytiva). Proteins were eluted over a linear gradient of 30 mM to 500 mM imidazole in a buffer of 50 mM Tris pH 8.0 and 500 mM NaCl.
- Peak fractions were pooled, concentrated in 10 kDa MWCO centrifugal filters (Millipore), sterile filtered (0.22 ⁇ m) and applied to either a Superdex TM 200 Increase 10/300, or HiLoad S200 pg GL SEC column (Cytiva) using 50 mM phosphate pH 7.4, 150 mM NaCl buffer. After size exclusion chromatography, bacterial-derived components were tested to confirm low levels of endotoxin. Biolayer interferometry. Biolayer interferometry data were collected using an Octet TM RED96 (ForteBio) and processed using the instrument’s integrated software.
- biotinylated RBD (Acro Biosystems) was loaded onto streptavidin-coated biosensors (SA ForteBio) at 20 nM in binding buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3 mM EDTA, 0.05% surfactant P20, and 0.5% non-fat dry milk) for 360 s.
- binding buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 3 mM EDTA, 0.05% surfactant P20, and 0.5% non-fat dry milk) for 360 s.
- Analyte proteins (LCB1v1.3 or LCB1-Fc) were diluted from concentrated stocks into binding buffer.
- the binding kinetics were monitored by dipping the biosensors in wells containing the target protein at the indicated concentration (association step) for 3,600 s and then dipping the sensors back into baseline/buffer (dissociation) for 7,200 s.
- Plaque assay Vero-furin cells (Mukherjee et al., 2016) were seeded at a density of 2.5 ⁇ 10 5 cells per well in flat-bottom 12-well tissue culture plates. The following day, medium was removed and replaced with 200 ⁇ L of 10-fold serial dilutions of the material to be titrated, diluted in DMEM+2% FBS, and plates incubated at 37°C with rocking at regular intervals.
- methylcellulose overlay was added. Plates were incubated at 37°C for 72 h, then fixed with 4% paraformaldehyde (final concentration) in PBS for 20 min. Fixed cell monolayers were stained with 0.05% (w/v) crystal violet in 20% methanol and washed twice with distilled, deionized water. Measurement of viral burden. Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser TM instrument (Roche Life Science) in 1,000 ⁇ L of DMEM media supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 5 min and stored at ⁇ 80°C.
- a TaqMan TM assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA (SEQ ID NO: 190); Reverse primer: GACTGCCGCCTCTGCTC (SEQ ID NO: 191); Probe: /56- FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/) (SEQ ID NO: 192).
- This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction.
- the reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively. Cytokine and chemokine mRNA measurements. RNA was isolated from lung homogenates as described above.
- cDNA was synthesized from DNAse-treated RNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Scientific) with the addition of RNase inhibitor following the manufacturer’s protocol. Cytokine and chemokine expression was determined using TaqMan TM Fast Universal PCR master mix (Thermo Scientific) with commercial primers/probe sets specific for IFN-g (IDT: Mm.PT.58.41769240), IL-6 (Mm.PT.58.10005566), IL-1b (Mm.PT.58.41616450), Tnfa (Mm.PT.58.12575861), CXCL10 (Mm.PT.58.43575827), CCL2 (Mm.PT.58.42151692), CCL5 (Mm.PT.58.43548565), CXCL11 (Mm.PT.58.10773148.g), Ifnb (Mm.PT.58.30132453.g), CXCL1 (Mm.
- Fold change was determined using the 2 - ⁇ Ct method comparing treated mice to na ⁇ ve controls.
- Lung Pathology Animals were euthanized before harvest and fixation of tissues. The left lung was first tied off at the left main bronchus and collected for viral RNA analysis. The right lung was inflated with approximately 1.2 mL of 10% neutral buffered formalin using a 3-mL syringe and catheter inserted into the trachea. Tissues were embedded in paraffin, and sections were stained with hematoxylin and eosin. Slides were scanned using a Hamamatsu NanoZoomer TM slide scanning system, and images were viewed using NDP view software (ver.1.2.46). Respiratory mechanics.
- mice were anesthetized with ketamine/xylazine (100 mg/kg and 10 mg/kg, i.p., respectively).
- the trachea was isolated via dissection of the neck area and cannulated using an 18-gauge blunt metal cannula (typical resistance of 0.18 cmH 2 O.s/mL), which was secured in place with a nylon suture.
- the mouse then was connected to the flexiVent TM computer-controlled piston ventilator (SCIREQ Inc.) via the cannula, which was attached to the FX adaptor Y-tubing.
- mice were given an additional 100 mg/kg of ketamine and 0.1 mg/mouse of the paralytic pancuronium bromide via intraperitoneal route to prevent breathing against the ventilator and during measurements.
- Mice were ventilated using default settings for mice, which consisted in a positive end expiratory pressure at 3 cm H 2 O, a 10 mL/kg tidal volume (Vt), a respiratory rate at 150 breaths per minute (bpm), and a fraction of inspired oxygen (FiO 2 ) of 0.21 (i.e., room air).
- Respiratory mechanics were assessed using the forced oscillation technique, as previously described (McGovern et al., 2013), using the latest version of the flexiVent TM operating software (flexiWare v8.1.3). Pressure-volume loops and measurements of inspiratory capacity also were performed. Neutralization assay. Serial dilutions of binder proteins were incubated with 10 2 focus-forming units (FFU) of SARS-CoV-2 for 1 h at 37°C.
- FFU focus-forming units
- Binder-virus complexes were added to Vero E6 (WA1/2020) or Vero-hACE2-TMPRSS2 (B.1.1.7 and WA1/2020 E484K/N501Y/D614G) cell monolayers in 96-well plates and incubated at 37°C for 1 h. Subsequently, cells were overlaid with 1% (w/v) methylcellulose in MEM supplemented with 2% FBS. Plates were harvested 24-30 h later by removing overlays and fixed with 4% PFA in PBS for 20 min at room temperature.
- C-terminal biotinylated LCB1.1v3 was immobilized on streptavidin-coated plates (RayBiotech #7C-SCP-1) at 2.5 ⁇ g/mL in 100 ⁇ L total volume per well and incubated at 4°C overnight. Plates were washed with wash buffer (TBS + 0.1% (w/v) BSA + 0.05% (v/v) Tween20) and blocked with 200 ⁇ L/well blocking buffer (TBS + 2% (w/v) BSA + 0.05% (v/v) Tween20) for 1 h at room temperature. Plates were rinsed with wash buffer using 200 ⁇ L/well, and 100 ⁇ L of 1:100 diluted sera samples in blocking buffer were added to respective wells.
- Fc-RBD was serially diluted 1:5 starting at 240 ng/mL in 100 ⁇ L of blocking buffer. All samples were incubated for 1 h at room temperature. Plates were washed using 200 ⁇ L/well of wash buffer.
- HRP-conjugated horse anti-mouse IgG antibody (Vector Laboratories #PI-2000-1) was diluted 1:200 in blocking buffer, and 100 ⁇ L was incubated in each well at room temperature for 30 min.
- HRP-conjugated mouse anti-human IgG antibody (Invitrogen #05-4220) was diluted 1:500 in blocking buffer, and 100 ⁇ L was incubated in each well at room temperature for 30 min.
- SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma (Cold Spring Harbor Laboratory).
- multivalent minibinders as potential prophylactic and therapeutic agents to address this problem.
- the optimized designs have greatly slowed dissociation rates from the SARS-CoV-2-S- glycoprotein with complex half-lives of more than two weeks.
- Cryo-EM of the structures reveal that both homotrimer and fusion minibinder constructs can engage all three RBDs on a single spike protein.
- the top trimeric and fusion candidates neutralize the wild-type SARS- CoV-2 virus in addition to the B.1.1.7, B.1.351, B.1.1.28 variants of concern with IC50s in the low pM range. Additionally, the top homotrimer candidate provided prophylactic protection in a human ACE2-expressing transgenic mice against the same variant strains.
- the workflow combines a cell-free DNA assembly step utilizing Gibson assembly followed by PCR to generate linear expression templates that are used to drive cell-free protein synthesis (CFPS).
- CFPS cell-free protein synthesis
- the developed workflow allows us to translate synthetic DNA to purified protein in as little as 6 hours, is easily scaled to high-throughput formats (e.g., 96- or 384-well plates), and is amenable to automated liquid handling.
- PPI protein- protein interaction
- cryo-EM single particle cryo-electron microscopy
- F231-P24 bound to three RBDs, with M1 binding a closed conformation RBD and M2 and M3 binding to open conformation RBDs. This suggests the linker length is sufficiently long enough to enable all three binding domains to simultaneously engage all three RBDs without significant distortion of the native state.
- the maps are highly suggestive of multivalent binding, though the flexible linkers yield no density in the EM map to confirm linkage of the domains.
- Multivalent minibinders neutralize widely circulating SARS-CoV-2 variants. We next sought to determine ability of the multivalent constructs to neutralize SARS- CoV-2 variants. We screened the off rate of the best multivalent minibinders against a panel of mutant spike proteins (Fig.16).
- the homotrimers showed the most mutational resistance, with the H2 homotrimers showing little dissociation after 24 hours against any of the mutant spikes.
- the two-domain fusions showed little increased resilience to the tested point mutants.
- the three-domain fusions showed considerably more consistent binding to the tested point mutants, though some still impacted binding.
- the H2-0 and H2-1 homotrimers consistently performed the best across all constructs tested, with IC 50 s in the low pM range.
- the three-domain fusions also performed well, with IC 50 s in the sub nM range for all tested variants.
- H2-0 provides prophylactic protection in human ACE2-expressing transgenic mice
- Fig.17 A single 50 ⁇ g dose of H2-0 was administered intranasally (i.n.) one day prior to inoculation with 10 3 focus forming units of SARS-CoV-2 Variants B.1.1.7, B1.351, B.1.1.24. In all cases, i.n. administration of H2-0 protected the mice against SARS- CoV-2-induced weight loss.
- the designed protein constructs could have a number of advantages over monoclonal antibodies for preventing and treating COVID-19 infection.1) direct administration into respiratory system, 2) low cost of goods and amenability to very large-scale production, 3) high stability and lack of need for cold chain, and 4) very broad resistance to escape mutants in single compounds. More generally, designed high affinity multivalent minibinders could provide a powerful platform for combating viral pandemics.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Oncology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Communicable Diseases (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202180049677.2A CN116209672A (zh) | 2020-07-14 | 2021-05-25 | Sars-cov-2抑制剂 |
| JP2023502638A JP2023542453A (ja) | 2020-07-14 | 2021-05-25 | Sars-cov-2阻害剤 |
| AU2021308208A AU2021308208A1 (en) | 2020-07-14 | 2021-05-25 | SARS-CoV-2 inhibitors |
| CA3181996A CA3181996A1 (en) | 2020-07-14 | 2021-05-25 | Sars-cov-2 inhibitors |
| US18/004,545 US20230250134A1 (en) | 2020-07-14 | 2021-05-25 | SARS-COV-2 inhibitors |
| KR1020237001812A KR20230038485A (ko) | 2020-07-14 | 2021-05-25 | Sars-cov-2 저해제 |
| EP21739198.6A EP4182027A1 (en) | 2020-07-14 | 2021-05-25 | Sars-cov-2 inhibitors |
| JP2025136537A JP2025170319A (ja) | 2020-07-14 | 2025-08-19 | Sars-cov-2阻害剤 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063051474P | 2020-07-14 | 2020-07-14 | |
| US63/051,474 | 2020-07-14 | ||
| US202063067593P | 2020-08-19 | 2020-08-19 | |
| US63/067,593 | 2020-08-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022015418A1 true WO2022015418A1 (en) | 2022-01-20 |
Family
ID=76808129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/034069 Ceased WO2022015418A1 (en) | 2020-07-14 | 2021-05-25 | Sars-cov-2 inhibitors |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20230250134A1 (https=) |
| EP (1) | EP4182027A1 (https=) |
| JP (2) | JP2023542453A (https=) |
| KR (1) | KR20230038485A (https=) |
| CN (1) | CN116209672A (https=) |
| AU (1) | AU2021308208A1 (https=) |
| WO (1) | WO2022015418A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4368631A4 (en) * | 2021-07-07 | 2025-08-13 | Univ Nat Corp Tokyo Medical & Dental | PEPTIDE HAVING ANTIVIRAL ACTIVITY, ANTIVIRAL AGENT COMPRISING SAID PEPTIDE, AND METHOD FOR PRODUCING SAID ANTIVIRAL AGENT |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20240177843A (ko) * | 2023-06-20 | 2024-12-30 | 주식회사 엔큐라젠 | SARS-CoV-2스파이크 단백질에 특이적으로 결합하는 펩타이드 및 이의 용도 |
| WO2025101453A1 (en) * | 2023-11-07 | 2025-05-15 | University Of Washington | De novo design of potent minibinder antagonists of il-6r, gp130, and il1-r1 |
| WO2025221716A1 (en) * | 2024-04-17 | 2025-10-23 | University Of Washington | Smart mhc: a de-novo designed platform for soluble expression of peptide-receptive class-i mhc in e. coli |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002098448A1 (en) * | 2001-06-04 | 2002-12-12 | Human Genome Sciences, Inc. | Methods and compositions for modulating ace-2 activity |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20230017215A (ko) * | 2020-05-27 | 2023-02-03 | 유니버시티 오브 워싱턴 | 드 노보 설계한 단백질 스위치에 기반한 모듈형의 일반화 가능한 바이오센서 플랫폼 |
-
2021
- 2021-05-25 EP EP21739198.6A patent/EP4182027A1/en active Pending
- 2021-05-25 KR KR1020237001812A patent/KR20230038485A/ko active Pending
- 2021-05-25 CN CN202180049677.2A patent/CN116209672A/zh active Pending
- 2021-05-25 AU AU2021308208A patent/AU2021308208A1/en active Pending
- 2021-05-25 WO PCT/US2021/034069 patent/WO2022015418A1/en not_active Ceased
- 2021-05-25 JP JP2023502638A patent/JP2023542453A/ja active Pending
- 2021-05-25 US US18/004,545 patent/US20230250134A1/en active Pending
-
2025
- 2025-08-19 JP JP2025136537A patent/JP2025170319A/ja active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002098448A1 (en) * | 2001-06-04 | 2002-12-12 | Human Genome Sciences, Inc. | Methods and compositions for modulating ace-2 activity |
Non-Patent Citations (42)
| Title |
|---|
| "Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS, INC., article "Guide to Protein Purification" |
| A. L. LEHNINGER: "Gene Transfer and Expression Protocols", 1975, THE HUMANA PRESS INC., pages: 109 - 128 |
| CAO, L.X.GORESHNIK, I.COVENTRY, B.CASE, J.B.MILLER, L.KOZODOY, L.CHEN, R.E.CARTER, L.WALLS, A.C.PARK, Y.J. ET AL.: "De novo design of picomolar SARS-CoV-2 miniprotein inhibitors", SCIENCE, vol. 370, 2020 |
| CASE JBROTHLAUF PWCHEN RELIU ZZHAO HKIM ASBLOYET L-MZENG QTAHAN SDROIT L ET AL.: "Neutralizing antibody and soluble ACE2 inhibition of a replication-competent VSV-SARS-CoV-2 and a clinical isolate of SARS-CoV-2", BIORXIV 2020:2020.2005.2018.102038 |
| CASE, J.B.BAILEY, A.L.KIM, A.S.CHEN, R.E.DIAMOND, M.S.: "Growth, detection, quantification, and inactivation of SARS-CoV-2", VIROLOGY, vol. 548, 2020, pages 39 - 48, XP055738086, DOI: 10.1016/j.virol.2020.05.015 |
| CHEN, R.ZHANG, X.CASE, J.B.WINKLER, E.LIU, Y.VANBLARGAN, L.LIU, J.ERRICO, J.XIE, X.SURYADEVARA, N. ET AL., RESISTANCE OF SARS-COV-2 VARIANTS TO NEUTRALIZATION BY MONOCLONAL AND SERUM-DERIVED POLYCLONAL ANTIBODIES (RESEARCH SQUARE, 2021 |
| CHEVALIER, A.SILVA, D.A.ROCKLIN, G.J.HICKS, D.R.VERGARA, R.MURAPA, P.BERNARD, S.M.ZHANG, L.LAM, K.H.YAO, G. ET AL.: "Massively parallel de novo protein design for targeted therapeutics", NATURE, vol. 550, 2017, pages 74 - 79, XP055621081, DOI: 10.1038/nature23912 |
| DATABASE CAS [online] 29 April 2021 (2021-04-29), ANONYMOUS: "Hit details for CAS:2021_512700_2639510022_1", XP055836719, retrieved from EBI accession no. CAS:2021_512700_2639510022_1 Database accession no. 2021:512700-2639510-02-2 * |
| DAY, M.: "Covid-19: identifying and isolating asymptomatic people helped eliminate virus in Italian village", BMJ, vol. 368, 2020, pages m 1165 |
| G. ZHANG ET AL: "The first-in-class peptide binder to the SARS-CoV-2 spike protein", BIORXIV, 30 March 2020 (2020-03-30), XP055759391, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2020.03.19.999318v1.full.pdf> [retrieved on 20201211], DOI: 10.1101/2020.03.19.999318 * |
| GALLOWAY, S.E.PAUL, P.MACCANNELL, D.R.JOHANSSON, M.A.BROOKS, J.T.MACNEIL, A.SLAYTON, R.B.TONG, S.SILK, B.J.ARMSTRONG, G.L. ET AL.: "Emergence of SARS-CoV-2 B.I. 1.7 Lineage - United States", MMWR MORB MORTAL WKLY REP, vol. 70, 29 December 2020 (2020-12-29), pages 95 - 99 |
| GOLDEN, J.W.CLINE, C.R.ZENG, X.GARRISON, A.R.CAREY, B.D.MUCKER, E.M.WHITE, L.E.SHAMBLIN, J.D.BROCATO, R.L.LIU, J. ET AL.: "Human angiotensin-converting enzyme 2 transgenic mice infected with SARS-CoV-2 develop severe and fatal respiratory disease", JCI INSIGHT, vol. 5, 2020 |
| HASSAN, A.O.CASE, J.B.WINKLER, E.S.THACKRAY, L.B.KAFAI, N.M.BAILEY, A.L.MCCUNE, B.T.FOX, J.M.CHEN, R.E.ALSOUSSI, W.B. ET AL.: "A SARS-CoV-2 Infection Model in Mice Demonstrates Protection by Neutralizing Antibodies", CELL, vol. 182, 2020, pages 744 - 753 e744 |
| HOAGLAND, D.A.MOLLER, R.UHL, S.A.OISHI, K.FRERE, J.GOLYNKER, I.HORIUCHI, S.PANIS, M.BLANCO-MELO, D.SACHS, D. ET AL.: "Leveraging the antiviral type I interferon system as a first line of defense against SARS-CoV-2 pathogenicity", IMMUNITY, 2021 |
| HOFFMANN, M.KLEINE-WEBER, H.SCHROEDER, S.KRUGER, N.HERRLER, T.ERICHSEN, S.SCHIERGENS, T.S.HERRLER, G.WU, N.H.NITSCHE, A. ET AL.: "SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor", CELL, vol. 181, 2020, pages 271, XP086136225, DOI: 10.1016/j.cell.2020.02.052 |
| INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS |
| JEYANATHAN, M.AFKHAMI, S.SMAILL, F.MILLER, M.S.LICHTY, B.D.XING, Z.: "Immunological considerations for COVID-19 vaccine strategies", NAT REV IMMUNOL, vol. 20, 2020, pages 615 - 632, XP037255123, DOI: 10.1038/s41577-020-00434-6 |
| JOHNSON, K.D.HARRIS, C.CAIN, J.K.HUMMER, C.GOYAL, H.PERISETTI, A.: "Pulmonary and Extra-Pulmonary Clinical Manifestations of COVID-19", FRONT MED (LAUSANNE, vol. 7, 2020, pages 526 |
| KANG, T.H.JUNG, S.T.: "Boosting therapeutic potency of antibodies by taming Fc domain functions", EXP MOL MED, vol. 51, 2019, pages 1 - 9 |
| KORDZADEH-KERMANI, E.KHALILI, H.KARIMZADEH, I.: "Pathogenesis, clinical manifestations and complications of coronavirus disease 2019 (COVID-19", FUTURE MICROBIOL, vol. 15, 2020, pages 1287 - 1305 |
| KRAMMER, F.: "SARS-CoV-2 vaccines in development", NATURE, vol. 586, 2020, pages 516 - 527, XP037277122, DOI: 10.1038/s41586-020-2798-3 |
| LETKO, M.MARZI, A.MUNSTER, V.: "Functional assessment of cell entry and receptor usage for SARS-CoV-2 and other lineage B betacoronaviruses", NAT MICROBIOL, vol. 5, 2020, pages 562, XP037078966, DOI: 10.1038/s41564-020-0688-y |
| LEUNG, K.SHUM, M.H.LEUNG, G.M.LAM, T.T.WU, J.T.: "Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom", EURO SURVEILL, vol. 26, 2021 |
| LI, R.PEI, S.CHEN, B.SONG, Y.ZHANG, T.YANG, W.SHAMAN, J.: "Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2", SCIENCE, vol. 368, 2020, pages 489 - 493 |
| LUPALA CECYLIA S. ET AL: "Computational analysis on the ACE2-derived peptides for neutralizing the ACE2 binding to the spike protein of SARS-CoV-2", BIORXIV, 4 May 2020 (2020-05-04), pages 1 - 27, XP055799136, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2020.05.03.075473v1.full.pdf> [retrieved on 20210427], DOI: 10.1101/2020.05.03.075473 * |
| MATSUYAMA, S.NAO, N.SHIRATO, K.KAWASE, M.SAITO, S.TAKAYAMA, I.NAGATA, N.SEKIZUKA, T.KATOH, H.KATO, F. ET AL.: "Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells", PROC NATL ACAD SCI U S A, vol. 117, 2020, pages 7001 - 7003, XP055813015, DOI: 10.1073/pnas.2002589117 |
| MCGOVERN, T.K.ROBICHAUD, A.FEREYDOONZAD, L.SCHUESSLER, T.F.MARTIN, J.G.: "Evaluation of respiratory system mechanics in mice using the forced oscillation technique", J VIS EXP, 2013, pages e50172 |
| MUKHERJEE, S.SIROHI, D.DOWD, K.A.CHEN, Z.DIAMOND, M.S.KUHN, R.J.PIERSON, T.C.: "Enhancing dengue virus maturation using a stable furin over-expressing cell line", VIROLOGY, vol. 497, 2016, pages 33 - 40, XP029723741, DOI: 10.1016/j.virol.2016.06.022 |
| R.I. FRESHNEY: "Culture of Animal Cells: A Manual of Basic Technique", 1987, LISS, INC. |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SCHAFER, A.MUECKSCH, F.LORENZI, J.C.C.LEIST, S.R.CIPOLLA, M.BOURNAZOS, S.SCHMIDT, F.MAISON, R.M.GAZUMYAN, A.MARTINEZ, D.R. ET AL.: "Antibody potency, effector function, and combinations in protection and therapy for SARS-CoV-2 infection in vivo", J EXP MED, vol. 218, 2021 |
| See also references of EP4182027A1 |
| STANDL, F.JOCKEL, K.H.BRUNE, B.SCHMIDT, B.STANG, A.: "Comparing SARS-CoV-2 with SARS-CoV and influenza pandemics", LANCET INFECT DIS, 2020 |
| WALTER JUSTIN D ET AL: "Sybodies targeting the SARS-CoV-2 receptor-binding domain", BIORXIV, 16 May 2020 (2020-05-16), XP055795467, Retrieved from the Internet <URL:https://doi.org/10.1101/2020.04.16.045419> [retrieved on 20210415], DOI: 10.1101/2020.04.16.045419 * |
| WANG, Z.SCHMIDT, F.WEISBLUM, Y.MUECKSCH, F.BARNES, C.O.FINKIN, S.SCHAEFER-BABAJEW, D.CIPOLLA, M.GAEBLER, C.LIEBERMAN, J.A. ET AL.: "mRNA vaccine-elicited antibodies to SARS-CoV-2 and circulating variants", NATURE, 2021 |
| WINKLER, E.S.BAILEY, A.L.KAFAI, N.M.NAIR, S.MCCUNE, B.T.YU, J.FOX, J.M.CHEN, R.E.EARNEST, J.T.KEELER, S.P. ET AL.: "SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function", NAT IMMUNOL, vol. 21, 2020, pages 1327 - 1335, XP037274470, DOI: 10.1038/s41590-020-0778-2 |
| WINKLER, E.S.GILCHUK, P.YU, J.BAILEY, A.L.CHEN, R.E.ZOST, S.J.JANG, H.HUANG, Y.ALLEN, J.D.CASE, J.B. ET AL.: "Human neutralizing antibodies against SARS-CoV-2 require intact Fc effector functions and monocytes for optimal therapeutic protection", CELL, 2020 |
| XIE, X.LIU, Y.LIU, J.ZHANG, X.ZOU, J.FONTES-GARFIAS, C.R.XIA, H.SWANSON, K.A.CUTLER, M.COOPER, D. ET AL.: "Neutralization of SARS-CoV-2 spike 69/70 deletion, E484K and N501Y variants by BNT162b2 vaccine-elicited sera", NATURE MEDICINE, 2021 |
| XIE, X.LIU, Y.LIU, J.ZHANG, X.ZOU, J.FONTES-GARFIAS, C.R.XIA, H.SWANSON, K.A.CUTLER, M.COOPER, D.: "Neutralization of SARS-CoV-2 spike 69/70 deletion, E484K and N501Y variants by BNT162b2 vaccine-elicited sera", NAT MED, 2021 |
| YUAN MWU NCZHU XLEE CDSO RTYLV HMOK CKPWILSON IA: "A highly conserved cryptic epitope in the receptor binding domains of SARS-CoV-2 and SARS-CoV", SCIENCE, vol. 368, no. 6491, 2020, pages 630 - 633, XP055707792, DOI: 10.1126/science.abb7269 |
| ZHOU, D.FUK-WOO CHAN, J.ZHOU, B.ZHOU, R.LI, S.SHAN, S.LIU, L.ZHANG, A.J.CHEN, S.J.CHUNG-SING CHAN, C. ET AL.: "Robust SARS-CoV-2 Infection in Nasal Turbinates after Treatment with Systemic Neutralizing Antibodies", CELL HOST & MICROBE, 2021 |
| ZHOU, F.YU, T.DU, R.FAN, G.LIU, Y.LIU, Z.XIANG, J.WANG, Y.SONG, B.GU, X. ET AL.: "Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study", LANCET, vol. 395, 2020, pages 1054 - 1062, XP086105445, DOI: 10.1016/S0140-6736(20)30566-3 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4368631A4 (en) * | 2021-07-07 | 2025-08-13 | Univ Nat Corp Tokyo Medical & Dental | PEPTIDE HAVING ANTIVIRAL ACTIVITY, ANTIVIRAL AGENT COMPRISING SAID PEPTIDE, AND METHOD FOR PRODUCING SAID ANTIVIRAL AGENT |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2021308208A1 (en) | 2023-01-05 |
| JP2023542453A (ja) | 2023-10-10 |
| US20230250134A1 (en) | 2023-08-10 |
| CN116209672A (zh) | 2023-06-02 |
| JP2025170319A (ja) | 2025-11-18 |
| EP4182027A1 (en) | 2023-05-24 |
| KR20230038485A (ko) | 2023-03-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12171827B2 (en) | Nucleic acid vaccine against the SARS-CoV-2 coronavirus | |
| US20230250134A1 (en) | SARS-COV-2 inhibitors | |
| Zhang et al. | Advances in developing ACE2 derivatives against SARS-CoV-2 | |
| JP7094103B2 (ja) | インフルエンザウイルスワクチンおよびその使用 | |
| JP7554837B2 (ja) | 可溶性ace2及び融合タンパク質、並びにその適用 | |
| JP2022530439A (ja) | 組換えインフルエンザ抗原 | |
| JP2017521425A (ja) | インフルエンザウイルスワクチンおよびその使用 | |
| CN101472606A (zh) | 用于治疗黄病毒感染的方法、分子及用途 | |
| JP2015532269A (ja) | アルテリウイルス | |
| EP4402180A1 (en) | Multivalent polypeptide constructs capable of binding viral spike proteins and methods of using the same | |
| Isaacs et al. | A nanobody-based therapeutic targeting Nipah virus limits viral escape | |
| WO2026021236A1 (zh) | 可抑制类mers冠状病毒感染的多肽及其应用 | |
| CA3181996A1 (en) | Sars-cov-2 inhibitors | |
| Case et al. | Ultrapotent miniproteins targeting the receptor-binding domain protect against SARS-CoV-2 infection and disease in mice | |
| RU2837537C1 (ru) | Растворимый апф2, его слитый белок и способы их применения | |
| KR102812522B1 (ko) | Covid-19 유전자 백신용 dna 단편 및 이를 포함한 유전자 백신용 조성물 | |
| US20240035012A1 (en) | Engineered ace2 oligomers and uses thereof | |
| WO2025101453A1 (en) | De novo design of potent minibinder antagonists of il-6r, gp130, and il1-r1 | |
| AU2024347309A1 (en) | Reagents and methods for preventing, treating or limiting henipavirus infection | |
| WO2025064372A1 (en) | Reagents and methods for preventing, treating or limiting henipavirus infection | |
| WO2024130083A1 (en) | Modified measles viruses for treating coronavirus infections | |
| CN117915936A (zh) | 作为sars-cov-2抗病毒物的脂质肽融合抑制剂 | |
| EP4221747A2 (en) | Clec2 fusion protein and uses thereof | |
| HK40083738A (en) | Soluble ace2 and fusion protein, and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21739198 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3181996 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021308208 Country of ref document: AU Date of ref document: 20210525 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2023502638 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202317008533 Country of ref document: IN |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021739198 Country of ref document: EP Effective date: 20230214 |