WO2021261592A1 - Agent de liaison à une répétition - Google Patents

Agent de liaison à une répétition Download PDF

Info

Publication number
WO2021261592A1
WO2021261592A1 PCT/JP2021/024227 JP2021024227W WO2021261592A1 WO 2021261592 A1 WO2021261592 A1 WO 2021261592A1 JP 2021024227 W JP2021024227 W JP 2021024227W WO 2021261592 A1 WO2021261592 A1 WO 2021261592A1
Authority
WO
WIPO (PCT)
Prior art keywords
repeat
polyamide
type
cyclic
sequence
Prior art date
Application number
PCT/JP2021/024227
Other languages
English (en)
Japanese (ja)
Inventor
弘 杉山
俊和 板東
修司 池田
倫史 塩田
悌 矢吹
世煌 朝光
Original Assignee
国立大学法人京都大学
国立大学法人 熊本大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人京都大学, 国立大学法人 熊本大学 filed Critical 国立大学法人京都大学
Priority to JP2022532555A priority Critical patent/JPWO2021261592A1/ja
Publication of WO2021261592A1 publication Critical patent/WO2021261592A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4188—1,3-Diazoles condensed with other heterocyclic ring systems, e.g. biotin, sorbinil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/22—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains four or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the present disclosure relates to a repeat binder comprising a cyclic pyrrole-imidazole polyamide that targets a repeating sequence that causes repeat disease, and a pharmaceutical composition comprising the binder for the treatment or prevention of repeat disease.
  • Triplet repeat disease is a hereditary neurodegenerative disease caused by abnormal elongation of a repeating sequence (triplet repeat) consisting of three bases existing in a gene in the genome.
  • PI polyamide pyrrole-imidazole polyamide
  • P pyrrole-imidazole polyamide
  • P pyrrole and imidazole
  • imidazole P
  • imidazole facing each other by hairpin linkage
  • PI polyamide In PI polyamide, P / I pair is C (cytosine) / G (guanine) base pair, P / P pair is A (adenine) / T (thymine) or TA base pair, and I / P pair is G. -It recognizes C base pairs and can specifically bind to any double-stranded DNA sequence. Therefore, by designing PI polyamides in which pyrrole and imidazole are linked in various orders, any site on the genome can be targeted.
  • PI polyamide usually has a hairpin shape in which the C-terminal and N-terminal of two antiparallel PI polyamide chains are connected by ⁇ -aminobutyric acid ( ⁇ -turn). Further, a cyclic PI polyamide in which the hairpin was closed by the second ⁇ -turn was also synthesized (for example, Non-Patent Document 1).
  • Non-Patent Document 2 a conjugate of a long-chain hairpin-type PI polyamide targeting the CAG / CTG triplet repeat and chlorambucil has been reported.
  • Non-Patent Document 2 a conjugate of a long-chain hairpin-type PI polyamide targeting the CAG / CTG triplet repeat and chlorambucil has been reported.
  • Non-Patent Document 2 a conjugate of a long-chain hairpin-type PI polyamide targeting the CAG / CTG triplet repeat and chlorambucil has been reported (Non-Patent Document 2).
  • Non-Patent Document 2 a conjugate of a long-chain hairpin-type PI polyamide targeting the CAG / CTG triplet repeat and chlorambucil
  • the present disclosure utilizes PI polyamide to provide a repeat binder that binds to repeat sequences responsible for various neurological disorders, and thus, pharmaceutical compositions for treating and / or preventing repeat diseases.
  • the purpose is to provide.
  • a repeat binder comprising a cyclic pyrrole-imidazole polyamide that targets a repeat sequence that causes repeat disease, including A or T.
  • the cyclic pyrrole-imidazole polyamide has the following chemical formula: and The binder according to any one of (3) to (5), which is selected from the group consisting of the compounds indicated by.
  • the cyclic pyrrole-imidazole polyamide conjugated with the functional molecule has the following chemical formula:
  • a pharmaceutical composition for treating or preventing repeat diseases which comprises the binder according to any one of (1) to (7).
  • the repeat disease includes Huntington's disease, muscular tonic dystrophy type 1, Friocerebellar ataxia, spinocerebellar muscular atrophy, spinocerebellar degeneration type 1, spinocerebellar degeneration type 2, and spinocerebellar degeneration type 3. , Spinocerebellar degeneration type 6, Spinocerebellar degeneration type 7, Spinocerebellar degeneration 17
  • the pharmaceutical composition according to (8) which is selected from the group consisting of a disease-related disease type 2, spinocerebellar degeneration type 10, spinocerebellar degeneration type 31, and muscle tonic dystrophy type 2.
  • the repeat disease includes Huntington's disease, muscle tonic dystrophy type 1, Friocerebellar ataxia, spinocerebellar muscle atrophy, spinocerebellar degeneration type 1, spinocerebellar degeneration type 2, and spinocerebellar degeneration type 3.
  • Spinocerebellar degeneration type 6 Spinocerebellar degeneration type 7, Spinocerebellar degeneration 17
  • the method according to (10) which is selected from the group consisting of a related disease type 2, spinocerebellar degeneration type 10, spinocerebellar degeneration type 31, and muscle tonic dystrophy type 2.
  • a repeat binder comprising a cyclic pyrrole-imidazole polyamide targeting a repeating sequence consisting of several bases and having a high affinity for binding to the target.
  • a repeating sequence consisting of several bases can be a repeating sequence that causes repeat disease, and therefore, according to an exemplary embodiment of the present disclosure, a cyclic pyrrole that targets the repeating sequence that causes repeat disease.
  • a repeat binding agent containing imidazole polyamide and having high affinity for binding to a target is provided.
  • the repeat binder can be used to provide a pharmaceutical composition for treating or preventing repeat diseases.
  • FIG. 1 shows the melting temperature measurement result.
  • “hairpin”, “cyclic”, and “cyclic PEG” indicate “hairpin type PI polyamide”, “cyclic PI polyamide”, and “cyclic PI polyamide-PEG”, respectively.
  • FIG. 2 shows the melting temperature measurement result.
  • “hairpin”, “cyclic”, and “cyclic PEG” indicate “hairpin type PI polyamide”, “cyclic PI polyamide”, and “cyclic PI polyamide-PEG”, respectively.
  • FIG. 3 shows the melting temperature measurement result. In the figure, “hairpin”, “cyclic”, and “cyclic PEG” indicate “hairpin type PI polyamide”, “cyclic PI polyamide”, and “cyclic PI polyamide-PEG”, respectively.
  • FIG. 4 shows suppression of triplet repeat RNA expression by cyclic PI polyamide.
  • FIG. 5 shows the formation of abnormal RNA aggregates in the nucleus of cells derived from CDM patients.
  • FIG. 6 shows the expression level of abnormal RNA aggregates in the nucleus of cells derived from CDM patients.
  • repeat binder refers to a compound that binds to a repeating sequence that causes repeat disease.
  • "Repeat disease” is a disease caused by abnormal elongation of a repeating sequence consisting of several bases existing in a gene in the genome, and examples thereof include hereditary diseases, especially hereditary neurodegenerative diseases, to date. Various diseases are known. Repeat disease can occur, for example, by suppressing transcription by aberrant extension of a repeat sequence, or by transcribing and translating an abnormally elongated repeat sequence to produce a toxic protein, or by transcribing an abnormally elongated repeat sequence. It is caused by the production of toxic RNA.
  • the repeat binder of the present invention contains a cyclic PI polyamide and binds to a target repeat sequence by the sequence-specific recognition / binding ability of the PI polyamide.
  • PI polyamide usually has a ⁇ -aminobutyric acid moiety as a linker (hereinafter referred to as “ ⁇ -linker” or “ ⁇ -turn”) and is completely folded to form a U-shaped conformation (hairpin type).
  • ⁇ -linker ⁇ -linker
  • PI polyamide can also take an annular conformation in which the ends of the hairpin structure are ring-closed by a second ⁇ -turn.
  • cyclic PI polyamide is used.
  • PI polyamide in the above conformation, two chains containing P and I are lined up in parallel with the ⁇ -linker in between.
  • the pair consisting of P and / or I facing each other of these two chains (hereinafter, also referred to as "pyrrole-imidazole pair") is a specific combination (P / I pair, I / P pair, or P / P pair).
  • PI polyamide binds to specific base pairs in DNA with high affinity.
  • P / I pairs can bind to C / G base pairs
  • I / P pairs can bind to G / C base pairs.
  • P / P pairs can bind to both A / T base pairs and T / A base pairs.
  • the PI polyamide may contain 3-hydroxypyrrole (Hp) and ⁇ -alanine residues in addition to P and I, and P can be replaced with Hp or ⁇ -alanine.
  • Hp / P pairs can bind to TA base pairs.
  • P / Hp pairs can bind to AT base pairs.
  • the ⁇ -alanine / ⁇ -alanine pair can bind to TA base pair or AT base pair.
  • the ⁇ -alanine / I pair can bind to CG base pair.
  • the I / ⁇ -alanine pair can bind to G ⁇ C base pair.
  • the ⁇ -alanine / P pair and the P / ⁇ -alanine pair can bind to TA base pair or AT base pair.
  • the ⁇ -turn moiety can bind to TA base pair or AT base pair.
  • the composition, order, combination, etc. of the pair formed by P, I, Hp, and / or ⁇ -alanine it is possible to design a PI polyamide that recognizes and binds to a desired DNA sequence. ..
  • the methyl group on the nitrogen at the 1-position of P and I constituting the cyclic PI polyamide may be replaced with hydrogen or an alkyl group other than the methyl group.
  • alkyl groups other than methyl groups are straight chain, branched or cyclic saturated or unsaturated alkyl groups having 2 to 10 carbon atoms, preferably straight chain or branched chains having 2 to 5 carbon atoms.
  • Examples include linear, branched or cyclic saturated or unsaturated alkyl groups, such as ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl and the like.
  • the alkyl group including the methyl group may be substituted, and for example, methylene in the alkyl group may be substituted with oxygen or the like.
  • the 3-position of P constituting the PI polyamide may be substituted with a hydroxy group.
  • P or "pyrrole unit” and “I” or “imidazole unit” are N-substituted or N-unsubstituted pyrrole units, 3-hydroxypyrrole units, and N-substituted as described above. Or includes N-unsubstituted imidazole units.
  • the ⁇ -turn moiety of the cyclic PI polyamide may be substituted, preferably having a substituent at the ⁇ -position or ⁇ -position of the ⁇ -turn moiety, and more preferably the ⁇ -turn moiety. It may have a substituent at the ⁇ -position of.
  • the cyclic PI polyamide may also be substituted with one or both of the two ⁇ -turns. If both of the two ⁇ -turn moieties of the cyclic PI polyamide have substituents, the substituents at each ⁇ -turn may be the same or different.
  • the bonding position of the substituent in each ⁇ -turn may be the same or different.
  • the substituent include, but are not limited to, an amino group, an acetylamino group, a dimethylaminopropylamino group, a hydroxyl group, a methoxy group and the like.
  • the ⁇ -turn moiety may be an N- ⁇ -N- ⁇ -diaminobutyric acid residue or an N- ⁇ -N- ⁇ -diaminobutyric acid residue in which the ⁇ or ⁇ position is substituted with an amino group. good.
  • the cyclic PI polyamide used in the present disclosure is designed to target any repeating sequence that causes repeat disease.
  • the repeat sequence is usually a DNA sequence consisting of several nucleotides, for example, but is not limited to, a DNA sequence consisting of 2 to 10, 2 to 9, or 2 to 8 nucleotides. May be good.
  • the repeat sequence is a DNA sequence consisting of 2, 3, 4, 5, 6, 7, or 8 nucleotides.
  • targeting with respect to PI polyamide means that the PI polyamide recognizes and binds to a part or all of the repeating sequence. Conversely, the PI polyamide has a DNA sequence recognition portion corresponding to a part or all of the repeating sequence.
  • the repeating sequence that can be the target of the cyclic PI polyamide is not particularly limited as long as it is a repeating sequence that causes any repeat disease and is a sequence containing A or T.
  • the "repeated sequence that causes repeat disease” is a sequence that causes repeat disease due to abnormal elongation of the repeat sequence.
  • the repeating sequence may be, for example, one that causes a disease by suppressing transcription due to its abnormal elongation, or one that causes a disease by transcribing and translating an abnormally elongated repeating sequence to produce a toxic protein. Examples include, but are not limited to, those that cause disease by transcribing elongated repeat sequences to produce toxic RNA.
  • the abnormal elongation means that the number of repetitions of the repeated sequence in the target disease patient is larger than that in the healthy person or the person who does not suffer from the target disease.
  • the repeating sequence that can be a target of the cyclic PI polyamide may be, but is not limited to, a sequence containing CAG, CTG, GAA, ATTCT, TGGAA, CCTG and the like.
  • repeat disease examples include, but are not limited to, Huntington's disease (HD), spinocerebellar atrophy (SBMA), spinocerebellar degeneration (SCA) [eg, spinocerebellar degeneration type 1 (SCA1), Spinocerebellar degeneration type 2 (SCA2), spinocerebellar degeneration type 3 (SCA3), spinocerebellar degeneration type 6 (SCA6), spinocerebellar degeneration type 7 (SCA7), spinocerebellar degeneration type 8 (SCA8), Spinocerebellar degeneration type 10 (SCA10), spinocerebellar degeneration type 12 (SCA12), spinocerebellar degeneration type 17 (SCA17), spinocerebellar degeneration type 31 (SCA31), etc.], dentate nucleus red nucleus paleosphere Louis body degeneration (DRPLA), muscle tonic dystrophy [eg, muscle tonic dystrophy type 1 (DM1), muscle tonic dystrophy type 2 (DM
  • Myotonic dystrophy includes both congenital, juvenile, and adult myotonic dystrophy.
  • Huntington's disease repeats the CAG sequence about 36 to 121 times
  • spinocerebellar atrophy SBMA
  • spinocerebellar degeneration type 1 SCA1
  • SCA1 spinocerebellar degeneration type 1
  • SCA3 spinocerebellar degeneration type 3
  • Type 6 repeats the CAG sequence about 19 to 33 times
  • spinocerebellar degeneration type 7 repeats the CAG sequence about 37 to 306 times
  • spinocerebellar degeneration type 17 repeats the CAG sequence about. Repeat 47-63 times
  • dentate nucleus red nucleus paleosphere Louis body degeneration repeats CAG sequence about 49-88 times
  • spinocerebellar degeneration type 12 repeats CAG sequence about 51-78 times. repeat.
  • Myotonic dystrophy type 1 repeats CTG sequence 50 times or more
  • spinocerebellar degeneration type 8 repeats CTG sequence about 71 to 1300 times
  • Huntington's disease-related disease type 2 repeats CTG sequence. Is repeated 41 times or more.
  • Friedreich's ataxia FRDA
  • Spinocerebellar degeneration type 10 (SCA10) repeats the ATTCT sequence approximately 280-4500 times.
  • Spinocerebellar degeneration type 31 (SCA31) repeats the TGGAA sequence about 500-760 times.
  • Myotonic dystrophy type 2 repeats the CCTG sequence about 75 to 11000 times.
  • the number of pyrrole-imidazole pairs formed by P, I, Hp, and / or ⁇ -alanine constituting the cyclic PI polyamide used in the present disclosure may be one or more, and is not particularly limited. It may be appropriately determined according to the above-mentioned repeating sequence to be targeted.
  • the number of pyrrole-imidazole pairs constituting the cyclic PI polyamide used may be 2 to 15.
  • the number of pyrrole-imidazole pairs constituting the cyclic PI polyamide used may be 3-12.
  • the number of pyrrole-imidazole pairs constituting the cyclic PI polyamide used may be 4-10, for example 5, 6, 7, 8 or 9.
  • a PI polyamide having a DNA sequence recognition moiety having a pyrrole-imidazole pair number of 5 or more it is preferably designed to contain 1 or more ⁇ -alanine.
  • pyrrole-imidazole pair includes a pair consisting of any combination of P, I, Hp, and ⁇ -alanine.
  • the pyrrole-imidazole pair constituting the cyclic PI polyamide is determined based on the target repeat sequence. That is, based on the target repeat sequence, the recognition sequence of PI polyamide is set so that the 5'and 3'ends are A or T, and the pyrrole-imidazole pair corresponding to the recognition sequence is selected.
  • cyclic PI polyamides are designed to recognize sequences that repeat the target repeat sequence one or more times. For example, if the target repeat sequence is "CAG”, the cyclic PI polyamide may be designed to recognize sequences such as "AGCAGCA", "AGCAGCAGCA”, etc., where the target repeat sequence is repeated more than once.
  • the cyclic PI polyamide may be designed to recognize a partial sequence of a sequence in which the target repeat sequence is repeated twice. For example, if the target repeat sequence is "CCTG”, the cyclic PI polyamide may be designed to recognize "TGCCT” which is a partial sequence of "CCTGCCTG” where the target repeat sequence is repeated twice. Further, when the target repeat sequence is a sequence consisting of 4 or more nucleotides, a cyclic PI polyamide containing a pyrrole-imidazole pair corresponding to the partial sequence of the sequence may be designed. For example, if the target repeat sequence is "ATTCT”, the cyclic PI polyamide may be designed to recognize "ATT", "TCT” or “TTCT”. Also, for example, if the target repeat sequence is "TGGAA", the cyclic PI polyamide may be designed to recognize "TGGA”.
  • Cyclic PI polyamide can be produced by a known method.
  • a molecule that produces a hairpin-type PI polyamide by a known solid-phase synthesis method dissolves it in dimethylformamide (DMF), and uses a combination of pentafluorophenyldiphenylphosphinate (FDPP) and N, N-diisopropylethylamine (DIEA). It can be manufactured by cyclization by internal condensation.
  • DPP pentafluorophenyldiphenylphosphinate
  • DIEA N, N-diisopropylethylamine
  • the solid-phase synthesis method for example, a solid-phase synthesis method using Fmoc (9-fluorenylmethoxycarbonyl) (Fmoc solid-phase synthesis method) can be used.
  • cyclic PI polyamides are shown in Tables 1-1 to 1-3.
  • the cyclic PI polyamide may be conjugated (complexed) with a functional molecule.
  • the "functional molecule” is not particularly limited as long as it is a molecule having some function.
  • functional molecules include, but are not limited to, fluorescent molecules, biotin, polyethylene glycol, aminopolyethylene glycol and the like.
  • functional molecules include, but are not limited to, substances that affect genes containing the sequence when PI polyamide binds to the target DNA sequence, such as, but not limited to, transcriptional activators, transcriptional repression. Substances and the like can be mentioned.
  • fluorescent molecules examples include fluorescein, fluorescein derivatives (for example, fluorescein isothiocyanate, etc.), rhodamine dyes, TAMRA (5-carboxytetramethylrhodamine), cyanine dyes, ATTO dyes, Alexa Fluor dyes, BODIPY, and the like. However, but not limited to these.
  • transcriptional activators include bromodomain inhibitors (eg, JQ1, 5-isoxazolyl-benzoimidazole compounds, I-BET762, OTX015, etc.), histone acetylase (HAT) activators [eg, N- (eg, N- (eg, N-). 4-Chloro-3- (trifluoromethyl) phenyl) -2-ethoxybenzamide (CTB), etc.], histone deacetylase (HDAC) inhibitor [for example, suberoylanilide hydroxamic acid (SAHA), etc.], etc.
  • HDAC histone deacetylase
  • SAHA suberoylanilide hydroxamic acid
  • the transcription inhibitor examples include, but are not limited to, an alkylating agent and the like.
  • the alkylating agent is not particularly limited, but is preferably one having low or no cytotoxicity in consideration of its use in a pharmaceutical composition described later.
  • alkylating agents include, but are not limited to, chlorambucil, duocarmycin, seco-CBI (1-chloromethyl-5-hydroxy-1,2-dihydro-3H-benzo].
  • alkylating agents include, but are not limited to, chlorambucil, duocarmycin, seco-CBI (1-chloromethyl-5-hydroxy-1,2-dihydro-3H-benzo].
  • e] Indole Indole
  • CBI 1,2,9,9a-tetrahydrocyclopropane
  • benzo benzo
  • pyrolobenzodiazepines nitrogen mustards and the like.
  • Chlorambucil, seco-CBI, and CBI given as examples of the above-mentioned alkylating agent are represented by the following chemical formulas.
  • Conjugation of the cyclic PI polyamide with the functional molecule can be performed according to a known coupling method or synthetic method.
  • the functional molecule is attached to the ⁇ -turn moiety of the cyclic PI polyamide, preferably the ⁇ - or ⁇ -position of the ⁇ -turn moiety.
  • the functional molecule is also bound to one or both of the two ⁇ -turns of the cyclic PI polyamide. If the functional molecule binds to both of the two ⁇ -turn moieties of the cyclic PI polyamide, the molecule that binds to each ⁇ -turn may be the same or different.
  • the binding position of the molecule in each ⁇ -turn may be the same or different.
  • the cyclic PI polyamide and the functional molecule may be directly bonded by, for example, an amide bond, a phosphodisulfide bond, an ester bond, a coordination bond, an ether bond, or the like, or may be bonded via a linker.
  • the linker is not particularly limited as long as it does not interfere with the action of the functional molecule and does not interfere with the recognition of the target sequence.
  • the linker examples include, but are not limited to, polyethylene glycol linkers, peptide linkers, alkyl linkers, polyether linkers and the like.
  • the functional molecule may be conjugated to the cyclic PI polyamide via an amide bond with an amino group substituted at the ⁇ - or ⁇ -position of the ⁇ -turn of the cyclic PI polyamide.
  • the functional molecule is conjugated via an amide bond with a polyethylene glycol residue added by an amide bond with an amino group substituted at the ⁇ - or ⁇ -position of the ⁇ -turn of the cyclic PI polyamide. May be good.
  • the complex (conjugate) of the cyclic PI polyamide and the functional molecule may be in the form of a pharmacologically acceptable salt.
  • a pharmacologically acceptable salt such as hydrochloride, sulfate, phosphate or hydrobromide, or acetate, fumarate, maleate, oxalate, citrate, methanesulfonate, benzenesulfonate.
  • organic acid salts such as acid salts or toluene sulfonates.
  • the substituent or functional molecule is ⁇ -turned to take an R or S configuration. It may be bonded to a portion.
  • the substitution or conjugate configuration (R or S) of each ⁇ -turn moiety is the same. It may or may not be different.
  • the cyclic PI polyamide has a substituent at the ⁇ -turn moiety or is conjugated to a functional molecule, it may be present in the form of enantiomers or diastereomers or mixtures thereof. These isomers can be separated by methods well known in the art, such as chromatography or fractional crystallization.
  • compositions include the repeat binder as an active ingredient.
  • the pharmaceutical composition may be the repeat binder itself, or may contain a pharmaceutically acceptable carrier or additive in addition to the repeat binder, as described below.
  • the pharmaceutical composition may comprise a repeat binder comprising a complex of cyclic PI polyamide and a functional molecule.
  • the functional molecule is as described above, and may be appropriately selected depending on the repeat disease targeted for treatment and / or prevention, for example.
  • a complex of cyclic PI polyamide and a transcriptional activator is useful in the treatment and / or prevention of repeat disease caused by inhibition of transcription by aberrant extension of the repeat sequence.
  • repeat diseases include Friedreich's ataxia and the like.
  • the complex of cyclic PI polyamide and a transcriptional repressor is a repeat disease caused by toxic RNA produced by transcription of an abnormally elongated repeat sequence, or a toxic protein produced by transcription and translation of an abnormally elongated repeat sequence. It is useful for the treatment and / or prevention of repeat diseases caused by.
  • Such repeat diseases include Huntington's disease, myotonic dystrophy, and the like.
  • the cyclic PI polyamide itself can inhibit the transcription of the gene containing the sequence by binding to the target DNA sequence, for example, it affects the transcription activity of the unconjugated cyclic PI polyamide and the target gene.
  • Cyclic PI polyamides conjugated with non-functional molecules are also repeat diseases caused by toxic RNA caused by transcription of abnormally elongated repeat sequences, or repeats caused by toxic proteins caused by transcription and translation of abnormally elongated repeat sequences. It is useful for the treatment and / or prevention of diseases.
  • the pharmaceutical composition in the present disclosure contains a repeat binder that binds to a repeat sequence that causes repeat disease, it binds to the repeat sequence on the genome and affects the transcription of the sequence.
  • various repeat diseases can be treated and prevented.
  • treatment also includes alleviation and alleviation of pathological symptoms.
  • the subject of administration of the pharmaceutical composition in the present disclosure is any organism that develops or is at risk of developing repeat disease and that utilizes double-stranded DNA for biological control, especially mammals (eg, humans, rats, rabbits). , Sheep, pigs, cows, cats, dogs, monkeys, etc.), and can be preferably used for humans.
  • mammals eg, humans, rats, rabbits.
  • the target disease of the pharmaceutical composition in the present disclosure is, as described in the section of "1.
  • Repeat Binder a repeat disease caused by a repeat sequence that can be a target of the cyclic PI polyamide, and is not particularly limited.
  • a repeat disease caused by a repeat sequence that can be a target of the cyclic PI polyamide, and is not particularly limited.
  • Huntington's disease HD
  • SBMA spinocerebellar atrophy
  • SCA1 spinocerebellar degeneration type 1
  • SCA2 spinocerebellar degeneration type 2
  • Muscle tonic dystrophy [for example, muscle tonic dystrophy type 1 (DM1), muscle tonic dystrophy type 2 (DM2), etc.], Huntington's disease-related disease type 2 (HDL2), Friedrich's imbalance (FRDA), etc. Be done. Myotonic dystrophy includes both congenital, juvenile, and adult myotonic dystrophy.
  • the pharmaceutical composition in the present disclosure may be in either oral or parenteral dosage form.
  • dosage forms can be formulated according to a conventional method, and may contain a pharmaceutically acceptable carrier or additive.
  • Such carriers and additives include water, acetic acid, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium carboxymethyl cellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, Carboxymethyl starch sodium, pectin, methyl cellulose, ethyl cellulose, xanthan gum, arabic rubber, casein, agar, polyethylene glycol, diglycerin, glycerin, propylene glycol, vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose. , Surfactants and the like that are acceptable as pharmaceutical additives.
  • the additive is selected alone or in combination from the above depending on the dosage form of the pharmaceutical composition in the present disclosure.
  • the dosage form is tablets, capsules, fine granules, powders, granules, liquids, syrups, sprays, coatings, eye drops, external preparations, etc., or suitable dosage forms.
  • an injection type or the like can be mentioned.
  • the injection type it can be administered systemically or locally by, for example, intravenous injection such as infusion, subcutaneous injection, intraperitoneal injection, intratumoral injection, or the like.
  • the pharmaceutical composition in the present disclosure when used as an injectable preparation, is dissolved in a solvent (for example, physiological saline, buffer solution, dextrose solution, 0.1% acetic acid, etc.) and an appropriate additive (human) thereof.
  • a solvent for example, physiological saline, buffer solution, dextrose solution, 0.1% acetic acid, etc.
  • an appropriate additive human
  • Serum albumin, PEG, mannose-modified dendrimer, cyclodextrin conjugate, etc. can be added.
  • it may be freeze-dried to form a dosage form that dissolves before use.
  • sugar alcohols such as mannitol and glucose and sugars can be used.
  • the dose of the pharmaceutical composition in the present disclosure varies depending on age, gender, symptom, route of administration, frequency of administration, and dosage form, and is appropriately determined by those skilled in the art.
  • Example 1 Synthesis of Cyclic PI Polyamides Cyclic PI polyamides targeting CAG repeat sequences by continuous binding of five pyrrole-imidazole pairs, conjugates of the cyclic PI polyamides with aminopolyethylene glycols, and as a control. Hairpin-type PI polyamides for the same target were synthesized (Table 2).
  • Fmoc solid-phase synthesis of PI polyamide The solid-phase synthesis of each PI polyamide was carried out by a known Fmoc solid-phase synthesis method.
  • the constituent blocks used were FmocHN-Py-CO 2 H, FmocHN-Im-CO 2 H, FmocHN-Py- ⁇ -CO 2 H, and FmocHN-Boc- (R) - ⁇ -aminobutyric acid.
  • Each constituent block was continuously introduced into FmocHN-Py-trityl resin or FmocHN-Py-oxime resin.
  • the N-terminus of the hairpin-type PI polyamide was capped with an acetyl group using 20% Ac 2 O in DMF.
  • Synthetic DIEA (28 ⁇ L, 164.7 ⁇ mol) of cyclic PI polyamide-PEG [cyclic (-ImPy ⁇ ImPy- (R) ⁇ -NH-miniPEG-NH2 ⁇ -ImPy ⁇ ImPy- (R) ⁇ -NH-miniPEG-NH2 ⁇ -)], FDPP (31.0 mg, 80.7 ⁇ mol) and Fmoc-mini-PEG® (31.0 mg, 80.4 ⁇ mol; manufactured by PEPTIDES INTERNATIONAL) of crude PI polyamide (36.1 mg) in DMF (361 ⁇ L). Added to the solution. The mixture was stirred at room temperature for 20 hours.
  • the reaction solution was added dropwise to diethyl ether, centrifuged, and vacuum dried to obtain a powder (49.7 mg, 24.1 ⁇ mol). 1000 ⁇ L of a 20% piperidine / DMF solution was added to this powder, and the mixture was stirred at room temperature for 30 minutes. The reaction solution was added dropwise to diethyl ether, centrifuged, and vacuum dried to obtain a powder (34.9 mg, 21.6 ⁇ mol). It was purified by flash column to give PI polyamide conjugate as a pale yellow powder. (11.0 mg, 6.8 ⁇ mol).
  • MALDI-TOF MS m / z C 70 H 93 N 28 O 18 + [M + H] + calculated value 1613.71, measured value 1614.20.
  • the four DNA oligomers used in the analysis (5'-CGAGCAGCCG-3' / 3'-GCTCGTCGTGC-5', 5'-(CAG) 10 -3'and 5'-(CTG) 10 -3') were Sigma. I bought it from. An aqueous solution of 2.5 mM sodium chloride and 10 mM Tris-HCl (pH 7.5) containing 0.375% v / v DMSO was used as the analytical buffer for Tm analysis. The concentration of double-stranded DNA was 2.5 ⁇ M. Prior to analysis, annealing was performed from 95 ° C to 20 ° C at a rate of 1.0 ° C / min.
  • each PI polyamide (cyclic PI polyamide 5 ⁇ M, cyclic PI polyamide-PEG 5 ⁇ M, hairpin)
  • type PI polyamide 3.75 ⁇ M
  • 0.5% v / v DMSO was added instead of PI polyamide.
  • Example 3 Binding affinity experiment 2 (SPR analysis) The binding affinities of the three types of PI polyamides produced in Example 1 were compared. Biotinylated hairpin DNA containing the recognition sequence of these PI polyamides (5'-AGCAGCA-3') was immobilized on a sensor chip by forming a complex of biotin and streptavidin. Binding properties were evaluated by SPR (Surface Plasmon Resonance).
  • the concentration of PI polyamide was measured as follows.
  • a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific Inc.) was used to measure the absorbance.
  • the SPR experiment was carried out on a Biacore X device (manufactured by GE Healthcare).
  • Biotinylated hairpin DNA (5'-biotin-CGCGAGCAGCAGCGTTTTTCGGCGTGCTGCTCGCG-3') was purchased from SIGMA-Aldrich.
  • the streptavidin-functionalized SA sensor chip was purchased from Biacore.
  • Biotinylated DNA was immobilized on the sensor chip to obtain the desired fixation level (increased by about 900 RU).
  • the SPR assay was performed using HBS-EP buffer (10 mM HPES (pH 7.4), 150 mM NaCl, 3 mM EDTA, and 0.005% Surfactant P20) with 0.1% DMSO at 25 ° C.
  • PI polyamide solutions of varying concentrations were prepared in buffer containing 0.1% DMSO and injected at a flow rate of 20 ⁇ L / min.
  • a 1: 1 binding model with mass transfer (1: 1) using the BIA evolution 4.1 program to calculate the binding rate (ka), dissociation rate (kd), and dissociation constant (KD kd / ka).
  • Data processing was performed using binding model with mass transfer).
  • ka, kd and KD values could be obtained for the hairpin type PI polyamide, but the measured values could not be calculated for the cyclic PI polyamide and the cyclic PI polyamide-PEG conjugate. It is considered that the binding affinity is very high.
  • Example 4 Effect of cyclic PI polyamide targeting CTG repeating sequence
  • CDM1 The causative gene mutation in CDM1 is an abnormal CTG repeat elongation present in the 3'untranslated region of the myotonin protein kinase (DMPK) gene.
  • CDM1 develops when the number of repeats is 1000 or more. It is believed that the complex of CUG-RNA derived from extended CTG repeat and its binding protein forms abnormal RNA aggregates and is the cause of pathological conditions. Therefore, it was investigated whether the production of RNA aggregates could be inhibited by suppressing the transcription of abnormal CUG-RNA using a cyclic PI polyamide targeting CTG repeat.
  • cyclic PI polyamide Suppression test of CUG repeat RNA expression by cyclic PI polyamide
  • the above cyclic PI polyamide (0.1 ⁇ M, 1 ⁇ M, 5 ⁇ M) was administered to mouse neuroblasts overexpressing the CTG700 repeat gene.
  • Neuro-2a mouse neuroblastoma cells (CCL-131, American Type Culture Collection (ATCC)) are subjected to 10% heat-inactivated FBS and penicillin / streptomycin (100 units / 100 ⁇ g ml -1 ) ( It was grown in DMEM (SIGMA D5796) supplemented with Gibco 15140122) in a 5% CO 2 incubator at 37 ° C.
  • Transfections were performed using Lipofectamine 2000 (Invitrogen 11668019) transfection reagents according to the manufacturer's protocol.
  • the transfected plasmid was a CTG700 repeat inserted into the pCMV-Nluc-3xFlag vector.
  • Eight hours after transfection, cells were treated with cyclic PI polyamide (final concentration 0.1, 1 or 5 ⁇ M) for 48 hours before subject to RT-qPCR analysis.
  • RT-qPCR analysis was performed as follows. Total RNA was purified from Neuro-2a cells using SuperPrepII Cell Lysis & RT Kit for qPCR (TOYOBO SCQ-401) according to the manufacturer's protocol, and then RT- using gene-specific primers (Table 6). It was attached to PCR. RT-qPCR analysis was performed on a BIO-RAD CFX Connect Real-Time System using KOD SYBR qPCR Mix (TOYOBO QKD-201). After standardization for SV40, gene expression (CTG700-Nluc mRNA) was evaluated using the difference ( ⁇ CT method) in the standardized CT (cycle threshold). The change multiple was calculated by 2- ⁇ CT. As a result, RNA expression of CUG700 repeat was significantly suppressed in a concentration-dependent manner (Fig. 4).
  • RNA aggregates are specifically formed in the nucleus of fibroblasts derived from CDM1 patients. Therefore, cyclic PI polyamide was administered to CDM1 pathological cells, and CUG nuclear aggregates (nuclear foci) were evaluated by fluorescence in situ hybridization (FISH). Briefly, CDM1 pathological cells grown to 80% confluence as described above were treated with 5 ⁇ M final concentration cyclic PI polyamide for 48 hours. After discarding the medium, cells were rinsed with PBS and treated with 4% paraformaldehyde in PBS at room temperature for 10 minutes. The cells were washed 3 times with PBS for 5 minutes at room temperature and permeabilized with 0.5% Triton X-100 in PBS for 10 minutes at room temperature.
  • FISH fluorescence in situ hybridization
  • the cells were then washed 3 times with PBS for 5 minutes at room temperature. Prior to hybridization, the cells were prehybridized in 40% formamide in 2X SSC buffer for 10 minutes at room temperature. Hybridization was performed using a 1nM probe [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (5'Cyanine5)] at 37 ° C. in a hybridization buffer (40% formamide, 2xSSC buffer, 10% dextran sulfate, 2 mM vanadyl sulfate, 1 mg / mL yeast tRNA) for 6 hours. It was carried out. The cells were washed 3 times with 40% formamide in 1X SSC for 5 minutes at 37 ° C.
  • RNA foci were counted using a cell analyzer 6000 (GE). As a result, the formation of abnormal RNA aggregates was significantly suppressed (FIGS. 5 and 6).
  • SEQ ID NO: 1 Forward Primer Nluc SEQ ID NO: 2: Reverse Primer Nluc SEQ ID NO: 3: Forward Primer HPRT1 SEQ ID NO: 4: Reverse Primer HPRT1 SEQ ID NO: 5: DNA oligomer SEQ ID NO: 6: DNA oligomer SEQ ID NO: 7: DNA oligomer SEQ ID NO: 8: DNA oligomer SEQ ID NO: 9: Hairpin DNA oligomer SEQ ID NO: 10: Probe

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Neurology (AREA)
  • Epidemiology (AREA)
  • Neurosurgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Psychiatry (AREA)
  • Psychology (AREA)
  • Medicinal Preparation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne : un agent de liaison à une répétition contenant un polyamide pyrrole-imidazole cyclique qui cible une séquence répétitive qui comprend A ou T et qui provoque des maladies liées à une répétition ; et une composition pharmaceutique contenant ledit agent de liaison.
PCT/JP2021/024227 2020-06-26 2021-06-25 Agent de liaison à une répétition WO2021261592A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2022532555A JPWO2021261592A1 (fr) 2020-06-26 2021-06-25

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2020110752 2020-06-26
JP2020-110752 2020-06-26

Publications (1)

Publication Number Publication Date
WO2021261592A1 true WO2021261592A1 (fr) 2021-12-30

Family

ID=79281450

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2021/024227 WO2021261592A1 (fr) 2020-06-26 2021-06-25 Agent de liaison à une répétition

Country Status (2)

Country Link
JP (1) JPWO2021261592A1 (fr)
WO (1) WO2021261592A1 (fr)

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HIROSE YUKI, ASAMITSU SEFAN, BANDO TOSHIKAZU, SUGIYAMA HIROSHI: "Control of Forward/Reverse Orientation Preference of Cyclic Pyrrole–Imidazole Polyamides", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, AMERICAN CHEMICAL SOCIETY, vol. 141, no. 33, 21 August 2019 (2019-08-21), pages 13165 - 13170, XP055893650, ISSN: 0002-7863, DOI: 10.1021/jacs.9b05516 *
KANG JEENJOO SOPHIA: "Targeting DNA repeat sequences with Py-Im polyamides Thesis by", DISSERTATION, 27 March 2015 (2015-03-27), pages 98 - 113, XP055893646 *
SEFAN ASAMITSU, YUSUKE KAWAMOTO, FUMITAKA HASHIYA, KAORI HASHIYA, MAKOTO YAMAMOTO, SEIICHIRO KIZAKI, TOSHIKAZU BANDO, HIROSHI SUGI: "Sequence-specific DNA alkylation and transcriptional inhibition by long-chain hairpin pyrrole–imidazole polyamide–chlorambucil conjugates targeting CAG/CTG trinucleotide repeats", BIOORGANIC, ELSEVIER, AMSTERDAM, NL, vol. 22, no. 17, 1 September 2014 (2014-09-01), AMSTERDAM, NL, pages 4646 - 4657, XP055611679, ISSN: 0968-0896, DOI: 10.1016/j.bmc.2014.07.019 *
TOSHIKI TAKAGAKI; TOSHIKAZU BANDO; MASAAKI KITANO; KAORI HASHIYA; GENGO KASHIWAZAKI; HIROSHI SUGIYAMA;: "Evaluation of PI polyamide conjugates with eight-base pair recognition and improvement of the aqueous solubility by PEGylation", BIOORGANIC, ELSEVIER, AMSTERDAM, NL, vol. 19, no. 19, 5 August 2011 (2011-08-05), AMSTERDAM, NL, pages 5896 - 5902, XP028294130, ISSN: 0968-0896, DOI: 10.1016/j.bmc.2011.08.009 *
YU ZUTAO; PANDIAN GANESH N.; HIDAKA TAKUYA; SUGIYAMA HIROSHI: "Therapeutic gene regulation using pyrrole–imidazole polyamides", ADVANCED DRUG DELIVERY REVIEWS, ELSEVIER, AMSTERDAM , NL, vol. 147, 10 February 2019 (2019-02-10), Amsterdam , NL , pages 66 - 85, XP085927736, ISSN: 0169-409X, DOI: 10.1016/j.addr.2019.02.001 *

Also Published As

Publication number Publication date
JPWO2021261592A1 (fr) 2021-12-30

Similar Documents

Publication Publication Date Title
AU2013276480B2 (en) N-substituted second generation derivatives of antifungal antibiotic Amphotericin B and methds of their preparation and application
JP2002515063A (ja) 予め決定されたｄｎａ配列にナノモル以下の濃度で結合するポリアミド
JP2005508832A (ja) 間隔を開けてアルギニン部分を含むトランスポーター
US11547681B2 (en) N-acylethanolamide derivatives and uses thereof
US20230285573A1 (en) Methods and compounds for the treatment of genetic disease
EP4234553A2 (fr) Procédés et composés pour le traitement d'une maladie génétique
US7049061B1 (en) Stereochemical control of the DNA binding affinity, sequence specificity, and orientation-preference of chiral hairpin polyamides in the minor groove
WO2015053413A1 (fr) Nouvel agent d'alkylation pour l'alkylation de cible à mutation oncogène pilote
JP2000510129A (ja) ジスタマイシン誘導体、その調製方法並びに抗腫瘍薬及び抗ウイルス薬としてのその使用
JPWO2005087762A1 (ja) Ｄｎａの特定塩基配列をアルキル化する新規インドール誘導体ならびにそれを用いたアルキル化剤および薬剤
CN111943892A (zh) 组蛋白去乙酰化酶亚型抑制剂硫乙酰芳胺类化合物及用途
WO2021261592A1 (fr) Agent de liaison à une répétition
US20210205348A1 (en) Methods for the Treatment of Bladder Cancer
EP4234550A2 (fr) Procédés et composés pour le traitement d'une maladie génétique
WO2015153560A1 (fr) Hybrides peptide-peptoïde stabilisés et leurs utilisations
WO2019230669A1 (fr) Composition pharmaceutique ciblant une séquence de liaison au runx, et inhibiteur du runx
US20240124491A1 (en) Methods and compounds for treating friedreich's ataxia
EP2336108A1 (fr) Composés hybrides tripyrrol-octaarginine et utilisation de ceux-ci en tant que médicament pour traiter le cancer et les maladies microbiennes
EP4365590A2 (fr) Agent ciblant l'adn d'organite à double membrane
EP4257128A2 (fr) Procédés et composés pour le traitement d'une maladie génétique
EP3049420B1 (fr) Dérivés de thiéno[2,3-e]indole en tant que nouveaux agents antitumoraux
JP2002523382A (ja) 薬物ターゲティング
WO2021080020A1 (fr) Amplificateur de l'administration d'acide nucléique
US20230285569A1 (en) Methods and compounds for the treatment of fragile x
CA3229661A1 (fr) Composes et procedes pour sauter l'exon 44 dans la dystrophie musculaire de duchenne

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21830068

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2022532555

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21830068

Country of ref document: EP

Kind code of ref document: A1