WO2021259743A2 - Vaccine - Google Patents
Vaccine Download PDFInfo
- Publication number
- WO2021259743A2 WO2021259743A2 PCT/EP2021/066343 EP2021066343W WO2021259743A2 WO 2021259743 A2 WO2021259743 A2 WO 2021259743A2 EP 2021066343 W EP2021066343 W EP 2021066343W WO 2021259743 A2 WO2021259743 A2 WO 2021259743A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antigen
- klebsiella pneumoniae
- pneumoniae
- polysaccharide
- optionally
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1077—Pentosyltransferases (2.4.2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/025—Enterobacteriales, e.g. Enterobacter
- A61K39/0266—Klebsiella
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/385—Haptens or antigens, bound to carriers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/6415—Toxins or lectins, e.g. clostridial toxins or Pseudomonas exotoxins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
- A61K47/646—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent the entire peptide or protein drug conjugate elicits an immune response, e.g. conjugate vaccines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/21—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/26—Klebsiella (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/02—Pentosyltransferases (2.4.2)
- C12Y204/02036—NAD(+)--diphthamide ADP-ribosyltransferase (2.4.2.36)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/99—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
- C12Y204/99019—Undecaprenyl-diphosphooligosaccharide—protein glycotransferase (2.4.99.19)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6037—Bacterial toxins, e.g. diphteria toxoid [DT], tetanus toxoid [TT]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6068—Other bacterial proteins, e.g. OMP
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to the field of immunogenic compositions and vaccines, their manufacture and the use of such immunogenic compositions and vaccines in medicine. More particularly, it relates to immunogenic compositions comprising Klebsiella pneumoniae O-antigen polysaccharide conjugates.
- Klebsiella pneumoniae is a gram-negative, encapsulated non-motile bacteria of the Enterobacteraceae family. It colonizes the gastrointestinal, respiratory and urinary tracts and is carried asymptomatically as part of the human microbiome. Klebsiella pneumoniae is an important cause of community, long term care facilities and hospital-acquired infections.
- Klebsiella pneumoniae expresses two types of polysaccharide molecules on the surface: capsular polysaccharide (K-antigen) and lipopolysaccharide (O-antigen, also known as O-antigen polysaccharides or OPS).
- K-antigen capsular polysaccharide
- O-antigen lipopolysaccharide
- Capsule polysaccharides are highly diverse with at least 77 serologically distinct K-antigens.
- O3 serogroup has three different subtypes differing in the number of mannose residues within the O-antigen repeating units (Guachalla et al. (2017) Scientific Reports 7: 6635, 1-13).
- the carbohydrate repeating unit structures of OPSs of K. pneumoniae are described in Figure 1 of Clarke et al. J. Biol. Chem. (2016) 293(13) 4666–4679 and Figure 1 of Kelly et al.
- T-independent antigens for example saccharides
- compositions and methods are the first to consider the prevelance of certain Klebsiella pneumoniae subserotypes (i.e., O1v1 vs O1v2, O2afg vs O2a, O3 vs O3b), the first to consider antibiotic resistant Klebsiella pneumoniae, and the first to consider cross-reactivities between distinct Klebsiella pneumoniae subserotypes.
- Klebsiella pneumoniae subserotypes i.e., O1v1 vs O1v2, O2afg vs O2a, O3 vs O3b
- immunogenic compositions e.g. vaccines
- Immunogenic compositions and vaccines of the present invention provide broad coverage against several different subserotypes of Klebsiella pneumoniae.
- the present invention also provides novel conjugates, in particular bioconjugates, against the subserotypes O1v1, O2a, O2afg, O3b of Klebsiella pneumoniae which can be used in the immunogenic compositions (e.g. vaccines) and methods of the invention.
- an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O- antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a carrier protein.
- an immunogenic composition of the invention comprising combining a Klebsiella pneumoniae O1v1 O- antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, and optionally a pharmaceutically acceptable excipient and/or carrier.
- a host cell comprising: i) nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b, optionally integrated into the host cell genome; ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase, optionally within a plasmid; iii) a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g.
- EPA Pseudomonas aeruginosa
- EPA Pseudomonas aeruginosa
- X and Z may be any natural amino acid except proline
- a nucleotide sequence encoding an ABC transporter optionally K. pneumoniae genes wzm and wzt, optionally integrated into the host cell genome.
- a process for producing a bioconjugate comprising (i) culturing the host cell of any the invention under conditions suitable for the production of glycoproteins and (ii) isolating the bioconjugate.
- a conjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b conjugated to a carrier protein, wherein the carrier protein is a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- EPA Pseudomonas aeruginosa
- an immunogenic composition comprising the conjugate (e.g. bioconjugate) of the invention, and optionally a pharmaceutically acceptable excipient and/or carrier.
- a vaccine comprising the immunogenic composition of the invention and optionally an adjuvant.
- a method of inducing an immune response to Klebsiella pneumoniae in a subject comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of the invention, or the vaccine of the invention, to a subject in need thereof.
- an immunogenic composition of the invention, or the vaccine of the invention for use in inducing an immune response to Klebsiella pneumoniae in a subject.
- an immunogenic composition of the invention for use in the manufacture of a medicament for inducing an immune response to Klebsiella pneumoniae in a subject.
- the used carriers contain 3 glycosylation sites (B, lane 1), 4 glycosylation sites (A, lane 7; B lane 2), 5 glycosylation sites (A, lanes 1, 2, and 3), 6 glycosylation sites (A, lanes 4 and 5), 7 glycosylation sites (A, lane 6).
- PAGERULERTM Prestained Protein Ladder (ThermoFisher) is indicated by “M”.
- FIG. 2A, 2B, 2C, and 2D Analysis of the O1v1, O2a, O2afg, and O3b-conjugate-producing strains’ products (A, B, C, and D, respectively). Two experimental replicates per serotype are analysed.
- Coomassie staining (A, left picture; B; C, right picture; D), anti K. pneumoniae O1v1 Western blot (A, central picture), anti K. pneumoniae O2a Western blot (A, right picture; C, left picture), anti K. pneumoniae O2afg Western blot (C, central picture) are shown.
- PAGERULERTM Prestained Protein Ladder (ThermoFisher) is loaded in lanes 1, 4, 9, 10, the corresponding band size in kDa is reported. Other lanes contain the two replicas from each conjugate-producing strain.
- FIG.3 Purified conjugates were analyzed via SDS-PAGE and Coomassie staining.
- FIG.3 Purified conjugates were analyzed via SDS-PAGE and Coomassie staining.
- FIG. 5 O2a opsonisation index (OI) in pre- and post-III immunization sera from rabbit immunized with monovalent O2a conjugate or polyvalend Kp5v composition. O2a wild type strain was used. Control group are animals immunized with buffer alone.
- FIG. 6 K. pneumoniae wild type strains were tested for binding with pools of sera of animals immunized with monovalent vaccine via flow cytometry. Median fluorescence intensity due to the binding of the antisera to the cells is reported. Mean and standard deviaton are shown. New Zealand white rabbits were injected at days 0, 14 and 28 with 1 ⁇ g of monovalent vaccine with no adjuvant. Control group are animals immunized with buffer alone.
- Carrier protein a protein which may be covalently attached to an antigen (e.g. saccharide antigen, such as a bacterial polysaccharide antigen) to create a conjugate (e.g. bioconjugate).
- an antigen e.g. saccharide antigen, such as a bacterial polysaccharide antigen
- a carrier protein activates T-cell mediated immunity in relation to the antigen to which it is conjugated.
- EPA Exotoxin A of Pseudomonas aeruginosa (also known as “Exotoxin of P.
- proline refers to an amino acid selected from the group consisting of alanine (ala, A), arginine (arg, R), asparagine (asn, N) , aspartic acid (asp,D), cysteine (cys, C) ,glutamine (gln, Q), glutamic acid (glu, E), glycine (gly, G), histidine (his, H), isoleucine (ile,I), leucine (leu, L), lysine (lys, K), methionine (met, M), phenylalanine (phe, F), serine (ser, S), threonine (thr, T), tryptophan (trp, W), tyrosine (tyr, Y), and valine (val, V).
- alanine ala, A
- arginine arg, R
- asparagine asparagine
- aspartic acid aspartic acid
- cysteine
- Naturally occurring amino acid residues amino acids that are naturally incorporated into polypeptides.
- the 20 amino acids encoded by the universal genetic code alanine (ala, A), arginine (arg, R), asparagine (asn, N) , aspartic acid (asp,D), cysteine (cys, C) ,glutamine (gln, Q), glutamic acid (glu, E), glycine (gly, G), histidine (his, H), isoleucine (ile,I), leucine (leu, L), lysine (lys, K), methionine (met, M), phenylalanine (phe, F), proline (pro, P), serine (ser, S), threonine (thr, T), tryptophan (trp, W), tyrosine (tyr, Y), and valine (val, V).
- O-Antigens also known as O-specific polysaccharides or O-side chains: a component of the surface lipopolysaccharide (LPS) of Gram-negative bacteria.
- LPS surface lipopolysaccharide
- examples include O-antigens from Klebsiella pneumoniae.
- a “Klebsiella pneumoniae O-antigen polysaccharide O1v1” is an O-antigen polysaccharide from Klebsiella pneumoniae serotype O1v1.
- a “Klebsiella pneumoniae O-antigen polysaccharide O2a” is an O-antigen polysaccharide from Klebsiella pneumoniae serotype O2a.
- a “Klebsiella pneumoniae O-antigen polysaccharide O2afg” is an O-antigen polysaccharide from Klebsiella pneumoniae serotype O2afg.
- a “Klebsiella pneumoniae O-antigen polysaccharide O3b” is an O-antigen polysaccharide from Klebsiella pneumoniae serotype O3b.
- LPS Lipopolysaccharide
- wzy a polysaccharide polymerase gene encoding an enzyme which catalyzes polysaccharide polymerization.
- the encoded enzyme transfers oligosaccharide units to the non-reducing end forming a glycosidic bond.
- waaL a O-antigen ligase gene encoding a membrane bound enzyme.
- the encoded enzyme transfers undecaprenyl-diphosphate (UPP)-bound O-antigen to the lipid A core oligosaccharide, forming lipopolysaccharide.
- UPP undecaprenyl-diphosphate
- D-galactan I as used herein is a reference to a polymer built of [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D- Galp-(1 ⁇ ] repeating units (see Hsieh et al. 2014 Front. Microbiol.
- D-galactan II as used herein is a reference to a polymer built of [ ⁇ 3)- ⁇ -D-Galp-(1 ⁇ 3)- ⁇ - D-Galp-(1 ⁇ ] repeating units (see Hsieh et al. 2014 Front. Microbiol. 5:608, doi:10.3389/fmicb.2014.00608).
- D-galactan III as used herein is a reference to a polymer built of [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- [ ⁇ -D-Galp-(1 ⁇ 4)]- ⁇ -D-Galp-(1 ⁇ ] repeating units (see Stojkovic et al. 2017 Front. Microbiol. 8:684, doi: 10.3389/fmicb.2017.00684).
- GlcNAc as used herein is a reference to N-Acetylglucosamine.
- Gal or “Galp” as used herein is a reference to D-galactopyranose.
- Galf as used herein is a reference to D-galactofuranose.
- a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate comprises a carrier protein covalently linked to an Klebsiella pneumoniae O1v1 O-antigen polysaccharide.
- a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate comprises a carrier protein covalently linked to an Klebsiella pneumoniae O2a O-antigen polysaccharide.
- a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate comprises a carrier protein covalently linked to an Klebsiella pneumoniae O2afg O-antigen polysaccharide.
- a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate comprises a carrier protein covalently linked to an Klebsiella pneumoniae O3b O-antigen polysaccharide.
- bioconjugate refers to conjugate between a protein (e.g. a carrier protein) and an antigen (e.g.
- an amino acid sequence may have a certain % identity to a reference amino acid sequence. Variants may differ from the reference amino acid sequence by the deletion and/or addition and/or substitution of one or more amino acids (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 amino acids). Amino acid substitution may be conservative or non-conservative. In one aspect, amino acid substitution is conservative. Substitutions, deletions, additions or any combination thereof may be combined in a single variant so long as the variant is an immunogenic polypeptide.
- 1 to 10, 5 to 10, 1 to 5, 1 to 3, 1 to 2 or 1 amino acids of the reference amino acid sequence may be substituted or deleted.
- conservative amino acid substitution involves substitution of a native amino acid residue with a non-native residue such that there is little or no effect on the size, polarity, charge, hydrophobicity, or hydrophilicity of the amino acid residue at that position, and without resulting in decreased immunogenicity.
- these may be substitutions within the following groups: valine, glycine; glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
- Conservative amino acid modifications to the sequence of a polypeptide may produce polypeptides having functional and chemical characteristics similar to those of a parental polypeptide.
- the term “deletion” is the removal of one or more amino acid residues from the protein sequence.
- no more than about from 1 to 6 residues are deleted at any one site within the protein molecule.
- the terms “insertion” or “addition” means the addition of one or more non-native amino acid residues in the protein sequence or, as the context requires, addition of one or more non-native nucleotides in the polynucleotide sequence.
- no more than about from 1 to 10 residues, (e.g. 1 to 7 residues, 1 to 6 residues, or 1 to 4 residues) are inserted at any one site within the protein molecule.
- the term “added next to” is the addition of one or more non-native amino acid residues in the protein sequence at a position adjacent to the referenced amino acid or amino acid region.
- a “consensus sequence” is a sequence have a specific structure and/or function.
- the term “consensus sequence” is a sequence comprising a glycosite.
- a consensus sequence may be selected from: a five amino acid consensus sequence D/E-X-N-Z-S/T (SEQ ID NO: 1), a seven amino acid consensus sequence K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) or an extended consensus sequence (e.g.
- nucleotide sequences or amino acid sequences that are the same or have a specified percentage of nucleotide residues or amino acid residues that are the same (e.g. 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identity over a specified region), when compared and aligned for maximum correspondence using, for example, sequence comparison algorithms or by manual alignment and visual inspection.
- Identity between polypeptides may be calculated by various algorithms. In general, when calculating percentage identity the two sequences to be compared are aligned to give a maximum correlation between the sequences. This may include inserting "gaps" in either one or both sequences, to enhance the degree of alignment. For example the Needleman Wunsch algorithm (Needleman and Wunsch 1970, J. Mol. Biol.48: 443-453) for global alignment, or the Smith Waterman algorithm (Smith and Waterman 1981 , J. Mol. Biol. 147: 195- 197) for local alignment may be used, e.g. using the default parameters (Smith Waterman uses BLOSUM 62 scoring matrix with a Gap opening penalty of 10 and a Gap extension penalty of 1).
- a preferred algorithm is described by Dufresne et al. in Nature Biotechnology in 2002 (vol. 20, pp. 1269-71) and is used in the software GenePAST (Genome Quest Life Sciences, Inc. Boston, MA).
- the GenePAST “percent identity” algorithm finds the best fit between the query sequence and the subject sequence, and expresses the alignment as an exact percentage. GenePAST makes no alignment scoring adjustments based on considerations of biological relevance between query and subject sequences. Identity between two sequences is calculated across the entire length of both sequences and is expressed as a percentage of the reference sequence (e.g. SEQ ID NO: 16 of the present invention).
- the term “recombinant” means artificial or synthetic.
- a “recombinant protein” refers to a protein that has been made using recombinant nucleotide sequences (nucleotide sequences introduced into a host cell).
- the nucleotide sequence that encodes a “recombinant protein” is heterologous to the host cell.
- the terms “isolated” or “purified” mean a protein, conjugate (e.g. bioconjugate), polynucleotide, or vector in a form not found in nature. This includes, for example, a a protein, conjugate (e.g. bioconjugate), polynucleotide, or vector having been separated from host cell or organism (including crude extracts) or otherwise removed from its natural environment.
- an isolated or purified protein is a protein essentially free from all other polypeptides with which the protein is innately associated (or innately in contact with).
- the term “subject” refers to an animal, in particular a mammal such as a primate (e.g. human).
- the term “effective amount,” in the context of administering a therapy (e.g. an immunogenic composition or vaccine of the invention) to a subject refers to the amount of a therapy which has a prophylactic and/or therapeutic effect(s).
- an “effective amount” refers to the amount of a therapy which is sufficient to achieve one, two, three, four, or more of the following effects: (i) reduce or ameliorate the severity of a bacterial infection or symptom associated therewith; (ii) reduce the duration of a bacterial infection or symptom associated therewith; (iii) prevent the progression of a bacterial infection or symptom associated therewith; (iv) cause regression of a bacterial infection or symptom associated therewith; (v) prevent the development or onset of a bacterial infection, or symptom associated therewith; (vi) prevent the recurrence of a bacterial infection or symptom associated therewith; (vii) reduce organ failure associated with a bacterial infection; (viii) reduce hospitalization of a subject having a bacterial infection; (ix) reduce hospitalization length of a subject having a bacterial infection; (x) increase the survival of a subject with a bacterial infection; (xi) eliminate a bacterial infection in a subject; (xii) inhibit
- a “multivalent immunogenic composition” or “multivalent vaccine” is an immunogenic composition/vaccine that comprises two or more different antigens.
- the multivalent immunogenic composition/vaccine comprises two or more different serotypes or subserotypes of a particular pathogen (e.g. against two or more different subserotypes of Klebsiella pneumoniae).
- the word “is” may be used as a substitute for “consists of” or “consisting of”.
- the abbreviation, “e.g.” is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example”.
- the present invention provides an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate.
- a carrier protein e.g.
- the present invention provides a multivalent immunogenic composition against subserotypes O1v1, O2a, O2afg and O3b of Klebsiella pneumoniae.
- the immunogenic composition comprises O-antigens from subserotypes O1v1, O2a, O2afg and O3b of Klebsiella pneumoniae.
- O-antigens may be in the form of a polysaccharide conjugate where the O-antigen polysaccharide is conjugated (i.e. covalently linked) to a carrier protein.
- Polysaccharides comprise 2 or more monosaccharides, typically greater than 10 monosaccharides.
- O1-antigens and O2-antigens are built of homopolymers of galactose, i.e. galactans. These O- antigen polysaccharides are part of a family of related structures, which share a D-galactan I backbone (gal-I).
- D-galactan I has the repeating unit structure: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ( Figure 1 of Hsieh et al. 2014 Front. Microbiol. 5:608, doi:10.3389/fmicb.2014.00608) and is the core element of serotype O2a.
- the O-antigen polysaccharide of serotype O2afg differs from other known O-antigen polysaccharides in Klebsiella spp. in that each of the main-chain Galp residues in the O2afg O-antigen polysaccharide is substituted with an ⁇ -(1 ⁇ 4)-linked D-Galp residue, to form a trisaccharide repeating unit, D-galactan III (gal-III) (Kelly et al. (1995) Innate Immun. 2, 131–140).
- D-galactan III has the repeating unit structure: ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)-[ ⁇ -D-Galp-(1 ⁇ 4)]- ⁇ -D-Galp-(1 ⁇ (Stojkovic et al. 2017 Front. Microbiol. 8:684, doi: 10.3389/fmicb.2017.00684). Kelly et al. J. Biol. Chem. (2019) 294(28) 10863–10876 further describes the repeat-unit structures of O1 and O2 serogroup antigens.
- D-galactan-II is capped by repeats of an antigenically different galactose disaccharide termed D-galactan-II (gal-II).
- D-galactan II has the repeating unit structure: [ ⁇ 3)- ⁇ -D-Galp-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ( Figure 1 of Hsieh et al. 2014 Front. Microbiol. 5:608, doi:10.3389/fmicb.2014.00608.)
- the O-antigen O3b of Klebsiella pneumoniae is described in Guachalla et al. (2017) Scientific Reports 7: 6635, 1-13.
- the O3b O-antigen has a tri-mannose form, whereas O3 has a penta-mannose form and O3a has a tetra-mannose form. These subtypes have been shown by Guachalla et al. (2017) to be antigenically different.
- the Klebsiella pneumoniae O1v1 O-antigen polysaccharide may have the structure –(D-galactan II)n – (D-galactan I)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galp-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n-[ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units for D-galactan II may be different from the number of repeat units for D-galactan I.
- the number of repeat units (n) ranges from 4 to 8 or 5 to 7, for example 6 for D-galactan II and the number of repeat units (n) ranges from 2 to 10, 3 to 6, for example 4 for D-galactan I.
- the number of repeat units (n) may range from 5 to 7 for D-galactan II and the number of repeat units (n) may range from 3 to 5 for D-galactan I.
- the ratio of D-galactan II:D-galactan I ranges between 2:1 to 1:50 or 2:1 to 1:2 (e.g. between 1.5:1 to 2:1).
- the Klebsiella pneumoniae O2a O-antigen polysaccharide may have the structure –(D-galactan I)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 10 to 30, e.g. from 15 to 30.
- An an immunogenic composition of the invention the Klebsiella pneumoniae O2afg O-antigen polysaccharide may have the structure –(D-galactan III)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)-[ ⁇ -D-Galp-(1 ⁇ 4)]- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 5 to 25 (e.g. from 5 to 15).
- the degree of branching ranges from 90-100%.
- the Klebsiella pneumoniae O3b O-antigen polysaccharide may have the structure Me-P-3(Man- ⁇ 2-Man- ⁇ 3-Man- ⁇ 3)n – Man- ⁇ 3-Man- ⁇ 3- GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: Me-P-[ ⁇ 3)- ⁇ -D- Man(1 ⁇ 2)- ⁇ -D-Man(1 ⁇ 3) - ⁇ -D-Man(1 ⁇ ]n ⁇ 3)- ⁇ -D-Man(1 ⁇ 3)- ⁇ -D-Man(1 ⁇ 3)-D-GlcNAc.
- An immunogenic composition of the invention may also comprise a pharmaceutically acceptable excipient and/or carrier.
- Pharmaceutically acceptable excipients and carriers are described, for example, in Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co. Easton, PA, 5th Edition (1975).
- Pharmaceutically acceptable excipients can include a buffer, such as a phosphate buffer (e.g. sodium phosphate).
- Pharmaceutically acceptable excipients can include a salt, for example sodium chloride.
- Pharmaceutically acceptable excipients can include a solubilizing/stabilizing agent, for example, polysorbate (e.g. TWEEN 80).
- compositions comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a carrier protein (e.g.
- a carrier protein e.g.
- an immunogenic composition of the invention comprising combining a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, and optionally a pharmaceutically acceptable excipient and/or carrier.
- EPA Pseudomonas aeruginosa
- the present invention provides an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate.
- Any carrier protein suitable for use in the production of conjugate vaccines e.g. bioconjugates for use in vaccines
- a nucleotide sequence encoding the carrier protein can be introduced into a host provided herein for the production of a bioconjugate, e.g.
- a bioconjugate comprising a carrier protein linked to a Klebsiella pneumoniae O-antigen.
- carrier proteins include, without limitation, detoxified Exotoxin A of P. aeruginosa (EPA), CRM197, maltose binding protein (MBP), Diphtheria toxoid, Tetanus toxoid, detoxified hemolysin A of S. aureus, clumping factor A, clumping factor B, E. coli FimH, E. coli FimHC, E. coli heat labile enterotoxin, detoxified variants of E.
- EPA P. aeruginosa
- MBP maltose binding protein
- Diphtheria toxoid Tetanus toxoid
- detoxified hemolysin A of S. aureus clumping factor A
- clumping factor B E. coli FimH
- E. coli FimHC E. coli heat labile enterotoxi
- the carrier protein used in the generation of the bioconjugates described herein are modified, e.g. modified in such a way that the carrier protein is less toxic and/or more susceptible to glycosylation.
- the carrier proteins used in the generation of the bioconjugates described herein are modified such that the number of glycosylation sites in the carrier proteins is increased in a manner that allows for lower concentrations of the protein to be administered, e.g. in an immunogenic composition, in its bioconjugate form.
- the carrier protein may be modified to include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more glycosylation sites than would normally be associated with the carrier protein (e.g. relative to the number of glycosylation sites associated with the carrier protein in its native/natural, e.g. “wild-type” state).
- glycosylation sites are accomplished by insertion of glycosylation consensus sequences (as described in WO 2006/119987) anywhere in the primary structure of the protein.
- the carrier protein used herein may comprise a D/E-X-N-Z-S/T (SEQ ID NO: 1) consensus sequence, wherein X and Z are independently any amino acid except proline.
- the present invention provides an immunogenic composition
- an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T (SEQ ID NO: 1) wherein X and Z may be any natural amino acid except proline.
- the classical 5 amino acid glycosylation consensus sequence (D/E-X- N-Z-S/T (SEQ ID NO: 1)) may be extended by lysine residues for more efficient glycosylation (e.g. K- D/E-X-N-Z-S/T-K (SEQ ID NO: 2)), wherein X and Z are independently any amino acid except proline (preferably wherein X is Q (glutamine), Z is A (alanine).
- one or more amino acids e.g. 1-7 amino acids, e.g.
- one amino acid) of the carrier protein amino acid sequence is/are substituted by a five amino acid D/E-X-N-Z-S/T (SEQ ID NO: 1) or by a seven amino acid K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) (e.g. K-D-Q-N-A-T-K (SEQ ID NO: 3) also referred to as “KDQNATK”) consensus sequence, wherein X and Z are independently any amino acid except proline (preferably wherein X is Q (glutamine), Z is A (alanine)).
- a single amino acid in the carrier protein amino acid sequence may be substituted (i.e.
- D/E-X-N-Z-S/T SEQ ID NO: 1
- K-D/E-X-N-Z-S/T-K SEQ ID NO: 2
- K-D-Q-N-A-T-K SEQ ID NO: 3
- 2, 3, 4, 5, 6 or 7 amino acids within the carrier protein amino acid sequence may be substituted (i.e.
- D/E-X-N-Z-S/T SEQ ID NO: 1
- K-D/E-X-N-Z-S/T-K SEQ ID NO: 2 consensus sequence
- X and Z are independently any amino acid except proline (preferably wherein X is Q (glutamine), Z is A (alanine)) (e.g. K-D-Q-N-A-T-K (SEQ ID NO: 3).
- the classical 5 amino acid glycosylation consensus sequence (D/E-X-N-Z-S/T (SEQ ID NO: 1)) may also be extended by 1-5 other amino acid residues either side of the consensus sequence for more efficient glycosylation J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4) wherein J and U are independently 1 to 5 naturally occurring amino acid residues (preferably J and U are independently 1 to 5 amino acid residues independently selected from glycine and/or serine, e.g. G-S-G-G-G-D/E-X-N-Z-S/T-G-S-G-G (SEQ ID NO: 5)).
- the carrier protein as used herein may comprise consensus sequence(s) selected from: D/E-X-N-Z-S/T (SEQ ID NO: 1), K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) and/or J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4) wherein X and Z are independently any amino acid except proline (preferably wherein X is Q (glutamine), Z is A (alanine)) and wherein J and U are independently 1 to 5 naturally occurring amino acid residues (preferably J and U are independently 1 to 5 amino acid residues independently selected from glycine and/or serine).
- the carrier protein as used herein may comprise 3- 7 consensus sequence(s) selected from: D/E-X-N-Z-S/T (SEQ ID NO: 1), K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) and/or J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4) wherein X and Z are independently any amino acid except proline (preferably wherein X is Q (glutamine), Z is A (alanine)) and wherein J and U are independently 1 to 5 naturally occurring amino acid residues (preferably J and U are independently 1 to 5 amino acid residues independently selected from glycine and/or serine).
- a combination of consensus sequences selected from: a five amino acid consensus sequence D/E-X-N-Z-S/T (SEQ ID NO: 1), a seven amino acid consensus sequence K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) and an extended consensus sequence (e.g. J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4)) may be used.
- a carrier protein may comprise 1, 2, 3, 4 or 5 consensus sequences selected from D/E- X-N-Z-S/T (SEQ ID NO: 1) and K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2), wherein X and Z are independently any amino acid except proline (preferably wherein X is Q (glutamine), Z is A (alanine)), and the carrier protein may further comprise 1 or 2 extended consensus sequences J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4) wherein J and U are independently 1 to 5 naturally occurring amino acid residues (preferably J and U are independently 1 to 5 amino acid residues independently selected from glycine and/or serine, e.g.
- G-S-G-G-G-D/E-X-N-Z-S/T-G-S-G-G (SEQ ID NO: 5)).
- an extended consensus sequence such as J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4) or G-S-G-G-G-D/E-X-N-Z-S/T-G-S-G-G (SEQ ID NO: 5) is used where the consensus sequence is added next to the N-terminal or C-terminal amino acid of the EPA protein.
- the present invention also provides an immunogenic composition
- an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a carrier protein comprising 3 to 7 consensus sequence(s) selected from: D/E-X-N-Z-S/T (SEQ ID NO: 1), K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) and/or J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4), wherein X and
- glycosylation sites can be accomplished by, e.g. adding new amino acids to the primary structure of the protein (i.e. the glycosylation sites are added, in full or in part), or by mutating existing amino acids in the protein in order to generate the glycosylation sites (i.e.
- amino acids are not added to the protein, but selected amino acids of the protein are mutated so as to form glycosylation sites).
- amino acid sequence of a protein can be readily modified using approaches known in the art, e.g. recombinant approaches that include modification of the nucleic acid sequence encoding the protein.
- glycosylation consensus sequences are introduced into specific regions of the carrier protein, e.g. surface structures of the protein, at the N or C termini of the protein, and/or in loops that are stabilized by disulfide bridges at the base of the protein.
- the carrier protein may be a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- Exotoxin A of Pseudomonas aeruginosa is a secreted bacterial toxin, a member of the ADP-ribosyltransferasetoxin family.
- An EPA protein useful in the invention can be produced by methods known in the art in view of the present disclosure, see for example Ihssen et al. (2010) Microbial Cell Factories 9:61, WO 2006/119987, WO 2009/104074 and WO2015124769A1.
- Exotoxin A from Pseudomonas aeruginosa strain PA103 was cloned and sequenced by Gray et al. (1984) Proc. Nati. Acad. Sci.
- a S T L I 610 SQPGKPPRED LK The numbering of the amino acid residues as specified herein, refers to the amino acid position in SEQ ID NO: 16 (or where an amino acid sequence is at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 to an equivalent position to that of SEQ ID NO: 16 if this sequence was lined up with an amino acid sequence of SEQ ID NO: 16 in order to maximise the sequence identity between the two sequences using Needleman Wunsch algorithm). Because EPA is a toxin, it needs to be detoxified (i.e. rendered non-toxic to a mammal, e.g.
- a detoxified EPA protein may be genetically detoxified (i.e. by mutation).
- the genetically detoxified sequences may remove undesirable activities such as ADP-ribosyltransferase activity, in order to reduce the toxicity, whilst retaining the ability to induce anti-EPA protective and/or neutralizing antibodies following administration to a human.
- the genetically detoxified sequences may maintain their immunogenic epitopes.
- a detoxified EPA protein may be genetically detoxified by one or more point mutations.
- detoxification can be achieved by mutating and deleting catalytically essential residues, such as substitution of leucine 552 to valine (L552V) and by deletion of glutamic acid-553 ( ⁇ E553), according to Lukac et al. (1988), Infect Immun, 56: 3095-3098, and Ho et al. (2006), Hum Vaccin, 2:89-98.
- catalytically essential residues such as substitution of leucine 552 to valine (L552V) and by deletion of glutamic acid-553 ( ⁇ E553)
- Detoxification can be achieved by mutating/deleting the catalytically essential residues L552V ⁇ E553 using quick change mutagenesis (Stratagene) and phosphorylated oligonucleotides 5' -GAAGGCGGGCGCGTGACCA TTCTCGGC (SEQ ID NO: 40) and 5'- GCCGAGAATGGTCACGCGCCCGCCTTC (SEQ ID NO: 41) resulting in construct pGVXN70.
- the detoxified EPA protein as used herein may have an amino acid sequence comprising (or consisting) of an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and having a substitution of leucine 552 to valine (L552V) and deletion of glutamine 553 ( ⁇ E553) with reference to the amino acid sequence of SEQ ID NO: 16 (or an equivalent position in an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16).
- Detoxification can be measured by determining the inhibition of ADP-ribosyltransferase and cytotoxic activity according to the methodology described in Lukac et al. (1988), Infect Immun, 56: 3095-3098, and references cited therein, namely Douglas et al (1987) J. Bacteriol 169: 4962-4966 and Douglas et al (1987).
- a detoxified EPA has ADP-ribosyltransferase and cytotoxic activites lower than wild-type EPA, suitably the same as or less than that of the modified EPA described in Lukac et al (1988) i.e. ⁇ E553 EPA (EPA having deletion of glutamic acid-533).
- the present invention provides an immunogenic composition
- an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA), e.g.
- EPA Pseudomonas aeruginosa
- EPA Pseudomonas aeruginosa
- EPA Pseudomonas aeruginosa
- SEQ ID NO: 16 amino acid sequence comprising (or consisting) of an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and having a substitution of leucine 552 to valine (L552V) and deletion of glutamine 553 ( ⁇ E553).
- the detoxified Exotoxin A of Pseudomonas aeruginosa may be further modified in that the amino acid sequence comprises one (or more) consensus sequence(s) selected from: D/E-X-N-Z-S/T (SEQ ID NO: 1), K-D/E-X-N-Z-S/T-K (SEQ ID NO: 2) or J-D/E-X-N-Z-S/T-U (SEQ ID NO: 4) wherein X is Q (glutamine), Z is A (alanine), J and U are independently 1 to 5 amino acid residues independently selected from glycine and/or serine, as described above.
- D/E-X-N-Z-S/T SEQ ID NO: 1
- K-D/E-X-N-Z-S/T-K SEQ ID NO: 2
- J-D/E-X-N-Z-S/T-U SEQ ID NO: 4
- X is Q (glutamine)
- Z is A
- the one (or more) consensus sequences may each be added next to, or substituted for one or more amino acids selected from specific amino acid residues within the EPA protein (consensus sequence sites).
- the detoxified Exotoxin A of Pseudomonas aeruginosa may comprise 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline.
- the present invention provides an immunogenic composition
- a Klebsiella pneumoniae O1v1 O- antigen polysaccharide conjugate a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate
- each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) comprises 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline.
- EPA Pseudomonas aeruginosa
- a detoxified Exotoxin A of Pseudomonas aeruginosa having an amino acid sequence comprising (or consisting) of an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and having a substitution of leucine 552 to valine (L552V) and deletion of glutamine 553 ( ⁇ E553) and comprising 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline.
- EPA Pseudomonas aeruginosa
- the present invention also provides an immunogenic composition
- an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O- antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) carrier protein having an amino acid sequence comprising (or consisting) of an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 modified in having a substitution of leucine 552 to
- K-D-Q-N-A-T-K (SEQ ID NO: 3), and wherein J and U are independently 1 to 5 naturally occurring amino acid residues (preferably J and U are independently 1 to5 amino acid residues independently selected from glycine and/or serine, e.g. G-S-G-G-G-D/E-X-N-Z-S/T-G-S-G-G (SEQ ID NO: 5)).
- the detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) as used herein may contain four consensus sequences.
- the detoxified Exotoxin A of Pseudomonas aeruginosa may have an amino acid sequence of SEQ ID NO: 16 or an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 modified in that the amino acid sequence has a substitution of leucine 552 to valine (L552V), a deletion of glutamine 553 ( ⁇ E553) and comprises four consensus sequences, e.g.
- the detoxified Exotoxin A of Pseudomonas aeruginosa may contain four consensus sequences, optionally substituted for amino acid residues Y208, R274, A519 and added next to the N-terminal amino acid of SEQ ID NO: 16 or an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16.
- the detoxified Exotoxin A of Pseudomonas aeruginosa may comprise (or consist of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 17.
- the carrier protein as used herein further comprises a signal sequence which is capable of directing the carrier protein to the periplasm of a host cell (e.g. bacterium). Signal sequences, including periplasmic signal sequences, are usually removed during translocation of the protein into, for example, the periplasm by signal peptidases (i.e., a mature protein is a protein from which at least the signal sequence has been removed).
- the signal sequence may be from E.
- coli flagellin [MIKFLSALILLLVTTAAQA (SEQ ID NO: 6)], E. coli outer membrane porin A (OmpA) [MKKTAIAIAVALAGFATVAQA (SEQ ID NO: 7)], E. coli maltose binding protein (MalE) [MKIKTGARILALSALTTMMFSASALA (SEQ ID NO: 8)], Erwinia carotovorans pectate lyase (PelB) [MKYLLPTAAAGLLLLAAQPAMA (SEQ ID NO: 9)], heat labile E.
- the signal sequence is from E.
- the carrier protein may further comprise a signal sequence which is capable of directing the carrier protein to the periplasm of a host cell (e.g. bacterium), optionally said signal sequence being DsbA (SEQ ID NO: 12).
- a signal peptide of the protein DsbA from E. coli can be genetically fused to the N-terminus of the mature carrier protein sequence.
- plasmid derived from pEC415 [Schulz, H., Hennecke, H., and Thony- Meyer, L., Science, 281, 1197-1200, 1998] containing the DsbA signal peptide code followed by a RNase sequence can be digested (NdeI to EcoRI) to keep the DsbA signal and remove the RNase insert.
- EPA is then amplified using PCR (forward oligo 5'-AAGCTAGCGCCGCCGAGGAAGCCTTCGACC (SEQ. ID NO. 19) and reverse oligo 5'-AAGAA TTCTCAGTGGTGGTGGTGGTGGTGCTTCAGGTCCTCGCGCGGCGG (SEQ. ID NO.
- pGVXN69 encodes a protein product with an DsbA signal peptide, the mature carrier sequence and a hexa-histag.
- EPA Pseudomonas aeruginosa
- DsbA signal sequence having an amino acid sequence comprising (or consisting of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 18.
- the carrier protein expressed by host cells of the invention are expressed from a nucleotide sequence that has been integrated into the genome of the host cell. That is, a nucleotide sequence encoding the carrier protein has been integrated into the host cell genome.
- the carrier protein expressed in the host cell of the invention is expressed from a plasmid that has been introduced into the host cell.
- Conjugates The present invention also provides a conjugate (e.g. bioconjugate) comprising a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b conjugated to a carrier protein, e.g.
- the carrier protein is a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- the conjugate e.g. bioconjugate
- the Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b is directly linked to the carrier protein, e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- the Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b is directly linked to an amino acid residue of the carrier protein, e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- the Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b is covalently linked to the carrier protein, e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) through a chemical linkage obtainable using a chemical conjugation method (i.e. the conjugate is produced by chemical conjugation).
- the chemical conjugation method may be selected from the group consisting of carbodiimide chemistry, reductive animation, cyanylation chemistry (for example CDAP chemistry), maleimide chemistry, hydrazide chemistry, ester chemistry, and N-hydroysuccinimide chemistry.
- Conjugates can be prepared by direct reductive amination methods as described in, US200710184072 (Hausdorff) US 4365170 (Jennings) and US 4673574 (Anderson). Other methods are described in EP-0-161-188, EP-208375 and EP-0-477508.
- the conjugation method may alternatively rely on activation of the saccharide with 1-cyano-4- dimethylamino pyridinium tetrafluoroborate (CDAP) to form a cyanate ester.
- CDAP 1-cyano-4- dimethylamino pyridinium tetrafluoroborate
- Such conjugates are described in PCT published application WO 93/15760 Uniformed Services University and WO 95/08348 and WO 96/29094. See also Chu C. et al. Infect. Immunity, 1983245256.
- the following types of chemical groups on carrier protein e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) can be used for coupling / conjugation:
- A) Carboxyl for instance via aspartic acid or glutamic acid.
- this group is linked to amino groups on saccharides directly or to an amino group on a linker with carbodiimide chemistry e.g. with EDAC.
- B) Amino group (for instance via lysine).
- this group is linked to carboxyl groups on saccharides directly or to a carboxyl group on a linker with carbodiimide chemistry e.g. with EDAC.
- this group is linked to hydroxyl groups activated with CDAP or CNBr on saccharides directly or to such groups on a linker; to saccharides or linkers having an aldehyde group; to saccharides or linkers having a succinimide ester group.
- D) Hydroxyl group for instance via tyrosine). In one embodiment this group is activated/modified with bis diazobenzidine.
- E) Imidazolyl group (for instance via histidine).
- this group is activated/modified with bis diazobenzidine.
- Guanidyl group for instance via arginine.
- Indolyl group for instance via tryptophan).
- a saccharide in general the following groups can be used for a coupling: OH, COOH or NH2.
- Aldehyde groups can be generated after different treatments such as: periodate, acid hydrolysis, hydrogen peroxide, etc.
- Conjugates can be purified by any method known in the art for purification of a protein, for example, by chromatography (e.g. ion exchange, anionic exchange, affinity, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
- a detoxified Exotoxin A of Pseudomonas aeruginosa to which the antigen is linked is selected from the group consisting of: Ala, Arg, Asp, Cys, Gly, Glu, Gln, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val.
- the amino acid is: an amino acid containing a terminal amine group, a lysine, an arginine, a glutaminic acid, an aspartic acid, a cysteine, a tyrosine, a histidine or a tryptophan.
- the amino acid residue on the carrier protein e.g.
- a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA), to which the antigen is linked is not an asparagine residue and in this case, the conjugate is typically produced by chemical conjugation.
- the antigen is linked to an amino acid on the carrier protein, e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA), selected from asparagine, aspartic acid, glutamic acid, lysine, cysteine, tyrosine, histidine, arginine or tryptophan (e.g.
- the conjugate may be a bioconjugate (for example an enzymatic conjugation using a oligosaccharyltransferase such as PglB).
- the amino acid residue on the carrier protein e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA), to which the antigen is linked is an asparagine residue.
- the amino acid residue on the modified EPA protein to which the antigen is linked is part of the consensus sequence, e.g.
- the conjugate of the invention may be a conjugate of a a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b (e.g. chemical conjugate or bioconjugate).
- the conjugate of the invention may be a conjugate of an isolated recombinant carrier protein, e.g.
- a recombinant detoxified Exotoxin A of Pseudomonas aeruginosa EPA
- a recombinant antigen e.g. recombinant Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b
- the present invention provides a conjugate (e.g. bioconjugate) wherein the Klebsiella pneumoniae O1v1 O-antigen polysaccharide has the structure –(D-galactan II)n – (D-galactan I)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galp-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n-[ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units for D-galactan II may be different from the number of repeat units for D-galactan I.
- the number of repeat units (n) ranges from 4 to 8, 5 to 7, for example 6 for D-galactan II and the number of repeat units (n) ranges from 2 to 10, 3 to 7, for example 4 for D-galactan I.
- the number of repeat units (n) may range from 5 to 7 for D-galactan II and the number of repeat units (n) may range from 3 to 5 for D-galactan I.
- the ratio of D-galactan II:D-galactan I ranges between 2:1 to 1:50 or 2:1 to 1:2 (e.g. between 1.5:1 to 2:1).
- the present invention provides a conjugate (e.g. bioconjugate) wherein the Klebsiella pneumoniae O2a O-antigen polysaccharide has the structure –(D-galactan I)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 10 to 30, e.g. from 15 to 30.
- the present invention provides a conjugate (e.g. bioconjugate) wherein the Klebsiella pneumoniae O2afg O-antigen polysaccharide has the structure –(D-galactan III)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)-[ ⁇ -D-Galp-(1 ⁇ 4)]- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 5 to 25 (e.g. from 5 to 15).
- the degree of branching ranges from 90-100%.
- the present invention provides a conjugate (e.g.
- the Klebsiella pneumoniae O3b O-antigen polysaccharide has the structure Me-P-3(Man- ⁇ 2-Man- ⁇ 3-Man- ⁇ 3)n – Man- ⁇ 3-Man- ⁇ 3- GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: Me-P-[ ⁇ 3)- ⁇ -D- Man(1 ⁇ 2)- ⁇ -D-Man(1 ⁇ 3) - ⁇ -D-Man(1 ⁇ ]n ⁇ 3)- ⁇ -D-Man(1 ⁇ 3)- ⁇ -D-Man(1 ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 5 to 25 (e.g.
- the conjugates (e.g. bioconjugate), of the invention are particularly suited for inclusion in immunogenic compositions and vaccines.
- the present invention also provides an immunogenic composition comprising a conjugate (e.g. bioconjugate) of the invention, and optionally a pharmaceutically acceptable excipient and/or carrier.
- Host cell The present invention provides a host cell comprising nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b and a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g. detoxified exotoxin A of Pseudomonas aeruginosa (EPA) comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline).
- EPA Pseudomonas aeruginosa
- the present invention provides a host cell comprising: i) nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b, optionally integrated into the host cell genome; (ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase, optionally within a plasmid; (iii) a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g.
- detoxified exotoxin A of Pseudomonas aeruginosa comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline), optionally within a plasmid; and optionally (iv) a nucleotide sequence encoding an ABC transporter, optionally K. pneumoniae genes wzm and wzt, optionally integrated into the host cell genome.
- the present invention also provides a host cell comprising: i) nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b, optionally integrated into the host cell genome; ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase, optionally within a plasmid; iii) a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g.
- Host cells that can be used to produce the bioconjugates of the invention include archea, prokaryotic host cells, and eukaryotic host cells.
- the host cell is a non-human host cell.
- Exemplary prokaryotic host cells for use in production of the bioconjugates of the invention include Escherichia species, Shigella species, Klebsiella species, Xhantomonas species, Salmonella species, Yersinia species, Lactococcus species, Lactobacillus species, Pseudomonas species, Corynebacterium species, Streptomyces species, Streptococcus species, Staphylococcus species, Bacillus species, and Clostridium species.
- the host cell is E. coli (e.g. E. coli K12 W3110).
- E. coli e.g. E.coli K12 W3110
- nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide may be integrated into the E.coli O-antigen locus (e.g. the O16-antigen locus of E. coli K12 W3110), optionally in place of one or more genes of the E.coli O-antigen locus.
- the sequence of the O-antigen cluster of E coli W3110 is reported in GenBank with accession number U03041 (rfb, GenBank U03041).
- the host cell is E. coli (e.g. E.coli K12 W3110)
- the K. pneumoniae genes wbbM, glf, wbbN, and wbbO may be integrated into E.coli O-antigen locus (e.g. the O16-antigen locus of E. coli K12 W3110), optionally retaining the E. coli O-antigen promoter as a promoter for the polysaccharide synthesis genes.
- E. coli e.g. E.coli K12 W3110
- the K. pneumoniae genes wbbM, glf, wbbN, and wbbO may be integrated into E.coli O-antigen locus (e.g. the O16-antigen locus of E. coli K12 W3110), optionally retaining the E. coli O-antigen promoter as a promoter for the polysaccharide synthesis genes.
- E. coli e.g. E.coli K12
- E.coli K12 W3110 nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen polysaccharide may be integrated into the E.coli yeaS locus, optionally in place of the E.coli yeaS gene.
- the genome of E. coli K12 W3110 is reported in GenBank with accession number NC_007779.
- the YeaS gene occupies positions 1’881’835 to 1’882’473 (GenBank NC_007779 position 1’881’835 to 1’882’473).
- the host cell is E. coli (e.g. E.coli K12 W3110), the K.
- the present invention also provides a host cell wherein the host cell is E. coli (e.g. E.coli K12 W3110) and wherein K. pneumoniae genes wbbM, glf, wbbN, and wbbO are integrated into E.coli O-antigen locus (e.g. the O16-antigen locus of E. coli K12 W3110), optionally in place of one or more genes of the E.coli O- antigen locus, and the K.
- E. coli e.g. E.coli K12 W3110
- K. pneumoniae genes wbbM, glf, wbbN, and wbbO are integrated into E.coli O-antigen locus (e.g. the O16-antigen locus of E. coli K12 W3110), optionally in place of one or more genes of the E.coli O- antigen locus, and the K.
- Host cells may be modified to delete or modify genes in the host cell genetic background (genome) that compete or interfere with the synthesis of the polysaccharide of interest (e.g. compete or interfere with one or more heterologous polysaccharide synthesis genes that are recombinantly introduced into the host cell). These genes can be deleted or modified in the host cell background (genome) in a manner that makes them inactive/dysfunctional (i.e. the host cell nucleotide sequences that are deleted/modified do not encode a functional protein or do not encode a protein whatsoever).
- nucleotide sequences when nucleotide sequences are deleted from the genome of the host cells of the invention, they are replaced by a desirable sequence, e.g. a sequence that is useful for polysaccharide synthesis.
- a desirable sequence e.g. a sequence that is useful for polysaccharide synthesis.
- Exemplary genes that can be deleted in host cells (and, in some cases, replaced with other desired nucleotide sequences) include genes of host cells involved in glycolipid biosynthesis, such as waaL (see, e.g. Feldman et al.
- the O-antigen cluster rfb or wb
- enterobacterial common antigen cluster wec
- the lipid A core biosynthesis cluster waa
- galactose cluster gal
- arabinose cluster ara
- colonic acid cluster wc
- capsular polysaccharide cluster e.g. uppS (Undecaprenyl pyrophosphate synthase), uppP (Undecaprenyl diphosphatase)
- Und-P recycling genes e.g. uppS (Undecaprenyl pyrophosphate synthase), uppP (Undecaprenyl diphosphatase)
- Und-P recycling genes e.g. uppS (Undecaprenyl pyrophosphate synthase), uppP (Undecaprenyl diphosphatase)
- Und-P recycling genes e.g. uppS (Undecaprenyl pyrophosphate synthase), uppP (Undecaprenyl
- one or more of the native waaL gene, gtrA gene, gtrB gene, gtrS gene, or a gene or genes from the enterobacterial common antigen cluster (ECA, wec), or a gene, or a gene or genes from the colonic acid cluster (wc) are deleted or functionally inactivated from the genome of a prokaryotic host cell of the invention.
- the host cell of the invention is E. coli, wherein the enterobacterial common antigen cluster (ECA, wec) with the exception of wecA, the colanic acid cluster (wca), and the O- antigen cluster (e.g. the O16-antigen cluster of E. coli K12 W3110) have been deleted.
- wec genes are as follows: wecA (UDP-N-acetylglucosamine transferase), wzzE (chain length regulator), wecB (UDP-N-acetylglucosamine epimerase), wecC (UDP-N- acetylmannosamine dehydrogenase), rlmB (TDP-glucose 4,6-dehydratase), rlmA (glucose-1- phosphate thymidylyltransferase), wecD (fucosamine acetyltransferase), wecE (TDP-4-oxo-6-deoxy- D-glucose transaminase), wzxE (ECA translocase), wecF (UDP-N-acetylfucosamine transferase), wzy (ECA polymerase), and wecG (UDP-N-acetyl
- the native enterobacterial common antigen cluster (ECA, wec) with the exception of wecA is deleted
- the genes from wzzE to wecG i.e. wzzE, wecB, wecC, rlmB, rlmA, wecD, wecE, wzxE, wecF, wzy, and wecG
- the native lipopolysaccharide O-antigen ligase waaL may be deleted from the host cell of the invention.
- the native gtrA gene, gtrB gene and gtrS gene (e.g. the E.
- the host cells of the present invention are engineered to comprise heterologous nucleotide sequences.
- the host cells of the present invention are engineered to comprise a nucleotide sequence that encodes nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b.
- Polysaccharide synthesis genes encode proteins involved in synthesis of a polysaccharide.
- the host cells of the invention may comprise one or more nucleotide sequences sufficient for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b.
- the present invention provides a host cell comprising nucleotide sequences for producing a Klebsiella pneumoniae O-antigen polysaccharide O1v1, O2a, O2afg or O3b, optionally integrated into the host cell genome.
- the present invention provides a host cell comprising nucleotide sequences for producing a Klebsiella pneumoniae O-antigen polysaccharide O1v1, optionally integrated into the host cell genome.
- the present invention provides a host cell comprising nucleotide sequences for producing a Klebsiella pneumoniae O-antigen polysaccharide O2a, optionally integrated into the host cell genome.
- the present invention provides a host cell comprising nucleotide sequences for producing a Klebsiella pneumoniae O-antigen polysaccharide O2afg, optionally integrated into the host cell genome.
- the present invention provides a host cell comprising nucleotide sequences for producing a Klebsiella pneumoniae O-antigen polysaccharide O3b, optionally integrated into the host cell genome.
- Heterologous nucleotide sequences e.g.
- nucleotide sequences that encode carrier proteins and/or nucleotide sequences that encode other proteins, e.g. proteins involved in glycosylation) can be introduced into the host cells of the invention using methods such as electroporation, chemical transformation by heat shock, natural transformation, phage transduction, and conjugation.
- heterologous nucleotide sequences are introduced into the host cells of the invention using a plasmid, e.g. the heterologous nucleotide sequences are expressed in the host cells by a plasmid (e.g. an expression vector).
- heterologous nucleotide sequences are introduced into the host cells of the invention using the method of insertion described in WO14/037585.
- the host cell of the present invention comprises one or more nucleotide sequences that comprise polysaccharide synthesis genes which are heterologous to the host cell.
- one or more of said nucleotide sequences that comprise polysaccharide synthesis genes which are heterologous to the host cell are integrated into the genome of the host cell.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b may be integrated into the host cell genome.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O1v1, O2a or O2afg O-antigen polysaccharide may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO from a K.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO from a K. pneumoniae strain which expresses an O2a O-antigen.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO from a K. pneumoniae strain which expresses an O2afg O-antigen.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO from a K. pneumoniae strain which expresses an O1v1 O-antigen.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO.
- the nucleotide sequence for K. pneumoniae gene wbbM comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 23.
- the nucleotide sequence for K comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 23.
- the nucleotide sequence for K comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 23.
- pneumoniae gene glf comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 24.
- the nucleotide sequence for K. pneumoniae gene wbbN comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 25.
- the nucleotide sequence for K. pneumoniae gene wbbO comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 26.
- the present invention provides a host cell (e.g. E. coli) comprising: i) nucleotide sequences for producing a Klebsiella pneumoniae O2a O-antigen polysaccharide comprising K. pneumoniae genes wbbM, glf, wbbN and wbbO, optionally integrated into the host cell genome; ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase (e.g.
- pglB optionally from Campylobacter jejuni
- a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g. detoxified exotoxin A of Pseudomonas aeruginosa (EPA) comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline), optionally within a plasmid
- EPA Pseudomonas aeruginosa
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O2a O-antigen polysaccharide may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O2a O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen may comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO from a K. pneumoniae strain which expresses an O2 O-antigen (e.g. from a K. pneumoniae strain which expresses a O2a O-antigen).
- wbbM, glf, wbbN and wbbO are from a K. pneumoniae strain which expresses an O2a O-antigen.
- the nucleotide sequence for K. pneumoniae gene wbbM comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 23.
- the nucleotide sequence for K. pneumoniae gene glf comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 24.
- the nucleotide sequence for K comprises
- pneumoniae gene wbbN comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 25.
- the nucleotide sequence for K. pneumoniae gene wbbO comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 26.
- the present invention provides a host cell (e.g. E. coli) comprising: i) nucleotide sequences for producing a Klebsiella pneumoniae O2afg O-antigen polysaccharide comprising K.
- a nucleotide sequence encoding a heterologous oligosaccharyl transferase e.g. pglB, optionally from Campylobacter jejuni
- a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g.
- detoxified exotoxin A of Pseudomonas aeruginosa comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline), optionally within a plasmid; and iv) a nucleotide sequence encoding an ABC transporter, optionally K. pneumoniae genes wzm and wzt, optionally integrated into the host cell genome.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O2afg O-antigen polysaccharide may comprise K.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, gmlA, gmlB and gmlC.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O2afg O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, gmlA, gmlB and gmlC.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen may comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, gmlA, gmlB and gmlC from a K.
- the nucleotide sequence encoding K. pneumoniae gene gmlA comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 27.
- the nucleotide sequence encoding K comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 27.
- the nucleotide sequence encoding K comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 27.
- the nucleotide sequence encoding K comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 27.
- pneumoniae gene gmlB comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 28.
- the nucleotide sequence encoding K. pneumoniae gene gmlC comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 29.
- the present invention provides a host cell (e.g. E. coli) comprising: i) nucleotide sequences for producing a Klebsiella pneumoniae O1v1 O-antigen polysaccharide comprising K.
- pneumoniae genes wbbM, glf, wbbN, wbbO, wbbY and wbbZ optionally integrated into the host cell genome; ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase (e.g. pglB, optionally from Campylobacter jejuni), optionally within a plasmid; iii) a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g.
- detoxified exotoxin A of Pseudomonas aeruginosa comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline), optionally within a plasmid; and iv) a nucleotide sequence encoding an ABC transporter, optionally K. pneumoniae genes wzm and wzt, optionally integrated into the host cell genome.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O1v1 O-antigen polysaccharide may comprise K.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, wbbY and wbbZ.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O1v1 O-antigen polysaccharide comprise K.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O1v1 O-antigen may comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, wbbY and wbbZ from a K. pneumoniae strain which expresses an O1 O-antigen (e.g. from a K. pneumoniae strain which expresses an O1v1 O-antigen).
- at least wbbY and wbbZ are from a K.
- the nucleotide sequence encoding K. pneumoniae gene wbbY comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 30.
- the nucleotide sequence encoding K. pneumoniae gene wbbZ comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 31.
- the present invention provides a host cell (e.g. E.
- nucleotide sequences for producing a Klebsiella pneumoniae O3b O-antigen polysaccharide comprising K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC, optionally integrated into the host cell genome; ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase (e.g.
- pglB optionally from Campylobacter jejuni
- a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g. detoxified exotoxin A of Pseudomonas aeruginosa (EPA) comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline), optionally within a plasmid
- EPA Pseudomonas aeruginosa
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O3b O-antigen polysaccharide may comprise K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen polysaccharide comprise K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC.
- the present invention provides a host cell wherein the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O3b O-antigen polysaccharide comprise K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O3b O- antigen may comprise K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC from a K. pneumoniae strain which expresses an O3 O-antigen (e.g. from a K.
- wbdA is from a K. pneumoniae strain which expresses an O3b O-antigen.
- the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen may comprise K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC from a K. pneumoniae strain which expresses an O3b O-antigen.
- the nucleotide sequence encoding K. pneumoniae gene manC comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 32.
- the nucleotide sequence encoding K. pneumoniae gene manB comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 33.
- the nucleotide sequence encoding K. pneumoniae gene wbdD comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 36.
- the nucleotide sequence for K. pneumoniae encoding wbdA comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 37.
- the nucleotide sequence encoding K. pneumoniae gene wbdB comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 38.
- the nucleotide sequence encoding K comprises
- pneumoniae gene wbdC comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 39.
- the host cells of the present invention are also engineered to comprise a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g. detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline), optionally within a plasmid.
- EPA Pseudomonas aeruginosa
- host cells of the present invention may comprise a nucleotide sequence that encodes a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) having an amino acid sequence comprising (or consisting) of an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and having a substitution of leucine 552 to valine (L552V) and deletion of glutamine 553 ( ⁇ E553) and comprising 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline.
- EPA Pseudomonas aeruginosa
- host cells of the present invention may comprise a nucleotide sequence that encodes a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) having an amino acid sequence comprising (or consisting of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 17.
- EPA Pseudomonas aeruginosa
- host cells of the present invention may comprise a nucleotide sequence that encodes a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) with a signal sequence having an amino acid sequence comprising (or consisting of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 18.
- EPA Pseudomonas aeruginosa
- host cells of the invention can produce a bioconjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b which is attached to a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g. detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline.
- EPA Pseudomonas aeruginosa
- the host cells may also comprise heterologous nucleotide sequences that are located outside of an O-antigen cluster.
- nucleotide sequences encoding glycosyltransferases and acetyltransferases that are found outside of O-antigen clusters and that modify recombinant polysaccharides can be introduced into the host cells.
- Oligosaccharyl Transferase N-linked protein glycosylation (the addition of carbohydrate molecules to an asparagine residue in the polypeptide chain of the target protein) is the most common type of post-translational modification occurring in the endoplasmic reticulum of eukaryotic organisms.
- the process is accomplished by the enzymatic oligosaccharyltransferase complex (OST) responsible for the transfer of a preassembled oligosaccharide from a lipid carrier (dolichol phosphate) to an asparagine residue of a nascent protein within the conserved sequence Asn-X-Ser/Thr (where X is any amino acid except proline) in the Endoplasmic reticulum.
- OST enzymatic oligosaccharyltransferase complex
- the machinery responsible of this reaction is encoded by a cluster called “pgl” (for protein glycosylation).
- the C. jejuni glycosylation machinery can be transferred to E. coli to allow for the glycosylation of recombinant proteins expressed by the E. coli cells.
- Previous studies have demonstrated how to generate E. coli strains that can perform N- glycosylation (see, e.g. Wacker et al. Science.2002; 298 (5599):1790-3; Nita-Lazar et al. Glycobiology. 2005; 15(4):361-7; Feldman et al. Proc Natl Acad Sci U S A. 2005; 102(8):3016-21; Kowarik et al. EMBO J.
- the host cells of the present invention comprise a nucleotide sequence encoding a heterologous oligosaccharyl transferase, optionally within a plasmid.
- the oligosaccharyl transferase is an oligosaccharyl transferase from Campylobacter.
- the oligosaccharyl transferase is a pglB, optionally from Campylobacter jejuni (i.e. pglB; see, e.g. Wacker et al. 2002, Science 298:1790-1793; see also, e.g. NCBI Gene ID: 3231775, UniProt Accession No.
- host cells of the present invention may comprise a nucleotide sequence encoding pglB, optionally pglB from Campylobacter jejuni, optionally a nucleotide sequence encoding pglB from Campylobacter jejuni having a sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 15, optionally within a plasmid.
- Chain Elongation In host cells of the present invention chain elongation is carried out by multifunctional glycosyltransferases (i.e.
- host cells of the present invention may lack a nucleotide sequence encoding a heterologous polymerase (e.g. wzy).
- ABC transporters The host cells of the present invention may be engineered to comprise a nucleotide sequence that encodes an ABC transporter. The ABC transporter transfers the repeating units of a polysaccharide from the cytoplasm into the periplam of host cells (e.g. E. coli).
- host cells of the present invention may comprise a nucleotide sequence encoding K. pneumoniae genes wzm and wzt.
- the nucleotide sequences encoding an ABC transporter may comprise K. pneumoniae genes wzm and wzt from a K. pneumoniae strain which expresses O2 O-antigen (e.g. from a K. pneumoniae strain which expresses an O2a O-antigen), e.g. for synthesis of a Klebsiella pneumoniae O2a O-antigen.
- the nucleotide sequences encoding an ABC transporter may comprise K. pneumoniae genes wzm and wzt from a K. pneumoniae strain which expresses O2 O-antigen (e.g.
- the nucleotide sequences encoding an ABC transporter may comprise K. pneumoniae genes wzm and wzt from a K. pneumoniae strain which expresses O1 O-antigen (e.g. from a K. pneumoniae strain which expresses an O1v1 O-antigen), e.g. for synthesis of a Klebsiella pneumoniae O1v1 O-antigen.
- the amino acid sequence encoding K may comprise K. pneumoniae genes wzm and wzt from a K. pneumoniae strain which expresses O1 O-antigen (e.g. from a K. pneumoniae strain which expresses an O1v1 O-antigen), e.g. for synthesis of a Klebsiella pneumoniae O1v1 O-antigen.
- pneumoniae gene wzm comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 21.
- the amino acid sequence encoding K. pneumoniae gene wzt comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 22.
- the nucleotide sequences encoding an ABC transporter may comprise K. pneumoniae genes wzm and wzt from a K. pneumoniae strain which expresses O3 O-antigen (e.g. from a K. pneumoniae strain which expresses an O3b O-antigen), e.g.
- the nucleotide sequence encoding K. pneumoniae gene wzm comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 34.
- the nucleotide sequence encoding K. pneumoniae gene wzt comprises (or consists of) a nucleotide sequence at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 35.
- the nucleotide sequence that encodes an ABC transporter may be introduced as part of the Klebsiella pneumoniae O-antigen cluster for a particular serotype.
- the nucleotide sequence encoding the ABC transporter may be integrated into the host cell genome.
- the nucleotide sequence encoding the ABC transporter may co-localised with the nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O- antigen polysaccharide O1v1, O2a, O2afg or O3b within the host cell genome.
- the present invention provides a host cell wherein nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide O1v1, O2a, O2afg or O3b and the nucleotide sequence encoding an ABC transporter are integrated into the host cell genome, optionally co-localized.
- Accessory Enzymes In an embodiment, nucleotide sequences encoding one or more accessory enzymes are introduced into the host cells of the invention.
- a host cell of the invention may further comprise one or more of these accessory enzymes.
- Such nucleotide sequences encoding one or more accessory enzymes can be either plasmid-borne or integrated into the genome of the host cells of the invention.
- Exemplary accessory enzymes include, without limitation, epimerases (see e.g. WO2011/062615), branching, modifying (e.g. to add cholins, glycerolphosphates, pyruvates), amidating, acetylating, formylating enzymes.
- Bioconjugates The present invention provides a bioconjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide, in particular a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b, conjugated to a carrier protein, wherein the carrier protein is a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- EPA Pseudomonas aeruginosa
- the present invention provides a bioconjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide O1v1 has the structure –(D-galactan II)n – (D-galactan I)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galp-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n-[ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units for D-galactan II may be different from the number of repeat units for D-galactan I.
- the number of repeat units (n) ranges from 4 to 8 or 5 to 7, for example 6 for D-galactan II and the number of repeat units (n) ranges from 2 to 10 or 3 to 7, for example 4 for D-galactan I.
- the number of repeat units (n) may range from 5 to 7 for D-galactan II and the number of repeat units (n) may range from 3 to 5 for D-galactan I.
- the ratio of D-galactan II:D-galactan I ranges between 2:1 to 1:50 or 2:1 to 1:2 (e.g. between 1.5:1 to 2:1).
- the present invention provides a bioconjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide O2a has the structure –(D-galactan I)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 10 to 30, e.g. from 15 to 30.
- the present invention provides a bioconjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide O2afg has the structure –(D-galactan III)n - GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: [ ⁇ 3)- ⁇ -D-Galf-(1 ⁇ 3)-[ ⁇ -D-Galp-(1 ⁇ 4)]- ⁇ -D-Galp-(1 ⁇ ]n ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 5 to 25 (e.g. from 5 to 15).
- the degree of branching ranges from 90-100%.
- the present invention provides a bioconjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide O3b has the structure Me-P-3(Man- ⁇ 2-Man- ⁇ 3-Man- ⁇ 3)n – Man- ⁇ 3-Man- ⁇ 3-GlcNAc: wherein n is the number of repeat units.
- This structure can also be written as: Me-P-[ ⁇ 3)- ⁇ -D- Man(1 ⁇ 2)- ⁇ -D-Man(1 ⁇ 3) - ⁇ -D-Man(1 ⁇ ]n ⁇ 3)- ⁇ -D-Man(1 ⁇ 3)- ⁇ -D-Man(1 ⁇ 3)-D-GlcNAc.
- the number of repeat units (n) ranges from 5 to 25 (e.g. from 10 to 20).
- the present invention provides a bioconjugate according to the invention wherein the detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) comprises 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T (SEQ ID NO. 1), wherein X and Z may be any natural amino acid except proline.
- a detoxified Exotoxin A of Pseudomonas aeruginosa having an amino acid sequence comprising (or consisting) of an amino acid sequence at least 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 16 and having a substitution of leucine 552 to valine (L552V) and deletion of glutamine 553 ( ⁇ E553) and comprising 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline.
- EPA Pseudomonas aeruginosa
- a detoxified Exotoxin A of Pseudomonas aeruginosa having an amino acid sequence comprising (or consisting of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 17.
- the present invention provides a bioconjugate wherein the detoxified Exotoxin A of Pseudomonas aeruginosa (EPA) comprises 3 to 7 inserted consensus sequences D/E-X- N-Z-S/T, wherein X and Z may be any natural amino acid except proline, optionally comprising (or consisting of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 17.
- EPA Pseudomonas aeruginosa
- the Klebsiella pneumoniae O-antigen may be linked to an amino acid on the modified EPA protein selected from asparagine, aspartic acid glutamic acid lysine cysteine tyrosine, histidine, arginine or tryptophan (e.g. asparagine).
- Bioconjugates, as described herein, have advantageous properties over chemical conjugates of antigen-carrier protein, in that they require less chemicals in manufacture and are more consistent in terms of the final product generated.
- a further aspect of the invention is a process for producing a bioconjugate that comprises (or consists of) a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b, conjugated to a carrier protein, wherein the carrier protein is a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA), said process comprising (i) culturing the host cell of the invention under conditions suitable for the production of glycoproteins and (ii) isolating the bioconjugate produced by said host cell, optionally isolating the bioconjugate from a periplasmic extract from the host cell.
- EPA Exotoxin A of Pseudomonas aeruginosa
- bioconjugates comprising (i) culturing the host cell of the invention under conditions suitable for the production of glycoproteins and (ii) isolating the bioconjugate.
- a process for producing a bioconjugate comprising (i) culturing the host cell of the invention under conditions suitable for the production of glycoproteins and (ii) isolating the bioconjugate from a periplasmic extract from the host cell.
- bioconjugates can be made using the shakeflask process, e.g. in a LB shake flask.
- a fed-batch process for the production of recombinant glycosylated proteins in bacteria can be used to produce bioconjugates of the invention.
- the aim is to increase glycosylation efficiency and recombinant protein yield per cell and while maintaining simplicity and reproducibility in the process.
- Bioconjugates of the present invention can be manufactured on a commercial scale by developing an optimized manufacturing method using typical E. coli production processes. Various types of feed strategies, such as batch, chemostat and fed-batch can be used.
- the bioconjugates of the invention can be purified for example, by chromatography (e.g.
- bioconjugates may be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification.
- the present invention also provides an immunogenic composition comprising the conjugate (e.g. bioconjugate) of the invention, and optionally a pharmaceutically acceptable excipient and/or carrier.
- the invention provides an immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate (e.g. bioconjugate) of the invention.
- the invention provides an immunogenic composition comprising a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate (e.g. bioconjugate) of the invention.
- the invention provides an immunogenic composition comprising a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate (e.g. bioconjugate) of the invention.
- the invention provides an immunogenic composition comprising a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate (e.g. bioconjugate) of the invention.
- Hydrazinolysis can be used to analyze glycans.
- polysaccharides are released from their protein carriers by incubation with hydrazine according to the manufacturer’s instructions (Ludger Liberate Hydrazinolysis Glycan Release Kit, Oxfordshire, UK).
- the nucleophile hydrazine attacks the glycosidic bond between the polysaccharide and the carrier protein and allows release of the attached glycans.
- N-acetyl groups are lost during this treatment and have to be reconstituted by re-N- acetylation.
- the free glycans are purified on carbon columns and subsequently labeled at the reducing end with the fluorophor 2-amino benzamide. See Bigge JC, Patel TP, Bruce JA, Goulding PN, Charles SM, Parekh RB: Nonselective and efficient fluorescent labeling of glycans using 2-amino benzamide and anthranilic acid. Anal Biochem 1995, 230(2):229-238.
- the labeled polysaccharides are separated on a GlycoSep-N column (GL Sciences) according to the HPLC protocol of Royle et al..
- Yield may be measured as carbohydrate amount derived from a liter of bacterial production culture grown in a bioreactor under controlled and optimized conditions. After purification of bioconjugate, the carbohydrate yields can be directly measured by either the anthrone assay or ELISA using carbohydrate specific antisera. Indirect measurements are possible by using the protein amount (measured by BCA, Lowry, or bardford assays) and the glycan length and structure to calculate a theoretical carbohydrate amount per gram of protein. In addition, yield can also be measured by drying the glycoprotein preparation from a volatile buffer and using a balance to measure the weight. Various methods can be used to analyze the conjugates of the invention including, for example, SDS-PAGE or capillary gel electrophoresis.
- Polymer length is defined by the number of repeat units that are linearly assembled. This means that the typical ladder like pattern is a consequence of different repeat unit numbers that compose the glycan. Thus, two bands next to each other in SDS PAGE (or other techniques that separate by size) differ by only a single repeat unit. These discrete differences are exploited when analyzing glycoproteins for glycan size: the unglycosylated carrier protein and the bioconjugate with different polymer chain lengths separate according to their electrophoretic mobilities. The first detectable repeat unit number (n1) and the average repeat unit number (naverage) present on a bioconjugate are measured. These parameters can be used to demonstrate batch to batch consistency or polysaccharide stability, for example.
- Glycosylation site usage may be quantified by, for example, glycopeptide LC-MS/MS: conjugates are digested with protease(s), and the peptides are separated by a suitable chromatographic method (C18, Hydrophilic interaction HPLC HILIC, GlycoSepN columns, SE HPLC, AE HPLC), and the different peptides are identified using MS/MS. This method can be used with or without previous sugar chain shortening by chemical (smith degradation) or enzymatic methods. Quantification of glycopeptide peaks using UV detection at 215 to 280nm allows relative determination of glycosylation site usage.
- site usage may be quantified by size exclusion HPLC: Higher glycosylation site usage is reflected by an earlier elution time from a SE HPLC column.
- site usage may be quantified by quantitative densitometry of purified bioconjugates stained with Coomassie Briliant Blue following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
- Vaccines The present invention also provides an immunogenic composition (e.g., a vaccine composition) optionally comprising an adjuvant.
- adjuvant refers to a compound that when administered in conjunction with or as part of an immunogenic composition of vaccine of the invention augments, enhances and/or boosts the immune response to a conjugate (e.g. bioconjugate) of the invention, but when the compound is administered alone does not generate an immune response to the conjugate (e.g. bioconjugate).
- adjuvants can enhance an immune response by several mechanisms including, e.g. lymphocyte recruitment, stimulation of B and/or T cells, and stimulation of macrophages.
- adjuvants include, but are not limited to, aluminum salts (alum) (such as aluminum hydroxide, aluminum phosphate, and aluminum sulfate), 3 De-O-acylated monophosphoryl lipid A (MPL) (see United Kingdom Patent GB2220211), MF59 (Novartis), AS01 (GlaxoSmithKline), and saponins, such as QS21 (see Kensil et al. in Vaccine Design: The Subunit and Adjuvant Approach (eds. Powell & Newman, Plenum Press, NY, 1995); U.S. Pat. No. 5,057,540).
- the adjuvant is Freund’s adjuvant (complete or incomplete).
- adjuvants are oil in water emulsions (such as squalene or peanut oil), optionally in combination with immune stimulants, such as monophosphoryl lipid A (see Stoute et al. N. Engl. J. Med. 336, 86-91 (1997)).
- a method of making the immunogenic composition of the invention comprising the step of mixing the conjugate (e.g. bioconjugate) of the invention with a pharmaceutically acceptable excipient and/or carrier and an adjuvant.
- Vaccine preparation is generally described in Vaccine Design (“The subunit and adjuvant approach” (eds Powell M.F. & Newman M.J.) (1995) Plenum Press New York).
- the immunogenic compositions of the invention can be included in a container, pack, or dispenser together with instructions for administration.
- the immunogenic compositions or vaccines of the invention can be stored before use, e.g. the compositions can be stored frozen (e.g. at about -20 ⁇ C or at about -70 ⁇ C); stored in refrigerated conditions (e.g. at about 4 ⁇ C); or stored at room temperature.
- the immunogenic compositions or vaccines of the invention may be stored in solution or lyophilized. In an embodiment, the solution is lyophilized in the presence of a sugar such as sucrose, trehalose or lactose. In another embodiment, the vaccines of the invention are lyophilized and extemporaneously reconstituted prior to use.
- Immunogenic compositions or vaccines of the invention may be used to protect or treat a subject (e.g. mammal), by means of administering said immunogenic composition or vaccine via systemic or mucosal route.
- administrations may include injection via the intramuscular (IM), intraperitoneal, intradermal (ID) or subcutaneous (SC) routes; or via mucosal administration to the oral/alimentary, respiratory, genitourinary tracts.
- the immunogenic composition or vaccine of the invention is administered by the intramuscular delivery route.
- Intramuscular administration may be to the thigh or the upper arm. Injection is typically via a needle (e.g. a hypodermic needle), but needle-free injection may alternatively be used.
- a typical intramuscular dose is 0.5 ml.
- the immunogenic composition or vaccine of the invention is administered by the intradermal administration.
- Human skin comprises an outer "horny" cuticle, called the stratum corneum, which overlays the epidermis. Underneath this epidermis is a layer called the dermis, which in turn overlays the subcutaneous tissue.
- the conventional technique of intradermal injection, the "mantoux procedure" comprises steps of cleaning the skin, and then stretching with one hand, and with the bevel of a narrow gauge needle (26 to 31 gauge) facing upwards the needle is inserted at an angle of between 10 to 15°.
- the immunogenic composition or vaccine of the invention is administered by the intranasal administration.
- the immunogenic composition or vaccine is administered locally to the nasopharyngeal area, e.g. without being inhaled into the lungs. It is desirable to use an intranasal delivery device which delivers the immunogenic composition or vaccine formulation to the nasopharyngeal area, without or substantially without it entering the lungs.
- Suitable devices for intranasal administration of the vaccines according to the invention are spray devices.
- Suitable commercially available nasal spray devices include ACCUSPRAYTM (Becton Dickinson).
- Immunogenic compositions comprise an immunologically effective amount of one or more Klebsiella pneumoniae polysaccharide conjugates (e.g. bioconjugates) of the invention, as well as any other components.
- Klebsiella pneumoniae polysaccharide conjugates e.g. bioconjugates
- immunologically effective amount it is meant that the administration of that amount to an individual, either as a single dose or as part of a series is effective for treatment or prevention of a Klebsiella pneumoniae infection, disease or condition. This amount varies depending on the health and physical condition of the individual to be treated, age, the degree of protection desired, the formulation of the vaccine and other relevant factors.
- the amount of conjugate (e.g. bioconjugate) in each immunogenic composition or vaccine dose is selected as an amount which induces an immunoprotective response without significant, adverse side effects in typical vaccines. Such amount will vary depending upon which specific immunogen is employed and how it is presented.
- the content of conjugate (e.g. bioconjugate) will typically be in the range 1-100 ⁇ g, suitably 5-50 ⁇ g.
- Prophylactic and Therapeutic Uses The present invention also provides an immunogenic composition of the invention, or the vaccine of the invention, for use in medicine.
- methods (and uses) of inducing an immune response in a subject against Klebsiella pneumoniae comprising administering to the subject a conjugate (e.g.
- the immunogenic composition of the invention or the vaccine of the invention comprises conjugate(s) (e.g. bioconjugate(s)) of Klebsiella pneumoniae O1v1 O-antigen polysaccharide, Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, Klebsiella pneumoniae O2afg O-antigen polysaccharide and/or a Klebsiella pneumoniae O3b O-antigen polysaccharide, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a carrier protein.
- conjugate(s) e.g. bioconjugate(s) of Klebsiella pneumoniae O1v1 O-antigen polysaccharide, Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, Klebsiella pneumoniae O2afg O-antigen polysaccharide
- the conjugate(s) is/are bioconjugate(s).
- said subject has bacterial infection at the time of administration. In another embodiment, said subject does not have a bacterial infection at the time of administration.
- the present invention provides a method of inducing an immune response to Klebsiella pneumoniae in a subject, the method comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of the invention, or the vaccine of the invention, to a subject (e.g. human) in need thereof.
- the present invention also provides an immunogenic composition of the invention, or the vaccine of the invention, for use in inducing an immune response to Klebsiella pneumoniae in a subject (e.g. human).
- the present invention also provides an immunogenic composition of the invention for use in the manufacture of a medicament for inducing an immune response to Klebsiella pneumoniae in a subject (e.g. human). Also provided herein are methods (and uses) of inducing the production of opsonophagocytic antibodies in a subject (e.g.human) against Klebsiella pneumoniae, comprising administering to the subject a conjugate (e.g. bioconjugate) of the invention an immunogenic composition of the invention or a vaccine of the invention. In an embodiment, the conjugate (e.g.
- an immunogenic composition of the invention or a vaccine of the invention can be used to induce the production of opsonophagocytic antibodies in a subject (e.g. human) against Klebsiella pneumoniae.
- the present invention also provides methods of treating and/or preventing a Klebsiella pneumoniae infection in a subject comprising administering to the subject a conjugate (e.g. bioconjugate) of the invention.
- the conjugate e.g. bioconjugate
- the conjugate may be in the form of an immunogenic composition or vaccine.
- the present invention provides a method of treating or preventing a Klebsiella pneumoniae infection, disease or condition in a subject, the method comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of the invention, or the vaccine of the invention, to a subject (e.g. human) in need thereof.
- the present invention also provides an immunogenic composition of the invention, or the vaccine of the invention, for use in treating or preventing a Klebsiella pneumoniae infection, disease or condition in a subject (e.g. human).
- the present invention also provides an immunogenic composition of the invention for use in the manufacture of a medicament for treating or preventing a Klebsiella pneumoniae infection, disease or condition in a subject (e.g. human).
- the present inventors have found that antisera generated by immunization with a conjugate of Klebsiella pneumoniae O1v1 O-antigen polysaccharide bind the corresponding subserotype Klebsiella pneumoniae O1v2 O-antigen polysaccharide and that antisera generated by immunization with a conjugate of Klebsiella pneumoniae O1v2 O-antigen polysaccharide bind the corresponding subserotype Klebsiella pneumoniae O1v1 O-antigen polysaccharide.
- the cross protection between these two distinct subserotypes allows a vaccine comprising either an O1v1 or O1v2 serotype to protect against the other serotype.
- the multivalent immunogenic composition or vaccine of the invention can offer a broader protection against the range of Klebsiella pneumoniae serotypes, covering greater than 60% of non-resistant strains and greater than 75% of resistant strains (with cross-reactivity it is estimated to cover 80.4% of non-resistant strains and 81.9% of resistant strains).
- the advantages of such an immunogenic composition/vaccine include minimizing the cost of goods and minimizing the likelihood of interference of one antigen over another.
- the present invention provides a method of treating or preventing a Klebsiella pneumoniae infection, disease or condition associated with an O1v2 strain of Klebsiella pneumoniae in a subject, the method comprising administering a therapeutically or prophylactically effective amount of an immunogenic composition of the invention or the vaccine of the invention, comprising a conjugate (e.g. bioconjugate) of a Klebsiella pneumoniae O1v1 O-antigen polysaccharide, to a subject (e.g. human) in need thereof.
- the present invention also provides an immunogenic composition of the invention or a vaccine of the invention, comprising a conjugate (e.g.
- the present invention also provides an immunogenic composition of the invention comprising a conjugate (e.g. bioconjugate) of a Klebsiella pneumoniae O1v1 O-antigen polysaccharide, for use in the manufacture of a medicament for treating or preventing a Klebsiella pneumoniae infection, disease or condition associated with an O1v2 strain of Klebsiella pneumoniae in a subject (e.g. human).
- a conjugate e.g. bioconjugate
- the immunogenic composition of the invention, or vaccine of the invention comprising a conjugate (e.g. bioconjugate of Klebsiella pneumoniae O1v1 O-antigen polysaccharide), when administered to a subject (e.g. human), is able to induce the formation of antibodies capable of binding to Klebsiella pneumoniae O1v2 as measured by ELISA assay.
- a conjugate e.g. bioconjugate of Klebsiella pneumoniae O1v1 O-antigen polysaccharide
- ELISA Enzyme-linked lmmunosorbent Assay
- the immunogenic composition of the invention, or the vaccine of the invention does not comprise Klebsiella pneumoniae O1v2 O-antigen polysaccharide.
- the present invention provides a method of treating or preventing a Klebsiella pneumoniae infection, disease or condition associated with an O1v2 strain of Klebsiella pneumoniae in a subject, the method comprising administering a therapeutically or prophylactically effective amount of an immunogenic composition of the invention or a vaccine of the invention, comprising a conjugate (e.g.
- the present invention also provides an immunogenic composition of the invention or a vaccine of the invention, comprising a conjugate (e.g.
- the present invention also provides an immunogenic composition of the invention comprising a conjugate (e.g.
- An immunogenic composition comprising a Klebsiella pneumoniae O1v1 O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2a O-antigen polysaccharide conjugate, a Klebsiella pneumoniae O2afg O-antigen polysaccharide conjugate and a Klebsiella pneumoniae O3b O-antigen polysaccharide conjugate, wherein each of the Klebsiella pneumoniae O1v1, O2a, O2afg and O3b O-antigen polysaccharides are individually conjugated to a carrier protein (e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA)).
- a carrier protein e.g. a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA)
- the immunogenic composition according to paragraph 1 wherein the carrier protein comprises an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline. 3.
- the detoxified Exotoxin A of Pseudomonas aeruginosa comprises 3 to 7 inserted consensus sequences D/E-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline, optionally comprising (or consisting of) an amino acid sequence which is at least 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 17. 5.
- a host cell comprising: i) nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg and O3b, optionally integrated into the host cell genome; ii) a nucleotide sequence encoding a heterologous oligosaccharyl transferase, optionally within a plasmid; iii) a nucleotide sequence that encodes a carrier protein comprising an inserted consensus sequence D/E-X-N-Z-S/T wherein X and Z may be any natural amino acid except proline (e.g.
- nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide O1v1, O2a, O2afg or O3b and the nucleotide sequence encoding an ABC transporter are integrated into the host cell genome, optionally co-localized.
- nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN and wbbO. 13.
- nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, gmlA, gmlB and gmlC. 14.
- nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide comprise K. pneumoniae genes wbbM, glf, wbbN, wbbO, wbbY and wbbZ. 15.
- nucleotide sequences comprising polysaccharide synthesis genes for producing a Klebsiella pneumoniae O-antigen polysaccharide comprise K. pneumoniae genes manC, manB, wbdD, wbdA, wbdB and wbdC. 16.
- E. coli e.g. E.coli K12 W3110
- the host cell is E. coli (e.g. E.coli K12 W3110) and wherein K.
- pneumoniae genes wbbM, glf, wbbN, wbbO are integrated into the E.coli O-antigen locus (e.g. the O16-antigen locus of E. coli K12 W3110), optionally in place of one or more genes of the E.coli O-antigen locus. 18.
- the host cell is E. coli (e.g. E.coli K12 W3110) and wherein K. pneumoniae genes wbbM, glf, wbbN, wbbO are integrated into E.coli O-antigen locus (e.g. the O16-antigen locus of E.
- coli K12 W3110) optionally in place of one or more genes of the E.coli O-antigen locus, and the K. pneumoniae genes wbbY and wbbZ are integrated into the E.coli yeaS locus, optionally in place of the E.coli yeaS gene.
- the heterologous oligosaccharyl transferase is a PglB, optionally derived from Campylobacter jejuni. 20.
- ECA enterobacterial common antigen cluster
- wca the colanic acid cluster
- O-antigen cluster e.g. the O16-antigen cluster of E. coli K12 W3110
- 21. The host cell according to paragraph 20 wherein the E. coli lipopolysaccharide O-antigen ligase waaL has been deleted. 22.
- a process for producing a bioconjugate comprising (i) culturing the host cell of any of paragraphs 10 to 22 under conditions suitable for the production of glycoproteins and (ii) isolating the bioconjugate.
- a process for producing a bioconjugate according to paragraph 23 comprising isolating the bioconjugate from a periplasmic extract from the host cell.
- a conjugate e.g. bioconjugate
- a conjugate comprising a Klebsiella pneumoniae O-antigen polysaccharide selected from O1v1, O2a, O2afg or O3b conjugated to a carrier protein, wherein the carrier protein is a detoxified Exotoxin A of Pseudomonas aeruginosa (EPA).
- a conjugate e.g. bioconjugate
- the Klebsiella pneumoniae O-antigen polysaccharide is O1v1 has the structure –(D-galactan II)n – (D-galactan I)n - GlcNAc: optionally wherein the number of repeat units n ranges from 5 to 7 for D-galactan II and the number of repeat units n ranges from 3 to 5 for D-galactan I and optionally wherein the ratio of D-galactan II:D-galactan I ranges between 2:1 to 1:50.
- a conjugate e.g.
- a conjugate e.g. bioconjugate according to paragraph 25 wherein the Klebsiella pneumoniae O-antigen polysaccharide is O2a has the structure –(D-galactan I)n - GlcNAc: optionally wherein the number of repeat units n ranges from 15 to 30. 28.
- a conjugate e.g. bioconjugate according to paragraph 25 wherein the Klebsiella pneumoniae O-antigen polysaccharide is O2afg has the structure –(D-galactan III)n - GlcNAc: optionally wherein the number of repeat units n ranges from 5 to 15 and optionally wherein the degree of branching ranges from 90-100%. 29.
- a conjugate e.g.
- the Klebsiella pneumoniae O-antigen polysaccharide is O3b has the structure Me-P-3(Man- ⁇ 2-Man- ⁇ 3-Man- ⁇ 3)n – Man- ⁇ 3- Man- ⁇ 3-GlcNAc: optionally wherein the number of repeat units n ranges from 10 to 20. 30.
- An immunogenic composition comprising the conjugate (e.g. bioconjugate) of any of paragraphs 25 to 30, and optionally a pharmaceutically acceptable excipient and/or carrier. 32.
- a vaccine comprising the immunogenic composition of any of paragraphs 1 to 8 or paragraph 31 and optionally an adjuvant.
- 33. A method of inducing an immune response to Klebsiella pneumoniae in a subject, the method comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of paragraphs 1 to 8 or 31, or the vaccine of paragraph 32, to a subject (e.g. human) in need thereof.
- 34. A method of treating or preventing a Klebsiella pneumoniae infection, disease or condition in a subject, the method comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of paragraphs 1 to 8 or 31, or the vaccine of paragraph 32, to a subject (e.g. human) in need thereof. 35.
- a method of treating or preventing a Klebsiella pneumoniae infection, disease or condition associated with an O1v2 strain of Klebsiella pneumoniae in a subject comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of paragraphs 1 to 8 or 31 or the vaccine of paragraph 32, comprising a conjugate (e.g. bioconjugate) of a Klebsiella pneumoniae O1v1 O-antigen polysaccharide, to a subject (e.g. human) in need thereof.
- a conjugate e.g. bioconjugate
- the immunogenic composition of paragraphs 1 to 8 or 31, or the vaccine of paragraph 32 for use in inducing an immune response to Klebsiella pneumoniae in a subject (e.g. human). 37.
- the immunogenic composition of paragraphs 1 to 8 or 31, or the vaccine of paragraph 32 for use in treating or preventing a Klebsiella pneumoniae infection, disease or condition in a subject (e.g. human).
- the immunogenic composition of paragraphs 1 to 8 or 31 or the vaccine of paragraph 32 comprising a conjugate (e.g. bioconjugate) of a Klebsiella pneumoniae O1v1 O-antigen polysaccharide, for use in treating or preventing a Klebsiella pneumoniae infection, disease or condition associated with an O1v2 strain of Klebsiella pneumoniae in a subject (e.g. human).
- the immunogenic composition of paragraphs 1 to 8 or 31 for use in the manufacture of a medicament for inducing an immune response to Klebsiella pneumoniae in a subject (e.g. human).
- the immunogenic composition of paragraphs 1 to 8 or 31 for use in the manufacture of a medicament for treating or preventing a Klebsiella pneumoniae infection, disease or condition in a subject (e.g. human).
- 41. The immunogenic composition of paragraphs 1 to 8 or 31 comprising a conjugate (e.g.
- bioconjugate of a Klebsiella pneumoniae O1v1 O-antigen polysaccharide, for use in the manufacture of a medicament for treating or preventing a Klebsiella pneumoniae infection, disease or condition associated with an O1v2 strain of Klebsiella pneumoniae in a subject (e.g. human).
- a subject e.g. human
- EXAMPLES Example 1: Generation of Klebsiella pneumoniae O1v1, O2a, O2afg, O3b O-antigen-EPA bioconjugates.
- Bioconjugate-producing strains’ construction In order to be able to produce glycan-protein bioconjugates, E. coli K12 W3110 requires the following genetic modifications: i. deletion of genomic cluster involved in glycan biosynthesis and transport which could potentiall negatively affect the expression of recombinant glycans; ii. introduction of the target glycan’s biosynthetic genes; iii. introduction of the protein carrier’s encoding gene; iv. introduction of the olygosaccharyl transferase PglB encoding gene.
- the construction of glycan- production strains for the four K. pneumoniae serotypes varies therefore only with respect of the genes required for the glycan biosynthesis.
- coli K12 W3110-derivative strain devoid of potential interfering pathways was constructed by subsequent replacements of the targeted gene clusters with an FRT sites-flanked selection marker via ⁇ -Red homologous recombination followed by FLP recombinase-catalysed marker removal as described by Kuhlman and Cox (Nucleic Acids Res. 2010 Apr; 38(6): e92; also described in WO 19/30234). Five homologous recombination / marker removal steps were carried out, removing genomic sequences of: i.
- O16 O-antigen cluster (rfb or wb, GenBank NCBI Reference Sequence NC_007779.1 (dated June 7, 2020) position 2’114’113 to 2’103’814), ii. colanic acid cluster (wca, GenBank NCBI Reference Sequence NC_007779.1 (dated June 7, 2020)position 2’138’241 to 2’118’033), iii. ECA cluster retaining wecA (wec, GenBank NCBI Reference Sequence NC_007779.1 (dated June 7, 2020) position 3’666’604 to 3’656’725), iv.
- CP052562.1 (dated May 4, 2020) position 1’706’431 to 1’703’615) were inserted into the ECA cluster (retaining wecA) of the O2a glycan- producing strain together with a selection marker (which was later removed) using known techniques (TE Kuhlman and EC Cox. Nucleic Acids Res. 2010 Apr; 38(6): e92.), originating the O2afg glycan- producing strain.
- the transcription of the inserted genes was driven by the native E. coli ECA cluster promoter and was therefore constitutive. Genes wbbY and wbbZ and the DNA region in between them featuring a transcription promoter as in K. pneumoniae (GenBank Accession No.
- LT174607.1 (dated May 9, 2017) position 5’605 to 8’734) were used to replace the gene yeaS (GenBank NCBI Reference Sequence NC_007779.1 (dated June 7, 2020)position 1’881’835 to 1’882’473) of the O2a glycan-producing strain together with a selection marker (which was later removed) using known techniques (TE Kuhlman and EC Cox. Nucleic Acids Res. 2010 Apr; 38(6): e92.), originating the O1v1 glycan-producing strain.
- the transcription of the inserted genes was driven by the K. pneumoniae promoters which are incluided in the inserted DNA and was constitutive.
- the four strains were transformed with plasmids encoding the inducible expression of the oligosaccharyl transferase PglB, the carrier protein EPA (detoxified exotoxin A from Pseudomonas aeruginosa) containing four PglB glycosylation consensus sequences, and, for O3b, a further copy of the genes manC and manB, generating the respective conjugate-producing strains.
- the expression of these genes was inducibly expressed by isopropyl ⁇ -D-1-thiogalactopyranoside (IPTG).
- IPTG isopropyl ⁇ -D-1-thiogalactopyranoside
- the used plasmids vary among the four strain due to their specific better performance in terms of bioconjugate production.
- the amino acid sequences of the introduced EPA e.g.
- the conjugate production was assessed by extracting the periplasm’s content and analysing it on SDS page which was either stained with coomassie staining or transferred on blotting membranes for the execution of Western Blot analyses.
- FIG.1 are reported analyses of conjugates extracted from Research-level shaking flasks experiment where EPA carrier with different numbers of PglB consensus glycosylation sequences were compared. The indicated glycan-producing strains were transformed with plasmids carrying an EPA variant and a plasmid expressing PglB.
- the amount of cells from o/n cultures corresponding to OD600 60 (measured using a spectrophotometer) was harvested by centrifugation.
- the cell pellets were resuspended in 1.5 ml of lysis buffer (30 mM Tris-HCl pH 8.5, 1 mM EDTA (Ethylenediaminetetraacetic acid), 20% sucrose) and lysozyme was added to a final concentration of 1 mg/ml.
- the suspensions were incubated with slight shaking for 25 minutes at 4°C and then centrifuged at 16’000 rcf for 10 min. After centrifugation, the supernatant corresponding to periplasmic extract (PPE) was transferred to a fresh tube.
- PPE periplasmic extract
- pH 7 phosphate- buffered TBdev medium with 50 g/L glycerol, 10 mM MgCl2, antibiotics was inoculated with the appropriate strain and stirred at 37°C (or 35°C for O2a) in a bioreactor vessel. Temperature was shifted to 30°C (or kept at 37°C for O3b) ahead of induction. Induction was carried out with 0.1 mM IPTG, and a feed was started at OD 25-40. Feed medium was phosphate-buffered at pH 7 and consists of yeast extract 67 g/L, Soy peptone 33 g/L, glycerol 250 to 300 g/L, 0.1 mM IPTG, antibiotics.
- NMR analyses of the purified conjugates The O1v1-EPA conjugate sample was exchanged twice with D2O and then dissolved in 0.6 mL D2O and transferred to a 5 mm NMR tube. NMR spectra were recorded at 323K. 1D ( 1 H & DOSY) and 2D, TOCSY and HSQC-DEPT NMR spectra were obtained using a Bruker Avance III 600 MHz NMR spectrometer equipped with a BBO Prodigy cryoprobe. The spectra were recorded and processed using standard Bruker software (Topspin 3.2). The 1D proton spectra were recorded using a 30 degree pulse and a D1 of 5s.
- the 2D DOSY-TOCSY experiments was performed using a mixing time of 180 ms.
- 2D experiments were recorded using non-uniform sampling: 50% for homonuclear and 20% for heteronuclear experiments. Spectra were referenced relative to ⁇ -Galf: 1 H at 5.21 ppm, 13 C at 110.2 ppm [Vinogradov et al. Structures of Lipopolysaccharides from Klebsiella pneumoniae , JBC, 2002, 277, 25070-25081].
- the O2a-EPA cobjugate sample was exchanged twice with D2O and then dissolved in 0.6 mL D2O and transferred to a 5 mm NMR tube.
- NMR spectra were recorded at 323K.
- 1D ( 1 H) and 2D, DOSY-TOCSY and HSQC-DEPT NMR spectra were obtained using a Bruker Avance III 600 MHz NMR spectrometer equipped with a BBO Prodigy cryoprobe. The spectra were recorded and processed using standard Bruker software (Topspin 3.2).
- the 1D proton spectra were recorded using a 30 degree pulse and a D1 of 5s.
- the O2afg-EPA conjugate sample was exchanged twice with D2O and then dissolved in 0.6 mL D2O and transferred to a 5 mm NMR tube.
- NMR spectra were recorded at 323K. 1D (1H).
- DOSY and 2D, DOSY-TOCSY and HSQC-DEPT NMR spectra were obtained using a Bruker Avance III 600 MHz NMR spectrometer equipped with a BBO Prodigy cryoprobe. The spectra were recorded and processed using standard Bruker software (Topspin 3.2). The 1D proton spectra were recorded using a 30 degree pulse and a D1 of 5s.
- the O3b-EPA conjugate sample was exchanged twice with D2O then dissolved in 0.6 mL D2O and transferred to a 5 mm NMR tube for analysis.
- NMR spectra were recorded at 323K.
- 1D ( 1 H and DOSY and 31 P) and 2D, COSY, DOSY-TOCSY, NOESY, HSQC-DEPT and 1 H- 31 P HMBC NMR spectra were obtained using a Bruker Avance III 600 MHz NMR spectrometer equipped with a BBO Prodigy cryoprobe. The spectra were recorded and processed using standard Bruker software (Topspin 3.2).
- the 1D proton spectra were recorded using a 30 degree pulse and a D1 of 5s.
- the 2D DOSY-TOCSY experiment were performed using mixing time of 180 ms (1D using 200 ms) and the 2D NOESY recorded using a mixing time of 300 ms.
- Spectra were referenced relative to H1/C1 of 2- ⁇ -Man: 1 H at 5.36 ppm, 13 C at 101.4 ppm and 31 P at 2.08 ppm (Scientific reports 2017, 7, 6635). Results are summarized in Table 1. Table 1. Comparison of relevant parameter determined by NMR studies on wild type K. pneumoniae LPS and on purfide glycoconjugates.
- bleeds were harvested at day 0, 28, and 42 of the protocol, respectively, and sera were obtained.
- the specific antibody content of each serum was measured via enzyme-linked immunosorbent assay (ELISA) using LPS purified as described above from K. pneumoniae strains expressing the O-antigen of interest as coating antigen.
- ELISA enzyme-linked immunosorbent assay
- Microtiter 96-well plates flat-bottom polystyrene medium binding plate, Greiner cat#655001
- dilution buffer was PBS. After incubation overnight at 4°C, the plates were washed 4 times with TBS.
- Conjugates were able to elicit the production of O-antigen specific antibodies.
- Functionality of the anti O2a conjugate antisera The anti-O2a antisera obtained from monovalent or polyvalent rabbit immunizations were tested for their ability to kill Klebsiella pneumoniae O2 in vitro with a view to using this as a proxy of the likely efficacy of specific antibodies to protect in vivo.
- O2a clinical isolate was grown on horse blood agar overnight at 37°C, 5% CO2. The following day, single colonies were inoculated into Todd-Hewitt broth (THB) and grown at 37°C, 5% CO2 to an A600 of 0.5-0.7.
- TTB Todd-Hewitt broth
- opsonisation buffer Hank's balanced salt solution HBSS, gelatin, fetal bovine serum FBS
- Serum samples were heat inactivated at 56°C for 30 mins and serially diluted in OPS buffer in a 96 well round bottom plate, bacteria were incubated with serum for 30 mins at room temperature on an orbital shaker at 700 rpm.
- Baby rabbit complement was added to each well with human promyelocytic leukemia cells (HL-60) as the exogenous source of phagocytic cells at a concentration of 1x10 7 cells/ml and incubated for 45 mins at 37°C, 5% CO2 on an orbital shaker at 680 rpm.
- Each plate was run with two complement controls, a heat-inactivated (control A) and an active complement control (control B); the difference between the numbers of colony forming units (CFU) for each complement control was calculated as the percentage of non-specific killing (NSK). A level of NSK below 35% was considered acceptable.
- the reaction was stopped by incubating on ice for 20 mins, the mixture was then spotted on to THB agar (without yeast extract) and allowed to dry. THB overlay agar (without yeast extract) was then poured over each plate and plates were inverted and incubated at 37°C, 5% CO2 for 16-18 hours. CFU are counted using an automated colony counter.
- the opsonisation index (OI) of a sample was calculated as the dilution of serum that kills 50% of bacteria. For a sample to be considered positive, the maximum killing must be greater than 70% (samples with a maximum killing between 40% and 70% are usually repeated). Results are reported in FIG. 5. Both antisera form polyvalent and monovalent immunizations are able to bridge the killing of K.
- pneumoniae strains NCTC 11682, NCTC 9127, NCTC 9163, NCTC 9147, NCTC 9178, NCTC 13439, expressing O-antigen O1v1, O1v2, O2a, O2afg, O3, and O3b, respectively, were streaked on Luria-Bertani broth (LB) agar plates (Sigma-Aldrich) and were grown over night at 37°C in a 5% CO2 atmosphere. On the following day, a few colonies were re- suspended in 7 ml sterile liquid LB medium to reach an OD600 of 0.13-0.15. The bacteria were incubated for 1 hour under rotation at 37°C 5% CO2.
- the bacterial suspension was diluted 5x in Dulbecco’s phosphate-buffered saline (DPBS, Sigma- Aldrich) with 1% bovine serum albumin (DPBS-BSA; Sigma-Aldrich). 250 ⁇ l of this culture were transferred into the working Eppendorf tubes and spun with 13’000rpm for 5 minutes. The supernatant was discarded and 250 ⁇ l of 1% formalin in PBS (Sigma-Aldrich) was added to fix the cells for 15 minutes at 37°C. Fixed bacteria were washed with DPBS-BSA before proceeding with any of the following steps. Fixed and washed K.
- DPBS Dulbecco’s phosphate-buffered saline
- DPBS-BSA bovine serum albumin
- pneumoniae cells were re-suspended in 100 ⁇ l DPBS-BSA.
- DPBS-BSA heat-inactivated anti-rabbit serum from monovalent immunzations (1:50 dilution) was added, and the samples subsequently vigorously vortexed. After 1 hour of incubation at room temperature, bacteria were spun, washed with DPBS-BSA and re-suspended in 100 ⁇ l of DPBS-BSA containing Alexa 488-conjugated secondary goat-anti-rabbit IgG antibody (1:500 dilution, SouthernBiotech, cat-nr. 4030-30, USA).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Toxicology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3185639A CA3185639A1 (en) | 2020-06-25 | 2021-06-17 | Vaccine |
| EP21731535.7A EP4171625A2 (en) | 2020-06-25 | 2021-06-17 | Klebsiella pneumoniae o-antigen vaccine |
| JP2022580015A JP7847091B2 (ja) | 2020-06-25 | 2021-06-17 | 肺炎桿菌o抗原ワクチン |
| US18/001,525 US20230293657A1 (en) | 2020-06-25 | 2021-06-17 | Vaccine |
| CN202180044800.1A CN116209753A (zh) | 2020-06-25 | 2021-06-17 | 肺炎克雷伯氏菌o-抗原疫苗 |
| BR112022024267A BR112022024267A2 (pt) | 2020-06-25 | 2021-06-17 | Vacina |
| MX2022016589A MX2022016589A (es) | 2020-06-25 | 2021-06-17 | O-antigeno de klebsiella pneumoniae. |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202063043883P | 2020-06-25 | 2020-06-25 | |
| EP20182139 | 2020-06-25 | ||
| US63/043,883 | 2020-06-25 | ||
| EP20182138.6 | 2020-06-25 | ||
| EP20182139.4 | 2020-06-25 | ||
| EP20182138 | 2020-06-25 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2021259743A2 true WO2021259743A2 (en) | 2021-12-30 |
| WO2021259743A3 WO2021259743A3 (en) | 2022-04-21 |
Family
ID=76375084
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2021/066343 Ceased WO2021259743A2 (en) | 2020-06-25 | 2021-06-17 | Vaccine |
| PCT/EP2021/066336 Ceased WO2021259742A1 (en) | 2020-06-25 | 2021-06-17 | Modified exotoxin a proteins |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2021/066336 Ceased WO2021259742A1 (en) | 2020-06-25 | 2021-06-17 | Modified exotoxin a proteins |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US20230226175A1 (https=) |
| EP (2) | EP4171624A1 (https=) |
| JP (2) | JP2023531242A (https=) |
| CN (2) | CN116209753A (https=) |
| BR (2) | BR112022023234A2 (https=) |
| CA (2) | CA3185642A1 (https=) |
| MX (2) | MX2022015734A (https=) |
| WO (2) | WO2021259743A2 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022249034A1 (en) * | 2021-05-26 | 2022-12-01 | Pfizer Inc. | Recombinant expression of klebsiella pneumoniae o-antigens in escherichia coli |
| WO2023118033A1 (en) * | 2021-12-22 | 2023-06-29 | Glaxosmithkline Biologicals Sa | Vaccine |
| WO2024089001A1 (en) * | 2022-10-24 | 2024-05-02 | Idorsia Pharmaceuticals Ltd | Vaccine against klebsiella pneumoniae |
| WO2024121280A1 (en) * | 2022-12-08 | 2024-06-13 | Idorsia Pharmaceuticals Ltd | Vaccine against klebsiella pneumoniae |
| WO2024175620A1 (en) * | 2023-02-23 | 2024-08-29 | Glaxosmithkline Biologicals Sa | Immunogenic composition |
| EP4271417A4 (en) * | 2020-12-31 | 2024-11-27 | Vaxnewmo Llc | GLYCOSYLATED KLEBSIELLA PNEUMONIAE O-ANTIGEN AND METHODS OF PREPARATION AND USES THEREOF |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024146325A1 (zh) * | 2023-01-06 | 2024-07-11 | 中国人民解放军军事科学院军事医学研究院 | 用于生产抗原多糖-载体蛋白生物偶联产物的工程菌及其应用 |
| WO2025032534A2 (en) * | 2023-08-09 | 2025-02-13 | Glaxosmithkline Biologicals Sa | Modified proteins |
| CN120192388B (zh) * | 2025-03-04 | 2025-12-02 | 江西澄实生物科技有限公司 | 一种预防肺炎克雷伯氏菌感染的疫苗及其应用 |
Citations (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4365170A (en) | 1979-09-21 | 1982-12-21 | Hitachi, Ltd. | Semiconductor switch |
| EP0161188A2 (en) | 1984-05-10 | 1985-11-13 | Merck & Co. Inc. | Covalently-modified bacterial polysaccharides, stable covalent conjugates of such polysaccharides and immunogenic proteins with bigeneric spacers, and methods of preparing such polysaccharides and conjugates and of confirming covalency |
| EP0208375A2 (en) | 1985-07-05 | 1987-01-14 | SCLAVO S.p.A. | Glycoproteinic conjugates having trivalent immunogenic activity |
| US4673574A (en) | 1981-08-31 | 1987-06-16 | Anderson Porter W | Immunogenic conjugates |
| GB2220211A (en) | 1988-06-29 | 1990-01-04 | Ribi Immunochem Research Inc | Modified lipopolysaccharides |
| US5057540A (en) | 1987-05-29 | 1991-10-15 | Cambridge Biotech Corporation | Saponin adjuvant |
| EP0477508A1 (en) | 1990-09-28 | 1992-04-01 | American Cyanamid Company | Improved oligosaccharide conjugate vaccines |
| WO1993015760A1 (en) | 1992-02-11 | 1993-08-19 | U.S. Government, As Represented By The Secretary Of The Army | Dual carrier immunogenic construct |
| WO1995008348A1 (en) | 1993-09-22 | 1995-03-30 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | Method of activating soluble carbohydrate using novel cyanylating reagents for the production of immunogenic constructs |
| WO1996029094A1 (en) | 1995-03-22 | 1996-09-26 | Andrew Lees | Producing immunogenic constructs using soluble carbohydrates activated via organic cyanylating reagents |
| WO2003074687A1 (en) | 2002-03-07 | 2003-09-12 | Eidgenössische Technische Hochschule Zürich | System and method for the production of recombinant glycosylated proteins in a prokaryotic host |
| WO2006119987A2 (en) | 2005-05-11 | 2006-11-16 | ETH Zürich | Recombinant n-glycosylated proteins from procaryotic cells |
| WO2009104074A2 (en) | 2008-02-20 | 2009-08-27 | Glycovaxyn Ag | Bioconjugates made from recombinant n-glycosylated proteins from procaryotic cells |
| WO2011006261A1 (en) | 2009-07-17 | 2011-01-20 | Ocean Harvest Technology (Canada) Inc. | Natural and sustainable seaweed formula that replaces synthetic additives in fish feed |
| WO2011062615A1 (en) | 2009-11-19 | 2011-05-26 | Glycovaxyn Ag | Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells |
| WO2011138361A1 (en) | 2010-05-06 | 2011-11-10 | Glycovaxyn | Capsular gram-positive bacteria bioconjugate vaccines |
| WO2014037585A1 (en) | 2012-09-10 | 2014-03-13 | Glycovaxyn Ag | Bioconjugates comprising modified antigens and uses thereof |
| WO2014057109A1 (en) | 2012-10-12 | 2014-04-17 | Glycovaxyn Ag | Methods of host cell modification |
| WO2014072405A1 (en) | 2012-11-07 | 2014-05-15 | Glycovaxyn Ag | Production of recombinant vaccine in e. coli by enzymatic conjugation |
| WO2015124769A1 (en) | 2014-02-24 | 2015-08-27 | Glycovaxyn Ag | Novel polysaccharide and uses thereof |
| WO2016020499A2 (en) | 2014-08-08 | 2016-02-11 | Glycovaxyn Ag | Modified host cells for use in bioconjugate production |
| WO2019030234A1 (en) | 2017-08-07 | 2019-02-14 | Glaxosmithkline Biologicals Sa | PROCESS FOR PRODUCING NUCLEIC ACIDS |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070184072A1 (en) | 2005-04-08 | 2007-08-09 | Wyeth | Multivalent pneumococcal polysaccharide-protein conjugate composition |
| GB201301085D0 (en) * | 2013-01-22 | 2013-03-06 | London School Hygiene & Tropical Medicine | Glycoconjugate Vaccine |
| MX371513B (es) * | 2013-10-11 | 2020-01-31 | Glaxosmithkline Biologicals Sa | Metodos de modificacion de celulas huespedes. |
| US9988426B2 (en) * | 2014-09-18 | 2018-06-05 | University Of Maryland, Baltimore | Broad spectrum conjugate vaccine to prevent Klebsiella pneumoniae and Pseudomonas aeruginosa infections |
| TWI715617B (zh) | 2015-08-24 | 2021-01-11 | 比利時商葛蘭素史密斯克藍生物品公司 | 對抗腸道外病原性大腸桿菌之免疫保護之方法及組合物 |
| EP3492481A1 (en) * | 2017-11-30 | 2019-06-05 | Vaxxilon AG | Vaccine against klebsiella pneumoniae |
| JP2021528059A (ja) * | 2018-06-16 | 2021-10-21 | ヴァックスニューモ エルエルシーVaxnewmo Llc | グリコシル化されたComPピリンバリアント、製造方法及びその使用 |
| BR112022014555A2 (pt) * | 2020-02-23 | 2022-09-20 | Pfizer | Composições de escherichia coli e métodos das mesmas. |
-
2021
- 2021-06-17 WO PCT/EP2021/066343 patent/WO2021259743A2/en not_active Ceased
- 2021-06-17 CN CN202180044800.1A patent/CN116209753A/zh active Pending
- 2021-06-17 WO PCT/EP2021/066336 patent/WO2021259742A1/en not_active Ceased
- 2021-06-17 CA CA3185642A patent/CA3185642A1/en active Pending
- 2021-06-17 BR BR112022023234A patent/BR112022023234A2/pt unknown
- 2021-06-17 CA CA3185639A patent/CA3185639A1/en active Pending
- 2021-06-17 BR BR112022024267A patent/BR112022024267A2/pt unknown
- 2021-06-17 MX MX2022015734A patent/MX2022015734A/es unknown
- 2021-06-17 US US18/001,498 patent/US20230226175A1/en active Pending
- 2021-06-17 EP EP21731533.2A patent/EP4171624A1/en active Pending
- 2021-06-17 EP EP21731535.7A patent/EP4171625A2/en active Pending
- 2021-06-17 JP JP2022579677A patent/JP2023531242A/ja active Pending
- 2021-06-17 JP JP2022580015A patent/JP7847091B2/ja active Active
- 2021-06-17 US US18/001,525 patent/US20230293657A1/en active Pending
- 2021-06-17 CN CN202180045684.5A patent/CN115996749A/zh active Pending
- 2021-06-17 MX MX2022016589A patent/MX2022016589A/es unknown
Patent Citations (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4365170A (en) | 1979-09-21 | 1982-12-21 | Hitachi, Ltd. | Semiconductor switch |
| US4673574A (en) | 1981-08-31 | 1987-06-16 | Anderson Porter W | Immunogenic conjugates |
| EP0161188A2 (en) | 1984-05-10 | 1985-11-13 | Merck & Co. Inc. | Covalently-modified bacterial polysaccharides, stable covalent conjugates of such polysaccharides and immunogenic proteins with bigeneric spacers, and methods of preparing such polysaccharides and conjugates and of confirming covalency |
| EP0208375A2 (en) | 1985-07-05 | 1987-01-14 | SCLAVO S.p.A. | Glycoproteinic conjugates having trivalent immunogenic activity |
| US5057540A (en) | 1987-05-29 | 1991-10-15 | Cambridge Biotech Corporation | Saponin adjuvant |
| GB2220211A (en) | 1988-06-29 | 1990-01-04 | Ribi Immunochem Research Inc | Modified lipopolysaccharides |
| EP0477508A1 (en) | 1990-09-28 | 1992-04-01 | American Cyanamid Company | Improved oligosaccharide conjugate vaccines |
| WO1993015760A1 (en) | 1992-02-11 | 1993-08-19 | U.S. Government, As Represented By The Secretary Of The Army | Dual carrier immunogenic construct |
| WO1995008348A1 (en) | 1993-09-22 | 1995-03-30 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | Method of activating soluble carbohydrate using novel cyanylating reagents for the production of immunogenic constructs |
| WO1996029094A1 (en) | 1995-03-22 | 1996-09-26 | Andrew Lees | Producing immunogenic constructs using soluble carbohydrates activated via organic cyanylating reagents |
| WO2003074687A1 (en) | 2002-03-07 | 2003-09-12 | Eidgenössische Technische Hochschule Zürich | System and method for the production of recombinant glycosylated proteins in a prokaryotic host |
| WO2006119987A2 (en) | 2005-05-11 | 2006-11-16 | ETH Zürich | Recombinant n-glycosylated proteins from procaryotic cells |
| WO2009104074A2 (en) | 2008-02-20 | 2009-08-27 | Glycovaxyn Ag | Bioconjugates made from recombinant n-glycosylated proteins from procaryotic cells |
| WO2011006261A1 (en) | 2009-07-17 | 2011-01-20 | Ocean Harvest Technology (Canada) Inc. | Natural and sustainable seaweed formula that replaces synthetic additives in fish feed |
| WO2011062615A1 (en) | 2009-11-19 | 2011-05-26 | Glycovaxyn Ag | Biosynthetic system that produces immunogenic polysaccharides in prokaryotic cells |
| WO2011138361A1 (en) | 2010-05-06 | 2011-11-10 | Glycovaxyn | Capsular gram-positive bacteria bioconjugate vaccines |
| WO2014037585A1 (en) | 2012-09-10 | 2014-03-13 | Glycovaxyn Ag | Bioconjugates comprising modified antigens and uses thereof |
| WO2014057109A1 (en) | 2012-10-12 | 2014-04-17 | Glycovaxyn Ag | Methods of host cell modification |
| WO2014072405A1 (en) | 2012-11-07 | 2014-05-15 | Glycovaxyn Ag | Production of recombinant vaccine in e. coli by enzymatic conjugation |
| WO2015124769A1 (en) | 2014-02-24 | 2015-08-27 | Glycovaxyn Ag | Novel polysaccharide and uses thereof |
| WO2016020499A2 (en) | 2014-08-08 | 2016-02-11 | Glycovaxyn Ag | Modified host cells for use in bioconjugate production |
| WO2019030234A1 (en) | 2017-08-07 | 2019-02-14 | Glaxosmithkline Biologicals Sa | PROCESS FOR PRODUCING NUCLEIC ACIDS |
Non-Patent Citations (42)
| Title |
|---|
| "Gen Bank", Database accession no. CP052562.1 |
| "GenBank", Database accession no. LT174604.1 |
| "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO. |
| "UniProt", Database accession no. 086154 |
| APICELLA M. A., METHODS IN MOLECULAR BIOLOGY, vol. 431, 2008, pages 3 - 13 |
| BIGGE JCPATEL TPBRUCE JAGOULDING PNCHARLES SMPAREKH RB: "Nonselective and efficient fluorescent labeling of glycans using 2-amino benzamide and anthranilic acid", ANAL BIOCHEM, vol. 230, no. 2, 1995, pages 229 - 238, XP002489980, DOI: 10.1006/abio.1995.1468 |
| CHU C. ET AL., INFECT. IMMUNITY, 1983, pages 245 256 |
| CLARKE ET AL., J. BIOL. CHEM., vol. 293, no. 13, 2018, pages 4666 - 4679 |
| CLARKE ET AL.: "Molecular basis for the structural diversity in serogroup 02-antigen polysaccharides in Klebsiella pneumoniae", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 293.13, 2018, pages 4666 - 4679, XP055475277, DOI: 10.1074/jbc.RA117.000646 |
| DATSENKO, A.WANNER, L., PNAS, vol. 97, no. 12, 2000, pages 6640 - 6645 |
| DAVID ET AL., NATURE MICROBIOLOGY, vol. 4, 2019, pages 1919 - 1929 |
| DOUGLAS ET AL., J. BACTERIOL, vol. 169, 1987, pages 4962 - 4966 |
| DUFRESNE ET AL., NATURE BIOTECHNOLOGY, vol. 20, 2002, pages 1269 - 71 |
| FAZEKAS DE ST. GROTH, S.WEBSTER, R. G.DATYNER, A.: "Two new staining procedures for quantitative estimation of proteins on electrophoretic strips", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 71, 1963, pages 377 - 391 |
| FELDMAN ET AL., PNAS USA, vol. 102, 2005, pages 3016 - 3021 |
| FELDMAN ET AL., PROC NATL ACAD SCI USA., vol. 102, no. 8, 2005, pages 3016 - 21 |
| GRAY ET AL., PROC. NATI. ACAD. SCI. USA, vol. 81, 1984, pages 2645 - 2649 |
| GUACHALLA ET AL., SCIENTIFIC REPORTS, vol. 7, no. 6635, 2017, pages 1 - 13 |
| HEGERLE ET AL., PLOS ONE, vol. 13, no. 9, 2018, pages e0203143 |
| HO ET AL., HUM VACCIN, vol. 2, 2006, pages 89 - 98 |
| HSIEH ET AL., FRONT. MICROBIOL., vol. 5, 2014, pages 608 |
| IHSSEN, MICROBIAL CELL FACTORIES, vol. 9, 2010, pages 61 |
| KELLY ET AL., INNATE IMMUN., vol. 2, 1995, pages 131 - 140 |
| KELLY ET AL., J. BIOL. CHEM., vol. 294, no. 28, 2019, pages 10863 - 10876 |
| KENSIL ET AL.: "Vaccine Design: The Subunit and Adjuvant Approach", 1995, PLENUM PRESS, article "The subunit and adjuvant approach" |
| KOWARIK ET AL., EMBO J., vol. 25, no. 9, 2006, pages 1957 - 66 |
| LAEMMLI, U. K.: "Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4", NATURE, vol. 227, no. 5259, 1970, pages 680 - 685, XP055108426, ISSN: 0028-0836, DOI: 10.1038/227680a0 |
| LUKAC ET AL., INFECT IMMUN, vol. 56, 1988, pages 3095 - 3098 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453 |
| NITA-LAZAR ET AL., GLYCOBIOLOGY, vol. 15, no. 4, 2005, pages 361 - 7 |
| PERDOMO R.MONTERO V., BIOTECNOIOGIA APLICADA, vol. 23, 2006, pages 124 - 129 |
| ROYLE LMATTU TSHART ELANGRIDGE JIMERRY AHMURPHY NHARVEY DJDWEK RARUDD PM: "An analytical and structural database provides a strategy for sequencing O-glycans from microgram quantities of glycoproteins", ANAL BIOCHEM, vol. 304, no. 1, 2002, pages 70 - 90, XP055596344, DOI: 10.1006/abio.2002.5619 |
| SARASWAT ET AL., BIOMED. RES. INT., 2013, pages 1 - 18 |
| SCHULZ, H.HENNECKE, H.THONY-MEYER, L., SCIENCE, vol. 281, 1998, pages 1197 - 1200 |
| SCIENTIFIC REPORTS, vol. 7, 2017, pages 6635 |
| SMITHWATERMAN, J. MOL. BIOL., vol. 147, 1981, pages 195 - 197 |
| STOJKOVIC ET AL., FRONT. MICROBIOL., vol. 8, 2017, pages 684 |
| STOUTE ET AL., N. ENGL. J. MED., vol. 336, 1997, pages 86 - 91 |
| TE KUHLMANEC COX, NUCLEIC ACIDS RES., vol. 38, no. 6, April 2010 (2010-04-01), pages e92 |
| VINOGRADOV ET AL.: "Structures of Lipopolysaccharides from Klebsiella pneumoniae", JBC, vol. 277, 2002, pages 25070 - 25081, XP055312120, DOI: 10.1074/jbc.M202683200 |
| WACKER ET AL., PROC NATL ACAD SCI USA., vol. 103, no. 18, 2006, pages 7088 - 93 |
| WACKER ET AL., SCIENCE, vol. 298, no. 5599, 2002, pages 1790 - 1793 |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4271417A4 (en) * | 2020-12-31 | 2024-11-27 | Vaxnewmo Llc | GLYCOSYLATED KLEBSIELLA PNEUMONIAE O-ANTIGEN AND METHODS OF PREPARATION AND USES THEREOF |
| WO2022249034A1 (en) * | 2021-05-26 | 2022-12-01 | Pfizer Inc. | Recombinant expression of klebsiella pneumoniae o-antigens in escherichia coli |
| WO2023118033A1 (en) * | 2021-12-22 | 2023-06-29 | Glaxosmithkline Biologicals Sa | Vaccine |
| WO2024089001A1 (en) * | 2022-10-24 | 2024-05-02 | Idorsia Pharmaceuticals Ltd | Vaccine against klebsiella pneumoniae |
| WO2024121280A1 (en) * | 2022-12-08 | 2024-06-13 | Idorsia Pharmaceuticals Ltd | Vaccine against klebsiella pneumoniae |
| WO2024175620A1 (en) * | 2023-02-23 | 2024-08-29 | Glaxosmithkline Biologicals Sa | Immunogenic composition |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112022024267A2 (pt) | 2023-01-17 |
| EP4171625A2 (en) | 2023-05-03 |
| MX2022016589A (es) | 2023-02-01 |
| MX2022015734A (es) | 2023-01-18 |
| US20230293657A1 (en) | 2023-09-21 |
| BR112022023234A2 (pt) | 2023-01-03 |
| JP2023531059A (ja) | 2023-07-20 |
| CN115996749A (zh) | 2023-04-21 |
| WO2021259743A3 (en) | 2022-04-21 |
| EP4171624A1 (en) | 2023-05-03 |
| JP7847091B2 (ja) | 2026-04-16 |
| JP2023531242A (ja) | 2023-07-21 |
| US20230226175A1 (en) | 2023-07-20 |
| CN116209753A (zh) | 2023-06-02 |
| CA3185639A1 (en) | 2021-12-30 |
| CA3185642A1 (en) | 2021-12-30 |
| WO2021259742A1 (en) | 2021-12-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7847091B2 (ja) | 肺炎桿菌o抗原ワクチン | |
| US11406696B2 (en) | P aeruginosa PcrV-linked antigen vaccines | |
| JP6682451B2 (ja) | 改変型宿主細胞およびその使用 | |
| KR20150054800A (ko) | 변형된 항원을 포함하는 생체접합체 및 이의 용도 | |
| JP7551618B2 (ja) | O-結合型グリコシル化のための修飾キャリアタンパク質 | |
| US11819544B2 (en) | Immunogenic composition | |
| US20240207383A1 (en) | Minimal Sequons Sufficient for O-Linking Glycosylation | |
| US20250381257A1 (en) | Vaccine | |
| WO2024175620A1 (en) | Immunogenic composition | |
| US20240139304A1 (en) | P aeruginosa pcrv-linked antigen vaccines | |
| WO2025032535A2 (en) | Modified proteins | |
| CN121693343A (zh) | 经修饰的蛋白质 | |
| JP2025535072A (ja) | モラクセラ科o結合型オリゴ糖転移酵素、糖鎖付加断片、及びそれらの使用 | |
| WO2024182291A2 (en) | Compositions and methods for producing glycoconjugate polypeptides having isopeptide bonds with a second polypeptide partner and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21731535 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202217068316 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 3185639 Country of ref document: CA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112022024267 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022580015 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 112022024267 Country of ref document: BR Kind code of ref document: A2 Effective date: 20221128 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021731535 Country of ref document: EP Effective date: 20230125 |