WO2021263194A1 - Inhibition de grp94 n-glycosylée - Google Patents

Inhibition de grp94 n-glycosylée Download PDF

Info

Publication number
WO2021263194A1
WO2021263194A1 PCT/US2021/039230 US2021039230W WO2021263194A1 WO 2021263194 A1 WO2021263194 A1 WO 2021263194A1 US 2021039230 W US2021039230 W US 2021039230W WO 2021263194 A1 WO2021263194 A1 WO 2021263194A1
Authority
WO
WIPO (PCT)
Prior art keywords
grp94
cancer
substituted
halogen
aliphatic
Prior art date
Application number
PCT/US2021/039230
Other languages
English (en)
Inventor
Gabriela Chiosis
Pengrong YAN
Original Assignee
Memorial Sloan Kettering Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Memorial Sloan Kettering Cancer Center filed Critical Memorial Sloan Kettering Cancer Center
Publication of WO2021263194A1 publication Critical patent/WO2021263194A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D473/00—Heterocyclic compounds containing purine ring systems
    • C07D473/40—Heterocyclic compounds containing purine ring systems with halogen atoms or perhalogeno-alkyl radicals directly attached in position 2 or 6
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52—Purines, e.g. adenine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D473/00—Heterocyclic compounds containing purine ring systems
    • C07D473/26—Heterocyclic compounds containing purine ring systems with an oxygen, sulphur, or nitrogen atom directly attached in position 2 or 6, but not in both
    • C07D473/32—Nitrogen atom
    • C07D473/34—Nitrogen atom attached in position 6, e.g. adenine

Definitions

  • GRP94 Glucose regulated protein 94
  • GRP94 is one of four HSP90 paralogs and shares 50% amino acid homology with the cytosolic chaperone HSP90 (Marzec et al., 2012; McCaffrey and Braakman, 2016; Zhu and Lee, 2015).
  • GRP94 functions in ER quality control, buffers Ca 2 + levels, and is a key chaperone in the folding of “client” proteins.
  • TGF ⁇ associated protein GARP insulin like growth factors
  • TLRs Toll-like receptors
  • integrins integrins
  • GRP94 While primarily localized to the ER, GRP94 is also found in the cytosol, at the cell surface, and extracellularly (Ansa-Addo et al., 2016; Lee, 2014; Wiersma et al., 2015).
  • GRP94 maintains the stability of HER2 and its enhanced downstream signaling (Patel et al., 2013).
  • GRP94 hyperglycosylated GRP94 was also reported, but it is a non- functional form targeted for degradation in an OS-9–mediated, ERAD-independent, lysosomal- like mechanism (Cherepanova et al., 2019; Dersh et al., 2014).
  • stress is a common hallmark of disease, it is mostly studied as a damager of proteins and of their function (Solimini et al., 2007).
  • chaperones such as GRP94 are important in stress regulation as they may correct and influence such damage through folding or dis- aggregation and degradation (Brehme and Voisine, 2016).
  • chaperones Accordingly, changes in chaperone expression, have been extensively studied in disease, and GRP94 overexpression has been implicated in cancer (Buc Calderon et al., 2018; Lee, 2014). Stress however also alters how proteins interact (Harper and Bennett, 2016), a feature also influenceable by chaperones (Ellis, 2013). Accordingly, structurally modified chaperone pools, termed epichaperomes, may form under stress and act as scaffolds to pathologically remodel cellular processes by mediating aberrant protein-protein interactions, and in turn, creating a state of proteome-wide connectivity dysfunction (Dart, 2016; Joshi et al., 2018).
  • the present disclosure unveils a specific N- glycosylation pattern used by a chaperone, GRP94, to alter its conformational fitness and stabilize a state most permissive for stable interactions with proteins at the plasma membrane.
  • This ‘protein assembly mutation’ remodels protein networks and properties of the cell.
  • the present disclosure shows in cells, human specimens, and mouse xenografts that proteome connectivity is restorable by inhibition of the N-glycosylated GRP94 variant.
  • the present disclosure provides biochemical evidence for stressor induced chaperone- mediated protein mis-assemblies and demonstrates how these alterations are actionable in disease.
  • the present disclosure provides a method of treating cancer, inflammatory diseases, neurodegenerative diseases, rheumatoid arthritis, or diabetes, comprising the step of administering to a subject suffering therefrom an effective amount of a compound of Formula (I): or a pharmaceutically acceptable salt thereof, wherein X 1 , X 2 , X 3 , X 5 , Z 2 , and R 1 are as defined herein.
  • a compound of Formula (I): or a pharmaceutically acceptable salt thereof wherein X 1 , X 2 , X 3 , X 5 , Z 2 , and R 1 are as defined herein.
  • (A) Viability of cancer cell lines (n 64) treated for 72 hr with PU-WS13 (10 ⁇ M) or PU-29F (20 ⁇ M). Mean values of triplicate experiments are graphed. Negative values depict killing of the initial cell population.
  • (B) Correlative analysis between RTK (i.e. HER2 and EGFR) levels and cell viability for BC cells in (A). Pearson’s r, two-tailed, n 12.
  • a and B Native-PAGE (top) and SDS-PAGE (bottom) separation followed by immunoblot with the 9G10 anti-GRP94 antibody in un-treated cell lines (A) or in those treated for 4 hr with PU- WS13 (10 ⁇ M) (B).
  • Each data point is an individual cell line; 1-11: BT474, MDA-MB-468, SKBr3, AU565, MDA-MB-361, HCC1806, MCF7, MDA-MB-231, T47D, BT20, HMEC.
  • Graph mean. Error bar, SEM, unpaired t-test, **p ⁇ 0.01, ***p ⁇ 0.001.
  • FIG. 3A-3C describe a specific GRP94 conformation enables the formation of stable HMW GRP94 and HER2 pools.
  • A Anti-GRP94 antibody captured cargo from SKBr3 cell extracts and the remaining supernatant separated under native and denaturing conditions, and immunoblotted with the indicated antibodies.+, 1x, ++, 2x antibody amount. IgG, control; black arrow, unspecific signal.
  • FIG. 4A-4F describe that the N-glycan content of GRP94 regulates the stability and function of the HMW GRP94-HER2 PM-associated pool.
  • A Schematic of the experimental design to investigate the role of N-glycans on the conformation, stability and function of the HMW GRP94 pools.
  • WS13-B biotinylated PU-WS13.
  • PM pool of GRP94 and HER2 in SKBr3 extracts treated under native conditions as in (A) with the indicated enzymes.
  • FIG. 5A-5G describe that glycosylation at N62 of GRP94 is a key regulator in the formation of the HMW GRP94 variant and is important for its oncogenic activity.
  • A Schematic for clone generation and validation. MDA-MB-468 cells (WT) and clones containing the indicated GRP94 mutants were then used for the analyses below.
  • B The effect of GRP94 N- glycan mutagenesis or KO evaluated on glycosylation load.
  • (E) Baseline activity of EGFR-downstream signaling measured by western blot analysis of p- ERK and ERK. Graph, mean (n 3).
  • FIG. 6A-6E describe the accumulation of hgGRP94 at the PM is sufficient to augment HMW GRP94 levels, stabilize receptors at the PM and rewire protein networks in the cytosol.
  • FIG. 6A Biochemical profile of GRP94 in the indicated cell fractions obtained from cells containing the WT (1) or the TM96 (2) GRP94 construct. LRP6, control for PM proteins, p-p65, p- ERK control for signaling activity and HSP90-incorporating epichaperomes for oncogenic activation of cytosolic chaperomes.
  • Negative y-axis values depict killing of the initial cell population.
  • E Schematic of the findings.
  • Figures 7A-7L describe that the HMW GRP94 tumor variant is an actionable target.
  • a and B PD analyses at 24 hr after one dose of PU-WS13 (75 mg/kg, i.p.) administered to mice bearing AU565 (A) or MDA-MB-468 (B) orthotopic tumors.
  • mice 75MWF, 75 mg/kg given Mon-Wed-Fri; qod, every-other-day; qd, every day, Mon through Fri.
  • Graph mean ⁇ SEM, two-tailed Mann Whitney test, *p ⁇ 0.05.
  • Figures 8A-8E describe the sensitivity of cancer cells to PU-WS13 inhibition, Related to Figures 1A-1E.
  • A Viability (by Annexin staining) of breast cancer cell lines treated for 48 hr with PU-WS13 (WS, 10 ⁇ M) or Vehicle (V, DMSO).
  • D SDS-PAGE (top) and native PAGE (bottom) analysis of GRP94 knock-down in MDA- MB-468 cells treated for 72 hr with scramble or a GRP94-specific siRNA construct at the indicated concentrations.
  • cPARP cleaved PARP.
  • E Western blot analysis of GRP94 in cells differentiated by their RTK levels. GAPDH, loading control. Graph, mean ⁇ SEM, unpaired t-test, ns, p > 0.05. S, WS13-sensitive, R, WS13-resistant cell lines.
  • Figures 9A-9C describe the protein solubility tests and cell fractionation techniques used for the enrichment of the plasma membrane and ER-Golgi proteins, Related to Figures 2A- 2G.
  • A Ponceau stained and GRP94 (9G10) or concanavalin A (ConA) blotted membranes of experiments from Figure 2C. SDS and native PAGE separation for SKBr3 and MCF7 whole cell extracts are show; first column, vehicle treated and second column, PUWS13 treated (10 ⁇ M for 4 hr).
  • B Native PAGE analysis of protein unfolding induced by chemical denaturants such as urea.
  • FIG. 10A-10D describe that a biotinylated PU-WS13 has preferential capture for the plasma membrane resident GRP94 and isolates GRP94 in complex with the RTK in RTK- overexpressing cancer cells, Related to Figures 2A-2G.
  • A Western blot analysis of cell surface and intracellular GRP94. Cell fractions were obtained as indicated in the schematic. Black arrow indicates the GRP94 of MW higher than 100 kDa.
  • (B) Western blot of protein cargo isolated by PU-WS13-biotin from SKBr3 extracts prepared as indicated in the schematic. Graph, mean ⁇ SEM, n 3, unpaired t-test, **p ⁇ 0.01.
  • FIG. 11A-11C describe that GRP94 present at the plasma membrane has a higher N-glycan content than the ER resident GRP94, Related to Figures 4A-4F.
  • WCL whole cell lysate
  • F1 enriched in ER-Golgi and cytosol fractions
  • F2 enriched in plasma membrane.
  • B The effect of N-glycan removal on the interaction between GRP94 and RTKs as evidenced by the analysis of the protein cargo isolated by PU-WS13-biotin (WS13-B).
  • C Plasma membrane pool of GRP94 treated under native conditions as indicated in schematic with the indicated enzymes or for 4 hr with PU-WS13 (10 ⁇ M) (right), and western blot analysis of cells treated for 4 hr with PU-WS13 (10 ⁇ M) or vehicle (-) prior to Nglycan removal and capture with the WS13-B reagent (right). Gels are representative of three individual experiments.
  • Figures 12A-12C describe the effect of GRP94 N-glycan mutagenesis or KO on the HMW GRP94 species, Related to Figures 5A-5G.
  • A The effect of protein loading on the biochemical signature of GRP94 and its sensitivity to PU-WS13 (WS13), or the lack of, in the indicated clones treated with either vehicle or PU-WS13 (5 ⁇ M, 4 hr).
  • B Western blot analysis of whole cell extracts of indicated GRP94 mutant clones treated for 24 hr with PU-WS13 (0, 0.1, 0.25, 0.5 ⁇ M).
  • C Cellular localization of EGFR and GRP94.1, WCL; 2, F1; 3, F2 fractions.
  • FIGS. 13A-13B describe that TM96 GRP94 is N-glycosylated, participates in the formation of HMW GRP94 pools and is sensitive to PUWS13, Related to Figures 6A-6E.
  • A Western blot analysis of GRP94 in plasma membrane extracts of MethA WT and TM96 cells in which N-glycan removal was performed with the indicated enzymes under native conditions.
  • B Plasma membrane pool of HMW and total GRP94 in MethA TM96 extracts obtained from cells treated for 24 hr with PUWS13 (0, 5, 10 ⁇ M) prior to fractionation. Gels are representative of three independent experiments.
  • Figures 14A-14C describe that the HMW GRP94 tumor variant is an actionable target, Related to Figures 7A-7L.
  • A Schematic of the testing paradigm to evaluate the safety and efficacy of PU-WS13 in EGFR+ and HER2+ tumor bearing mice.
  • B and C Representative western blot analyses for the pharmacodynamic (PD) analyses of HMW GRP94 tumor markers following one dose of PU-WS13 (75 mg/kg) administered intraperitoneally (i.p.) to mice bearing AU565 (B) or MDA-MB-468 (C) orthotopic tumors. Each column, individual mouse. See Figure 7A, 7B for graphed data on all tumors.
  • Figure 16 depicts Native PAGE assays of PU-WS12, SO-IV-33A, and HJP-VI-110.
  • Figure 17 depicts Native PAGE assays of PU-WS13, SO-IV-33A, SO-IV-26A, and SO-III-116A.
  • FIG. 18 depicts Immunoprecipitation (IP) of PU-WS13, HJP-V-149, WS-12, Bnlm, and HJP-V-92 with the indicated GRP94 antibodies.
  • IP Immunoprecipitation
  • the present disclosure describes, among other things, the role of N-glycosylated forms of Grp94 in certain cancers.
  • the present disclosure also provides inhibitors of such N- glycosylated forms of Grp94.
  • Inhibitors of Grp94 are known, including those described in WO 2015/023976, which describes compounds that are particularly suited for inhibiting Grp94 selectively over Hsp90.
  • the present disclosure provides surprising evidence that only a subset of such compounds known to inhibit Grp94 are also capable of inhibiting N- glycosylated forms of Grp94 described herein.
  • compounds described herein as inhibitors of N-glycosylated Grp94 are unexpectedly less potent against Grp94 in biochemical assays and/or less selective for Grp94 over Hsp90 compared to other compounds known in the art.
  • the present disclosure encompasses the recognition that disease associated stresses may greatly modify the proteome creating intracellular pools of structurally and functionally heterogeneous proteins and protein assemblies.
  • the present disclosure describes that these protein pools are chaperone mediated assemblies which portend disease-associated activity by remodeling proteome-wide connectivity, and thus function.
  • the present disclosure combines chemical biology tools and complementary biochemical and functional approaches, with specific interest on functions and modifications induced by proteome stress associated with malignant transformation and mediated by GRP94 modifications.
  • the present disclosure uses established cancer cell lines, fresh patient biospecimens and cell- and patient-derived xenografts in mice and ex vivo as disease models.
  • the present disclosure identifies a biochemical mechanism whereby aberrant N- glycosylation of a fraction of the cellular pool of the chaperone GRP94 remodels its location and conformation, and in turn, its interaction strength and interaction partners (i.e. connectivity). The outcomes are aberrantly remodeled protein pathways and in turn, a pathologic cellular phenotype.
  • the present disclosure therefore provides a missing link in chaperone-mediated protein connectivity dysfunction by demonstrating how stress hijacks the customary role of a protein, turning it from a folder into a remodeler of protein connectivity.
  • GRP94 inhibition is lethal in a subset of tumor cells [0030]
  • PU-WS13 is a small molecule whose selectivity arises from its ability to bind to an allosteric pocket of GRP94 that only partly overlaps with the ATP-binding pocket and is not accessible in the closely related paralog, HSP90 (Gewirth, 2016; Patel et al., 2015; Patel et al., 2013; Shrestha et al., 2016; Stothert et al., 2017). It shows >100-fold selectivity over HSP90 and no interaction with kinases when tested at 10 ⁇ M in a 98-kinase panel (Patel et al., 2015).
  • the present disclosure used PU-29F, a selective inhibitor of cytosolic HSP90 (Patel et al., 2013).
  • the present disclosure provides that only a subset of these cell lines were vulnerable to PU-WS13 as measured by ATP levels and Annexin V staining ( Figures 1A and S1A).
  • RTK receptor tyrosine kinase
  • GRP94 is heterogeneous in cancer
  • Total GRP94 levels were comparable between the different cancer cell lines assessed for sensitivity to GRP94 inhibition ( Figure 8E), suggesting that chaperone concentration alone was not responsible for the different responses to inhibition.
  • the present disclosure analyzed the GRP94 isolated from sensitive and resistant cell lines for residence in stable protein complexes, cellular localization, conformation, and post-translational modification.
  • Cell homogenates from both inhibitor-sensitive and resistant cancer cells were run on native gels in buffers near the physiological pH (Figure 2A).
  • HMW high molecular weight
  • the present disclosure therefore proceeded to investigate the contribution of each factor to the observed HMW species: complexation, conformation and PTM.
  • GRP94 complexation contributes to its heterogeneity
  • HER2 an abundant RTK in SKBr3 cells, co-localizes with GRP94 at the PM in these cells ( Figure 2D and (Li et al., 2015; Patel et al., 2013)
  • the present disclosure probed the cellular fractions of this cell line for HER2.
  • HER2 detected by Western blotting on native gels was observed as a HMW species in the whole cell lysate (WCL), total membrane (TM), and PM fractions (Figure 2E).
  • HMW HER2 species absent in MCF7 cells, correspond to the same fractions that contained the HMW GRP94 species.
  • Short-term treatment of SKBr3 cells with PU- WS13 reduced the amount of HMW HER2 in the F2 pool (Figure 2D, immunofluorescence and Figure 2E, native PAGE) without majorly changing the overall levels of HER2 ( Figure 2E, WCL by SDS-PAGE), paralleling the observations seen with GRP94.
  • the present disclosure introduced a biotinylated PU-WS13 reagent, PU- WS13-B, which was found to preferentially isolate the GRP94 found in the F2, and not in the ER, Golgi, or cytosolic fractions (F1) (Figure 10B) and to enrich for the ⁇ 100 kDa GRP94 species ( Figure 2G, black arrow).
  • This probe pulled down HER2 along GRP94 ( Figure 2G).
  • Similar results were seen in EGFR+ BC cells, where EGFR, another RTK, was GRP94-bound ( Figure 10C).
  • the present disclosure found PU-WS13-B preferentially isolated GRP94 bound to HER2 over free GRP94 (Figure 10D).
  • the G4420 antibody which recognizes amino acids 733-750 in the C-terminal domain of GRP94, was able to capture both the HER2-bound and the free GRP94 ( Figure 10D). Conformation is key in HMW GRP94 formation [0041]
  • the present disclosure next determined if GRP94’s conformational state contributes to formation of the HMW protein pool.
  • the present disclosure probed the HMW pool with two anti-GRP94 antibodies, the conformation-specific 9G10 antibody, and the G4420 antibody, which is not known to discriminate between different conformational states of the chaperone.
  • a dose-dependent immunocapture of GRP94 and HER2 by the G4420 antibody was associated with a dose-dependent decrease in the HMW GRP94 and HER2 pools noted on Native PAGE and a decrease in both GRP94 and HER2 levels in the supernatant noted on Western blot ( Figure 3A).
  • the antibody 9G10 captured GRP94 but not HER2; nonetheless, both the GRP94 and HER2 HMW pools were diminished on native PAGE but only GRP94 was reduced in the supernatant following 9G10 immunocapture, consistent with a conformational change induced by this antibody which is associated with release of the bound cargo.
  • PU-WS13-B preferentially captured the PM-localized GRP94 which was bound to HER2. To see if this corresponds to a specific conformation of the chaperone, the present disclosure treated cells with PU-WS13 prior to immunocapture with the two GRP94 antibodies ( Figure 3B). Increasing amounts of PU-WS13 or increased duration of PU-WS13 exposure dramatically reduced the amount of GRP94 captured by the 9G10 antibody, indicating that the inhibitor changes GRP94 to a conformation that is no longer recognized by the antibody.
  • GRP94 is post-translationally modified by phosphorylation and glycosylation (Cala, 2000), and the present disclosure investigates whether these PTMs contribute to the formation or stability of the HMW GRP94 complexes.
  • the mobility shift due to glycosylation differed between cellular fractions.
  • the F2 fraction exhibited a greater mobility shift compared to the ER F1 fraction.
  • the present disclosure probed for GRP94 and HER2 HMW complexes on native gels, or captured the GRP94 complexes with immobilized PU-WS13-B, or with the two GRP94 antibodies G4420 or 9G10.
  • Glycan removal significantly reduced the amounts of HMW GRP94 and HER2 species seen on native gels, indicating that glycosylation is important for the stability of these complexes ( Figure 4B).
  • the amount of the GRP94 and HER2 (or EGFR) cargo captured by PU-WS13-B and G4420 pulldown was also decreased by deglycosylation treatment (Figure 4C and 11B).
  • GRP94 contains six potential N-glycan acceptor sites and under normal conditions the protein is predominantly monoglycosylated at N217 (Cloutier and Coulombe, 2013; Schwarz and Aebi, 2011).
  • the present disclosure describes glycosylation site mapping by mass spectrometry and identified N62, N217 and N502 as putative glycosylated Asn sites on the hgGRP94 variant.
  • N62 was a key residue needed for the formation of the HMW GRP94 pool, as evidenced by native PAGE (Figure 5C and 12A), insensitivity to PU-WS13 (see GRP94 pools on native PAGE, Figure 5C and p-ERK and EGFR on SDS-PAGE, Figure 5D and 12B), a decrease in RTK signaling activity (see ERK downstream signaling, Figure 5E and 12B), diminished interaction with the G4220 antibody ( Figure 5F) and a significant decrease in GRP94 and RTK localized at the PM (Figure 5G and S5C) in the N62Q-containing clones when compared to WT.
  • GRP94 KO mimicked the effects observed with the N62Q-containing mutants (i.e.
  • GRP94 ability to form long-lived, stable complexes with RTKs at the PM (as opposed to the dynamic interactions needed for RTK folding by GRP94 in the ER) (Eletto et al., 2010) is dependent on a specific hyperglycosylation pattern, with N62 being a key residue for the observed switch of GRP94 from a folding, ER chaperone, to an oncogenic protein that stabilizes and activates RTKs at the PM.
  • HMW GRP94 an oncogenic gain-of-function
  • the present disclosure investigates if the accumulation of GRP94 at the PM was sufficient to initiate such oncogenic signaling.
  • the present disclosure utilized a construct that directs myc tagged GRP94 to the PM by deletion of the KDEL sequence and incorporation of a transmembrane domain from platelet-derived growth factor receptor (Zheng et al., 2001).
  • the present disclosure used a Meth A fibrosarcoma cell line that was stably transfected with this construct, TM96, and compared the properties of this cell line to those of WT Meth A cells.
  • TM96 GRP94 construct was found only in the F2 fraction, but not the ER (F1) or cytoplasmic (C) fractions ( Figure 6A).
  • TM96 expressed GRP94 participated in the formation of stable HMW GRP94 complexes as evidenced by the characteristic electrophoretic migration pattern on native gels (Figure 6A), its glycosylation status suggestive of hyperglycosylation ( Figure 13A) and its sensitivity to PU-WS13 ( Figure 13B).
  • TM96 expressed GRP94 also augmented the formation of intracellular stable HMW complexes incorporating HSP90 (Figure 6A, HSP90 native PAGE), also referred to as HSP90-incorporating epichaperomes, which act as molecular scaffolding platforms that augment the activity of cytosolic protein pathways, including signaling pathways (Joshi et al., 2018; Kourtis et al., 2018; Rodina et al., 2016).
  • PU-WS13 treatment was sufficient to reverse these effects, as evidenced by inhibition of the activated but not baseline signaling (Figure 6B) and the loss of the HMW GRP94 pool located at the PM ( Figure 12B).
  • HMW GRP94 is an actionable target in cancer [0052] Because PU-WS13 exhibits preference for the GRP94 pool incorporated into stable HMW complexes located at the PM of cancer cells, it can be used to address the targetability and safety of inhibiting this unusual GRP94 variant in cancer. Treatment is a balance between target engagement and therapeutic index, and the present disclosure evaluated whether target suppression can be safely achieved by PU-WS13 in vivo. To understand target engagement during the study, the present disclosure measured tumor and tissue pharmacokinetics (PK) and pharmacodynamics (PD) after either a single dose of PU-WS13 administered intraperitoneally (i.p.) or at the end of a long- term treatment (see Figure 14A for study design).
  • PK tumor and tissue pharmacokinetics
  • PD pharmacodynamics
  • the present disclosure therefore investigated the efficacy of 75 mg/kg and 125 mg/kg PU-WS13 given three times weekly (M-W-F), every other day (qod) or daily (qd) with weekends off (Figure 7D).
  • the present disclosure provides significant, and dose- and schedule-dependent effects of PU-WS13 (Figures 7E-7G), with complete tumor growth suppression observed under the daily treatment paradigm. Similar results were also noted when tumors were established subcutaneously ( Figures 7H, 7I).
  • PU-WS13 was well tolerated. Even for the long treatment regimens that delivered 37 to 62 doses of PU-WS13 to mice over 87 days, no treatment-related toxicities were observed: mice retained a normal weight throughout treatment (Figure 7J).
  • the present disclosure conducted complete necropsies and analyzed hematology and serum chemistry panels on vehicle-treated mice and on mice receiving the 125mg/kg dose five times per week for 87 days (Figure 7K and Figure 15). All hematological and clinical chemistry findings were within normal parameters, and histopathology conducted on major organs showed no toxic changes induced by PU-WS13. [0055] The present disclosure also evaluated GI tract LRP6 levels after PU-WS13 administration ( Figure 7L).
  • Housekeeping GRP94 is essential for folding and regulating physiologic functions of the Wnt receptor LRP6 (Rachidi et al., 2015), and it is expected that compounds such as PU-WS13 selectively targeting the tumor-specific HMW GRP94 variant will act on tumor functions while leaving housekeeping GRP94 functions unaltered at similar or higher concentrations as those seen in the tumor. Because most small molecules, including PU-WS13, are largely cleared via the GI tract, it is a body site most exposed to such agents over the time they spend in the body.
  • the present disclosure identifies a GRP94 variant in cancer, whereby by altering N- glycosylation, a new protein conformationally, dynamically and functionally distinct from the GRP94 of normal cells is created.
  • a specific increase in N-glycosylation promotes a conformational state that allows for stable interactions with oncoproteins at the PM.
  • hyperglycosylation is a modality used by GRP94 to alter its conformational fitness and stabilize a state most permissive for stable interactions. Through this stabilization, these proteins’ functions are enhanced, and cellular protein pathways are aberrantly remodeled - N-glycosylation thus transforms a chaperone, GRP94, from a folding to a scaffolding protein that remodels protein connectivity, with an end result of proteome-wide dysfunction. Therefore, the N-glycosylation pattern of GRP94 the present disclosure identifies is a specific modification exploited by cancer cells to alter the customary role of a chaperone.
  • the aberrantly N-glycosylated GRP94 variant is present only in some tumors, is independent of total GRP94 levels, and is absent or scarce in non-transformed cells.
  • the present disclosure found that the functions of one class of oncoproteins, RTKs, are modified by this GRP94 variant, and only in cancer cells driven by RTK overexpression.
  • RTK overexpression is a form of proteome stress, and under these conditions GRP94 N-glycosylation at specific sites is key both to enhance the presence of these proteins at the plasma membrane by forming stable complexes with the RTKs, as well as maintain RTKs in a state that enables aberrant downstream signaling and a rewiring of cytosolic protein pathways.
  • N-linked glycosylation is among the most ubiquitous protein modifications in eukaryotes. It is implicated in a myriad of housekeeping functions, including modification of a protein’s folding capacity, stability, and oligomerization and aggregation status, ER quality control and protein trafficking, host cell-surface interactions, and modulation of enzyme activity (Lee et al., 2015). Changes in glycosylation are observed in cancer where they affect the interaction and subsequently activation capacity of RTKs (Mereiter et al., 2019). Conversely, there is no report of N-glycosylation increasing the oncogenic properties of a protein, indirectly, by modulating its complexation.
  • N- glycosylation does not induce significant changes in a protein’s structure, but decreases protein conformational dynamics, likely leading to an increase in protein stability (Lee et al., 2015).
  • N-glycans act like molecular glues, holding together residues around the glycosylation sites through favorable interactions made with nearby protein residues, thus resulting in the stabilization of a specific protein conformation or disfavoring others (Sola and Griebenow, 2006).
  • HSP90 the cytosolic paralog of GRP94
  • an oncogenic stress such as MYC hyperactivation or a neuronal damaging stress such as tau overexpression redistributes the cytosolic pool of molecular chaperones and helpers into complexes of enhanced stability.
  • These stable assemblies termed epichaperomes, function as multi-component scaffolds to provide a framework on which the cell’s complement of proteins can work more efficiently or differently than they would without chaperome participation.
  • a conformational switch changes the direct interaction of GRP94 with HER2 or whether it mediates the creation of a stable multimeric platform with co-chaperones and other factors that mediate HER2 stabilization, similarly to that seen for HSP90, remains to be seen.
  • the present disclosure shows that inhibition of the hgGRP94 variant with compounds such as PU-WS13 is feasible in cancer cells, human primary tumor specimens, and xenografted tumors in mice.
  • GRP94 is abundant in most cells of the mammalian body, it is clear that the housekeeping variant and the N-glycosylated variant targeted in cancers are different, rendering compounds such as PU- WS13 selective for the cancer form.
  • the present disclosure also demonstrates that the N-glycosylated GRP94 variant, and the specific aberrant proteins and cellular processes enabled by this variant, are targetable in disease.
  • inhibitors of the N- glycosylated GRP94 variant are an example of a ‘targeted protein degradation-based therapeutic’ that act specifically on dysfunctions, and protein networks, enabled by this variant, thus sparing the normal folding functions of GRP94.
  • the present disclosure specifically exemplifies the expression and significance of the hgGRP94 variant in BC, several lines of evidence suggest that it is implicated in other cancers as well.
  • RTK overexpression ex.
  • EGFR, HER2, MET and others is observed in a variety of cancer cells and in cells of a tumor supportive microenvironment (Butti et al., 2018; Contessa et al., 2008; Contessa et al., 2010; Siddals et al., 2011; Tan et al., 2018; Turrini et al., 2017).
  • RTK amplifications also allow tumor cells to escape therapeutic treatment (MET and HER2 amplification can be detected in EGFR-mutant lung cancers that become resistant to EGFR TKI therapy (Yu et al., 2013)). Because EGFR overexpression is often a side effect of radiation therapy (Cuneo et al., 2015), targeting the GRP94 variant with PU-WS13 may also radiosensitize tumors. [0063] It is noteworthy that inhibition of the GRP94 variant is more toxic to EGFR+ tumors than the direct inhibition of EGFR by kinase inhibitors or anti-EGFR antibodies. Approximately half of all triple- negative BCs (TNBCs) and inflammatory BCs overexpress EGFR.
  • TNBCs triple- negative BCs
  • inflammatory BCs overexpress EGFR.
  • the present disclosure reports that increasing the interaction strength between GRP94 and RTKs and other receptors at the plasma membrane, which the present disclosure found to be regulated by a specific N-glycosylation pattern, is a mechanism used by a chaperone to enhance the stabilization and interaction of certain proteins. Without wishing to be bound by any particular theory, it is believed that these findings identify a biochemical mechanism whereby stress remodels a chaperone from a folding to a scaffolding protein creating a state of chaperone- mediated protein connectivity dysfunction.
  • GRP94 Aberrant N-glycosylation of a fraction of the cellular pool of the chaperone GRP94 remodels GRP94 location and conformation, and in turn, its interaction strength and interaction partners, with the outcome being aberrantly remodeled protein pathways and a pathologic cellular phenotype.
  • the present disclosure describes that the HMW form of GRP94 is an example of a ‘protein assembly mutation’ (Nussinov et al., 2019), a proteome malfunction defined by defective protein-protein interaction that portends pathologic activity. This variant is a target for cancers and other diseases.
  • structures depicted herein are meant to include all stereoisomeric (e.g., enantiomeric or diastereomeric) forms of the structure, as well as all geometric or conformational isomeric forms of the structure.
  • the R and S configurations of each stereocenter are contemplated as part of the disclosure. Therefore, single stereochemical isomers, as well as enantiomeric, diastereomic, and geometric (or conformational) mixtures of provided compounds are within the scope of the disclosure.
  • some structures depicted here show one or more stereoisomers of a compound, and unless otherwise indicated, represents each stereoisomer alone and/or as a mixture.
  • the term “about” may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value (except where such number would be less than 0% or exceed 100% of a possible value).
  • Aliphatic refers to a straight-chain (i.e., unbranched) or branched, optionally substituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation but which is not aromatic (also referred to herein as “carbocyclic” or “cycloaliphatic”), that has a single point of attachment to the rest of the molecule.
  • aliphatic groups contain 1-12 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms (e.g., C 1-6 ).
  • aliphatic groups contain 1-5 aliphatic carbon atoms (e.g., C1-5). In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms (e.g., C1-4). In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms (e.g., C 1-3 ), and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms (e.g., C 1-2 ). Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof.
  • aliphatic refers to a straight- chain (i.e., unbranched) or branched, optionally substituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation that has a single point of attachment to the rest of the molecule.
  • Alkyl The term “alkyl”, used alone or as part of a larger moiety, refers to a saturated, optionally substituted straight or branched hydrocarbon group having (unless otherwise specified) 1-12, 1-10, 1-8, 1-6, 1-4, 1-3, or 1-2 carbon atoms (e.g., C1-12, C1-10, C1-8, C1-6, C1-4, C1-3, or C 1-2 ).
  • Carbocyclyl The terms “carbocyclyl,” “carbocycle,” and “carbocyclic ring” as used herein, refer to saturated or partially unsaturated cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having from 3 to 14 members, wherein the aliphatic ring system is optionally substituted as described herein.
  • Carbocyclic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl.
  • “carbocyclyl” refers to an optionally substituted monocyclic C3-C8 hydrocarbon, or an optionally substituted C7-C10 bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.
  • the term “cycloalkyl” refers to an optionally substituted saturated ring system of about 3 to about 10 ring carbon atoms. In some embodiments, cycloalkyl groups have 3–6 carbons.
  • Exemplary monocyclic cycloalkyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.
  • cycloalkenyl refers to an optionally substituted non-aromatic monocyclic or multicyclic ring system containing at least one carbon-carbon double bond and having about 3 to about 10 carbon atoms.
  • Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenyl, and cycloheptenyl.
  • Alkenyl refers to an optionally substituted straight or branched hydrocarbon chain having at least one double bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C 2-12 , C 2-10 , C 2-8 , C 2-6 , C 2-4 , or C 2-3 ).
  • alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and heptenyl.
  • Alkynyl refers to an optionally substituted straight or branched chain hydrocarbon group having at least one triple bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C2-12, C2-10, C2-8, C2-6, C2-4, or C2-3).
  • exemplary alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, hexynyl, and heptynyl.
  • Aryl refers to monocyclic and bicyclic ring systems having a total of six to fourteen ring members (e.g., C 6-14 ), wherein at least one ring in the system is aromatic and wherein each ring in the system contains three to seven ring members.
  • the term “aryl” may be used interchangeably with the term “aryl ring”.
  • “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Unless otherwise specified, “aryl” groups are hydrocarbons.
  • Heteroaryl refers to monocyclic or bicyclic ring groups having 5 to 10 ring atoms (e.g., 5- to 6-membered monocyclic heteroaryl or 9- to 10- membered bicyclic heteroaryl); having 6, 10, or 14 ⁇ electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms.
  • heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2- a]pyridinyl, thienopyrimidinyl, triazolopyridinyl, and benzoisoxazolyl.
  • heteroaryl and “heteroar—”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring (i.e., a bicyclic heteroaryl ring having 1 to 3 heteroatoms).
  • Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, benzothiadiazolyl, benzoxazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H–quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, pyrido[2,3–b]–1,4– oxazin–3(4H)–one, and benzoisoxazolyl.
  • heteroaryl may be used interchangeably with the terms “heteroaryl ring”, “heteroaryl group”, or “heteroaromatic”, any of which terms include rings that are optionally substituted.
  • Heteroatom refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen.
  • Heterocycle As used herein, the terms “heterocycle”, “heterocyclyl”, and “heterocyclic ring” are used interchangeably and refer to a stable 3- to 8-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, such as one to four, heteroatoms, as defined above.
  • nitrogen includes a substituted nitrogen.
  • the nitrogen may be N (as in 3,4-dihydro- 2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (as in N-substituted pyrrolidinyl).
  • a heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted.
  • saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and thiamorpholinyl.
  • a heterocyclyl group may be mono-, bi-, tri-, or polycyclic, preferably mono-, bi-, or tricyclic, more preferably mono- or bicyclic.
  • a bicyclic heterocyclic ring also includes groups in which the heterocyclic ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings.
  • Exemplary bicyclic heterocyclic groups include indolinyl, isoindolinyl, benzodioxolyl, 1,3-dihydroisobenzofuranyl, 2,3- dihydrobenzofuranyl, and tetrahydroquinolinyl.
  • a bicyclic heterocyclic ring can also be a spirocyclic ring system (e.g., 7- to 11-membered spirocyclic fused heterocyclic ring having, in addition to carbon atoms, one or more heteroatoms as defined above (e.g., one, two, three or four heteroatoms)).
  • spirocyclic ring system e.g., 7- to 11-membered spirocyclic fused heterocyclic ring having, in addition to carbon atoms, one or more heteroatoms as defined above (e.g., one, two, three or four heteroatoms)).
  • Partially Unsaturated when referring to a ring moiety, means a ring moiety that includes at least one double or triple bond between ring atoms.
  • Patient or subject refers to any organism to which a provided composition is or may be administered, e.g., for experimental, diagnostic, prophylactic, cosmetic, and/or therapeutic purposes. Typical patients or subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and/or humans). In some embodiments, a patient or subject is a human. In some embodiments, a patient or a subject is suffering from or susceptible to one or more disorders or conditions.
  • a patient or subject displays one or more symptoms of a disorder or condition.
  • a patient or subject has been diagnosed with one or more disorders or conditions.
  • a patient or a subject is receiving or has received certain therapy to diagnose and/or to treat a disease, disorder, or condition.
  • Substituted or optionally substituted As described herein, compounds of this disclosure may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent.
  • Substituted applies to one or more hydrogens that are either explicit or implicit from the structure (e.g., refers to at least ).
  • an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position.
  • Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds.
  • stable refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes provided herein.
  • Groups described as being “substituted” preferably have between 1 and 4 substituents, more preferably 1 or 2 substituents.
  • Groups described as being “optionally substituted” may be unsubstituted or be “substituted” as described above.
  • treat refers to any administration of a therapy that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition.
  • treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
  • such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
  • treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition.
  • the present disclosure provides compounds that are inhibitors of N-glycosylated Grp94.
  • Such compounds are represented schematically in Formula (I): or a pharmaceutically acceptable salt thereof, wherein: Z 2 is –N- or –CR 10 -, wherein R 10 is H or unsubstituted or substituted -(C1-C6)aliphatic; X 1 is –H, -halogen, -N(R)2, -OR, -CN, or unsubstituted or substituted -(C1-C6)aliphatic; X 2 is –H, halogen, or unsubstituted or substituted -(C 1 -C 6 )aliphatic; X 3 and X 5 are independently -halogen, unsubstituted or substituted -(C 1 -C 12 )aliphatic, unsubstituted or substitute
  • Z 2 is –N-. In some embodiments, Z 2 is –CR 10 -. In some embodiments, Z 2 is –CH-. [0084] In some embodiments, X 1 is –H. In some embodiments, X 1 is halogen. In some embodiments, X 1 is F. In some embodiments, X 1 is Cl. In some embodiments, X 1 is Br. In some embodiments, X 1 is I. In some embodiments, X 1 is F or Cl. [0085] In some embodiments, X 2 is -H. In some embodiments, X 2 is halogen.
  • X 2 is –H, halogen, or unsubstituted or substituted -(C1- C 6 )aliphatic; and X 3 and X 5 are independently -halogen, unsubstituted or substituted -(C 1 - C12)aliphatic, unsubstituted or substituted phenyl, unsubstituted or substituted 5- to 6-membered monocyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, unsubstituted or substituted 8- to 10-membered bicyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, unsubstituted or substituted 3- to 10- membered heterocyclic group having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or unsubstituted or substituted 3- to 10-membered cycloalkyl group.
  • both X 3 and X 5 are halogen.
  • the halogen is Cl.
  • the halogen is F.
  • the halogen is I.
  • the halogen is Br.
  • X 3 and X 5 are identical halogen.
  • neither X 3 nor X 5 are hydrogen.
  • one of X 3 and X 5 is halogen.
  • one of X 3 and X 5 is hydrogen.
  • X 3 and X 5 are both Cl.
  • X 3 and X 5 are Cl and Br.
  • X 3 and X 5 and Cl and I are halogen, and the other of X 3 and X 5 is unsubstituted or substituted -(C 1 -C 6 )aliphatic. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted -(C1-C6)aliphatic. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted -(C1-C6)aliphatic.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted -(C1-C6)alkyl.
  • the -(C1-C6)alkyl group is substituted with one or more halogen, -OH, -CN, -NH2, or unsubstituted C1-6 aliphatic.
  • the -(C 1 -C 6 )alkyl group is substituted with -OH.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted -(C2-C6)alkenyl.
  • the -(C2-C6)alkenyl group is substituted with halogen, -OH, -CN, -NH 2 , or unsubstituted C 1-6 aliphatic.
  • the -(C 2 -C 6 )alkenyl group is substituted with -OH.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted -(C2-C6)alkynyl.
  • the -(C2-C6)alkynyl group is substituted with halogen, -OH, -CN, -NH 2 , or unsubstituted C 1-6 aliphatic.
  • the -(C2-C6)alkynyl group is substituted with -OH.
  • X 3 and X 5 are independently selected from halogen or the following groups:
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted phenyl. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted phenyl. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted phenyl.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted phenyl, wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, -CF3, unsubstituted C1-6 aliphatic, or C1-6 aliphatic substituted with halogen, -OH, -CN, -NO 2 , -CF 3 , or -NH 2 .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted phenyl, wherein the substituent is –NO 2 .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted phenyl, wherein the substituent is –OMe. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted phenyl, wherein the substituent is –CF 3 . [0095] In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted 5- to 6-membered monocyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted 5- to 6-membered monocyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted 5- to 6- membered monocyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, unsubstituted C 1-6 aliphatic, or C 1-6 aliphatic substituted with halogen, -OH, -CN, -NO 2 , or -NH 2 .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, unsubstituted C1-6 aliphatic, or C 1-6 aliphatic substituted with halogen, -OH, -CN, -NO 2 , or -NH 2 .
  • a substituent is –NO 2 .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is –-OMe. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is –CF 3 . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is –Me. [0097] In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein each substituent is independently halogen, -N(R) 2 , -OR, -CN, -NO 2 , unsubstituted C 1-6 aliphatic, or C1-6 aliphatic substituted with halogen, -OH, -CN, -NO2, or -NH2.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is –NO2. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is -OMe. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is –CF 3 . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is –Me.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, unsubstituted C1-6 aliphatic, or C1-6 aliphatic substituted with halogen, -OH, -CN, -NO2, or -NH2.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is –NO 2 . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is -OMe. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is –CF3. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted or , wherein the substituent is –Me.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, unsubstituted C1-6 aliphatic, or C1-6 aliphatic substituted with halogen, -OH, -CN, -NO2, or -NH2.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted or , wherein the substituent is –NO 2 .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is -OMe.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the su 3 5 bstituent is –CF3.
  • one of X and X is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is –Me.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted or or . In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or or .
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted or or , wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, unsubstituted C1-6 aliphatic, or C1-6 aliphatic substituted with halogen, -OH, -CN, -NO2, or -NH2.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted or , wherein the substituent is –NO2.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted , wherein the substituent is -OMe. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted wherein the substituent is –CF3. In some embodiments, one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted or or , wherein the substituent is –Me. [0101] In some embodiments, X 3 and X 5 are independently selected from halogen or the following groups:
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted or substituted 8- to 10-membered bicyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is unsubstituted 8- to 10-membered bicyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • one of X 3 and X 5 is halogen, and the other of X 3 and X 5 is substituted 8- to 10- membered bicyclic heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein each substituent is independently halogen, -N(R)2, -OR, -CN, -NO2, unsubstituted C 1-6 aliphatic, or C 1-6 aliphatic substituted with halogen, -OH, -CN, -NO 2 , or -NH 2 .
  • one of R 2 and R 3 is H. In some embodiments, both R 2 and R 3 are H.
  • neither of R 2 and R 3 is H.
  • one of R 2 and R 3 is H and the other is unsubstituted or substituted -(C 1 -C 8 )aliphatic. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted or substituted -(C1-C8)alkyl. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted -(C1-C8)alkyl. In some embodiments, one of R 2 and R 3 is H and the other is methyl. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted -(C 2 )alkyl.
  • one of R 2 and R 3 is H and the other is unsubstituted -(C 3 )alkyl. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted -(C4)alkyl. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted -(C 5 )alkyl. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted -(C 6 )alkyl. In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted -(C7)alkyl.
  • one of R 2 and R 3 is H and the other is unsubstituted -(C 8 )alkyl. In some embodiments, one of R 2 and R 3 is H and the other is substituted -(C 1 -C 8 )alkyl, wherein each substituent is independently halogen, -OH, -CN, -NH2, or unsubstituted C1-6 aliphatic. [0106] In some embodiments, one of R 2 and R 3 is H and the other is unsubstituted or substituted -(C 2 -C 8 )alkenyl.
  • R 2 and R 3 are H and the other is unsubstituted or substituted -(C2-C8)alkynyl.
  • R 2 and R 3 are independently selected from the following groups: [ , [0110]
  • compounds of Formula (I) have the structure of Formula (Ia): or a pharmaceutically acceptable salt thereof, wherein each of X 1 , X 2 , X 3 , X 5 , Z 2 , and R 3 is as defined and described herein, both singly and in combination.
  • compounds of Formula (I) have the structure of Formula (Ib): Ib or a pharmaceutically acceptable salt thereof, wherein each of X 1 , X 3 , X 5 , Z 2 , and R 1 is as defined and described herein, both singly and in combination.
  • compounds of Formula (I) have the structure of Formula (Ic- i) or (Ic-ii): Ic-ii or a pharmaceutically acceptable salt thereof, wherein each of X 1 , X 3 , Z 2 , and R 1 is as defined and described herein, both singly and in combination.
  • compounds of Formula (I) have the structure of Formula (Id): or a pharmaceutically acceptable salt thereof, wherein each of X 1 , X 3 , X 5 , Z 2 , and R 3 is as defined and described herein, both singly and in combination.
  • compounds of Formula (I) have the structure of Formula (Ie- i) or (Ie-ii): Ie-i
  • the present disclosure provides a method of treating cancer, inflammatory diseases, neurodegenerative diseases, rheumatoid arthritis, or diabetes, comprising the step of administering to a subject suffering therefrom an effective amount of a compound having the structure of Formula I, Ia, Ib, Ic-i, Ic-ii, Id, Ie-i, or Ie-ii, or a pharmaceutically acceptable salt thereof.
  • compositions [0117] The present disclosure also provides compositions comprising a compound provided herein with one or more other components.
  • provided compositions comprise and/or deliver a compound described herein (e.g., compounds of Formulae I, Ia, Ib, Ic-i, Ic-ii, Id, Ie-i, and Ie-ii ).
  • a provided composition is a pharmaceutical composition that comprises and/or delivers a compound provided herein (e.g., compounds of Formulae I, Ia, Ib, Ic-i, Ic-ii, Id, Ie-i, and Ie-ii ) and further comprises a pharmaceutically acceptable carrier.
  • Pharmaceutical compositions typically contain an active agent (e.g., a compound described herein) in an amount effective to achieve a desired therapeutic effect while avoiding or minimizing adverse side effects.
  • provided pharmaceutical compositions comprise a compound described herein and one or more fillers, disintegrants, lubricants, glidants, anti-adherents, and/or anti-statics, etc.
  • Provided pharmaceutical compositions can be in a variety of forms including oral dosage forms, topical creams, topical patches, iontophoresis forms, suppository, nasal spray and/or inhaler, eye drops, intraocular injection forms, depot forms, as well as injectable and infusible solutions. Methods of preparing pharmaceutical compositions are well known in the art. [0119] In some embodiments, provided compounds are formulated in a unit dosage form for ease of administration and uniformity of dosage.
  • unit dosage form refers to a physically discrete unit of an active agent (e.g., a compound described herein) for administration to a subject.
  • each such unit contains a predetermined quantity of active agent.
  • a unit dosage form contains an entire single dose of the agent.
  • more than one unit dosage form is administered to achieve a total single dose.
  • administration of multiple unit dosage forms is required, or expected to be required, in order to achieve an intended effect.
  • a unit dosage form may be, for example, a liquid pharmaceutical composition containing a predetermined quantity of one or more active agents, a solid pharmaceutical composition (e.g., a tablet, a capsule, or the like) containing a predetermined amount of one or more active agents, a sustained release formulation containing a predetermined quantity of one or more active agents, or a drug delivery device containing a predetermined amount of one or more active agents, etc.
  • a liquid pharmaceutical composition containing a predetermined quantity of one or more active agents
  • a solid pharmaceutical composition e.g., a tablet, a capsule, or the like
  • a sustained release formulation containing a predetermined quantity of one or more active agents
  • a drug delivery device containing a predetermined amount of one or more active agents
  • provided compounds and compositions are useful in research as, for example, analytical tools and/or control compounds in biological assays.
  • the present disclosure provides methods of administering provided compounds or compositions to a subject in need thereof.
  • the present disclosure provides methods of administering provided compounds or compositions to a subject suffering from or susceptible to a disease, disorder, or condition associated with N- glycosylated Grp94.
  • provided compounds are useful as N-glycosylated Grp94 inhibitors.
  • the present disclosure provides methods of inhibiting N- glycosylated Grp94 in a subject comprising administering a provided compound or composition.
  • the present disclosure provides methods of inhibiting N-glycosylated Grp94 in a biological sample comprising contacting the sample with a provided compound or composition. [0124] In some embodiments, the present disclosure provides methods of treating cancer, comprising administering a provided compound or composition to a subject in need thereof. In some embodiments, the present disclosure provides methods of treating proliferative diseases, comprising administering a provided compound or composition to a subject in need thereof.
  • the cancer is colorectal cancer, pancreatic cancer, thyroid cancer, basal cell carcinoma, melanoma, renal cell carcinoma, bladder cancer, prostate cancer, a lung cancer including small cell lung cancer and non-small cell lung cancer, breast cancer, neuroblastoma, gastrointestinal cancers including gastrointestinal stromal tumors, esophageal cancer, stomach cancer, liver cancer, gallbladder cancer, anal cancer, brain tumors including gliomas, lymphomas including follicular lymphoma and diffuse large B-cell lymphoma, leukemias, myelomas, myeloproliferative neoplasms and gynecologic cancers including ovarian, cervical, or endometrial cancer.
  • the cancer is breast cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is gastric cancer. In some embodiments, the cancer is esophageal cancer. In some embodiments, the cancer is non-small-cell lung cancer. [0125] In some embodiments, the present disclosure provides methods of treating a hematological malignancy, comprising administering a provided compound or composition to a subject in need thereof.
  • a hematological malignancy is leukemia (e.g., chronic lymphocytic leukemia, acute lymphoblastic leukemia, T-cell acute lymphoblastic leukemia, chronic myelogenous leukemia, acute myelogenous leukemia, or acute monocytic leukemia).
  • a hematological malignancy is lymphoma (e.g., Burkitt’s lymphoma, Hodgkin’s lymphoma, or non-Hodgkin’s lymphoma).
  • a hematological malignancy is myeloma (e.g., multiple myeloma).
  • a hematological malignancy is myeloproliferative neoplasm (e.g., polycythemia vera, essential thrombocytopenia, or myelofibrosis). In some embodiments, a hematological malignancy is myelodysplastic syndrome. [0126] In some embodiments, the present disclosure provides methods of treating an inflammatory disease, disorder, or condition (e.g., acute respiratory syndrome, hyperinflammation, and/or cytokine storm syndrome (including those associated with COVID-19) or atopic dermatitis), neurodegenerative diseases, rheumatoid arthritis, or diabetes comprising administering a provided compound or composition to a subject in need thereof.
  • an inflammatory disease, disorder, or condition e.g., acute respiratory syndrome, hyperinflammation, and/or cytokine storm syndrome (including those associated with COVID-19) or atopic dermatitis
  • neurodegenerative diseases rheumatoid arthritis, or diabetes
  • a provided compound or composition is administered as part of a combination therapy.
  • combination therapy refers to those situations in which a subject is simultaneously exposed to two or more therapeutic or prophylactic regimens (e.g., two or more therapeutic or prophylactic agents).
  • the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all “doses” of a first regimen are administered prior to administration of any doses of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens.
  • “administration” of combination therapy may involve administration of one or more agent(s) or modality(ies) to a subject receiving the other agent(s) or modality(ies) in the combination.
  • combination therapy does not require that individual agents be administered together in a single composition (or even necessarily at the same time), although in some embodiments, two or more agents, or active moieties thereof, may be administered together in a combination composition.
  • a provided compound or composition is administered to a subject who is receiving or has received one or more additional therapies (e.g., an anti-cancer therapy and/or therapy to address one or more side effects of such anti-cancer therapy, or otherwise to provide palliative care).
  • Exemplary additional therapies include ERBB2 inhibitors, EGFR inhibitors, CDK4 inhibitors, CRAF inhibitors, BRAF inhibitors, AKT inhibitors, MET inhibitors, BCR-ABL inhibitors, JAK inhibitors, HIF-1 ⁇ inhibitors, and p53 inhibitors.
  • the present disclosure contemplates, among other things, the following numbered embodiments: 1. A method of treating cancer comprising the step of administering to a subject suffering therefrom an effective amount of a compound that inhibits N-glycosylated Grp94. 2. A method of treating cancer characterized by the presence of N-glycosylated Grp94 comprising the step of administering to a subject suffering therefrom an effective amount of a compound that inhibits N-glycosylated Grp94. 3.
  • a method of treating a disease associated with N-glycosylated Grp94 comprising the step of administering to a subject suffering therefrom an effective amount of a compound that inhibits N- glycosylated Grp94.
  • the compound has the structure of Formula (I): or a pharmaceutically acceptable salt thereof, wherein: (b) each of Z 1 and Z 3 is independently -CH- or -N-; (c) Z 2 is -N- or –CR 10 -, wherein R 10 is H or unsubstituted or substituted -(C1-C6)aliphatic; (d) each of Z 4 , Z 5 , Z 6 , Z 7 and Z 8 is independently -C- or -N-, with the provisos that at least one of Z 4 , Z 6 and Z 7 is -C- and no three consecutive Z 4 through Z 8 are N; (e) X 1 is -H, -halogen, -N(R) 2 , -
  • each of Z 1 and Z 3 is independently -CH- or -N-;
  • Z 2 is -CH-, -N-, or –CR 10 -, wherein R 10 is -(C1-C6)alkyl;
  • each of Z 4 , Z 5 , Z 6 , Z 7 and Z 8 is independently -C- or -N-, with the provisos that at least one of Z 4 , Z 6 and Z 7 is -C- and no three consecutive Z 4 through Z 8 are N;
  • X 1 is -H, -halogen, -NH2, -CN, -(C1-C6)alkyl, -O(C1-C6)alkyl, -CH2OH, -C(halogen)3, -CH(halogen)2, -CH2(halogen), -OC(halogen)3, -OCH(halogen)2, or -OCH2(halogen);
  • each of Z 1 and Z 3 is independently -CH- or -N-
  • each of Z 1 and Z 3 is independently -CH- or -N-;
  • Z 2 is -N- or –CR 10 -, wherein R 10 is H or unsubstituted or substituted -(C 1 -C 6 )aliphatic;
  • X 1 is -H, -halogen, -N(R)2, -OR, -CN, or unsubstituted or substituted -(C1-C6)aliphatic;
  • each of X 3 and X 5 is independently -H, -halogen, -SR, -N(R)2, -OR, -CN, -NO2, - CN, -C(O)R, -C(O) 2 R, -S(O)R, -S(O) 2 R, -C(O)N(R) 2 , -SO 2 N(R) 2 , -OC(O)R, -
  • each of Z 1 and Z 3 is independently -CH- or -N-;
  • Z 2 is -CH-, -N-, or –CR 10 -, wherein R 10 is -(C 1 -C 6 )alkyl;
  • X 1 is -H, -halogen, -NH2, -CN, -(C1-C6)alkyl, -O(C1-C6)alkyl, -CH2OH, -C(halogen)3, -CH(halogen)2, -CH2(halogen), -OC(halogen)3, -OCH(halogen)2, or -OCH2(halogen);
  • each of X 3 and X 5 is independently -H, -halogen, -NH 2 , -CN, -(C 1 -C 6 )alkyl, -O(C 1 - C6)alkyl, -CH2OH, -C(halogen);
  • each of Z 1 and Z 3 is independently -CH- or -N-;
  • Z 2 is -N- or –CR 10 -, wherein R 10 is H or unsubstituted or substituted -(C 1 -C 6 )aliphatic;
  • each of Z 6 , Z 7 and Z 8 is independently -C- or -N-, with the proviso that at least one of Z 6 - Z 8 is -C-;
  • X 1 is -H, -halogen, -N(R) 2 , -OR, -CN, or unsubstituted or substituted -(C 1 -C 6 )aliphatic;
  • each of X 4 , X 5 , and X 6 is independently -H, -halogen, -SR, -N(R) 2 , -
  • each of Z 1 and Z 3 is independently -CH- or -N-;
  • Z 2 is -N- or –CR 10 -, wherein R 10 is H or unsubstituted or substituted -(C1-C6)aliphatic;
  • each of Z 4 , Z 5 , Z 6 , Z 7 and Z 8 is independently -C- or -N-, with the proviso that no three consecutive Z 4 through Z 8 are N;
  • X 1 is -H, -halogen, -N(R) 2 , -OR, -CN, or unsubstituted or substituted -(C 1 -C 6 )aliphatic;
  • each of X 4 , X 5 , and X 6 is independently -H, -halogen, -SR, -N(R)2, -
  • the compound is part of a pharmaceutical composition comprising the compound and a pharmaceutically acceptable excipient.
  • the N-glycosylated Grp94 comprises two or more N-glycan modified residues.
  • the N-glycosylated Grp94 comprises two or more N-glycan modified Asn residues.
  • the N-glycosylated Grp94 comprises glycosylated Asn at the N62 residue. 46.
  • the N-glycosylated Grp94 alters the function of one or more aberrant oncogenic proteins.
  • RTK receptor tyrosine kinase
  • the aberrant oncogenic protein is a receptor tyrosine kinase (RTK). 50.
  • the cancer is colorectal cancer, pancreatic cancer, thyroid cancer, basal cell carcinoma, melanoma, renal cell carcinoma, bladder cancer, prostate cancer, a lung cancer including small cell lung cancer and non-small cell lung cancer, breast cancer, neuroblastoma, gastrointestinal cancers including gastrointestinal stromal tumors, esophageal cancer, stomach cancer, liver cancer, gallbladder cancer, anal cancer, brain tumors including gliomas, lymphomas including follicular lymphoma and diffuse large B-cell lymphoma, leukemias, myelomas, myeloproliferative neoplasms and gynecologic cancers including ovarian, cervical, or endometrial cancer.
  • the cancer is colorectal cancer, pancreatic cancer, thyroid cancer, basal cell carcinoma, melanoma, renal cell carcinoma, bladder cancer, prostate cancer, a lung cancer including small cell lung cancer and non-small cell lung cancer, breast cancer, neuroblastoma, gastrointestinal cancers including gastrointestinal
  • Reagents and conditions (a) CS 2 , NaHCO 3 , H 2 O, EtOH, reflux, 4 days; (b) neocuproine hydrate, CuI, NaOtBu, 3,5-dichloroiodobenzene, DMF, 115°C, 24 h; (c) 1,3- dibromopropane, Cs 2 CO 3 , DMF, rt, 2 h; (d) amines, DMF, rt, 18-48 h.
  • Athymic nude mice (Hsd:Athymic Nude-Foxn1 nu , female, 20-25 g, 6 weeks old; RRID:MGI:5652489) were obtained from Envigo and NSG mice (NOD.Cg-Prkdc scid female, 20-25 g, 8 weeks old, IMSR Cat# JAX:005557, RRID:IMSR_JAX:005557) were obtained from the Jackson Laboratory.
  • Human Cell Lines [0161] Cell lines were obtained from laboratories at MSKCC, or purchased from the American Type Culture Collection (ATCC) or Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ). Cells were cultured as per the providers’ recommended culture conditions.
  • the breast cancer cell lines (MDA-MB-468 (HTB-132), HCC1806 (CRL- 2335), MDA-MB-231 (HTB-26), MDA-MB-415 (HTB-128), MCF-7 (HTB-22), BT474 (HTB- 20), BT20 (HTB-19), MDA- MB-361 (HTB-27), SKBr3 (HTB-30), MDA-MB-453 (HTB-131), T47D (HTB-133), AU565 (CRL-2351) and the non-transformed cell line HMEC (human primary mammary epithelial cells, PCS- 600-010) were obtained from the American Type Culture Collection (ATCC).
  • ATCC American Type Culture Collection
  • the pancreatic cancer cell lines include: MiaPaCa2 (CRL-1420), Panc-1 (CRL-1469), BxPc-3 (CRL-1687), Capan-1 (HTB-79), SU.86.86 (CRL-1837), HPAF2 (CRL- 1997), ASPC-1 (CRL-1682), PL45 (CRL-2558), CFPAC (CRL-1918), Capan-2 (HTB-80) were purchased from ATCC; 931102 and 931019 are patient derived cell lines provided by Dr. Y. Janjigian, MSKCC. The lung cancer cell lines NCI-H3122, NCI-H299 were kindly provided by Dr. M.
  • Neuroblastoma cells SY5Y (CRL-2266) was purchased from ATCC; LAN5 and SMS-KCNR were obtained from the Children’s Oncology Group (COG). Ewing’s sarcoma cells TC71 and A673 were kindly provided by Dr. S. Ambati, MSKCC. Lymphoma cell lines include: SU-DHL-6 (CRL- 2959), Toledo (CRL-2631), Farage (CRL-2630) and BC3 (CRL-2277) were purchased from ATCC; HBL-1, MD901 and U2932 were kindly provided by J.
  • Murine Cell Lines Wild type and TM96 expressing MethA fibrosarcoma cells were kindly provided by Dr. Z. Li, OSU. The cells were established as previously reported (Zheng et al., 2001) and cultured in RPMI medium with 10% heat-inactivated FBS (VWR) and 1% Penicillin/Streptomycin. Reagents [0163] PU-WS13, PU-WS13-biotin, inactive-WS13-biotin, PU29F, PU-H71, HJP-149 and SO-33 were synthesized using a previously reported protocol (Patel et al., 2015; Patel et al., 2013; Rodina et al., 2016).
  • PU-WS13 was synthesized via CuI-catalyzed coupling of 8- mercaptoadenine with 3,5-dichloroiodobenzene at 110 °C resulting in 8-(3,5-dichloro- phenylsulfanyl)adenine in 72% yield, which was heated with 3-(tertbutoxycarbonyl-isopropyl- amino)-propyl tosylate in DMF at 80 °C under nitrogen protection for 30 min.
  • PU-WS13-biotin was synthesized through alkylation of 8-(3,5-dichloro-phenyl sulfanyl)adenine at position N9 with N-(8- bromooctyl)phthalimide in the presence of Cs 2 CO 3 in DMF at room temperature to obtain 2-(8-(6- amino-8-((3,5-dichlorophenyl)thio)-9H-purin-9- yl)octyl)isoindoline-1,3-dione in 21% yield.
  • the synthetic route to inactive-WS13- biotin comprises S-alkylation of 8-mercaptoadenine with 1-iodo-2-methoxyethane in aqueous KOH solution providing 87% yield of 8-((2- methoxyethyl)thio)-9H-purin-6-amine. Further reaction with N-(8-bromooctyl)phthalimide, followed by phathalimide-deprotection and coupling with NHS-active ester of biotin in DMF gave crude inactive-WS13-biotin. This resulting residue was purified by preparatory TLC (CH 2 Cl 2 :MeOH-NH 3 (7N), 10:1) to give in 72% yield the inactive- WS13-biotin.
  • Synthesis of PU29F commenced with the coupling of 2,4,5,6-tetraaminopyrimidine with the acid fluoride of the 3,4,5- trimethoxyphenylacetic acid resulting in N-(2,4,6-triaminopyrimidin-5-yl)-2-(3,4,5- trimethoxyphenyl)acetamide.
  • the acid fluoride was generated by treating phenylacetic acid derivative with cyanuric fluoride and pyridine in CH 2 Cl 2 .
  • the acetamide derivative was cyclized to 8-(3,4,5-trimethoxybenzyl)-9H-purine-2,6-diamine by heating it in alcoholic NaOMe.
  • Taxol (S1150), Erlotinib (S1023) and Lapatinib (S2111) were purchased from Selleckchem. Cetuximab was received as leftover from the MSKCC Clinical Pharmacy. Lambda protein Phosphatase (Lambda PPase, P0753S), Endo H (P0703S) and PNGase F (P0709S) were purchased from NEB Inc. High capacity Streptavidin Agarose (20361) was purchased from ThermoFisher Scientific.
  • Cell Fractionation and Immunoblotting [0164] Cells were either treated with DMSO (vehicle) or indicated compounds and lysed in RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% sodium deoxycholate and 0.5% NP40) supplemented with cocktail protease inhibitors (Roche) to produce whole-cell lysates. Lysates for cytosol and total membrane fractions were harvested and processed using ProteoExtract Subcellular Proteome Extraction Kit (Millipore Sigma) following the manufacturer's instructions. Plasma membrane proteins were prepared using the Minute Kit (Invent Biotechnologies Inc.) according to manufacturer’s instructions. Protein concentrations were determined using the BCA kit (Pierce).
  • HSP90 SMC-107 from Stressmarq
  • HER2 28-0004
  • myc R950-25
  • Calnexin 610523
  • Calnexin 610523
  • Calnexin 610523
  • HSP70 SPA-810
  • GRP94 SPA-850
  • GAPDH ab8245
  • GRP78 ab21685
  • HSP90 ⁇ ab2928
  • cleaved PARP G7341) from Promega
  • EGFR 4267
  • LRP6 2560
  • p-AKT S473
  • AKT 4691
  • Caspase 7 9494
  • p-ERK1/2 T202/Y204
  • ERK1/2 4695
  • p-STAT3 9145
  • STAT3 (12640
  • p-p65 S536) (3033
  • p65 8242
  • Flotillin-1 3253
  • Protein extracts were prepared in the indicated buffers and diluted in Felts buffer. Samples were incubated with D-biotin (Control), Inactive-WS13-biotin (Control), PU-WS13-biotin (GRP94 bait) or GRP94 antibodies for 3 hr at 4°C, followed by incubation with High Capacity Streptavidin agarose beads (ThermoFisher Scientific) or Protein A/G agarose beads (Roche) for another 2 hr at 4°C.
  • PU-WS13-biotin beads were prepared by incubating 20 ⁇ M PU-WS13-biotin (chemical bait) with High Capacity Streptavidin agarose beads (ThermoFisher Scientific) for 3 hr at 4 °C followed by washing with Felts buffer for three times.
  • Antibody beads were prepared by incubating 9G10 or G4420 anti-GRP94 antibodies with protein A/G agarose beads (Roche) for 2 hr at 4 °C followed by washing with Felts buffer for three times.
  • the pre-formed chemical bait or antibody bait was then added into the cell lysate and the mixture was incubated on a rotator for 3 hr at 4 °C. After separating the beads by centrifugation, the supernatant was collected and incubated with new pre-formed chemical bait or antibody bait.
  • the sequential capture experiment was carried out by repeating the chemical precipitation (CP)/immunoprecipitation (IP) three times before the final IP with the indicated antibody bait. Captured cargos at each step were washed with Felts buffer three times before loading onto SDS-PAGE and subjecting to immunoblotting.
  • siRNA knock-down of GRP94 Transient transfections were carried out using Lipofectamine RNAiMax reagent (ThermoFisher) according to the manufacturer's instructions.
  • siGRP94 Gene HSP90B1
  • scramble siRNA were purchased from Qiagen. Cells were transfected with 5 nM or 20 nM siRNA. The knockdown efficiency and other cellular markers were evaluated at 72 hr post transfection by immunoblotting.
  • Immunofluorescence [0170] Cells were seeded and grown onto Lab-Tek II chamber slides for 24 hr before the experiment.
  • HER2 Zymed; 28004; 1:50
  • HER2-FITC BD; 340553; 1:200
  • GRP94 Sigma; G4420; 1:100
  • EEA1 Abcam; ab70521; 1:100
  • Calnexin Abcam; 22595; 1:100
  • Enzymatic Deglycosylation and Dephosphorylation [0171] Cell lysates were treated with Endo H or PNGase F according to the manufacturer’s instructions. After reacted at 37°C for 1h, the samples were mixed with protein loading buffer and subjected to immunoblotting.
  • the lysates were firstly diluted in Felts buffer and then incubated with the enzymes without protein denaturing on ice overnight.
  • the deglycosylated samples were further used for detatured or native gel electrophoresis, chemical or immuno precipitation experiments.
  • 1 ⁇ enzyme reaction buffer (1 ⁇ Protein MetalloPhosphatase (PMP) buffer for lambda PPase, 1 ⁇ glyco buffer 3 for Endo H or 1 ⁇ glyco buffer 2 for PNGase F.
  • PMP Protein MetalloPhosphatase
  • Enzymes were added into the reaction tubes and incubated for 1hr at 30 o C for PPase, at 37 o C for Endo H and PNGase F. Immediately after the reaction was finished, the samples were mixed with the protein loading buffer, heated at 95 o C for 5 min, stored on ice before loading into the gels.
  • Cell surface protein isolation kit (Pierce) was used to purify the cell surface proteins according to the manufacturer’s instructions. Briefly, cell surface proteins were biotinylated by incubating the live cells with Sulfo-NHS-SS-biotin for 30 min at 4 °C. The reaction was quenched and cells were lysed.
  • CRISPR/Cas9 mediated Knock-Out and targeted Mutagenesis of endogenous GRP94 were designed using the online tools CRISPOR (http://crispor.tefor.net/) and CHOPCHOP (https://chopchop.cbu.uib.no/).
  • sgRNAs against hGRP94 used in this study are: sg1948, GAAGAAGCTATTCAGTTGGA; sg3859, CAACGATACCCAGCACATCT.
  • the single- stranded oligos were synthesized by Intergrated DNA Technologies, cloned into PX458 (pSpCas9(BB)-2A- GFP, Addgene plasmid #48138, (Ran et al., 2013)) via BsaI, and the positive clones were validated by plasmid sequencing (Genewiz).
  • T7 endonuclease I assay Genomic regions flanking the CRISPR sgRNA target sites were PCR amplified with Fusion Flash High-Fidelity PCR Master Mix (F548S, ThermoFIsher Scientifics) using gene-specific primers. PCR products were purified with MinElute PCR Purification Kit (Qiagen) and hybridized in PCR buffer (95°C, 5 min; 95-85°C at ⁇ 2°C/s; 85- 25°C at ⁇ 0.1°C/s; hold at 4°C).
  • the sequencing primers used in this study are: N62-F, ccattttaacccccaagaca; N62-R, atcaggccgtgaacctattt; N217-F, cactttcagaaaaggccataaaa; N217-R, caggaaaattaaggcccaga.
  • Whole cell lysates were also validated by immunoblotting with GRP94 antibodies.
  • Soft Agar Colony Formation Assay [0178] 6-well plates were coated with a bottom layer of 2 mL 1% low-melting-point agarose (Invitrogen) dissolved in the complete culture medium. Cell suspension in culture medium containing 0.4% low-melting-point agarose was then added on the top of the layer.
  • Example 1 Ex vivo Studies [0181] The fresh tissue slicing method maintains tissue integrity and architecture within an intact tumor- microenvironment-macroenvironment context throughout treatment, providing a more clinically- relevant means to assess the inhibitors’ effects. This is important because interactions among tumor and stromal cells are known to play a major role in cancer growth and progression and in the anti-tumor efficacy of agents.
  • De-identified pathology discarded specimens were obtained in accordance with the guidelines and approval of the Institutional Review Board# 09-121 (PI: Dr. Modi).
  • the primary breast cancer specimens or fresh esophagogastric PDX samples were processed as reported before (Corben et al., 2014). Briefly, the sample was delivered in a fresh state, harvested in a sterile environment under 30 minutes from the surgical procedure. Tumor tissue was chosen from the periphery of the index lesion to avoid potential frank central necrosis (cell death). The necrotic tissue may be grossly recognizable by any of the following criteria: loss of color or paleness of the tissue; loss of strength in which necrotic tissue is soft and friable; a distinct demarcation between the necrotic and viable tissue.
  • the sample was placed in wet ice and transported to the laboratory for ex vivo fresh tissue sectioning.
  • Samples were then embedded into 5% Agarose gel and cut into 200 ⁇ m thick sections on a Leica VT 1000S vibratome.
  • the live sections were transferred into 24-well tissue culture plates and treated for 24 hr or 48 hr with the indicated concentration of PU-WS13.
  • Sections were then fixed in 4% formalin for 1hr at room temperature, and transferred into 70% ethanol. Following paraffin embedding, sectioning and mounting, the sections were stained with hematoxylin and eosin (H&E) and evaluated by the pathologists.
  • H&E hematoxylin and eosin
  • Example 2 In vivo Studies in Mice [0182] For the breast cancer model: Athymic nude mice (Hsd:Athymic Nude-Foxn1 nu , female, 20-25 g, 6 weeks old; RRID:MGI:5652489) were obtained from Envigo and were allowed to acclimatize at the MSKCC vivarium for 1 week prior to implanting tumors.
  • Tumor xenografts were established subcutaneously into the dorsal flank or orthotopically into the 4 th mammary fat pad. Tumors were initiated by subcutaneous injection of 5 ⁇ 10 6 cells for MDA-MB-468 or orthotopic injection of 5 ⁇ 10 6 cells for AU565 in a 200 ⁇ L cell suspension of a 1:1 v/v mixture of PBS with reconstituted basement membrane (BD matrigel, Collaborative Biomedical Products Inc.).
  • Tumor Volume was determined by measurement with Vernier calipers, calculated using the formula - length ⁇ width 2 ⁇ 0.5 and analyzed on indicated days as the median tumor volume ⁇ SD Mice were randomized prior to treatments, and euthanized after similar PU-WS13 treatment periods and at a time before tumor reached a size that resulted in discomfort or difficulty in physiological functions in the individual treatment group, in accordance with the IUCAC protocol.
  • Esophagogastric PDX model was generated as previously described (Mattar et al., 2018). Briefly, patient specimens ( ⁇ 0.5 g) collected under the approved IRB protocol (10-018, PI: Dr.
  • PU-WS13 was extracted in methylene chloride, and the organic layer was separated and dried under vacuum. Samples were reconstituted in mobile phase. Concentrations of PU-WS13 in tissue or plasma were determined by high-performance LC-MS/MS. PU-H71 was added as the internal standard. Compound analysis was performed on the 6410 LC-MS/MS system (Agilent Technologies) in multiple reaction monitoring mode using positive-ion electrospray ionization.
  • a Zorbax Eclipse XDB-C18 column (2.1 ⁇ 50 mm, 3.5 ⁇ m) was used for the LC separation, and the analyte was eluted under an isocratic condition (80% H 2 O + 0.1% HCOOH: 20% CH 3 CN) for 3 min at a flow rate of 0.4 mL/min.
  • a Zorbax Eclipse XDB-C18 column (4.6 x 50 mm, 5 ⁇ m) was used for the LC separation, and the analyte was eluted under a gradient condition (H 2 O+0.1% HCOOH:CH 3 CN, 95:5 to 70:30) at a flow rate of 0.35 mL/min.
  • PD study Tumors or tissues were homogenized in tissue lysis buffer (50 mM Tris- HCl pH 7.5, 50 mM KCl, 150 mM NaCl, 2 mM EDTA, 0.1% Sodium deoxycholate, 0.5% NP40, 0.5% Triton X-100, 0.5% SDS) using Bullet Blender Tissue Homogenizer (Next Advance Inc.). Protein concentrations were determined using the BCA kit (Pierce) according to the manufacturer’s instructions. Protein lysates (20-100 ⁇ g) were electrophoretically resolved by SDS/PAGE, transferred to nitrocellulose membrane, and probed with the indicated antibodies.
  • tissue lysis buffer 50 mM Tris- HCl pH 7.5, 50 mM KCl, 150 mM NaCl, 2 mM EDTA, 0.1% Sodium deoxycholate, 0.5% NP40, 0.5% Triton X-100, 0.5% SDS
  • Example 4 Efficacy Studies
  • Mice bearing MDA-MB-468 or AU565 xenograft tumors reaching a volume of 100–150 mm 3 were treated i.p. with PU-WS13 (75mg/kg or 125mg/kg, dissolved in 60mM citrate buffer (pH 4.0) with 30% Captisol) or vehicle, on a 3-times or 5 times per week schedule, as indicated.
  • Tumor volume (in mm 3 ) was determined by measurement with Vernier calipers, and was calculated as the product of its length ⁇ width 2 ⁇ 0.5.
  • mice were sacrificed after similar PU-WS13 treatment periods, and at a time before tumors reached a size that resulted in a discomfort or difficulty in physiological functions of mice in the individual treatment group, in accordance with our IUCAC protocol. All animals were observed daily for mortality from the time of animal receipt through the end of the study. Body weights for all animals were recorded no more than three times, but no fewer than once per week during the administration of the test article. All mice were observed for clinical symptoms at the time the animals were received and on all days in which the test article was administered.
  • Example 5 Toxicology Studies [0186] Toxicology studies: The study assessed the safety and relevant toxicities of PU- WS13 administered by i.p.
  • mice were anesthetized with isoflurane and approximately 100 ⁇ L of whole blood was collected from the orbital plexus of each mouse into a labeled tube containing EDTA anticoagulant.
  • EDTA anticoagulant EDTA anticoagulant
  • complete necropsies hematology and clinical chemistry were analyzed.
  • a necropsy was performed on each animal.
  • Gross examinations of each animal including internal organs were performed by a pathologist and any macroscopic lesions or other abnormal findings were recorded using standard terminology. For histopathology, tissues were collected and preserved in formalin.
  • Example 6 Identification of N-Glycosylation sites using nano LC-Mass Spectrometry (LC- MS/MS) [0187] Samples were treated with EndoH as described. Initially, non-treated samples, as well as samples treated with EndoH were utilized to develop the mass spectrometric workflow used.
  • Protein samples were separated by SDS-PAGE and processed using standard published protocols (Rodina et al., 2016) with the following modifications: Gel regions containing endoplasmin were generously excised and subjected to in-gel tryptic digestion with 200-300ng Trypsin (Trypsin Gold, Mass Spectrometry Grade, Promega) overnight, and after acidification with 10% formic acid (final concentration of 0.5-1% formic acid) resulting peptides were desalted using hand packed reversed phase Empore C18 Extraction Disks (3M, St. Paul, MN, USA) using a method described before (Rappsilber et al., 2007).
  • Desalted peptides were concentrated to a very small droplet by vacuum centrifugation and reconstituted in 10 ⁇ L 0.1% formic acid in water. Approximately 90% of the peptide material was used for liquid chromatography followed by tandem mass spectrometry (LC-MS/MS).
  • a Q Exactive HF mass spectrometer was coupled directly to an EASY-nLC 1000 (Thermo Fisher Scientific, Waltham, MA, USA) equipped with a self-packed 75 ⁇ m x 20-cm reverse phase column (360 mm OD, 75 mm ID, 10 mm ID tip Picotip emitter, New Objective, Woburn MA column packed with ReproSil-Pur C18, 3 ⁇ M beads, Dr. Maisch GmbH, Germany) for peptide separation.
  • Peptides were eluted with a 3-40% acetonitrile gradient over 110 min at a flow rate of 250 nL/min.
  • the mass spectrometer was operated in DDA mode with survey scans acquired at a resolution of 120,000 (at m/z 200) over a scan range of 300- 1750 m/z. Up to 15 most abundant precursors from the survey scan were selected with an isolation window of 1.6 Th for fragmentation by higher-energy collisional dissociation with normalized collision energy (NCE) of 27.
  • NCE normalized collision energy
  • the maximum injection time for the survey and MS/MS scans was 60 ms and the ion target value (AGC) for both scan modes was set to 3e6.
  • Mass Spectrometry Data Processing All mass spectra were first converted to mgf peak list format using Proteome Discoverer 1.4 (Thermo Fisher Scientific, Waltham, MA, USA) and the resulting mgf files searched against a human UniProt protein database using Mascot (Matrix Science, London,UK; version 2.5.0; www.matrixscience.com). Decoy protein sequences with reversed sequence were added to the database to allow for the calculation of false discovery rates (FDR).
  • FDR false discovery rates
  • a stock of 10 ⁇ M cy3B-GM and PU-FITC3 was prepared in DMSO and diluted with Felts buffer (20 mM Hepes (K), pH 7.3, 50 mM KCl, 2 mM DTT, 5 mM MgCl 2 , 20 mM Na 2 MoO 4 and 0.01% NP40 with 0.1 mg/mL BGG). To each well was added the fluorescent dye–labeled FP ligand, protein and tested inhibitor (initial stock in DMSO) in a final volume of 100 ⁇ L Felts buffer. Compounds were added in duplicate or triplicate wells.
  • FP refers to the fluorescent polarization binding assay with purified Grp94 protein – equilibrium binding.
  • cyt refers to alamar blue cytotoxicity assay in MDA-MB-468 breast cancer cells – N-glyc GRP94 dependent cancer cell. See Yan et al., Cell Reports 2020, 31, 107840, June 30, 2020, incorporated herein by reference. [0193] Results of FP and cyt Assays:
  • Example 9 Compound Profiles in Native Page and co-IP Studies
  • DMSO vehicle
  • RIPA buffer 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% sodium deoxycholate and 0.5% NP40
  • protease inhibitors Roche
  • Protein concentrations were determined using the BCA kit (Pierce).
  • the protein lysates (10–50 ⁇ g) were electrophoretically resolved by SDS-PAGE, transferred onto nitrocellulose membranes and probed with the indicated antibodies.
  • EGFR 4267) from Cell Signaling Technology; cleaved PARP (G7341) from Promega; HSP70 (SPA-810), GRP94 (SPA-850) from Enzo; GAPDH (ab8245) from Abcam; HER2 (28-0004) from Invitrogen.
  • the membranes were washed with TBS/0.1% Tween-20 and incubated with appropriate HRP-conjugated secondary antibodies.
  • Chemiluminescent signal was detected with Enhanced Chemiluminescence Detection System (GE Healthcare) according to the manufacturer’s instructions.
  • Native Gel Electrophoresis Native Gel Electrophoresis (Native PAGE) and Coomassie stain. Cells were lysed in the RIPA buffers.
  • Cells were either treated with DMSO (vehicle) or compounds for indicated time and lysed in RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% sodium deoxycholate and 0.5% NP40) supplemented with cocktail protease inhibitors (Roche) to produce cell lysates.
  • the lysates were diluted in Felts buffer (20 mM Hepes pH 7.3, 50 mM KCl, 2 mM DTT, 5 mM MgCl2, 20 mM Na2MoO4 and 0.01 % NP40 with 0.1 mg/mL BGG).
  • p185erbB2 binds to GRP94 in vivo. Dissociation of the p185erbB2/GRP94 heterocomplex by benzoquinone ansamycins precedes depletion of p185erbB2.
  • the epichaperome is a mediator of toxic hippocampal stress and leads to protein connectivity-based dysfunction.
  • Nature Communications s41467-019-14082-5. Joshi, S., Wang, T., Araujo, T.L.S., Sharma, S., Brodsky, J.L., and Chiosis, G. (2018). Adapting to stress - chaperome networks in cancer. Nat Rev Cancer 18, 562-575. Kim, J.Y., Jung, H.H., Do, I.G., Bae, S., Lee, S.K., Kim, S.W., Lee, J.E., Nam, S.J., Ahn, J.S., Park, Y.H., et al. (2016).
  • Fibroblast-secreted hepatocyte growth factor mediates epidermal growth factor receptor tyrosine kinase inhibitor resistance in triple-negative breast cancers through paracrine activation of Met.
  • Neuropathology official journal of the Japanese Society of Neuropathology 31, 583-588. Nussinov, R., Tsai, C.J., and Jang, H. (2019). Protein ensembles link genotype to phenotype.
  • Hsp90 inhibitors define tumor-specific regulation of HER2. Nat Chem Biol 9, 677-684. Pillarsetty, N., Jhaveri, K., Taldone, T., Caldas-Lopes, E., Punzalan, B., Joshi, S., Bolaender, A., Uddin, M.M., Rodina, A., Yan, P., et al. (2019).
  • Endoplasmic reticulum heat shock protein gp96 maintains liver homeostasis and promotes hepatocellular carcinogenesis.
  • a combination of Trastuzumab and 17- AAG induces enhanced ubiquitinylation and lysosomal pathway-dependent ErbB2 degradation and cytotoxicity in ErbB2-overexpressing breast cancer cells.
  • Selective compounds define Hsp90 as a major inhibitor of apoptosis in small-cell lung cancer. Nat Chem Biol 3, 498-507.
  • the epichaperome is an integrated chaperome network that facilitates tumour survival. Nature 538, 397-401. Schwarz, F., and Aebi, M. (2011). Mechanisms and principles of N-linked protein glycosylation. Curr Opin Struct Biol 21, 576-582. Shi, J., Yao, D., Liu, W., Wang, N., Lv, H., He, N., Shi, B., Hou, P., and Ji, M. (2012). Frequent gene amplification predicts poor prognosis in gastric cancer. International journal of molecular sciences 13, 4714-4726. Shrestha, L., Patel, H.J., and Chiosis, G. (2016).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne, entre autres, des méthodes de traitement du cancer. Dans certains modes de réalisation, la présente invention concerne des méthodes de traitement du cancer comprenant l'administration d'un inhibiteur de Grp94 N-glycosylée.
PCT/US2021/039230 2020-06-26 2021-06-25 Inhibition de grp94 n-glycosylée WO2021263194A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063045021P 2020-06-26 2020-06-26
US63/045,021 2020-06-26

Publications (1)

Publication Number Publication Date
WO2021263194A1 true WO2021263194A1 (fr) 2021-12-30

Family

ID=79281962

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/039230 WO2021263194A1 (fr) 2020-06-26 2021-06-25 Inhibition de grp94 n-glycosylée

Country Status (1)

Country Link
WO (1) WO2021263194A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8497354B2 (en) * 2010-06-16 2013-07-30 University of Pittsburgh—of the Commonwealth System of Higher Education Antibodies to endoplasmin and their use
WO2016201337A1 (fr) * 2015-06-12 2016-12-15 Immungene, Inc. Molécules de fusion d'interféron et d'anticorps obtenues par génie génétique pour le traitement de cancers exprimant la protéine 94 régulée par le glucose (grp94)
WO2017019540A2 (fr) * 2015-07-24 2017-02-02 Yale University Inhibiteurs de glycosylation à liaison en n et procédés les utilisant

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8497354B2 (en) * 2010-06-16 2013-07-30 University of Pittsburgh—of the Commonwealth System of Higher Education Antibodies to endoplasmin and their use
US20180230205A1 (en) * 2010-06-16 2018-08-16 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Antibodies to endoplasmin and their use
WO2016201337A1 (fr) * 2015-06-12 2016-12-15 Immungene, Inc. Molécules de fusion d'interféron et d'anticorps obtenues par génie génétique pour le traitement de cancers exprimant la protéine 94 régulée par le glucose (grp94)
WO2017019540A2 (fr) * 2015-07-24 2017-02-02 Yale University Inhibiteurs de glycosylation à liaison en n et procédés les utilisant

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SURIANO ROBERT, GHOSH SALIL K., ASHOK BADITHE T., MITTELMAN ABRAHAM, CHEN YUANGEN, BANERJEE ASESH, TIWARI RAJ K.: "Differences in Glycosylation Patterns of Heat Shock Protein, gp96: Implications for Prostate Cancer Prevention", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 65, no. 14, 15 July 2005 (2005-07-15), US , pages 6466 - 6475, XP055896151, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-04-4639 *

Similar Documents

Publication Publication Date Title
Zhou et al. Development of selective mono or dual PROTAC degrader probe of CDK isoforms
Tron et al. Discovery of Mcl-1-specific inhibitor AZD5991 and preclinical activity in multiple myeloma and acute myeloid leukemia
TWI711618B (zh) 選擇性ｇｒｐ９４抑制劑及其用途
Xu et al. Activation of Wnt/β‐catenin signalling is required for TGF‐β/Smad2/3 signalling during myofibroblast proliferation
Buraschi et al. Decorin antagonizes Met receptor activity and down-regulates β-catenin and Myc levels
Gao et al. Overcoming resistance to the THZ series of covalent transcriptional CDK inhibitors
Loskutov et al. LPA signaling is regulated through the primary cilium: a novel target in glioblastoma
Tang et al. Mcl-1 downregulation by YM155 contributes to its synergistic anti-tumor activities with ABT-263
Jabor Gozzi et al. Converting potent indeno [1, 2-b] indole inhibitors of protein kinase CK2 into selective inhibitors of the breast cancer resistance protein ABCG2
KR20200051684A (ko) 암 치료를 위한 shp2 억제제 조성물 및 방법
TW201900638A (zh) Ｋ－ｒａｓ調節劑
Yan et al. Molecular stressors engender protein connectivity dysfunction through aberrant N-glycosylation of a chaperone
Chen et al. mTOR promotes pituitary tumor development through activation of PTTG1
KR20210151820A (ko) 암을 치료하기 위한 조성물 및 방법
CN115103670A (zh) 转录增强相关结构域(tead)转录因子抑制剂及其用途
Ren et al. Anticancer efficacy of a nitric oxide‐modified derivative of bifendate against multidrug‐resistant cancer cells
Li et al. Novel-smoothened inhibitors for therapeutic targeting of naïve and drug-resistant hedgehog pathway-driven cancers
JP2021523942A (ja) 療法における使用のためのウロリシンａおよびその誘導体
Gasparoli et al. New pyrimido-indole compound CD-160130 preferentially inhibits the KV11. 1B isoform and produces antileukemic effects without cardiotoxicity
Abdelmoez et al. Screening and identification of molecular targets for cancer therapy
US20200033346A1 (en) Diagnostic and therapeutic methods for kras positive cancers
JP2016530273A (ja) 癌を治療するためのｈｄａｃ８阻害剤
Chai et al. Molecular stress-inducing compounds increase osteoclast formation in a heat shock factor 1 protein-dependent manner
De Martino et al. Radiation therapy promotes unsaturated fatty acids to maintain survival of glioblastoma
Zhang et al. Human CPTP promotes growth and metastasis via sphingolipid metabolite ceramide and PI4KA/AKT signaling in pancreatic cancer cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21829724

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21829724

Country of ref document: EP

Kind code of ref document: A1