WO2021260696A1 - Multi subunit protein modules, cells expressing same and uses thereof - Google Patents
Multi subunit protein modules, cells expressing same and uses thereof Download PDFInfo
- Publication number
- WO2021260696A1 WO2021260696A1 PCT/IL2021/050763 IL2021050763W WO2021260696A1 WO 2021260696 A1 WO2021260696 A1 WO 2021260696A1 IL 2021050763 W IL2021050763 W IL 2021050763W WO 2021260696 A1 WO2021260696 A1 WO 2021260696A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- target
- subunit protein
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70535—Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4203—Receptors for growth factors
- A61K40/4204—Epidermal growth factor receptors [EGFR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4244—Enzymes
- A61K40/4245—Tyrosinase or tyrosinase related proteinases [TRP-1 or TRP-2]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4271—Melanoma antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/57—Skin; melanoma
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- the present invention in some embodiments thereof, relates to multi subunit protein modules, cells expressing same and uses thereof.
- Cancer immunotherapy including cell-based therapy, antibody therapy and cytokine therapy, has emerged in the last couple of years as a promising strategy for treating various types of cancer owing to its potential to evade genetic and cellular mechanisms of drug resistance and to target tumor cells while sparing healthy tissues.
- Antibody-based cancer immunotherapies such as monoclonal antibodies, antibody-fusion proteins, and antibody drug conjugates (ADCs) depend on recognition of cell surface molecules that are differentially expressed on cancer cells relative to non-cancerous cells and/or immune- checkpoint blockade. Binding of an antibody-based immunotherapy to a cancer cell can lead to cancer cell death via various mechanisms, e.g., antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), direct cytotoxic activity of the payload from an antibody-drug conjugate (ADC) or suppressive checkpoint blockade. Many of these mechanisms initiate through the binding of the Fc domain of cell-bound antibodies to specialized cell surface receptors (Fc receptors) on hematopoietic cells.
- ADCC antibody-dependent cell-mediated cytotoxicity
- CDC complement-dependent cytotoxicity
- ADC antibody-drug conjugate
- suppressive checkpoint blockade Many of these mechanisms initiate through the binding of the Fc domain of cell-bound antibodies to specialized cell surface
- T cells having a T cell receptor (TCR) specific for an antigen differentially expressed in association with an MHC class I molecule on cancer cells relative to non-cancerous cells were shown to exert anti-tumor effects in several types of cancers, e.g. hematologic malignancies.
- TCR T cell receptor
- antigen-specific effector lymphocytes are very rare, individual-specific, limited in their recognition spectrum and difficult to obtain against most malignancies.
- a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), the amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of the at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell, such that upon binding of the extracellular binding domain to the target the activating signal is transmitted in an immune cell expressing the multi subunit protein module.
- FcRy Fc receptor common g chain
- the binding domain is of a receptor and the target is a ligand of the receptor.
- the binding domain is of an Fey receptor and the target is an Fc ligand.
- the binding domain is of a ligand and the target is a receptor of the ligand.
- the binding domain is of an antibody and the target is an antigen.
- the binding domain comprises a scFv.
- the at least one polypeptide comprising the binding domain comprises an amino acid sequence capable of recruiting polypeptides of the at least three polypeptides comprising the amino acid sequence of FcRy comprised in the multi subunit protein module upon binding of the binding domain to the target.
- the amino acid sequence capable of recruiting the other polypeptides comprises the transmembrane domain of an Fc receptor.
- the Fc receptor is Fey receptor.
- the Fey receptor is CD64.
- At least two of the at least three cell membrane polypeptides comprise a dimerizing moiety.
- the polypeptides comprising the amino acid sequence of FcRy and not comprising the binding domain comprise a dimerizing moiety.
- a dimerizing moiety comprises an amino acid sequence of a transmembrane domain of the FcRy.
- the binding domain is of CD64 and the target is an Fc ligand; the at least one polypeptide comprising the binding domain comprises a transmembrane domain of CD64; and the polypeptides comprising the amino acid sequence of FcRy and not comprising the binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of the FcRy.
- the target cell of the immune cell is a pathologic cell.
- At least one polynucleotide encoding the multi subunit protein module there is provided at least one polynucleotide encoding the multi subunit protein module.
- the at least one polynucleotide comprises a nucleic acid sequence encoding a first polypeptide comprising an extracellular and a transmembrane domain of CD64 and an intracellular domain of FcRy; and a nucleic acid sequence encoding a second polypeptide comprising an extracellular, a transmembrane and an intracellular domain of FcRy.
- the multi subunit protein module is encoded by a single polynucleotide.
- the polynucleotide comprises a nucleic acid sequence encoding a 2A skipping peptide between the nucleic acid sequence encoding the first polypeptide and the nucleic acid sequence encoding the second polypeptide.
- an immune cell genetically engineered to express the at least one polynucleotide.
- an immune cell expressing the at least one polynucleotide.
- an immune cell expressing the multi subunit protein module.
- a method of expressing a multi subunit protein module in an immune cell comprising introducing into an immune cell the at least one polynucleotide, under conditions which allow expression of the multi subunit protein module.
- the introducing is effected in-vitro or ex- vivo.
- the immune cell is a T cell.
- the immune cell is a NK cell.
- a T cell expressing a polypeptide complex
- the polypeptide complex comprises at least a first polypeptide and a second polypeptide, wherein the first and second polypeptides are not translationally fused
- the first polypeptide comprises an amino acid sequence of an Fc receptor common g chain (FcRy), the amino acid sequence is capable of transmitting an activating signal and forming a homodimer
- the second polypeptide comprising:
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the immune cell, wherein the pathologic cell presents the target on its cell surface, thereby treating the disease in the subject.
- the immune cell for use in treating a disease associated with a pathologic cell in a subject in need thereof, wherein the pathologic cell presents the target on its cell surface.
- the subject is treated with a therapeutic composition comprising the target, the therapeutic composition being specific for the pathologic cell.
- the method comprises administering to the subject a therapeutically effective amount of a therapeutic composition comprising the target, the therapeutic composition being specific for the pathologic cell.
- the immune cell and a therapeutic composition comprising the target, for use in treating a disease associated with a pathologic cell in a subject in need thereof, wherein the therapeutic composition being specific for the pathologic cell.
- an article of manufacture comprising a packaging material packaging the immune cells and a therapeutic composition comprising the target.
- the therapeutic composition is specific for a pathologic cell.
- the therapeutic composition is an Fc-fusion protein.
- the therapeutic composition is an antibody.
- the immune cell is a T cell; the binding domain is of CD64 and the target is an Fc ligand; and the therapeutic composition is an antibody specific for the pathologic cell.
- a method of increasing the killing capacity of an antibody against a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of:
- the immune cell wherein the immune cell is a T cell; wherein the binding domain is of CD64 and the target is an Fc ligand, thereby increasing the killing capacity of the antibody against the pathologic cell.
- the antibody is an IgG.
- the pathologic cell is a cancerous cell and wherein the disease is cancer.
- the cancer is selected from the group consisting of melanoma, lymphoma, colon cancer, lung cancer, breast cancer and pancreatic cancer.
- the cancer is melanoma or lymphoma.
- FIGs. 1A-B show schematic representations of the constructs used and illustrations of the receptors as expressed proteins.
- Figure 1A demonstrates a construct encoding the extracellular, transmembrane and intracellular domains of FcyRI, T2A skipping peptide and FcRy (SEQ ID NOs: 1-2), denoted herein as Alpha-2A-gamma.
- Figure IB demonstrates a construct encoding the extracellular and transmembrane domains of FcyRI fused to the intracellular domain of FcRy, T2A skipping peptide and FcRy (SEQ ID NOs: 3-4), denoted herein as Alpha-gamma 2A-gamma.
- Figure 2A-B show confocal microscopy of cells expressing the Alpha-2A-Gamma ( Figure 2A) or Alpha-gamma-2a-Gamma ( Figure 2B) construct and stained for TCR , FcyRI and GFP. X200 magnitude.
- FIG. 3 is a graph demonstrating the correlation between the number of cells counted by incuCyte imager in a field and the number of B16-H2B-tdTomato cells cultured in a well of 96 wells plate.
- FIGs. 4A-B demonstrate killing of B16 target cells by Alpha-2 A- Gamma infected cells in different ratios.
- Figure 4A shows representative images taken by incuCyte imager following 2 days of co-culturing CD8+ T cells infected with Alpha-2A-Gamma and B16-H2B-tdTomato at the indicated effector : target ratios ranging from 0.5:1 to 16:1, in the presence of an anti-TRP-1 antibody. xlOO magnitude.
- Figure 4B is a graph demonstrating the number of target cells counted by the incuCyte imager, following 2 days of co-culturing CD4+ or CD8+ T cells infected with Alpha-2A-Gamma and B16-H2B-tdTomato in different effector : target ratios with or without an anti-TRP-1 antibody.
- FIGs. 5A-C demonstrate killing of B16 target cells by Alpha-gamma-2a-Gamma infected cells.
- Figure 5 A shows representative images taken by incuCyte imager following 2 days of co culturing CD8+ T cells infected with Alpha-Gamma-2A-Gamma and B16-H2B-tdTomato at an effector : target ratio 2 : 1, in the presence or absence of an anti-TRP-1 antibody. xlOO magnitude.
- Figures 5B-C show graphs demonstrating the number of target cells counted by the incuCyte imager, following 2 days of co-culturing CD4+ ( Figure 5B) or CD8+ ( Figure 5C) T cells infected with Alpha-gamma-2A-Gamma at an effector : target ratio 2 : 1, in the presence or absence of an anti-TRP-1 antibody. Shown are also the following controls: B16 H2B-tdTomato target cells cultured alone, cultured with anti-TRP-1 antibody, co-cultured with non-infected CD4+ or CD8 + T cells (Sham), co-cultured with non-infected CD4+ or CD8+ T cells (Sham) and anti-TRP-1 antibody.
- Figure 6A-B show GFP and FcyRI (CD64) expression in infected effector T cells.
- Figure 6A shows images taken following co-culturing B16-H2B-tdTomato with CD4+ or CD8+ T cells infected with Alpha-gamma-2A-Gamma and an anti-TRP-1 antibody, with bright light, red and green filters in incuCyte imager. x200 magnitude.
- Figure 6B shows flow cytometry analysis of non-infected (sham) or Alpha-gamma-2A-Gamma infected mouse CD4+ T cells, mouse CD8+ T cells or human Jurkat T cells. Cells were analyzed for FcyRI (CD64) staining and GFP expression.
- Figure 7 demonstrates killing of B16 target cells by Alpha-gamma-2a-Gamma infected cells. Shown are the number of B16-H2B-tdTomato target cells counted by the incuCyte imager, following 60 hours of co-culturing with CD4+ or CD8+ T cells infected with Alpha-gamma-2A- Gamma in the presence or absence of an anti-TRP-1 antibody, as compared to non-infected cells (sham). Also shown is a control of B 16 H2B-tdTomato target cells cultured alone.
- Figure 8A-C demonstrate the necessity of FcyRI receptor to signal through the dimer of the co-receptor FcRy chain.
- Figure 8A shows schematic representations of a construct composed of FcRI alpha chain extracellular D1-D3 domains fused to the hinge and transmembrane domains of CD8a together with signaling intracellular gamma (SEQ ID NOs: 5-6), denoted herein as Alpha- CD8-gamma; and a construct composed of the same sequence of Alpha-gamma-2A-Gamma construct, but with two cysteine residues in the transmembrane domain (Cysteine 25 and 44), mutated to glycine in order to prevent S-S bonds which facilitates dimerization (SEQ ID NOs: 7- 8), denoted herein as Alpha-gamma-2A-Gamma(mut).
- Figure 8B shows representative images of B16-H2B-tdTomato target cells treated with an anti-TRP-1 antibody either alone or following 48 hours co-culturing with uninfected CD8+ T cells (Sham), CD8+ T cells infected with Alpha-2A- Gamma, Alpha-CD8-gamma, Alpha-gamma-2A-Gamma or Alpha-gamma-2A-Gamma (mut). Images were taken with bright light, red and green filters, x200 magnitude.
- Figure 8C is a graph showing target cell count following co-culturing with the CD8+ T cells described in Figure 8B.
- Figure 9 demonstrates killing of YUMM1.7-H2B-tdTomato target cells by Alpha-gamma- 2a-Gamma infected cells. Shown are representative images of YUMM1.7-H2B-tdTomato co cultured for 2 days with Alpha-gamma-2A-Gamma infected CD8 T cells at an effector : target ratio 2 : 1, with or without an anti-TRP-1 antibody. Images were taken with bright light, red and green filters, showing target cells nuclear tdTomato and GFP in the infected T cells population.
- Figure 10A-B demonstrate killing of A20 B-cell lymphoma target cells by Alpha-gamma- 2a-Gamma infected cells.
- Figure 10A shows representative confocal images of A20 cells co cultured with CD8+ T cells infected with Alpha-gamma-2A-Gamma cells at an effector : target ratio 2 : 1, with or without an anti-CD20 antibody. The cells were stained for T cell marker TCR and B cell marker B220. x200 magnitude.
- Figure 10B shows flow cytometry analysis of A20 B- lymphoma cells AnnexinV staining following 24 hours of co-culturing with Alpha-gamma-2A- Gamma CD8+ T cells, with or without an anti-CD20 antibody.
- Figure 11 demonstrates killing of B16 target cells by Alpha-gamma-2a-Gamma infected CD8+ T cells in combination with an anti-TRP-1 or with anti-CD44 antibody, following 24 hours of co-culturing.
- FIG. 13 shows a schematic representations of a construct encoding an anti-EGFR scFv fused to the extracellular D3 domain and transmembrane domain of FcyRI fused to the intracellular domain of FcRy, T2A skipping peptide and FcRy SEQ ID NOs: 37-38), denoted herein as scFv- alpha-gamma-2A-gamma.
- FIGs. 14A-F demonstrate killing of HER2 target cells by Alpha-gamma-2a-Gamma (AG2G) infected T cells as compared to Alpha-2A-Gamma (A2G) infected T cells.
- Figure 14A shows representative flow cytometry plots of human T cells infected with AG2G-IRES-GFP retrovirus, 10 days following infection.
- Figure 14B shows a representative confocal microscopy image of human T cells infected with AG2G-IRES-GFP and stained for FcyRI (CD64).
- Figure 14C shows a representative confocal microscopy image of human HT29 colon cancer cell line infected with HER2 and H2b-tdTomato, and stained for HER2.
- Figure 14D shows a representative confocal microscopy image of human HT29 colon cancer cell line infected with EGFR and H2b- tdTomato, and stained for EGFR.
- FIGs. 15A-F demonstrate killing of HER2 target cells and EGFR target cells by T cells infected with Alpha-gamma-2a-Gamma (AG2G) pMSVG.l vector in combination with the relevant antibody.
- Figure 15A shows representative confocal microscopy images of T cells infected with the pMSVG.l-AG2G construct and stained for CD64.
- Figures 15D-E show graphs demonstrating TNFa (Figure 15D) and IFNy (Figure 15E) concentration in supernatants of H2b-tdTomato HER2+ HT29 human colon carcinoma co-cultured with sham or AG2G-infected human T cells at effector : target ratio of 4:1, 2:1 or 1:1 with or without treatment with the relevant anti-HER2 antibody Trastuzumab, as determined by EFISA.
- Figure 15F is a graph demonstrating the number of target cells counted by the incuCyte imager of H2b-tdTomato HER2+ HT29 cells co-cultured with sham or AG2G- infected human T cells with or without treatment with the relevant anti-HER2 antibody Trastuzuman or the irrelevant antibodies, Cetuximab or Retuximab.
- FIG. 16 shows schematic representations of costimulatory and cytokine receptor signaling domains that can be added to the polypeptide of some embodiments of the invention.
- FIG. 17 shows GFP and FcyRI (CD64) expression in human gdT cells infected with the Alpha-gamma-2a-Gamma (AG2G)-IRES-GFP vector, 9 days following infection.
- Human PBMC from healthy donor were collected and gd T cells isolated following expansion using Zoledronate and IL-2 were transduced with retrovirus for AG2G cloned in pMIGII vector, and were imaged for GFP expression and for gd-TCR-APC or CD64-APC staining.
- FIGs. 18A-B show CD56 and FcyRI (CD64) expression in NK-92 cell line infected with Alpha-gamma-2a-Gamma (AG2G) pMSVG.l vector.
- Figure 18A shows representative flow cytometry plot demonstrating expression of AG2G using an anti-CD64-APC antibody.
- Figure 18B shows representative immuno staining images demonstrating expression of the NK marker CD56 using an anti-CD56-APC antibody and expression of AG2G using an anti-CD64-APC antibody.
- the present invention in some embodiments thereof, relates to multi subunit protein modules, cells expressing same and uses thereof.
- Cancer immunotherapy including cell-based therapy, antibody therapy and cytokine therapy, has emerged in the last couple of years as a promising strategy for treating various types of cancer.
- Antibody-based cancer immunotherapies depend on recognition of cell surface molecules that are differentially expressed on cancer cells relative to non-cancerous cells and/or immune-checkpoint blockade.
- cell-based therapy using e.g. T cells having a T cell receptor (TCR) specific for an antigen differentially expressed in association with an MHC class I molecule on cancer cells relative to non-cancerous cells were shown to exert anti-tumor effects in several types of cancers, e.g. hematologic malignancies.
- TCR T cell receptor
- the present inventors have exogenously expressed in T cells a first polypeptide comprising the binding domain of the high affinity Fey receptor FcyRI (CD64) and a second distinct polypeptide comprising the Fey chain which is capable of forming a homodimer.
- CD64 high affinity Fey receptor FcyRI
- a second distinct polypeptide comprising the Fey chain which is capable of forming a homodimer.
- These engineered T cells exerted in-vitro killing capabilities of tumor cells in combination with anti-tumor antibodies, which were advantageous to T cells exogenously expressing a single polypeptide comprising both the binding domain of FcyRI and the activating domain of Fey chain (Example 1 of the Examples section which follows).
- the present inventors discovered that by combining the two approaches and exogenously expressing a first polypeptide comprising both the binding domain of FcyRI and the activating domain of Fey chain and a second distinct polypeptide comprising Fey chain which is capable of forming a homodimer, the engineered T cells exerted more robust and in lower concentrations in-vitro killing capabilities (Example 1 of the Examples section which follows). Importantly, these cells also had a remarkable anti-tumor effect in an in-vivo mouse tumor model (Example 2 of the Examples section which follows).
- a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common y chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell, such that upon binding of said extracellular binding domain to said target said activating signal is transmitted in an immune cell expressing said multi subunit protein module.
- FcRy Fc receptor common y chain
- multi subunit protein module refers to a plurality of at least three polypeptides which together have the activity of transmitting an activating signal in an immune cell expressing the multi subunit protein module upon binding of the extracellular domain to its target presented on a cell surface of a target cell.
- the multi subunit protein module comprises 3, 4, 5, 6 or more polypeptides.
- the multi subunit protein module comprises 3 polypeptides.
- the plurality of polypeptides are complexed (or assembled) together (e.g. following binding of the extracellular binding domain to its target).
- said at least one polypeptide is one polypeptide.
- said at least two polypeptides is two polypeptides.
- Fc receptor common y chain refers to the polypeptide expression product of the FCER1G gene (Gene ID 2207).
- FcRy is human FcRy.
- the FcRy protein refers to the human protein, such as provided in the following GenBank Number NP_004097 (SEQ ID NO: 11).
- amino acid sequence of an Fc receptor common g chain (FcRy) capable of transmitting an activating signal refers to full length FcRy or a fragment thereof or a homolog thereof which comprises an intracellular domain and maintains at least the capability of transmitting an activating signal in a cell expressing an Fey receptor upon binding of the Fey receptor to a Fc ligand.
- amino acid or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
- amino acid includes both D- and L-amino acids.
- the amino acid sequence of an Fc receptor common y chain (FcRy) capable of transmitting an activating signal comprises an IT AM motif.
- activating refers to the process of stimulating a T cell that results in cellular proliferation, maturation, cytokine production, chemotaxis and/or induction of effector functions.
- Methods of determining signaling of an activating signal include, but are not limited to, enzymatic activity assays such as kinase activity assays, and expression of molecules involved in the signaling cascade using e.g. PCR, Western blot, immunoprecipitation and immunohistochemistry. Additionally or alternatively, determining transmission of an activating signal can be effected by evaluating T cell activation or function.
- Methods of evaluating T cell activation or function include, but are not limited to, proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation, cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, cytokine secretion assays such as intracellular cytokine staining, EFISPOT and ELISA, expression of activation markers such as CD25, CD69, CD137, CD107a, PD1, and CD62L using flow cytometry.
- proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation
- cytotoxicity assays such as CFSE staining, chromium release, Calcin AM
- cytokine secretion assays such as intracellular cytokine staining, EFISPOT and ELISA
- expression of activation markers such as CD25, CD69, CD137, CD
- amino acid sequence of FcRy comprises full length
- the polypeptide of some embodiments of the invention comprises full length FcRy.
- the amino acid sequence of FcRy comprises a fragment thereof or a homolog thereof which comprises an intracellular domain and maintains at least the capability of transmitting an activating signal in a cell expressing an Fey receptor upon binding of the Fey receptor to a Fc ligand.
- the polypeptide of some embodiments of the invention comprises the intracellular domain of FcRy capable of transmitting an activating signal and are devoid of the membranal and extracellular domains of FcRy.
- the multi subunit protein module comprises at least one polypeptide comprising the intracellular domain of FcRy capable of transmitting an activating signal and is devoid of the membranal and extracellular domains of FcRy; and at least two polypeptides comprising full length FcRy.
- the multi subunit protein module comprises a single polypeptide comprising the intracellular domain of FcRy capable of transmitting an activating signal and is devoid of the membranal and extracellular domains of FcRy; and two polypeptides comprising full length FcRy.
- the amino acid sequence of FcRy capable of transmitting an activating signal comprises SEQ ID NO: 12 or 39.
- the amino acid sequence of FcRy capable of transmitting an activating signal consists of SEQ ID NO: 12 or 39.
- the homolog (naturally occurring or synthetically/recombinantly produced) can be, for example, at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide provided in SEQ ID NO: 11, 12 or 39 or a functional fragment thereof which exhibit the desired activity (i.e., comprises an intracellular domain and maintains at least the capability of transmitting an activating signal in a cell expressing an Fey receptor upon binding of the Fey receptor to a Fc ligand); or at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least
- the homolog (naturally occurring or synthetically/recombinantly produced) can be, for example, at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide provided in SEQ ID NO: 11, 12 or 39 or a functional fragment thereof which exhibit the desired activity (i.e., comprises an intracellular domain and maintains at least the capability of transmitting an activating signal in a cell expressing an Fey receptor upon binding of the Fey receptor to a Fc
- Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE.
- the homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including a conservative and non-conservative amino acid substitution, as further described hereinbelow.
- the amino acid sequence of FcRy may comprise conservative and/or non-conservative amino acid substitutions.
- conservative substitution refers to the replacement of an amino acid present in the native sequence in the peptide with a naturally or non-naturally occurring amino or a peptidomimetics having similar steric properties.
- side-chain of the native amino acid to be replaced is either polar or hydrophobic
- the conservative substitution should be with a naturally occurring amino acid, a non-naturally occurring amino acid or with a peptidomimetic moiety which is also polar or hydrophobic (in addition to having the same steric properties as the side-chain of the replaced amino acid).
- amino acid analogs synthetic amino acids
- a peptidomimetic of the naturally occurring amino acid is well documented in the literature known to the skilled practitioner.
- the substituting amino acid should have the same or a similar functional group in the side chain as the original amino acid.
- non-conservative substitutions refers to replacement of the amino acid as present in the parent sequence by another naturally or non-naturally occurring amino acid, having different electrochemical and/or steric properties.
- the side chain of the substituting amino acid can be significantly larger (or smaller) than the side chain of the native amino acid being substituted and/or can have functional groups with significantly different electronic properties than the amino acid being substituted.
- non-conservative substitutions of this type include the substitution of phenylalanine or cycohexylmethyl glycine for alanine, isoleucine for glycine, or -NH-CH[(-CH2)5-COOH]-CO- for aspartic acid.
- Those non conservative substitutions which fall under the scope of the present invention are those which still constitute an amino acid sequence capable of binding a4b7 integrin.
- At least one but not all of the at least three cell membrane polypeptides comprised in the multi subunit protein module disclosed herein comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell.
- one of the at least three cell membrane polypeptides comprised in the multi subunit protein module disclosed herein comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell.
- the cell membrane polypeptide comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell.
- the cell membrane polypeptide is devoid of an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell.
- the multi subunit protein module comprises three cell membrane polypeptides each comprising an amino acid sequence of an FcRy, wherein one of the cell membrane polypeptides further comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell and the other two cell membrane polypeptides are devoid of such an extracellular binding domain.
- extracellular binding domain capable of binding a target refers to a proteinaceous moiety having a binding affinity (e.g., below 10 4 nM) to a target of interest being presented on a target cell.
- binding domains include the binding domain of a receptor, the binding domain of a ligand, the binding domain of a hormone (e.g. leptin) and an antigen binding moiety such an antibody, as further described hereinbelow.
- Assays for testing binding are well known in the art and include, but not limited to flow cytometry, bio-layer interferometry Blitz® assay, HPLC, surface plasmon resonance (e.g. Biacore).
- the extracellular binding domain binds the target presented on the cell with a Kd >10 9 M.
- target cell of an immune cell refers to a cell which upon recognition by an immune cell causes activation of the immune cell via the multi subunit protein module described herein.
- the target cell is a pathologic (diseased) cell.
- the target cell is a cancerous cell.
- the term “presented” refers to a target expressed by the target cell (e.g. an antigen) or bound to (yet not expressed by it) the target cell (e.g. an antibody which binds an antigen expressed by the target cell).
- the target is over-presented or only presented on the cell surface of the target cells as compared to other cells (e.g. healthy cells).
- Methods of determining cell surface presentation include, but not limited to flow cytometry and immuno-cytochemistry.
- the binding domain is of an antibody and the target is an antigen.
- antibody as used in this invention includes intact molecules as well as functional fragments thereof (that are capable of binding to an epitope of an antigen).
- epitopic determinants refers to any antigenic determinant on an antigen to which the paratope of an antibody binds.
- Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or carbohydrate side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics.
- the antibody is a whole or intact antibody.
- the antibody comprises an Fc domain.
- the antibody is an antibody fragment.
- the antibody fragments include, but are not limited to, single chain, Fab, Fab’ and F(ab') 2 fragments, Fd, Fcab, Fv, dsFv, scFvs, diabodies, minibodies, nanobodies, Fab expression library or single domain molecules such as VH and VF that are capable of binding to an epitope of the antigen in an HFA restricted manner.
- Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv (scFv), a disulfide- stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2, or antibody fragments comprising the Fc region of an antibody.
- CDR complementarity-determining region
- light chain referred to herein as “light chain”
- heavy chain a complementarity-determining region of an immunoglobulin heavy chain
- variable region of a light chain a variable region of a heavy chain
- the identity of the amino acid residues in the antibody that make up the variable region and/or the CDRs is determined by the method of Kabat et al. (See, e.g., Kabat et al., 1992, Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, NIH, Washington D.C.).
- Fv defined as a genetically engineered fragment consisting of the variable region of the light chain (VL) and the variable region of the heavy chain (VH) expressed as two chains;
- scFv single chain Fv
- dsFv disulfide-stabilized Fv
- Fab a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme papain to yield the intact light chain and the Fd fragment of the heavy chain which consists of the variable and CHI domains thereof;
- Fab a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin, followed by reduction (two Fab’ fragments are obtained per antibody molecule);
- F(ab’)2 a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin (i.e., a dimer of Fab’ fragments held together by two disulfide bonds);
- Single domain antibodies or nanobodies are composed of a single VH or VL domains which exhibit sufficient affinity to the antigen; and (viii) Fcab, a fragment of an antibody molecule containing the Fc portion of an antibody developed as an antigen-binding domain by introducing antigen-binding ability into the Fc region of the antibody.
- the extracellular binding domain capable of binding the target comprises a scFv.
- humanized antibodies are preferably used.
- the antibody is a humanized antibody.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
- Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
- CDR complementary determining region
- Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et ah, Nature, 321:522-525 (1986); Riechmann et ah, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
- Fc immunoglobulin constant region
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et ah, Nature, 321:522-525 (1986); Riechmann et ah, Nature 332:323-327 (1988); Verhoeyen et ah, Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
- humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- the antibody is a human antibody.
- Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et ah, J. Mol. Biol., 222:581 (1991)].
- the techniques of Cole et al. and Boemer et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boemer et al., J. Immunol., 147(l):86-95 (1991)].
- human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
- the antibody binds an antigen overexpressed or only expressed by a pathologic cell e.g. cancerous cell.
- Non-limiting examples for known cancer antigens include MAGE-AI, MAGE-A2, MAGE- A3, MAGE-A4, MAGE-AS, MAGE-A6, MAGE-A7, MAGE-AS, MAGE-A9, MAGE-AIO, MAGE-A11, MAGE-A12, GAGE-I, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, B AGE-1, RAGE- 1, LB33/MUM-1, PRAME, NAG, MAGE-Xp2 (MAGE-B2), MAGE- Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE- C1/CT7, MAGE-C2, NY-ESO-1, LAGE-1, SSX-1, SSX-2(HOM-MEL-40), SSX-3, SSX-4, SSX-5, SCP-1 and XAGE, melanocyte differentiation antigens, p53, ras, CEA
- the antibody binds EGFR, TRP-1, CD44, PDL-1, HER-2, MUC-1, MUC-16, CEA or EpCAM.
- the antibody binds EGFR.
- the antibody is an anti-EGFR comprising a variable heavy chain comprising SEQ ID NO: 41 and/or variable light chain comprising SEQ ID NO: 42.
- the extracellular binding domain capable of binding the target comprises an anti-EGFR scFv comprising SEQ ID NO: 43.
- the extracellular binding domain is of a ligand and the target is a receptor of the ligand.
- ligand - receptor pairs that can be used for targeting cancerous cells include a ligand of a tyrosine kinase receptor - tyrosine kinase receptor, EGF - EGFR, CD19 ligand - CD19, hyaluronic acid - CD44.
- the extracellular binding domain is of a receptor and said target is a ligand of the receptor.
- receptor - ligand pairs that can be used for targeting cancerous cells include PD-1 - PDL-1, CD 137 - CD137L, integrin alpha2betal - E-Cadherin.
- the target is bound to the target cell.
- the target may be an antibody or an Fc-fusion which is capable of binding an antigen expressed by a target cell.
- the extracellular binding domain is of an Fey receptor and the target is an Fc ligand bound to a target cell.
- extracellular binding domain of Fey receptor refers to at least a fragment of an Fey receptor which comprises an extracellular domain capable of binding an Fc ligand.
- Fc ligand refers to an Fc domain such as of an antibody.
- the Fc ligand is an IgG Fc domain.
- the term “Fey receptor” refers to a cell surface receptor which exhibits binding specificity to the Fc domain of an IgG antibody. Examples of Fey receptors include, without limitation, CD64A, CD64B, CD64C, CD32A, CD32B, CD16A, and CD16B.
- the term “Fey receptor” also encompasses functional homologues (naturally occurring or synthetically/recombinantly produced) and/or Fc receptors comprising conservative and non conservative amino acid substitutions, which exhibit the desired activity (i.e., capability of binding an IgG Fc binding domain).
- the Fey receptor is CD64.
- CD64 also known as FcyRI
- FcyRI refers to the polypeptide expression product of the FCGR1A, FCGR1B or FCGR1C gene (Gene ID 2209, 2210, 2211, respectively), and includes CD64A, CD64B and CD64C.
- Full length CD64 comprises an extracellular, transmembrane and an intracellular domain and is capable of at least binding an IgG (IgGl and IgG3) Fc domain and recruiting an FcRy. Methods of determining binding and recruitment of an FcRy are well known in the art and are also described hereinabove and below.
- CD64 is human CD64.
- the CD64 protein refers to the human CD64A protein, such as provided in the following UniProt Number P12314.
- the CD64 protein refers to the human CD64B protein, such as provided in the following UniProt Number Q92637.
- the CD64 protein refers to the human CD64C protein, such as provided in the following GenBank Number XM_001133198.
- the extracellular domain of full length CD64 comprises three immunoglobulin (Ig) domains referred to as D1-D3 from N to C.
- the extracellular binding domain of CD64 comprises all Ig domains D1-D3.
- the extracellular binding domain of CD64 comprises SEQ ID NO: 14, 44 or 64.
- the extracellular binding domain of CD64 consists of SEQ ID NO: 14, 44 or 64.
- the extracellular binding domain of CD64 comprises SEQ ID NO: 14 or 44.
- the extracellular binding domain of CD64 consists of SEQ ID NO: 14 or 44. According to specific embodiments, the extracellular binding domain of CD64 comprises the two Ig domains D1-D2.
- the extracellular binding domain of CD64 comprises SEQ ID NO: 45 or 46.
- the extracellular binding domain of CD64 consists of SEQ ID NO: 45 or 46.
- extracellular binding domain of CD64 also encompasses functional homologues (naturally occurring or synthetically/recombinantly produced), which exhibit the desired activity ⁇ i.e., binding an IgG Fc domain).
- Such homologues can be, for example, at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide SEQ ID No: 14, 44, 64, 45 or 46; or at least 70 %, at least 75 %, at least 80
- the extracellular binding domain of CD64 may comprise conservative and non-conservative amino acid substitutions.
- the at least one polypeptide comprising the extracellular binding domain comprises an amino acid sequence capable of recruiting other polypeptides comprising the amino acid sequence of FcRy being part of the multi subunit protein module upon binding of the binding domain to the target.
- Such recruitment will form a complex upon binding of the extracellular binding domain to the target, enabling transmission of an activating signal by the amino acid sequence of an FcRy in an immune cell expressing the multi subunit protein module.
- the recruitment refers to oligomerization e.g., trimerization of the at least three polypeptides being part of the multi subunit protein module.
- the amino acid sequence capable of recruiting the other polypeptides directly recruits the other polypeptide (i.e. without an intermediate polypeptide).
- amino acid sequences are well known to the skilled in the art and include for example the transmembrane and/or the cytoplasmic domains of several Fc receptors such as, but not limited to CD64, CD 16 A, CD16B, FceRIp, FcaRI (CD89). According to specific embodiments, the amino acid sequence capable of recruiting the other polypeptides is not of an Fee receptor (FceR).
- FceR Fee receptor
- determining recruitment of the polypeptides include, but are not limited to, enzymatic activity assays such as kinase activity assays, and expression of molecules involved in the signaling cascade using e.g. PCR, Western blot, immunoprecipitation and immunohistochemistry. Additionally or alternatively, determining recruitment of the polypeptides can be effected by evaluating cell activation or function by methods well known in the art such as, but not limited to proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation, cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, and the like.
- proliferation assays such as CFSE staining, MTT, Alamar blue, BRDU and thymidine incorporation
- cytotoxicity assays such as CFSE staining, chromium release, Calcin AM, and the like.
- the amino acid sequence capable of recruiting the other polypeptides comprising the amino acid sequence of FcRy comprises the transmembrane domain of an Fc receptor.
- the amino acid sequence capable of recruiting the other polypeptides comprising the amino acid sequence of FcRy comprises the transmembrane domain of an Fey receptor.
- the amino acid sequence capable of recruiting the other polypeptides comprising the amino acid sequence of FcRy comprises the transmembrane domain of CD64.
- the amino acid sequence capable of recruiting the other polypeptides comprising the amino acid sequence of FcRy consists of the transmembrane domain of CD64.
- the amino acid sequence capable of recruiting the other polypeptides comprises an amino acid sequence having at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to SEQ ID NO: 16 or 47.
- the amino acid sequence capable of recruiting the other polypeptides comprises SEQ ID NO: 16 or 47. According to specific embodiments, the amino acid sequence capable of recruiting the other polypeptides consists of SEQ ID NO: 16 or 47.
- both the extracellular binding domain and the amino acid sequence capable of recruiting the other polypeptides are of CD64.
- the at least one polypeptide which comprises the extracellular binding domain comprises the extracellular and the transmembrane domains of CD64.
- the at least one polypeptide which comprises the extracellular binding domain comprises an amino acid sequence having at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86
- the at least one polypeptide which comprises the extracellular binding domain comprises SEQ ID NO: 18 or 48.
- the at least one polypeptide which comprises the extracellular binding domain comprises an amino acid sequence having at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86
- the at least one polypeptide which comprises the extracellular binding domain comprises SEQ ID NO: 19 or 49.
- the at least one polypeptide which comprises the extracellular binding domain consists of SEQ ID NO: 19 or 49.
- At least two of the polypeptides in the multi subunit module are capable of forming a dimer.
- the dimer may be a homodimer or a heterodimer.
- the dimer is a homodimer.
- At least two of the at least three cell membrane polypeptides comprising the amino acid sequence of FcRy comprise a dimerizing moiety.
- the polypeptides devoid of the extracellular the binding domain are capable of forming a dimer.
- the polypeptides comprising the amino acid sequence of FcRy and not comprising the binding domain comprise a dimerizing moiety.
- dimerizing moiety refers to an amino acid sequence capable of forming a polypeptide dimer.
- an amino acid may include for example an amino acid sequence comprising at least two cysteine residues enabling the formation of a disulfide bond between the thiol groups.
- Methods of determining dimerization are known in the art, including but not limited to immunoprecipitation, size exclusion chromatography, fast protein liquid chromatography (FPLC), multi-angle light scattering (SEC-MALS) analysis, SDS-PAGE analysis, nano-DSF, yeast two-hybrid system (e.g. RRS) and flow cytometry.
- dimerizing moiety of some embodiments of the invention is also capable of forming multimers (e.g., at least three).
- dimerizing moiety Any known dimerizing moiety known in the art can be used with specific embodiments of the invention.
- a non-limiting example of such a dimerizing moiety which can be used with specific embodiments of the invention include an amino acid sequence of a transmembrane domain of FcRy.
- the dimerizing moiety comprises an amino acid sequence having at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to SEQ ID NO: 21 or 50.
- the dimerizing moiety comprises SEQ ID NO: 21 or 50.
- the dimerizing moiety consists of SEQ ID NO: 21 or 50.
- the multi subunit protein module of some embodiments of the invention comprises the following combination of elements: the binding domain is of an Fey receptor (e.g. CD64) and the target is an Fc ligand; the at least one polypeptide comprising said binding domain comprises a transmembrane domain of an Fey receptor (e.g. CD64); and the polypeptides comprising said amino acid sequence of FcRy and not comprising said binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of said FcRy.
- the binding domain is of an Fey receptor (e.g. CD64) and the target is an Fc ligand
- the at least one polypeptide comprising said binding domain comprises a transmembrane domain of an Fey receptor (e.g. CD64)
- the polypeptides comprising said amino acid sequence of FcRy and not comprising said binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of said FcRy.
- a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common y chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises a transmembrane domain of CD64 and an extracellular binding domain of CD64 capable of binding an Fc ligand; and wherein said polypeptides comprising said amino acid sequence of FcRy and not comprising said binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of said FcRy, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in an immune cell expressing said multi subunit protein module.
- FcRy Fc receptor common y chain
- At least one of the polypeptides in the multi subunit protein module comprises an amino acid sequence having at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87
- At least one of the polypeptides in the multi subunit protein module comprises SEQ ID NO: 23, 51 or 71.
- At least one of the at least three cell membrane polypeptides in the multi subunit protein module consists of SEQ ID NO: 23, 51 or 71.
- At least two of the polypeptides in the multi subunit protein module comprise an amino acid sequence having at least 70 %, at least 75 %, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identity to SEQ ID NO: 23, 51 or 71.
- At least two of the polypeptides in the multi subunit protein module comprise SEQ ID NO: 23, 51 or 71.
- At least two of the at least three cell membrane polypeptides in the multi subunit protein module consist of SEQ ID NO: 23,51 or 71.
- a polypeptide dimer wherein each of the polypeptides in the dimer comprises an amino acid sequence of FcRy capable of transmitting an activating signal (e.g. FcRy intracellular domain) and a dimerizing moiety (e.g. FcRy transmembrane domain); and
- a polypeptide comprising an extracellular binding domain capable of binding a target presented by a target cell of an immune cell (e.g. CD64 extracellular domain, scFv), an amino acid sequence capable of recruiting the polypeptide dimer following binding of the binding domain the target (e.g. CD64 transmembrane domain) and an amino acid sequence of FcRy capable of transmitting an activating signal (e.g. FcRy intracellular domain), such that upon binding of the extracellular binding domain to the target the activating signal is transmitted in an immune cell expressing the multi subunit protein module.
- an extracellular binding domain capable of binding a target presented by a target cell of an immune cell
- an amino acid sequence capable of recruiting the polypeptide dimer following binding of the binding domain the target
- an amino acid sequence of FcRy capable of transmitting an activating signal
- an activating signal e.g. FcRy intracellular domain
- the multi subunit protein module comprises:
- a polypeptide comprising a CD64 extracellular domain, a CD64 transmembrane domain and an FcRy intracellular domain.
- FIG. 2B A non-limiting example of such a multi subunit protein module is schematically demonstrated in Figure 2B.
- each of the polypeptides in the polypeptide dimer of (i) comprises SEQ ID NO: 23, 51 or 71 and the polypeptide of (ii) comprises SEQ ID NO: 19 or 49.
- each of the polypeptides in the polypeptide dimer of (i) consists of SEQ ID NO: 23, 51 or 71 and the polypeptide of (ii) consists of SEQ ID NO: 19 or 49.
- the multi subunit protein module comprises:
- a polypeptide comprising a scFv, a CD64 transmembrane domain and an FcRy intracellular domain.
- each of the polypeptides in the polypeptide dimer of (i) comprises SEQ ID NO: 23, 51 or 71 and the polypeptide of (ii) comprises SEQ ID NO: 52.
- each of the polypeptides in the polypeptide dimer of (i) consists of SEQ ID NO: 23, 51 or 71 and the polypeptide of (ii) consists of SEQ ID NO: 52.
- any of the polypeptides disclosed herein can comprise a co-stimulatory signaling domain.
- the at least one polypeptide comprising the extracellular binding domain comprises a co- stimulatory signaling domain.
- the polypeptide devoid of the extracellular binding domain comprises a co-stimulatory signaling domain.
- polypeptides disclosed herein do not comprise a co-stimulatory signaling domain.
- the at least one polypeptide comprising the extracellular binding domain does not comprise a co- stimulatory signaling domain.
- the polypeptide devoid of the extracellular binding domain does not comprise a co- stimulatory signaling domain.
- co- stimulatory signaling domain refers to an amino acid sequence of a co- stimulatory molecule capable of transmitting a secondary stimulatory signal resulting in activation of an immune cell (e.g. T cell).
- a co-stimulatory signaling domain does not comprise an IT AM domain.
- co- stimulatory signaling domains Any known co- stimulatory signaling domain can be used with specific embodiments of the present invention.
- co- stimulatory signaling domains include 4- IBB, CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFAl(CDlla), CD2.
- Non-limiting schematic representations of costimulatory domains that can be added to the polypeptide of some embodiments of the invention are provided in Figure 16.
- the co- stimulatory signaling domain is of 4- IBB and/or 0X40.
- Non-limiting examples of specific sequences of co-stimulatory signaling domains are provided in SEQ ID Nos: 25 (0X40), SEQ ID NO: 26 (4-1BB).
- any of the polypeptides disclosed herein can comprise a cytokine receptor signaling domain.
- the at least one polypeptide comprising the extracellular binding domain comprises a cytokine receptor signaling domain.
- the polypeptide devoid of the extracellular binding domain comprises cytokine receptor signaling domain.
- polypeptides disclosed herein do not comprise a cytokine receptor signaling domain.
- the at least one polypeptide comprising the extracellular binding domain does not comprise a cytokine receptor signaling domain.
- the polypeptide devoid of the extracellular binding domain does not comprise a cytokine receptor signaling domain.
- cytokine receptor signaling domain refers to an amino acid sequence of a cytokine receptor capable of transmitting a stimulatory signal resulting in activation of the T cell.
- cytokine receptor signaling domains include IL2rg that is the IL2 receptor common gamma chain (e.g. such as provided e.g. in SEQ ID NO: 27), the Toll/ILl receptor homology domain (TIR) that is the signaling domain of the myd88 receptor, TNF receptor intracellular domain (e.g. such as provided in SEQ ID NO: 28), IL12-Rbl intracellular domain (e.g. such as provided in SEQ ID NO: 29), IL12-Rbl intracellular domain (e.g. such as provided in SEQ ID NO: 30), IL23 receptor intracellular domain (e.g.
- IFNy receptor 1 intracellular domain e.g. such as provided in SEQ ID NO: 32
- IFNy receptor 2 intracellular domain e.g. such as provided in SEQ ID NO: 33
- IL2Rb intracellular domain e.g. such as provided in SEQ ID NO: 34
- IL1 receptor intracellular domain e.g. such as provided in SEQ ID NO: 35
- ILlAcP receptor intracellular domain e.g. such as provided in SEQ ID NO: 36.
- Non-limiting schematic representations of cytokine receptor signaling domains that can be added to the polypeptide of some embodiments of the invention are provided in Figure 16.
- any of the components comprised in a single polypeptide as described herein may be linked to each other directly of via a linker, each possibility represents a separate embodiment of the present invention.
- the linker may be derived from naturally-occurring multi-domain proteins or is an empirical linker as described, for example, in Chichili et ah, (2013), Protein Sci. 22(2): 153-167, Chen et al, (2013), Adv Drug Deliv Rev. 65(10): 1357-1369, the entire contents of which are hereby incorporated by reference.
- the linker may be designed using linker designing databases and computer programs such as those described in Chen et al., (2013), Adv Drug Deliv Rev. 65(10): 1357-1369 and Crasto et al., (2000), Protein Eng. 13(5):309-312, the entire contents of which are hereby incorporated by reference.
- the linker is a synthetic linker.
- the linker is a polypeptide.
- the linker is a GGGGSGGGGSGGGGS (SEQ ID NO: 59) linker.
- the light chain and the heavy chain of the antibody are linked via a linker, for example SEQ ID NO: 59.
- the linker comprises the extracellular Ig D3 domain of CD64 (e.g. SEQ ID NO: 60-61).
- the antibody e.g. scFv
- a linker for example SEQ ID NO: 60 or 61
- the multi subunit protein module is produced by recombinant DNA technology.
- At least one polynucleotide encoding the multi subunit protein module is provided.
- At least one polynucleotide encoding a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell, such that upon binding of said extracellular binding domain to said target said activating signal is transmitted in an immune cell expressing said multi subunit protein module.
- FcRy Fc receptor common g chain
- At least one polynucleotide encoding a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises a transmembrane domain of CD64 and an extracellular binding domain of CD64 capable of binding an Fc ligand; and wherein said polypeptides comprising said amino acid sequence of FcRy and not comprising said binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of said FcRy, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in an immune cell expressing said multi subunit protein module.
- FcRy Fc receptor common g chain
- polynucleotide refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence and/or a composite polynucleotide sequences (e.g., a combination of the above).
- This term includes polynucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions, which function similarly to the respective naturally occurring portions.
- naturally occurring nucleic acids molecules e.g., RNA or DNA
- synthetic polynucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone)
- synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions which function similarly to the respective naturally occurring portions.
- modified polynucleotide may comprise modification in either backbone, internucleoside linkages or bases.
- Modified polynucleotides may be preferred over native forms according to specific embodiments, because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
- the polynucleotide is a modified polynucleotide e.g. modified RNA.
- the at least one polynucleotide comprises a nucleic acid sequence encoding a first polypeptide comprising an extracellular and a transmembrane domain of CD64 and an intracellular domain of FcRy; and a nucleic acid sequence encoding a second distinct polypeptide comprising an extracellular, a transmembrane and an intracellular domain of FcRy.
- the at least three cell membrane polypeptides described herein are encoded by a single polynucleotide. Further description on expression of multiple polypeptides from a single polynucleotide is provided hereinbelow.
- the at least one polynucleotide is one polynucleotide.
- polynucleotides are used to encode the polypeptides of the multi subunit protein module.
- the at least three cell membrane polypeptides described herein are encoded by different polynucleotides.
- the at least one polypeptide comprising the extracellular binding domain disclosed herein is encoded by a first polynucleotide and the polypeptides not comprising the extracellular binding domain disclosed herein are encoded by a second polynucleotide.
- the at least one polynucleotide is at least two polynucleotides.
- the at least one polynucleotide is two polynucleotides.
- a polynucleotide sequence encoding the polypeptide(s) is preferably ligated into a nucleic acid construct suitable for cell expression.
- a nucleic acid construct includes at least one cis-acting regulatory element for directing expression of the nucleic acid sequence.
- Cis-acting regulatory sequences include those that direct constitutive expression of a nucleotide sequence as well as those that direct inducible expression of the nucleotide sequence only under certain conditions.
- a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner is included in the nucleic acid construct.
- mRNA since gene expression from an RNA source does not require transcription, there is no need in a promoter sequence or the additional sequences involved in transcription described hereinbelow.
- the nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration (e.g., shuttle vectors).
- a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
- such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
- the nucleic acid construct of some embodiments of the invention typically includes or encodes a signal sequence for targeting the polypeptide to the cell surface.
- the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
- Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
- the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
- the other upstream promoter elements determine the rate at which transcription is initiated.
- the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed, i.e. T cells.
- T cell specific promoters include lymphoid specific promoters [Calame et ah, (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et ah, (1989) EMBO J. 8:729- 733]
- Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma vims, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia vims, murine or Rous sarcoma vims and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
- CMV cytomegalovirus
- the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
- Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation.
- Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
- Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
- a vector may also include a transcription terminator (e.g., from Bovine Growth Hormone (BGH) gene), an element allowing episomal replication and replication in prokaryotes (e.g. SV40 origin and ColEl or others known in the art) and/or elements to allow selection (e.g., ampicillin resistance gene and/or zeocin marker).
- BGH Bovine Growth Hormone
- the expression vector can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or transduced through viral vectors.
- the selectable marker may be carried on a separate polynucleotide and used in a co- transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells.
- Useful selectable markers include, for example, antibiotic -resistance genes, such as neo and the like. Reporter genes maybe be used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences.
- a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the vector has been introduced into the host cells.
- Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et ah, 2000 FEBS Letters 479: 79-82).
- the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
- a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
- the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
- the expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) or a self-cleavable peptide; and sequences for genomic integration of the promoter-chimeric polypeptide.
- IRS internal ribosome entry site
- a self-cleavable peptide sequences for genomic integration of the promoter-chimeric polypeptide.
- polypeptides of the multi subunit protein module described herein are expressed from distinct constructs.
- the polypeptides of the multi subunit protein module described herein are expressed from a single construct in a multicistronic e.g. bicistronic manner.
- a multicistronic e.g. bicistronic manner Such an expression can be achieved by method well known in the art such as, but not limited to, using internal ribosome entry site (IRES) sequence and/or a nucleic acid sequence encoding a self-cleavable peptide e.g. a 2A peptide (e.g. P2A, T2A, E2A).
- IRS internal ribosome entry site
- the polynucleotide or construct comprises a self-cleavable peptide (e.g. 2A skipping peptide, e.g. such as provided in SEQ ID NOs: 76-77).
- a self-cleavable peptide e.g. 2A skipping peptide, e.g. such as provided in SEQ ID NOs: 76-77.
- the polynucleotide or construct comprises an IRES sequence or a nucleic acid sequence encoding a self-cleavable peptide e.g. a 2A peptide between a nucleic acid sequence encoding a first polypeptide comprising an extracellular and a transmembrane domain of CD64 and an intracellular domain of FcRy and a nucleic acid sequence encoding a second distinct polypeptide comprising an extracellular, a transmembrane and an intracellular domain of FcRy.
- a self-cleavable peptide e.g. a 2A peptide between a nucleic acid sequence encoding a first polypeptide comprising an extracellular and a transmembrane domain of CD64 and an intracellular domain of FcRy and a nucleic acid sequence encoding a second distinct polypeptide comprising an extracellular, a transmembrane and an intracellular domain of FcRy.
- a specific example of a polynucleotide encompassed by specific embodiments of the present invention comprises sequentially from 5’ to 3’ nucleic acid sequences encoding an extracellular domain of CD64, a transmembrane domain of CD64, an intracellular domain of FcRy, a 2A skipping peptide, an extracellular domain of FcRy, a transmembrane domain of FcRy and an intracellular domain of FcRy.
- the extracellular domain of CD64 the transmembrane domain of CD64 and the intracellular domain of FcRy are translationally fused.
- the extracellular, transmembrane and intracellular domains of FcRy are translationally fused.
- Non-limiting examples of nucleic acid constructs encoding the multi subunit protein module of some embodiments of the invention are provided in SEQ ID NO: 4, 63 and 38.
- the individual elements comprised in the expression vector can be arranged in a variety of configurations.
- enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding the polypeptide can be arranged in a "head- to-tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.
- a vector can be directly transduced into a cell, e.g., an immune cell e.g. a T cell or a NK cell.
- the vector is a cloning or expression vector, e.g., a vector including, but not limited to, one or more plasmids (e.g., expression plasmids, cloning vectors, minicircles, minivectors, double minute chromosomes), retroviral and lentiviral vector constructs.
- the vector is capable of expressing the polynucleotide in mammalian e.g. human T cells.
- the vector is capable of expressing the polynucleotide in mammalian e.g. human NK cell.
- mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pGF3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
- Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
- SV40 vectors include pSVT7 and pMT2.
- Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205.
- exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovims pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor vims promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types.
- the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the host cell.
- the ability to select suitable vectors for transforming T cells is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.
- infectious and “transducing”, which are interchangeably used herein, refer to modification of cells through use of a viral vector.
- Recombinant viral vectors are useful for expression of the polypeptides of some embodiments of the invention since they offer advantages such as lateral infection and targeting specificity.
- Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny.
- Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
- an expression vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art.
- the expression vector can be transferred into a host cell by physical, chemical, or biological means.
- Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al, 2012, MOLECULAR CLONING: A LABORATORY MANUAL, volumes 1 -4, Cold Spring Harbor Press, NY). An alternative method for the introduction of a polynucleotide into a host cell is lipofection, e.g., using Lipofectamine (Life Technologies).
- Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors.
- Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
- Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex vims I, adenoviruses and adeno-associated viruses, and the like.
- Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
- An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
- Other methods of state-of-the-art targeted delivery of nucleic acids are available, such as delivery of polynucleotides with targeted nanoparticles or other suitable sub micron sized delivery system.
- an exemplary delivery vehicle is a liposome.
- lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo).
- the nucleic acid may be associated with a lipid.
- the nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid.
- Lipid, lipid/DNA or lipid/expression vector associated compositions are not limited to any particular structure in solution.
- Lipids are fatty substances which may be naturally occurring or synthetic lipids.
- lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
- Lipids suitable for use can be obtained from commercial sources.
- DMPC dimyristyl phosphatidylcholine
- DCP dicetyl phosphate
- Choi cholesterol
- DMPG dimyristyl phosphatidylglycerol
- Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about -20°C. Chloroform is used as the only solvent since it is more readily evaporated than methanol.
- Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et ah, 1991 Glycobiology 5: 505-10).
- compositions that have different structures in solution than the normal vesicular structure are also encompassed.
- the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules.
- lipofectamine- nucleic acid complexes are also contemplated.
- Methods of the embodiments may concern transfecting the cells with a DNA encoding the multi subunit protein module described herein and, in some cases, a transposase.
- Such methods of transfecting of cells may also employ highly efficient transfections methods, such as electroporation.
- nucleic acids may be introduced into cells using a nucleofection apparatus. If such methods are employed, the transfection step preferably does not involve infecting or transducing the cells with virus, which can cause genotoxicity and/or lead to an immune response to cells containing viral sequences in a treated subject.
- Such methods may involve transfecting cells with an expression vector encoding the multi subunit protein module.
- a wide range of constructs and expression vectors for the same are known in the art and are further detailed herein.
- the expression vector is a DNA expression vector such as a plasmid, linear expression vector or an episome.
- the vector comprises additional sequences, such as sequence that facilitate expression of the polynucleotide, such a promoter, enhancer, poly- A signal, and/or one or more introns.
- the coding sequence is flanked by transposon sequences, such that the presence of a transposase allows the coding sequence to integrate into the genome of the transfected cell.
- the transposase is provided as DNA expression vector.
- the transposase is provided as an expressible RNA or a protein such that long-term expression of the transposase does not occur in the transgenic cells.
- the transposase may be provided as an mRNA (e.g., an mRNA comprising a cap and poly-A tail). Any transposase system may be used in accordance with the embodiments.
- the transposase is salmonid-type Tcl-like transposase (SB).
- the transposase can be the so called “Sleeping beauty” transposase, see e.g., U.S. Pat. No. 6,489,458, incorporated herein by reference.
- the transposase is an engineered enzyme with increased enzymatic activity.
- Some specific examples of transposases include, without limitation, SB 10, SB 11 or SBlOOx transposase (see, e.g., Mates et ah, 2009, incorporated herein by reference).
- a method can involve electroporation of cells with a mRNA encoding a SB 10, SB 11 or SBlOOx transposase.
- assays include, for example, "molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
- molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR
- biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
- Modification of cells to express the multi subunit protein modules may be performed with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno- associated virus (AAV) and lipid-based systems.
- viral or non-viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno- associated virus (AAV) and lipid-based systems.
- Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et ah, Cancer Investigation, 14(1): 54-65 (1996)].
- preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
- a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus -defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
- Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the vims used, unless it is already present in the viral construct.
- a construct typically includes a signal sequence for targeting the polypeptide to the desired site in a cell.
- the signal sequence comprises a membrane trafficking sequence.
- the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
- such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
- Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
- Specific embodiments of the present invention also contemplate immune cells expressing the multi subunit protein module described herein and method of generating same.
- an immune cell genetically engineered to express the at least one polynucleotide.
- an immune cell expressing the at least one polynucleotide.
- an immune cell expressing at least one polynucleotide encoding a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell, such that upon binding of said extracellular binding domain to said target said activating signal is transmitted in the immune cell.
- FcRy Fc receptor common g chain
- an immune cell expressing at least one polynucleotide encoding a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises a transmembrane domain of CD64 and an extracellular binding domain of CD64 capable of binding an Fc ligand; and wherein said polypeptides comprising said amino acid sequence of FcRy and not comprising said binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of said FcRy, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in the immune cell.
- FcRy Fc receptor common g chain
- an immune cell expressing the multi subunit protein module.
- an immune cell expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface of a target cell of an immune cell, such that upon binding of said extracellular binding domain to said target said activating signal is transmitted in the immune cell.
- FcRy Fc receptor common g chain
- an immune cell expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises a transmembrane domain of CD64 and an extracellular binding domain of CD64 capable of binding an Fc ligand; and wherein said polypeptides comprising said amino acid sequence of FcRy and not comprising said binding domain comprise as a dimerizing moiety an amino acid sequence of a transmembrane domain of said FcRy, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in the immune cell.
- FcRy Fc receptor common g chain
- a method of expressing a multi subunit protein module in an immune cell comprising introducing into an immune cell the at least one polynucleotide, under conditions which allow expression of said multi subunit protein module.
- Such conditions may be for example an appropriate temperature (e.g., 37 °C), atmosphere (e.g., air plus 5 % CO2), pH, light, medium, supplements and the like.
- an appropriate temperature e.g., 37 °C
- atmosphere e.g., air plus 5 % CO2
- pH e.g., pH, light, medium, supplements and the like.
- the introducing is effected in-vivo.
- the introducing is effected in-vitro or ex-vivo.
- PBMCs can be isolated by drawing whole blood from a subject and collection in a container containing an anti-coagulant (e.g. heparin or citrate); and apheresis.
- an anti-coagulant e.g. heparin or citrate
- the immune cells are obtained from a tissue comprising cells associated with a pathology.
- Methods for obtaining a tissue sample from a subject are well known in the art and include e.g. biopsy, surgery or necropsy and preparing a single cell suspension thereof.
- at least one type of an immune cell is purified from the peripheral blood or from the single cell suspension.
- the immune cell is a human cell.
- the immune cell is of a healthy subject.
- the immune cell is of a subject suffering from a pathology (e.g. cancer).
- a pathology e.g. cancer
- Non-limiting examples of immune cells that can be used with specific embodiments of the invention include T cells, NK cells, NKT cells, B cells, macrophages, monocytes, dendritic cells (DCs) and granulocytes.
- the immune cell is selected from the group consisting of T cells, NK cells and NKT cells.
- the immune cell does not express an endogenous FcRy, as determined by flow cytometry or western blot.
- the immune cell is a T cell.
- a T cell expressing a polypeptide complex
- the polypeptide complex comprises at least a first polypeptide and a second polypeptide, wherein said first and second polypeptides are not translationally fused
- the first polypeptide comprises an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal and forming a homodimer
- said second polypeptide comprising: (i) an extracellular ligand-binding domain of an Fey receptor (e.g. CD64) capable of binding an Fc ligand,
- an amino acid sequence capable of recruiting said first polypeptide e.g. the transmembrane domain of an Fc receptor, such that upon binding of said Fc ligand to said extracellular ligand-binding domain of said Fey receptor said activating signal is transmitted.
- polypeptide complex refers to a plurality of at least two distinct (i.e. not translationally fused) polypeptides which together have the activity of transmitting an activating signal in an immune cell expressing the polypeptide complex upon binding of the extracellular domain of the Fey receptor to its Fc ligand.
- T cell refers to a differentiated lymphocyte with a CD3+, T cell receptor (TCR)+ having either CD4+ or CD8+ phenotype.
- the T cell is an effector cell.
- effector T cell refers to a T cell that activates or directs other immune cells e.g. by producing cytokines or has a cytotoxic activity e.g., CD4+, Thl/Th2, CD8+ cytotoxic T lymphocyte.
- the T cell is a CD4+ T cell.
- the T cell is a CD8+ T cell.
- the T cell is a ab T cell.
- the T cell is a gd T cell.
- the T cell is a naive T cell.
- the T cell is a memory T cell.
- memory T cells include effector memory CD4+ T cells with a CD3+/CD4+/CD45RA-/CCR7- phenotype, central memory CD4+ T cells with a CD3+/CD4+/CD45RA-/CCR7+ phenotype, effector memory CD8+ T cells with a CD3+/CD8+ CD45RA-/CCR7 -phenotype and central memory CD8+ T cells with a CD3+/CD8+ CD45RA-/CCR7+ phenotype.
- the T cell is a proliferating cell.
- the phrase ’’proliferating cell refers to a T cell that proliferated upon stimulation as defined by a cell proliferation assay, such as, but not limited to, CFSE staining, MTS, Alamar blue, BRDU, thymidine incorporation, and the like.
- the T cell is a proliferating CD4+ T cell.
- the T cell is a proliferating CD8+ T cell.
- the T cell is expressing a T cell receptor specific for a pathologic (diseased, e.g. cancerous) cell, i.e. recognizes an antigen presented in the context of MHC which is overexpressed or only expressed by a pathologic cell as compared to a non- pathologic cell.
- pathologic diseased, e.g. cancerous
- Non-limiting examples of cancer antigens are further described hereinabove.
- the T cell is endogenously expressing a T cell receptor specific for a pathologic cell (e.g. cancerous cell).
- a pathologic cell e.g. cancerous cell
- the T cell is an engineered T cells transduced with a T cell receptor (TCR).
- TCR T cell receptor
- the phrase "transduced with a TCR” or “genetically engineered to express a TCR” refers to cloning of variable a- and i-chains from T cells with specificity against a desired antigen presented in the context of MHC.
- Methods of transducing with a TCR are known in the art and are disclosed e.g. in Nicholson et al. Adv Hematol. 2012; 2012:404081; Wang and Riviere Cancer Gene Ther. 2015 Mar;22(2):85-94); and Lamers et al, Cancer Gene Therapy (2002) 9, 613— 623.
- the TCR is specific for a pathologic cell.
- the T cell is an engineered T cells transduced with a chimeric antigen receptor (CAR).
- CAR chimeric antigen receptor
- the phrase "transduced with a CAR” or “genetically engineered to express a CAR” refers to cloning of a nucleic acid sequence encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen recognition moiety and a T-cell activation moiety.
- a chimeric antigen receptor (CAR) is an artificially constructed hybrid protein or polypeptide containing an antigen binding domain of an antibody (e.g., a single chain variable fragment (scFv)) linked to T-cell signaling or T-cell activation domains.
- scFv single chain variable fragment
- the antigen recognition moiety is specific for a pathologic cell.
- the T cell is not transduced (i.e. does not express) a CAR.
- the immune cells comprise NK cells.
- NK cells refers to differentiated lymphocytes with a CD 16+ CD56+ and/or CD57+ TCR- phenotype. NK are characterized by their ability to bind to and kill cells that fail to express “self’ MHC/HLA antigens by the activation of specific cytolytic enzymes, the ability to kill tumor cells or other diseased cells that express a ligand for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit the immune response.
- the immune cells comprise NKT cells.
- NKT cells refers to a specialized population of T cells that express a semi-invariant ab T-cell receptor, but also express a variety of molecular markers that are typically associated with NK cells, such as NK1.1.
- NKT cells include NK1.1+ and NK1.1-, as well as CD4+, CD4-, CD8+ and CD8- cells.
- the TCR on NKT cells is unique in that it recognizes glycolipid antigens presented by the MHC I-like molecule CD Id. NKT cells can have either protective or deleterious effects due to their abilities to produce cytokines that promote either inflammation or immune tolerance.
- the immune cells comprise B cells.
- B cells refers to a lymphocyte with a B cell receptor (BCR)+, CD 19+ and or B220+ phenotype. B cells are characterized by their ability to bind a specific antigen and elicit a humoral response.
- BCR B cell receptor
- the immune cells comprise phagocytic cells.
- phagocytic cells refer to a cell that is capable of phagocytosis and include both professional and non-professional phagocytic cells. Methods of analyzing phagocytosis are well known in the art and include for examples killing assays, flow cytometry and/or microscopic evaluation (live cell imaging, fluorescence microscopy, confocal microscopy, electron microscopy). According to specific embodiments, the phagocytic cells are selected from the group consisting of monocytes, dendritic cells (DCs) and granulocytes.
- DCs dendritic cells
- the immune cells comprise monocytes.
- monocytes refers to both circulating monocytes and to macrophages (also referred to as mononuclear phagocytes) present in a tissue.
- the monocytes comprise macrophages.
- cell surface phenotype of macrophages include CD14, CD40, CDllb, CD64, F4/80 (mice)/EMRl (human), lysozyme M, MAC-l/MAC-3 and CD68.
- the monocytes comprise circulating monocytes.
- cell surface phenotypes of circulating monocytes include CD14 and CD16 (e.g. CD14++ CD16-, CD14+CD16++, CD14++CD16+).
- the immune cells comprise DCs.
- DCs dendritic cells
- DCs refers to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues.
- DCs are a class of professional antigen presenting cells, and have a high capacity for sensitizing HLA- restricted T cells.
- DCs include, for example, plasmacytoid dendritic cells, myeloid dendritic cells (including immature and mature dendritic cells), Langerhans cells, interdigitating cells, follicular dendritic cells.
- Dendritic cells may be recognized by function, or by phenotype, particularly by cell surface phenotype.
- cell surface phenotype of DCs include CDla+, CD4+, CD86+, or HLA-DR.
- the term DCs encompasses both immature and mature DCs.
- the immune cells comprise granulocytes.
- granulocytes refer to polymorphonuclear leukocytes characterized by the presence of granules in their cytoplasm.
- the granulocytes comprise neutrophils.
- the granulocytes comprise mast-cells.
- the immune cells can be freshly isolated, stored e.g., cryopreserved (i.e. frozen) at e.g. liquid nitrogen temperature at any stage for long periods of time (e.g., months, years) for future use; and cell lines.
- cryopreserved i.e. frozen
- liquid nitrogen temperature e.g. liquid nitrogen temperature at any stage for long periods of time (e.g., months, years) for future use; and cell lines.
- the immune cells can be stored in a cell bank or a depository or storage facility.
- immune cells e.g. T cells
- methods disclosed herein as, but not limited to, a source for adoptive immune cells therapies for diseases that can benefit from activating immune cells against pathologic cells e.g. a hyper-proliferative disease; a disease associated with immune suppression and infections.
- the immune cells disclosed herein are for use in adoptive cell therapy.
- the immune cells used according to specific embodiments of the present invention may be autologous or non- autologous; they can be syngeneic or non- syngeneic: allogeneic or xenogeneic to the subject; each possibility represents a separate embodiment of the present invention.
- the cells are autologous to said subject.
- the cells are non-autologous to said subject.
- the immune cells described herein are cultured, expanded and/or activated ex- vivo prior to administration to the subject.
- T cells may be activated ex vivo in the presence of one or more molecule such as, but not limited to, an anti-CD3 antibody, an anti-CD28 antibody, anti-CD3 and anti-CD28 coated beads (such as the CD3CD28 MACSiBeads obtained from Miltenyi Biotec), IL-2, phytohemoagglutinin, an antigen-loaded antigen presenting cell [APC, e.g. dendritic cell], a peptide loaded recombinant MHC.
- an anti-CD3 antibody an anti-CD28 antibody, anti-CD3 and anti-CD28 coated beads (such as the CD3CD28 MACSiBeads obtained from Miltenyi Biotec), IL-2, phytohemoagglutinin, an antigen-loaded antigen presenting cell [APC, e.g. dendritic cell], a peptide loaded recombinant MHC.
- APC antigen-loaded antigen presenting cell
- the immune cells of specific embodiments of the present invention are activated upon binding of the extracellular binding domain to a target presented on a cell surface of a target cell of an immune cell, they may be used for, but not limited to, treating diseases associated with pathologic cells presenting the target on their cell surface.
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the immune cell disclosed herein, wherein said pathologic cell presents said target on its cell surface, thereby treating the disease in the subject.
- the immune cell disclosed herein for use in treating a disease associated with a pathologic cell in a subject in need thereof, wherein said pathologic cell presents said target on its cell surface.
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of T cells expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface said pathologic cell, such that upon binding of said extracellular binding domain to said target said activating signal is transmitted in the T cells, thereby treating the disease in the subject.
- a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target
- a therapeutically effective amount of T cells expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain capable of binding a target that is presented on a cell surface a pathologic cell, such that upon binding of said extracellular binding domain to said target said activating signal is transmitted in the T cells, for use in treating a disease associated with said pathologic cell in a subject in need thereof.
- FcRy Fc receptor common g chain
- the immune cells of specific embodiments of the present invention are activated upon binding of the extracellular binding domain to a target bound to a cell surface of a pathologic cell, they may be used for, but not limited to, treating diseases associated with pathologic cells in combination with a therapeutic composition comprising the target which is directed for binding the pathologic cells, i.e. binds an antigen overexpressed or only expressed by a pathologic (e.g. cancerous) cell as compared to a non-pathologic cell.
- a pathologic e.g. cancerous
- the subject is treated with a therapeutic composition comprising said target, said therapeutic composition being specific for said pathologic cell.
- the therapeutic composition comprising the Fc domain is specific for a pathologic cell.
- the method comprises administering to said subject a therapeutically effective amount of a therapeutic composition comprising said target, said therapeutic composition being specific for said pathologic cell.
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the immune cell disclosed herein, and a therapeutic composition comprising said target, said therapeutic composition being specific for said pathologic cell, thereby treating the disease in the subject.
- the immune cell disclosed herein and a therapeutic composition comprising said target, for use in treating a disease associated with a pathologic cell in a subject in need thereof, wherein said therapeutic composition being specific for said pathologic cell.
- the term “subject” or “subject in need thereof’ includes mammals, preferably human beings at any age or gender.
- the subject may be healthy or showing preliminary signs of a pathology, e.g. cancer. This term also encompasses individuals who are at risk to develop the pathology.
- treating refers to curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a disease or disorder (e.g. cancer).
- a disease or disorder e.g. cancer
- Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology (e.g. a malignancy), as discussed below.
- the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.
- disease associated with a pathologic cell means that pathologic cells drive onset and/or progression of the disease.
- the disease can benefit from activating the immune cells of the subject.
- a disease that can benefit from activating immune cells refers to diseases in which the subject’s immune response activity may be sufficient to at least ameliorate symptoms of the disease or delay onset of symptoms, however for any reason the activity of the subject’s immune response in doing so is less than optimal.
- Non-limiting examples of diseases treated by some embodiments of the invention include hyper-proliferative diseases, diseases associated with immune suppression, immunosuppression caused by medication (e.g. mTOR inhibitors, calcineurin inhibitor, steroids) and infections.
- medication e.g. mTOR inhibitors, calcineurin inhibitor, steroids
- the disease comprises an infection.
- infection refers to a disease induced by a pathogen.
- pathogens include, viral pathogens, bacterial pathogens e.g., intracellular mycobacterial pathogens (such as, for example, Mycobacterium tuberculosis), intracellular bacterial pathogens (such as, for example, Listeria monocytogenes), or intracellular protozoan pathogens (such as, for example, Leishmania and Trypanosoma).
- viral pathogens causing infectious diseases include, but are not limited to, retroviruses, circoviruses, parvoviruses, papovaviruses, adenoviruses, herpesviruses, iridoviruses, poxviruses, hepadnaviruses, picomaviruses, caliciviruses, togaviruses, flavivimses, reovimses, orthomyxoviruses, paramyxoviruses, rhabdoviruses, bunyavimses, coronaviruses, arenaviruses, and filoviruses.
- viral infections which may be treated according to specific embodiments of the present invention include, but are not limited to, human immunodeficiency virus (HlV)-induced acquired immunodeficiency syndrome (AIDS), influenza, rhinoviral infection, viral meningitis, Epstein-Barr vims (EBV) infection, hepatitis A, B or C virus infection, measles, papilloma vims infection/warts, cytomegalovims (CMV) infection, Herpes simplex vims infection, yellow fever, Ebola vims infection, rabies, etc.
- HlV human immunodeficiency virus
- AIDS human immunodeficiency virus
- AIDS human immunodeficiency virus
- AIDS human immunodeficiency virus
- rhinoviral infection HIV
- viral meningitis Epstein-Barr vims
- EBV Epstein-Barr vims
- hepatitis A, B or C virus infection measles
- the disease comprises a hyper-proliferative disease.
- the hyper-proliferative disease comprises sclerosis, fibrosis, Idiopathic pulmonary fibrosis, psoriasis, systemic sclerosis/scleroderma, primary biliary cholangitis, primary sclerosing cholangitis, liver fibrosis, prevention of radiation-induced pulmonary fibrosis, myelofibrosis or retroperitoneal fibrosis.
- the hyper-proliferative disease comprises cancer.
- the pathologic cell is a cancerous cell.
- Cancers which may be treated by some embodiments of the invention can be any solid or non- solid tumor (including liquid cancer), cancer metastasis and/or a pre-cancer.
- the cancer is a malignant cancer.
- cancer examples include but are not limited to, carcinoma, blastoma, sarcoma and lymphoma. More particular examples of such cancers include, but are not limited to, tumors of the gastrointestinal tract (colon carcinoma, rectal carcinoma, colorectal carcinoma, colorectal cancer, colorectal adenoma, hereditary nonpolyposis type 1, hereditary nonpolyposis type 2, hereditary nonpolyposis type 3, hereditary nonpolyposis type 6; colorectal cancer, hereditary nonpolyposis type 7, small and/or large bowel carcinoma, esophageal carcinoma, tylosis with esophageal cancer, stomach carcinoma, pancreatic carcinoma, pancreatic endocrine tumors), endometrial carcinoma, dermatofibrosarcoma protuberans, gallbladder carcinoma, Biliary tract tumors, prostate cancer, prostate adenocarcinoma, renal cancer (e.g., Wilms’ tumor type 2 or type 1), liver cancer (e
- the cancer is a pre-malignant cancer.
- Pre-cancers are well characterized and known in the art (refer, for example, to Berman JJ. and Henson DE., 2003. Classifying the pre-cancers: a metadata approach. BMC Med Inform Decis Mak. 3:8). Examples of pre-cancers include, but are not limited to, acquired small pre-cancers, acquired large lesions with nuclear atypia, precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer, and acquired diffuse hyperplasias and diffuse metaplasias.
- Non- limiting examples of small pre-cancers include HGSIL (High grade squamous intraepithelial lesion of uterine cervix), AIN (anal intraepithelial neoplasia), dysplasia of vocal cord, aberrant crypts (of colon), PIN (prostatic intraepithelial neoplasia).
- Non-limiting examples of acquired large lesions with nuclear atypia include tubular adenoma, AILD (angioimmunoblastic lymphadenopathy with dysproteinemia), atypical meningioma, gastric polyp, large plaque parapsoriasis, myelodysplasia, papillary transitional cell carcinoma in-situ, refractory anemia with excess blasts, and Schneiderian papilloma.
- Non-limiting examples of precursor lesions occurring with inherited hyperplastic syndromes that progress to cancer include atypical mole syndrome, C cell adenomatosis and MEA.
- Non-limiting examples of acquired diffuse hyperplasias and diffuse metaplasias include Paget's disease of bone and ulcerative colitis.
- glioblastomas or medulla blastomas head and/or neck cancer
- breast tumors including but not limited to circulatory system tumors (including but not limited to heart, mediastinum and pleura, and other intrathoracic organs, vascular tumors and tumor- associated vascular tissue); excretory system tumors (including but not limited to tumors of kidney, renal pelvis, ureter, bladder, other and unspecified urinary organs); gastrointestinal tract tumors (including but not limited to tumors of oesophagus, stomach, small intestine, colon, colorectal, rectosigmoid junction, rectum, anus and anal canal, tumors involving the liver and intrahepatic bile ducts, gall bladder, other and unspecified parts of biliary tract, pancreas, other and digestive organs); oral cavity tumors (including but not limited to tumors of lip, tongue, gum, floor of mouth, palate, and other parts of mouth, parotid gland, and other parts of the salivary glands
- small cell lung cancer or non-small cell lung cancer skeletal system tumors (including but not limited to tumors of bone and articular cartilage of limbs, bone articular cartilage and other sites); skin tumors (including but not limited to malignant melanoma of the skin, non-melanoma skin cancer, basal cell carcinoma of skin, squamous cell carcinoma of skin, mesothelioma, Kaposi's sarcoma); and tumors involving other tissues including peripheral nerves and autonomic nervous system, connective and soft tissue, retroperitoneum and peritoneum, eye and adnexa, thyroid, adrenal gland and other endocrine glands and related structures, secondary and unspecified malignant neoplasm of lymph nodes, secondary malignant neoplasm of respiratory and digestive systems and secondary malignant neoplasm of other sites.
- skeletal system tumors including but not limited to tumors of bone and articular cartilage of limbs, bone articular cartilage and other sites
- the solid tumor treated by the methods of the instant disclosure is pancreatic cancer, bladder cancer, colon cancer, liver cancer, colorectal cancer (colon cancer or rectal cancer), breast cancer, prostate cancer, renal cancer, hepatocellular cancer, lung cancer, ovarian cancer, cervical cancer, gastric cancer, esophageal cancer, head and neck cancer, melanoma, neuroendocrine cancers, CNS cancers, brain tumors, bone cancer, skin cancer, ocular tumor, choriocarcinoma (tumor of the placenta), sarcoma or soft tissue cancer.
- the solid tumor to be treated by the methods of the instant disclosure is selected bladder cancer, bone cancer, breast cancer, cervical cancer, CNS cancer, colon cancer, ocular tumor, renal cancer, liver cancer, lung cancer, pancreatic cancer, choriocarcinoma (tumor of the placenta), prostate cancer, sarcoma, skin cancer, soft tissue cancer or gastric cancer.
- the solid tumor treated by the methods of the instant disclosure is breast cancer.
- breast cancer that can be treated by the instant methods include ductal carcinoma in situ (DCIS or intraductal carcinoma), lobular carcinoma in situ (LCIS), invasive (or infiltrating) ductal carcinoma, invasive (or infiltrating) lobular carcinoma, inflammatory breast cancer, triple-negative breast cancer, paget disease of the nipple, phyllodes tumor (phylloides tumor or cystosarcoma phyllodes), angiosarcoma, adenoid cystic (or adenocystic) carcinoma, low-grade adenosquamous carcinoma, medullary carcinoma, papillary carcinoma, tubular carcinoma, metaplastic carcinoma, micropapillary carcinoma, and mixed carcinoma.
- DCIS ductal carcinoma in situ
- LCIS lobular carcinoma in situ
- invasive (or infiltrating) ductal carcinoma invasive (or infiltrating) lobular carcinoma
- inflammatory breast cancer triple-negative
- the solid tumor treated by the methods of the instant disclosure is bone cancer.
- bone cancer that can be treated by the instant methods include osteosarcoma, chondrosarcoma, the Ewing Sarcoma Family of Tumors (ESFTs).
- the solid tumor treated by the methods of the instant disclosure is skin cancer.
- skin cancer that can be treated by the instant methods include melanoma, basal cell skin cancer, and squamous cell skin cancer.
- the solid tumor treated by the methods of the instant disclosure is ocular tumor.
- ocular tumor that can be treated by the methods of the instant disclosure include ocular tumor is choroidal nevus, choroidal melanoma, choroidal metastasis, choroidal hemangioma, choroidal osteoma, iris melanoma, uveal melanoma, intraocular lymphoma, melanocytoma, metastasis retinal capillary hemangiomas, congenital hypertrophy of the RPE, RPE adenoma or retinoblastoma.
- cancers that are treated are liquid cancers.
- liquid cancers that can be treated by the methods provided herein include, but are not limited to, leukemias, myelomas, and liquid lymphomas.
- liquid cancers that can be treated in accordance with the methods described include, but are not limited to, liquid lymphomas, leukemias, and myelomas.
- Exemplary liquid lymphomas and leukemias that can be treated in accordance with the methods described include, but are not limited to, acute myelogenous leukemia (AML), myelodysplastic syndromes (MDS), chronic lymphocytic leukemia/small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma (such as waldenstrom macroglobulinemia), splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, monoclonal immunoglobulin deposition diseases, heavy chain diseases, extranodal marginal zone B cell lymphoma, also called malt lymphoma, nodal marginal zone B cell lymphoma (nmzl), follicular lymphoma, mantle cell lymphoma, diffuse large B cell lymphoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma,
- myelodysplastic syndromes is a heterogenous group of clonal, hematopoietic stem cell disorders characterized by distinct morphological bone marrow changes, abnormal blood counts, common cytogenetic abnormalities, and recurrent mutations. MDS can predominantly occur in the elderly. Treatment of MDS can be based on risk stratification, with the International Prognostic Scoring System (IPSS) or revised IPSS (IPSS-R) being the most common classification systems. Low-risk MDS patients can receive supportive care or hematopoietic growth factors. A subset of patients with 5q deletions can be treated with lenalidomide.
- IPS International Prognostic Scoring System
- IPSS-R revised IPSS
- High-risk patients can be treated with hypomethylating agents (e.g., azacitidine, decitabine), intensive chemotherapy, and/or allogeneic stem cell transplantation.
- MDS patients can be transformed to AML.
- Some MDS patients can develop progressive bone marrow failure and/or die of complications related to neutropenia (e.g., infection) or thrombocytopenia (e.g., bleeding).
- Initial management of MDS can be based on risk stratification.
- the newer IPSS-R can place patients into 5 categories: very good, good, intermediate, high, and very-high risk groups.
- DNMTs DNA-methyltransferases
- AML acute myeloid leukemia
- AML can be caused by chemical exposure, prior chemotherapy and radiation, or other environmental toxins.
- the cancer is selected from the group consisting of melanoma, lymphoma, colon cancer, lung cancer, breast cancer and pancreatic cancer.
- the cancer is melanoma or lymphoma.
- the cancer or the cancerous cell expresses a marker selected from the group consisting of PDL-1, E-Cadherin, CD19, MUC1, TRP-1 and TRP-2.
- the cancer or the cancerous cell expresses PDL-1.
- the immune cells are administered to the subject in combination with a therapeutic composition comprising the target.
- the therapeutic composition comprises an Fc domain.
- Therapeutic compositions comprising Fc domains specific for pathologic cells are well known in the art and include, but not limited to, Fc-fusion proteins and antibodies.
- the Fc domain is of an IgG antibody.
- the therapeutic composition is an Fc-fusion protein.
- Fc-fusion protein refers to a molecule comprising an amino acid sequence capable of binding a pathologic cell (i.e. an antigen overexpressed or only expressed on a pathologic cell) combined with an Fc domain of an antibody.
- Fc-fusion protein used is well within the capability of those skilled in the art, and depends on the type of the disease and the antigens expressed by the pathologic cells associated with the pathology.
- Fc-fusion proteins that can be used with specific embodiments are disclosed in Weidle et al. Cancer Genomics and Proteomics (2012) 9(6): 357-372; and Sioud et al. Molecular Therapy - Methods & Clinical Development (2015) 2, 15043, the contents of which is fully incorporated herein by reference.
- the therapeutic composition is an antibody. Selection of the therapeutic antibody used is well within the capability of those skilled in the art, and depends on the type of the disease and the antigens expressed by the pathologic cells associated with the pathology.
- the therapeutic antibody binds an antigen overexpressed or only expressed by tumor cells.
- tumor antigens are further described hereinabove.
- the antibody is an IgG antibody (e.g. IgGl, IgG2, IgG3, IgG4).
- the antibody isotype is IgGl or IgG3.
- the therapeutic antibody is an anti-TRP-1 or an anti- CD44 antibody.
- the therapeutic antibody is selected from the group consisting of Atezolizumab, Avelumab, Alemtuzumab, Cetuximab, Panitumumab, Nimotuzumab, Rituximab, Gatipotuzumab (previously known as PankoMab-GEX®), Trastuzumab, Alemtuzumab, Bevacizumab, Ofatumumab, Pertuzumab, ofatumumab, obinutuzumab and IVIG.
- the therapeutic antibody is selected from the group consisting of Atezolizumab, Rituximab, Cetuximab, Gatipotuzumab and IVIG.
- the therapeutic antibody is an anti-PDL-1.
- the cancerous cell expresses PDL-1 and the therapeutic antibody is an anti-PDL- 1.
- the antibody is Atezolizumab.
- a method of treating a disease associated with a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of:
- T cells expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain of CD64 capable of binding an Fc ligand, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in said T cell, thereby treating the disease in the subject.
- T cells expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain of CD64 capable of binding an Fc ligand, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in said T cell, for use in treating a disease associated with said pathologic cell in a subject in need thereof.
- a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain of CD64 capable of binding an Fc ligand, such that upon binding of said extracellular binding domain to said Fc ligand said activ
- a method of increasing the killing capacity of an antibody against a pathologic cell in a subject in need thereof comprising administering to the subject a therapeutically effective amount of:
- T cells expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain of CD64 capable of binding an Fc ligand, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in said T cell, thereby increasing the killing capacity of the antibody against the pathologic cell.
- the administration of the immune cells and the administration of the therapeutic composition can be effected in the same route or in separate routes.
- the administration of the immune cells may be following or concomitant with the therapeutic composition comprising the target.
- the immune cells disclosed herein are administered to the subject following treatment with the therapeutic composition comprising the target.
- the immune cells disclosed herein are administered to the subject concomitantly with the therapeutic composition comprising the target.
- administering the immune cells disclosed herein is effected following at least one administration of the therapeutic composition comprising the target.
- administering the cells disclosed herein is effected in a sequential order with the treatment with the therapeutic composition comprising the target.
- the multi subunit protein module is more efficient (e.g. at least 1.5 fold, at least 2 fold, at least 3 fold, at least 4 fold) in activating an immune cell (e.g. T cell) expressing the module following binding to the target as compared to an immune cell of the same type expressing only a single polypeptide comprising the extracellular binding domain capable of binding the target and the amino acid sequence of FcRy capable of transmitting the activating signal; or a peptide complex comprising a first polypeptide comprising the amino acid sequence of FcRy capable of transmitting the activating signal; and a second polypeptide comprising the extracellular binding domain capable of binding the target which is devoid of the amino acid sequence of FcRy capable of transmitting the activating signal.
- an immune cell e.g. T cell
- this increase in efficiency may be manifested by reduced ratio of effector immune cells : target cells (e.g. less than 4 : 1, less than 5 : 1, less than 6 : 1, less than 7 : 1, less than 8 : 1).
- this increase in efficiency may be manifested by reduced number of immune cells infused to the subject.
- the immune cells and the therapeutic compositions comprising the target disclosed herein can be administered to a subject in combination with other established or experimental therapeutic regimen to treat a disease associated with pathologic cells (e.g. cancer) including, but not limited to analgesics, chemotherapeutic agents, radiotherapeutic agents, cytotoxic therapies (conditioning), hormonal therapy and other treatment regimens (e.g., surgery) which are well known in the art.
- pathologic cells e.g. cancer
- the method of treatment involves first using pre conditioning for cell therapy.
- the method of some embodiments comprises administering a pre-conditioning agent prior to administering the immune cells (e.g. T cells).
- a pre-conditioning agent prior to administering the immune cells (e.g. T cells).
- pre conditioning patients prior to T cell therapies typically improves the efficacy of the T cell therapy by reducing the number of endogenous lymphocytes and increasing the serum level of homeostatic cytokines and/or pro-immune factors present in the patient. This creates a more optimal microenvironment for the transplanted T cells to proliferate once administered to the patient, and reduces the number of endogenous lymphocytes.
- pre-conditioning agents include cyclophosphamide and/or fludrabine.
- the immune cells disclosed herein and/or the therapeutic compositions disclosed herein can be administered to the subject per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
- a pharmaceutical composition refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
- active ingredient refers to the immune cells and/or the therapeutic composition accountable for the biological effect.
- the immune cells are the active ingredient in the formulation.
- physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
- An adjuvant is included under these phrases.
- excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
- excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
- Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, intradermal, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, e.g., into the right or left ventricular cavity, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.
- neurosurgical strategies e.g., intracerebral injection or intracerebroventricular infusion
- molecular manipulation of the agent e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB
- pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers)
- the transitory disruption of the integrity of the BBB by hyperosmotic disruption resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide).
- each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.
- the immune cells disclosed herein or the pharmaceutical composition comprising same is administered via an IV route.
- compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
- physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
- Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
- Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
- disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- Dragee cores are provided with suitable coatings.
- suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers ⁇
- the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
- stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
- compositions may take the form of tablets or lozenges formulated in conventional manner.
- the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
- the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
- the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
- a suitable vehicle e.g., sterile, pyrogen-free water based solution
- compositions of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
- Alternative embodiments include depots providing sustained release or prolonged duration of activity of the active ingredient in the subject, as are well known in the art.
- compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., cancer) or prolong the survival of the subject being treated.
- a disorder e.g., cancer
- the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
- a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
- Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
- the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
- the dosage may vary depending upon the dosage form employed and the route of administration utilized.
- the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et ah, 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).
- Dosage amount and interval may be adjusted individually to provide levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
- MEC minimum effective concentration
- the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations. Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
- compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
- compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
- Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.
- an article of manufacture comprising a packaging material packaging the immune cells disclosed herein and a therapeutic composition comprising said target.
- the therapeutic composition is specific for a pathologic cell.
- the immune cell is a T cell and the therapeutic composition is an antibody.
- an article of manufacture comprising a packaging material packaging an antibody and T cells expressing a multi subunit protein module comprising at least three cell membrane polypeptides each comprising an amino acid sequence of an Fc receptor common g chain (FcRy), said amino acid sequence is capable of transmitting an activating signal; wherein at least one but not all of said at least three polypeptides comprises an extracellular binding domain of an Fey receptor (e.g. CD64) capable of binding an Fc ligand, such that upon binding of said extracellular binding domain to said Fc ligand said activating signal is transmitted in said T cell.
- the article of manufacture is identified for the treatment of a disease associated with a pathologic cell (e.g. cancer).
- the immune cells e.g. T cell
- the therapeutic composition comprising the target e.g. antibody
- the immune cells e.g. T cell
- the therapeutic composition comprising the target e.g. antibody
- the article of manufacture further comprises a pre conditioning agent. Further description and non-limiting exemplary agents are further provide hereinabove.
- compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
- a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
- range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
- a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range.
- the phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
- the term "method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
- sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
- mice - Wild-type (WT) C57BL/6 mice or BALB/c mice were obtained from Envigo (Jerusalem, Israel), and from Jackson Laboratories (Bar-Harbor, ME, USA). All mice were housed in an American Association for the Accreditation of Laboratory Animal Care-accredited animal facility and maintained in specific pathogen-free conditions. Male and female 8-12 weeks old mice were used in all experiments. All animal experiments were approved by the Tel-Aviv University or the Stanford University Institutional Animal Care and Use Committees.
- B16F10 and YUMM1.7 cells were infected by lentivirus containing pLVX-H2B-tdTomato, and were sorted by FACS (BD FACSAriaTM III, BD Biosciences, Franklin Fakes, NJ) for the high-expressing tdTomato population.
- NK-92 cells (CRF-2407, ATCC) were cultured in RPMI supplemented with 200U of human IF-2 (Peprotech).
- Lentiviral infection - HEK-293FT cells were transfected with pFVX plasmids containing H2B-tdTomato under EF1 promoter together with psPAX2 (Addgene plasmid # 12260) and pCMV-VSV-G (Addgene plasmid # 8454). Media-containing viruses were collected following 24 and 48 hours. For infection, B16F10 or HT-29 cells were incubated with viruses and 100 pg / mL polybrene (Sigma Aldrich, Merck, Israel) for 30 minutes followed by 30 minutes centrifugation before medium was replaced. Following three days, cells that expressed tdTomato were sorted by FACSAriall.
- Histone H2B sequence was amplified with AATAACACTAGTGCCACCATGCCTGAACCGGCAAAAT (SEQ ID NO: 9) and AACAACCCCGGGACTTGTCGTCATCGTCTTTGT (SEQ ID NO: 10) primers and cloned into pLVX vector (Clontech) containing EF1 promoter into Spcl/Xmal sites in frame with tdTomato. Sequence was verified by MSCYv forward and tdTomato reverse primers (HyLabs Israel). Extracellular and transmembrane and 7 residues of intracellular region of human HER2 or EGFR were cloned into pLVX vector using Spcl/Notl or EoRI/Notl respectively) sites.
- Retroviral infection - Mouse total CD3 + T cells or specific CD4 + or CD8 + T cells were isolated from mouse blood and infected with the above constructs as follows: Platinum E cells were plated on 10 cm culture plates and co-transfected with 2 : 1 molar ratio of pMIGII 45 and PCL- Eco plasmids using Polyplus jetPRIME® reagent (Polyplus transfections). Following 24 hours, media was replaced with complete DMEM supplemented with 0.075 % Sodium Bicarbonate. Media-containing viruses were collected after 24 hours and 48 hours and centrifuged for 1 hour at 100,000g. Pellet was resuspended gently in 1 mL media and let to recover overnight at 4 °C.
- splenic CD4 + T cells or splenic CD8 + T cells were incubated on plate pre-coated with anti-CD3 (0.5 pg / mL) in T cell media containing high-dose IL-2 (1,000 IU / ml).
- 0.3 mL of concentrated retroviruses were added to every 2xl0 6 CD4 + or CD8 + T cells with 10 pg/mL polybrene. Cells were incubated for 30 minutes in 37 °C, 5 % CO2 and centrifuged at 37 °C 1,200 rpm for 1 hour. Following, 80 % of medium was replaced and T cells were cultured for additional three days in T cell media containing high-dose IL-2.
- 1.2 x 10 6 293GP cells were cultured in PLL-coated 6 well plate, transfected using JetOptimus (Polyplus transfections) with 1.4 pg RD114 envelope plasmid and 2 pg pMIGII or pMSVG.l plasmid. 48 hours later, supernatants were collected, filtered with 0.45 pM PVDF filter, and 1.5xl0 5 cells were infected in 24 well suspension plate coated with Retronectin (Takara).
- JetOptimus Polyplus transfections
- supernatants were collected, filtered with 0.45 pM PVDF filter, and 1.5xl0 5 cells were infected in 24 well suspension plate coated with Retronectin (Takara).
- Human PBMCs Primary human cells - Human PBMCs were collected from healthy donor, separated using Ficoll Histopaque-1077 HYBRI-MAX (Sigma aldrich), activated for 48 hours with Ultra- LEAFTM Purified anti-human CD3 Antibody (OKT3, Biolegend), together with 1000U IL-2 (Peprotech), followed by retrovirus infection.
- human PBMCs from healthy donor were collected and cultured for 8 days with Zoledronate (5uM, Novartis) and IL-2 (500U, Peprotech), separated using EasySepTM Human Gamma/Delta T Cell Isolation Kit (StemCell technologies), and transduced with a retrovirus vector as described.
- HT-29 were stained with Alexa Fluor® 488 anti-human CD340 (erbB2/HER-2, 24D2, BioLegend), Alexa Fluor® 488 anti human EGFR Antibody (AY13, BioLegend). Images were collected using a Zeiss LSM800 confocal laser scanning microscope and analyzed using ZEN software (Carl Zeiss Microscopy).
- Killing assay - IncuCyte imager killing assays were conducted by culturing 10 4 H2B- tdTomato B16F10 or YUMM1.7-H2B target cells in 96 wells plate with uninfected or infected CD4 + or CD8+ T cells at several effector : target ratios. Following 2 hours, where indicated, cells were added with 15 pg anti-TRP-1 (TA99, BioXcell) or anti-CD44 (IM7, BioLegend) antibodies in 200 pi medium.
- HT-29 For human cells killing assays, 10 4 HT-29 were cultured in 96 well plate; 24 hours later human effector cells were added in the specified ratios, with or without 60 pg / ml Trastuzumab (HY-P9907, MedChemExpress) or Cetuximab (HY-P9905, MedChemExpress). Cells were imaged by incuCyte S3 imager (Sartorius) for 24-60 hours. Images were then used to calculate numbers of target cells by incuCyte software.
- Human T cells activity was also evaluated by measuring the TNFa cytokine levels using Human TNF-alpha DuoSet ELISA (DY210, R&D Systems) and IFNy levels using Human IFN-gamma DuoSet ELISA (DY285, R&D Systems).
- A20 killing was evaluated following 24 hours co-culture of A20 cells in a u-shaped 96 wells plate with infected CD8+ T cells isolated from BALB/c splenocytes, with or without 10 mg anti-CD20 antibody (18B12, Absolute antibody). Killing of A20 cells was determined by APC-Annexin V staining kit (BioLegend) in flow cytometer.
- Flow cytometry - Purified T cells were analyzed using flow cytometry (CytoFLEX, Beckman Coulter, Lakeview Indianapolis, IA) for expressed GFP or by staining with Alexa Fluor® 647 anti-mouse CD64 (FcyRI) Antibody (X54-5/7.1, BioLegend), Brilliant Violet 421 or APC anti-human CD64 Antibody (10.1, BioLegend), Alexa Fluor® 488 -anti -human CD3 (HIT3a, BioLegend). A20 cells were stained by PE-anti CD45R/ B220 antibody (RA-3-6B2, BioLegend). Datasets were analyzed using FlowJo software (Tree Star).
- mice were sacrificed for ethical considerations. Animal were injected intravenously (i.v.) with 2xl0 6 uninfected (sham) or retroviral infected with pMIGII-alpha-gamma-2A-Gamma (SEQ ID NO: 4) CD3+ T cells, with or without 300 pg anti-TRPl antibody (clone TA99) s.c. Treatment was applied at days 7, 11 and 14 post tumor injection.
- B16-H2B-tdTomato were cultured in serial concentrations ranging from 24 cells to 50,000 per well, imaged in incuCyte and counted by incuCyte analysis tool which detect and count the red fluorescent nuclei in a field captured by the camera.
- the graph in Figure 3 shows a direct correlation between the amount of cell cultured and numbers of cell counted in a field. Consequently, the incuCyte imaging system was used to evaluate killing of B16-H2B-tdTomato by anti-TRP-1 antibody and T cells expressing Alpha-2A-gamma or Alpha-gamma-2 A-gamma cultured in different effector : target ratios, ranging from 0.5:1 to 16:1.
- FIG. 4A Representative images ( Figure 4A) and target cells numbers ( Figure 4B) after 48 hours show that both CD8 + and CD4 + T cells infected with Alpha-2A-gamma killed the tumor cells when the effector : target ratio is 8 to 1, or higher.
- the Alpha-gamma-2A-Gamma construct was much more potent compared to Alph- 2A-Gamma, and induced target cells killing in effector : target ratio of 2:1 ( Figures 5A-C).
- the B 16-H2B-tdTomato target cells can be distinguished by their red nucleus and the infected cells express GFP originated from the pMIGII vector backbone, their activity could be monitored in real time. Indeed, the majority of tumor cell killing was mediated by the infected T cells as manifested by their GFP expression (Figure 6A).
- Figure 6B In order to assess the exogenous expression of FcRI in the CD4+ and CD8+ T cells of mouse origin and in human Jurkat T cells infected with the Alpha-gamma-2A-Gamma, the cells were analyzed for GFP and FcRI (CD64) expression by flow cytometry ( Figure 6B).
- FcRI alpha fused to gamma chain can promote tumor cell killing, comparable to that observed when separating the gamma chain from the FcRI alpha chain (e.g. Alpha-2A-gamma and Alpha-gamma-2 A-gamma). Therefore, FcRI alpha chain extracellular D1-D2 domains were cloned fused to CD8 hinge and transmembrane domains of CD8a together with signaling intracellular gamma (denoted herein as Alpha-CD8- gamma, SEQ ID NOs: 5-6) as illustrated in Figure 8A.
- the present inventors tested if the gamma chain must form a dimer in Alpha-gamma-2A-Gamma by using a sequence with mutated cysteine residues in the transmembrane domain of the Gamma chain, denoted herein as Alpha-gamma-2A-Gamma(mut) (SEQ ID NOs: 7-8, Figure 8A).
- CD8+ T cell were infected with the Alpha-2A-Gamma construct (SEQ ID NO: 2), the Alpha-CD8-gamma construct (SEQ ID NO: 6), Alpha-gamma-2A-Gamma construct (SEQ ID NO: 4) or the Alpha-gamma-2A- Gamma(mut) construct (SEQ ID NO: 8) and were co-cultured with B16-H2B-tdTomato with or without an anti-TRP-1 antibody.
- Alpha-2A-Gamma construct SEQ ID NO: 2
- the Alpha-CD8-gamma construct SEQ ID NO: 6
- Alpha-gamma-2A-Gamma construct SEQ ID NO: 4
- Alpha-gamma-2A- Gamma(mut) construct SEQ ID NO: 8
- FIG. 10A shows representative confocal microscopy of the co-culture where T cells are stained for TCRP and A20 lymphoma cells are stained with B220. Analysis of A20 cell death by Annexin-V staining by flow cytometry showed about 20 % killing upon culturing with Alpha-gamma-2A-Gamma infected T cells and anti-CD20 antibody ( Figure 10B).
- tumor-binding antibody other than anti-TRP- 1 to mediate tumor cell killing by the Alpha-gamma-2A-Gamma infected T cells was evaluated.
- CD8+ T cells expressing the Alpha-gamma-2 A-gamma construct were cultured with B 16 cells along with an anti-CD44 antibody which binds the tumor cells.
- anti-CD44 induced tumor cell killing, comparable to that induced by an anti-TRP 1 antibody ( Figure 11).
- Both Alpha-2A-Gamma and Alpha-gamma-2A-Gamma showed killing activity when Trastuzumab was added to the HER2-expressing cells ( Figure 14E) compared to the EGFR- expressing cells ( Figure 14F), in which no killing activity was observed.
- Alpha-gamma- 2A-Gamma showed stronger activity than Alpha-2A-Gamma, as can be seen by the numbers of the live target cells along 48 hours co-culture.
- human T cells were infected with retrovirus carrying Alpha-gamma-2A-Gamma in pMSVG.l vector ( Figure 15A).
- the Alpha-gamma-2A- Gamma infected cells were compared for their killing activity to sham- infected cells, when added to HT-29 H2B tdTomato cells expressing HER2 with or without Trastuzumab ( Figure 15B) or HT-29 H2B tdTomato cells expressing EGFR with or without Cetuximab ( Figure 15C).
- Figure 15B HT-29 H2B tdTomato cells expressing HER2 with or without Trastuzumab
- Figure 15C Cetuximab
- Alpha-gamma-2A-Gamma and not sham-infected cells were able to elicit killing activity only when the tumor-binding antibody was added.
- the activity of the Alpha-gamma-2A-Gamma expressing T cells was evaluated by cytokines release.
- the Alpha-gamma-2 A-Gamma or sham-infected cells were co-cultured with HT-29 H2B tdTomato expressing HER2 together with Trastuzumab in different effector : target ratios, and TNFa (Figure 15D) and IFNy ( Figure 15E) were measured by ELISA.
- the results show a correlation between the numbers of Alpha-gamma-2A-Gamma effector to target cells and the levels of cytokines released, while co-culturing sham-infected cells with the target cells did not result in cytokines release.
- Alpha-gamma-2A-Gamma expressing human T cells were co-cultured with HT-29 H2B tdTomato HER2 expressing cells together with relevant or irrelevant antibodies ( Figure 15F). Following 48 hours of co-culture, only the HER-2 binding antibody, Trastuzumab, but not Cetuximab or Retuximab elicited killing of target cells.
- mice were injected sub-cutaneously to C57BL/6 mice. Once tumors reached palpable size, mice were injected with 300 pg anti-TRP-1 antibody sub-cutaneously and 2xl0 6 CD3 + cells infected with Alpha-gamma-2A-Gamma intravenously. As controls, tumor bearing mice were either left untreated, treated with the antibody plus non-infected CD3+ T cells, or with Alpha- gamma-2A-Gamma infected CD3+ T cells without anti-TRP-1 antibody. The results showed no increase in tumor volume only in mice treated with both Alpha-gamma-2A-Gamma infected CD3+ T cells and anti-TRP-1 antibody (Figure 12).
- PBMC peripheral blood mononuclear cells
- PBMC peripheral blood mononuclear cells
- the following construct is cloned: an anti-EGFR scFv fused to the extracellular D3 domain and transmembrane domain of FcyRI fused to the intracellular domain of FcRy, T2A skipping peptide and FcRy (SEQ ID NOs: 37-38), denoted herein as scFv-alpha-gamma-2A-gamma ( Figure 13).
- the plasmids are packed into retroviruses, and used to infect CD4 + and CD8 + T cells. Following, the killing activity of the transduced T cells is evaluated in-vitro on EGFR expressing tumor cells, for examples H29 colon cancer cells which express histone H2B-tdTomato. Co culture and killing is evaluated following imaging by incuCyte imager.
- Effector cells other than ab T cells can also be genetically-engineered to express Alpha-gamma-2 A-Gamma.
- PBMC peripheral blood mononuclear cells
- IF-2 IF-2
- Zoledronic acid in order to expand the gd T cells population.
- cells were separated using EasySepTM Human Gamma/Delta T Cell Isolation Kit, and transduced with Alpha-gamma-2A-Gamma pMIGII construct. The infected cells were imaged by confocal microscopy ( Figure 17).
- gd T cells were identified by the specific anti-gd TCR antibody, and only the transduced cells showed GFP expression originated from the pMIGII vector. The GFP expression was corolated with CD64 staining on the cell membrane.
- NK-92 cells were infected with retrovirus carrying Alpha-gamma-2A-Gamma in pMSVG.2 vector. Only infected cells showed high levels of CD64 in flow cytometry analysis ( Figure 18A). Following, the cells were stained for the NK marker CD56 and for CD64 originated from the Alpha-gamma-2 A- Gamma and were imaged by confocal microscopy ( Figure 18B).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Hospice & Palliative Care (AREA)
- Dermatology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022578892A JP2023530182A (ja) | 2020-06-22 | 2021-06-22 | 多重サブユニットタンパク質モジュール、それを発現する細胞、及びその使用 |
| EP21829402.3A EP4168438A4 (en) | 2020-06-22 | 2021-06-22 | Multi subunit protein modules, cells expressing same and uses thereof |
| IL299276A IL299276A (en) | 2020-06-22 | 2021-06-22 | Multi subunit protein modules, cells expressing same and uses thereof |
| AU2021294559A AU2021294559A1 (en) | 2020-06-22 | 2021-06-22 | Multi subunit protein modules, cells expressing same and uses thereof |
| CA3186887A CA3186887A1 (en) | 2020-06-22 | 2021-06-22 | Multi subunit protein modules, cells expressing same and uses thereof |
| CN202180056172.9A CN116194575A (zh) | 2020-06-22 | 2021-06-22 | 多亚基蛋白质组件、表达多亚基蛋白质组件的细胞及其用途 |
| US18/085,632 US12077569B2 (en) | 2020-06-22 | 2022-12-21 | Multi subunit protein modules, cells expressing same and uses thereof |
| US18/752,100 US20240409605A1 (en) | 2020-06-22 | 2024-06-24 | Multi subunit protein modules, cells expressing same and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063042080P | 2020-06-22 | 2020-06-22 | |
| US63/042,080 | 2020-06-22 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/085,632 Continuation-In-Part US12077569B2 (en) | 2020-06-22 | 2022-12-21 | Multi subunit protein modules, cells expressing same and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021260696A1 true WO2021260696A1 (en) | 2021-12-30 |
Family
ID=79282629
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2021/050763 Ceased WO2021260696A1 (en) | 2020-06-22 | 2021-06-22 | Multi subunit protein modules, cells expressing same and uses thereof |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US12077569B2 (enExample) |
| EP (1) | EP4168438A4 (enExample) |
| JP (1) | JP2023530182A (enExample) |
| CN (1) | CN116194575A (enExample) |
| AU (1) | AU2021294559A1 (enExample) |
| CA (1) | CA3186887A1 (enExample) |
| IL (1) | IL299276A (enExample) |
| WO (1) | WO2021260696A1 (enExample) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023197437A1 (zh) * | 2022-04-14 | 2023-10-19 | 呈诺再生医学科技(北京)有限公司 | 一种提升免疫细胞杀伤活性的嵌合受体及其应用 |
| WO2023196997A3 (en) * | 2022-04-08 | 2024-05-30 | Regeneron Pharmaceuticals, Inc. | Multipartite receptor and signaling complexes |
| WO2024154122A1 (en) | 2023-01-18 | 2024-07-25 | Gilboa Therapeutics LTD | Immune cells expressing a complement receptor and uses thereof |
| US12077569B2 (en) | 2020-06-22 | 2024-09-03 | Ramot At Tel-Aviv University Ltd. | Multi subunit protein modules, cells expressing same and uses thereof |
| WO2024236557A1 (en) | 2023-05-12 | 2024-11-21 | Gilboa Therapeutics LTD | Compositions comprising an fc domain for the treatment of medical conditions |
| WO2025109493A1 (en) * | 2023-11-21 | 2025-05-30 | National University Of Singapore | Chimeric Receptors with Binding Capacity for Antibodies |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014039523A1 (en) * | 2012-09-04 | 2014-03-13 | Cellectis | Multi-chain chimeric antigen receptor and uses thereof |
Family Cites Families (58)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL154600B (nl) | 1971-02-10 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen. |
| NL154598B (nl) | 1970-11-10 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking. |
| NL154599B (nl) | 1970-12-28 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen, alsmede testverpakking. |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| NL171930C (nl) | 1972-05-11 | 1983-06-01 | Akzo Nv | Werkwijze voor het aantonen en bepalen van haptenen, alsmede testverpakkingen. |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| IL86278A (en) | 1988-05-04 | 2003-06-24 | Yeda Res & Dev | Endowing cells with antibody specificity using chimeric t cell receptor |
| GB8823869D0 (en) | 1988-10-12 | 1988-11-16 | Medical Res Council | Production of antibodies |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| ATE158021T1 (de) | 1990-08-29 | 1997-09-15 | Genpharm Int | Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| US5641875A (en) | 1993-09-30 | 1997-06-24 | University Of Pennsylvania | DNA encoding chimeric IgG Fc receptor |
| US6111166A (en) | 1994-09-19 | 2000-08-29 | Medarex, Incorporated | Transgenic mice expressing human Fcα and β receptors |
| ATE466948T1 (de) | 1997-03-11 | 2010-05-15 | Univ Minnesota | Dns-basiertes transposon-system für die einführung von nucleinsäure in die dns einer zelle |
| AU1811801A (en) | 1999-12-03 | 2001-06-12 | Dendreon Corporation | Cryopreservation of antigen-loaded dendritic cells and their precursors in serum-free media |
| US7595378B2 (en) * | 2001-06-13 | 2009-09-29 | Genmab A/S | Human monoclonal antibodies to epidermal growth factor receptor (EGFR) |
| AU2005277831B2 (en) * | 2004-07-10 | 2012-11-22 | The Institute For Cancer Research | Genetically modified human natural killer cell lines |
| EP1787512A1 (en) | 2005-11-09 | 2007-05-23 | Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe | Method for the cryopreservation of human blood |
| EP2468850A4 (en) | 2009-08-19 | 2013-02-20 | Takara Bio Inc | CELL PRESERVATION PROCESS |
| US10144770B2 (en) | 2013-10-17 | 2018-12-04 | National University Of Singapore | Chimeric receptors and uses thereof in immune therapy |
| EP3092304A2 (en) | 2014-01-08 | 2016-11-16 | 1Globe Biomedical Co., Ltd. | Novel synthetic biology-based adcc technology |
| WO2015121454A1 (en) | 2014-02-14 | 2015-08-20 | Cellectis | Cells for immunotherapy engineered for targeting antigen present both on immune cells and pathological cells |
| US20170051037A1 (en) * | 2014-05-02 | 2017-02-23 | Cellectis | Cs1 specific multi-chain chimeric antigen receptor |
| US20170151283A1 (en) * | 2014-05-23 | 2017-06-01 | The Trustees Of The University Of Pennsylvania | Compositions and methods for treating antibody resistance |
| US20180134795A1 (en) * | 2014-06-17 | 2018-05-17 | Cellectis | Cd123 specific multi-chain chimeric antigen receptor |
| US10544201B2 (en) * | 2014-07-31 | 2020-01-28 | Cellectis | ROR1 specific multi-chain chimeric antigen receptor |
| CA2972714A1 (en) | 2014-09-09 | 2016-03-17 | Unum Therapeutics | Chimeric receptors and uses thereof in immune therapy |
| JP6839074B2 (ja) | 2014-09-17 | 2021-03-03 | ノバルティス アーゲー | 養子免疫療法のためのキメラ受容体での細胞毒性細胞のターゲティング |
| KR102763121B1 (ko) | 2015-02-06 | 2025-02-04 | 내셔널 유니버시티 오브 싱가포르 | 치료적 면역 세포의 효능의 향상 방법 |
| US11440946B2 (en) | 2015-03-13 | 2022-09-13 | University Of Maryland, Baltimore | Universal antibody-mediated biosensor |
| EP3341410B1 (en) * | 2015-08-24 | 2021-06-02 | Cellectis | Chimeric antigen receptors with integrated controllable functions |
| EP3430036A4 (en) | 2016-03-18 | 2019-08-14 | Unum Therapeutics | MODIFIED CHIMERIC RECEPTORS AND USES IN IMMUNOTHERAPY |
| WO2017205254A1 (en) | 2016-05-23 | 2017-11-30 | Unum Therapeutics | Immune cells expressing antibody-coupled t-cell receptor (actr) for use in inhibiting cancer cells expressing surface immunoglobulin |
| WO2018017649A1 (en) | 2016-07-19 | 2018-01-25 | Unum Therapeutics Inc. | Use of antibody-coupled t cell receptor (actr) with multiple anti-cancer antibodies in cancer treatment |
| WO2018027135A1 (en) | 2016-08-04 | 2018-02-08 | Unum Therapeutics Inc. | Treatment of lymphoma using antibody-coupled t cell receptor |
| AU2018213407A1 (en) | 2017-01-30 | 2019-08-08 | Unum Therapeutics Inc. | Improved antibody-coupled T cell receptor constructs and therapeutic uses thereof |
| US20190381171A1 (en) | 2017-02-17 | 2019-12-19 | Unum Therapeutics Inc. | Co-use of anti-bcma antibody and antibody-coupled t cell receptor (actr) in cancer therapy and b cell disorders |
| JP2022525927A (ja) | 2019-03-19 | 2022-05-20 | ラモット・アット・テル・アビブ・ユニバーシテイ・リミテッド | Fcガンマ受容体を発現するt細胞およびその使用方法 |
| JP2023530182A (ja) | 2020-06-22 | 2023-07-13 | ラモット・アット・テル・アビブ・ユニバーシテイ・リミテッド | 多重サブユニットタンパク質モジュール、それを発現する細胞、及びその使用 |
-
2021
- 2021-06-22 JP JP2022578892A patent/JP2023530182A/ja not_active Ceased
- 2021-06-22 AU AU2021294559A patent/AU2021294559A1/en not_active Abandoned
- 2021-06-22 IL IL299276A patent/IL299276A/en unknown
- 2021-06-22 EP EP21829402.3A patent/EP4168438A4/en active Pending
- 2021-06-22 CN CN202180056172.9A patent/CN116194575A/zh active Pending
- 2021-06-22 WO PCT/IL2021/050763 patent/WO2021260696A1/en not_active Ceased
- 2021-06-22 CA CA3186887A patent/CA3186887A1/en active Pending
-
2022
- 2022-12-21 US US18/085,632 patent/US12077569B2/en active Active
-
2024
- 2024-06-24 US US18/752,100 patent/US20240409605A1/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014039523A1 (en) * | 2012-09-04 | 2014-03-13 | Cellectis | Multi-chain chimeric antigen receptor and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| KRISTIN M. SNYDER, HULLSIEK ROBERT, MISHRA HEMANT K., MENDEZ DANIEL C., LI YUNFANG, ROGICH ALLISON, KAUFMAN DAN S., WU JIANMING, W: "Expression of a Recombinant High Affinity IgG Fc Receptor by Engineered NK Cells as a Docking Platform for Therapeutic mAbs to Target Cancer Cells", FRONTIERS IN IMMUNOLOGY, vol. 9, 6 December 2018 (2018-12-06), pages 2873, XP055742595, DOI: 10.3389/fimmu.2018.02873 * |
| See also references of EP4168438A4 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12077569B2 (en) | 2020-06-22 | 2024-09-03 | Ramot At Tel-Aviv University Ltd. | Multi subunit protein modules, cells expressing same and uses thereof |
| WO2023196997A3 (en) * | 2022-04-08 | 2024-05-30 | Regeneron Pharmaceuticals, Inc. | Multipartite receptor and signaling complexes |
| WO2023197437A1 (zh) * | 2022-04-14 | 2023-10-19 | 呈诺再生医学科技(北京)有限公司 | 一种提升免疫细胞杀伤活性的嵌合受体及其应用 |
| WO2024154122A1 (en) | 2023-01-18 | 2024-07-25 | Gilboa Therapeutics LTD | Immune cells expressing a complement receptor and uses thereof |
| WO2024236557A1 (en) | 2023-05-12 | 2024-11-21 | Gilboa Therapeutics LTD | Compositions comprising an fc domain for the treatment of medical conditions |
| WO2025109493A1 (en) * | 2023-11-21 | 2025-05-30 | National University Of Singapore | Chimeric Receptors with Binding Capacity for Antibodies |
Also Published As
| Publication number | Publication date |
|---|---|
| US20230340070A1 (en) | 2023-10-26 |
| AU2021294559A1 (en) | 2023-02-23 |
| US20240409605A1 (en) | 2024-12-12 |
| CA3186887A1 (en) | 2021-12-30 |
| IL299276A (en) | 2023-02-01 |
| EP4168438A1 (en) | 2023-04-26 |
| CN116194575A (zh) | 2023-05-30 |
| US12077569B2 (en) | 2024-09-03 |
| EP4168438A4 (en) | 2024-07-10 |
| JP2023530182A (ja) | 2023-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12077569B2 (en) | Multi subunit protein modules, cells expressing same and uses thereof | |
| JP7289293B2 (ja) | T細胞の改変 | |
| JP7249287B2 (ja) | T細胞受容体シグナル伝達を阻害または調節することによって、t細胞枯渇を処置する方法 | |
| CN105392888B (zh) | 使用人源化抗cd19嵌合抗原受体治疗癌症 | |
| JP2019536452A (ja) | 融合タンパク質を用いたtcrの再プログラミングのための組成物及び方法 | |
| US20250163128A1 (en) | T cell expressing an fc gamma receptor and methods of use thereof | |
| CN110352068A (zh) | 合成的免疫受体及其使用方法 | |
| JP2020504628A (ja) | 多官能性タンパク質 | |
| WO2021244654A1 (en) | Activation induced cytokine production in immune cells | |
| US20230226181A1 (en) | GENETIC ENGINEERING OF gamma delta T CELLS FOR IMMUNOTHERAPY | |
| EP4255482A1 (en) | Methods and materials for treating t cell cancers | |
| US20230048361A1 (en) | Methods of culturing t cells and uses of same | |
| AU2020334237B2 (en) | Cell therapy methods | |
| US20240207315A1 (en) | Chimeric receptors and uses thereof | |
| WO2024154122A1 (en) | Immune cells expressing a complement receptor and uses thereof | |
| WO2022214089A1 (zh) | 细胞免疫治疗的应用 | |
| WO2024236557A1 (en) | Compositions comprising an fc domain for the treatment of medical conditions | |
| US20240207314A1 (en) | Methods to improve t cell efficacy and safety by modulating mediators of phagocytosis | |
| WO2026003364A1 (en) | Chimeric coreceptors | |
| HK40013541A (en) | Synthetic immune receptors and methods of use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21829402 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3186887 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2022578892 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2021829402 Country of ref document: EP Effective date: 20230117 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021294559 Country of ref document: AU Date of ref document: 20210622 Kind code of ref document: A |