WO2021225424A1 - Composition pour la détection du coronavirus-19 et kit de détection associé - Google Patents

Composition pour la détection du coronavirus-19 et kit de détection associé Download PDF

Info

Publication number
WO2021225424A1
WO2021225424A1 PCT/KR2021/005774 KR2021005774W WO2021225424A1 WO 2021225424 A1 WO2021225424 A1 WO 2021225424A1 KR 2021005774 W KR2021005774 W KR 2021005774W WO 2021225424 A1 WO2021225424 A1 WO 2021225424A1
Authority
WO
WIPO (PCT)
Prior art keywords
cov
seq
sars
voice
covid
Prior art date
Application number
PCT/KR2021/005774
Other languages
English (en)
Korean (ko)
Inventor
문성우
문정주
Original Assignee
Moon Sung Woo
Moon Jung Joo
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020200067307A external-priority patent/KR20210136779A/ko
Application filed by Moon Sung Woo, Moon Jung Joo filed Critical Moon Sung Woo
Publication of WO2021225424A1 publication Critical patent/WO2021225424A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/101—Taqman
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a composition for detecting novel coronavirus-19 and a kit for detecting the same. Specifically, by using the detection composition and kit of the present invention, it is possible to detect novel coronavirus-19 (SARS-Cov-2) with higher accuracy and diagnose coronavirus infection-19 (COVID-19) quickly and inexpensively.
  • SARS-Cov-2 novel coronavirus-19
  • COVID-19 coronavirus infection-19
  • Coronavirus Infectious Disease-19 also called COVID-19 or COVID-19, is a respiratory infection caused by a new type of novel coronavirus (SARS-CoV-2) that first emerged in Wuhan, China in December 2019 and then spread worldwide. . It is called “the three plagues” because it has a huge negative impact on the lives of all centuries, society, economy, and politics. Coronavirus Infectious Disease-19 is transmitted when droplets (saliva droplets) from an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, or mouth. After an incubation period of about 2 to 14 days (estimated), a fever of 37.5 degrees or higher. Respiratory symptoms such as cough or shortness of breath and pneumonia are the main symptoms. However, there are many cases of asymptomatic infection and transmission in asymptomatic conditions is serious, which is a major problem.
  • SARS-CoV-2 novel coronavirus
  • the World Health Organization said that the transmission power of COVID-19 is lower than that of SARS (SARS-CoV, Severe Acute Respiratory Syndrome), but higher than MERS (MERS-CoV, Middle East Respiratory Syndrome).
  • SARS-CoV Severe Acute Respiratory Syndrome
  • MERS Middle East Respiratory Syndrome
  • the WHO estimated the 'preliminary R0 estimate' of COVID-19 to be 1.4-2.5, in the case of SARS, this R0 was 4, and MERS is known to be 0.4-0.9.
  • the World Health Organization revised the global risk level of COVID-19 from 'moderate' to 'high', and on January 30, declared an international public health emergency.
  • the number of confirmed cases worldwide is about 2 million, and the number of confirmed cases of COVID-19 is 604,070 in the United States and 10,623 in Korea, and the number of deaths is 130,885, with a mortality rate of 6.5%.
  • COVID-19 A characteristic of COVID-19 is that it shows a high rate of spread in the asymptomatic state at the beginning of the outbreak, and the damage caused by group infection is particularly serious.
  • effective prevention or treatment measures such as vaccines or antibodies have not been established.
  • the classic confirmation method of the SARS strain of the respiratory infection-causing coronavirus is intracellular culture, which takes at least three days and is difficult in reality because it requires a special laboratory.
  • the next step is to analyze the nucleotide sequence of the genome, which is also difficult to apply due to time and cost. For this reason, instead of this, the method of confirming the portion of the sequence specific to the genomic RNA of SARS-Cov-2 by the real-time reverse transcription real time PCR (rRT-PCR) method is used as a standard test today. do.
  • the present inventors determined that a molecular diagnostic test for early identification of patients infected with this virus is urgently needed.
  • a reverse transcription-real-time PCR kit that can minimize time and cost and maximize diagnostic performance by simultaneously identifying multiple regions of the genome (ORF1ab and N, RdRp regions) and human-derived internal control genes.
  • An object of the present invention is to provide a primer set for detecting novel coronavirus SARS-Cov-2.
  • Another object of the present invention is to provide a composition for detecting SARS-Cov-2 comprising the primer set.
  • Another object of the present invention is the primer set; And it provides a kit for detecting SARS-Cov-2 comprising a probe comprising a polynucleotide, a reporter and a quencher specific for each of two or more genes selected from the group consisting of N gene, ORF1ab, and RdRp of SARS-Cov-2 will do
  • Another object of the present invention is to provide a method for detecting SARS-Cov-2 using the composition for detecting SARS-Cov-2.
  • a pair of primers having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2; a pair of primers having the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4; and SEQ ID NO: 5 and SEQ ID NO: 6 and provides a primer set comprising two or more primer pairs among the primer pairs having the nucleotide sequences.
  • primer refers to a short polynucleotide having a free 3' hydroxyl group, capable of forming a base pair with a complementary template and serving as a starting point for template strand copying.
  • the primer can initiate DNA synthesis in the presence of a reagent for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphospates (dNTPs) in an appropriate buffer and temperature.
  • DNA polymerase or reverse transcriptase DNA polymerase or reverse transcriptase
  • dNTPs deoxynucleoside triphospates
  • the primer pair is forward and reverse primers specific for a gene to be targeted, and the primer pair having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 includes an N gene region of SARS-Cov-2;
  • the primer pair having the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 is the ORF1ab site of SARS-Cov-2;
  • the primer pair having the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6 is specific for an RdRp (RNA-dependent RNA polymerase) site.
  • gene-specific or “complementary” may mean capable of at least 80%, at least 85%, at least 90%, at least 95%, or 100% base pairing to a target gene.
  • the primer set comprises a pair of primers having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 and a primer pair having the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, or SEQ ID NO: 1 and SEQ ID NO: 2
  • the primer set comprises a pair of primers having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2; a pair of primers having the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4; and a primer pair having the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6.
  • the primer set according to one embodiment may be for detecting SARS-Cov-2.
  • SARS-Cov-2 is a virus that causes coronavirus infection-19 (COVID-19), among coronaviruses, a type of beta-coronavirus (subgenus sarbecovirus, Orthocoronaviridae subfamily) of single-stranded RNA genome. have The genome was first identified in January 2020, and may be based on the entire gene sequence information of the Wuhan-occurring first COVID-19 virus, defined as GenBank MN908947.3.
  • SARS-Cov-2 consists of a variable number of open reading frames (ORFs) and four essential structural proteins.
  • ORF1a/b In the first part of ORF, ORF1a/b, pp1a (Protein phosphatase 1 ⁇ ) and pp1b (Protein phosphatase 1 ⁇ ) are made, and essential structural proteins include spike (S) glycoprotein and small envelope (E) protein, matrix (M) proteins and nucleocapsid (N) proteins.
  • S spike glycoprotein and small envelope (E) protein
  • M matrix proteins
  • N nucleocapsid
  • the primers can be adapted to further include additional features to the extent that they do not change their basic properties to act as a starting point for gene synthesis. Accordingly, the primer may further include an additional nucleotide sequence of about 1 to 20 bp, 1 to 15 bp, 1 to 10 bp, or 1 to 5 bp, while including the nucleotide sequence of each defined SEQ ID NO.
  • Each terminus or specific base may further include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means. Examples of such labels include enzymes (eg, horseradish peroxidase, alkaline phosphatase), radioactive isotopes (eg, 32 P), fluorescent molecules, chemical groups (eg, biotin). and the like, but is not limited thereto.
  • the primer set may further include a primer pair specific for human beta-actin gene.
  • Genetic information of human beta-actin is generally well known and may be defined, for example, as GenBank NM_001101.5.
  • a primer pair for detecting the human beta-actin gene will be commonly known, for example, consisting of a primer of any one of SEQ ID NO: 7 or SEQ ID NO: 21 and a primer of any one of SEQ ID NO: 8 or SEQ ID NO: 22 primer pair, specifically SEQ ID NO:7 and SEQ ID NO:8; SEQ ID NO: 7 and SEQ ID NO: 22; SEQ ID NO: 21 and SEQ ID NO: 8; Alternatively, the primer pair of SEQ ID NO: 21 and SEQ ID NO: 22 may be used.
  • composition for detecting SARS-Cov-2 comprising a primer set according to an embodiment.
  • the composition for detecting SARS-Cov-2 further comprises a polynucleotide specific for each of two or more genes selected from the group consisting of the N gene, ORF1ab, and RdRp of the coronavirus SARS-Cov-2, a probe comprising a reporter and a quencher.
  • kits for detecting SARS-Cov-2 comprising the composition for detecting SARS-Cov-2 according to an embodiment.
  • probe includes a nucleic acid fragment such as RNA or DNA corresponding to a short several to several hundred bases capable of forming specific binding with a complementary nucleotide sequence, that is, a polynucleotide, and a reporter and Since fluorescence can be expressed by including a quencher, it is possible to perform qualitative and/or quantitative analysis of a target gene after gene amplification is performed.
  • the probe can introduce a different reporter for each gene in order to analyze several genes simultaneously in one tube.
  • the probe may be, for example, in the form of introducing a reporter at the 5' side and a quencher at the 3' side in a Taqman style.
  • the reporter is, for example, FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7 -dichlorofluorescein), fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green ), Alexa fluor, JOE (6-Carboxy-4',5' Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X- Rhodamine), Tetrachloro-Fluorescein (TET) Any one selected from the group consisting of , TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N
  • the quencher is, for example, TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl, It may be at least one selected from the group consisting of Eclipse, Deep Dark Quencher (DDQ), Blackberry Quencher, and Iowa black.
  • TAMRA 6-carboxytetramethyl-rhodamine
  • BHQ1 black hole quencher 1
  • BHQ2 black hole quencher 2
  • BHQ3 black hole quencher 3
  • NFQ nonfluorescent quencher
  • dabcyl It may be at least one selected from the group consisting of Eclipse, Deep Dark Quencher (DDQ), Blackberry Quencher, and Iowa black.
  • a polynucleotide specific for each of the N gene, ORF1ab, and RdRp gene of SARS-Cov-2 can be easily identified from GenBank MN908947.3, for example, the polynucleotide specific for the N gene is SEQ ID NO: 9, the polynucleotide specific for the ORF1ab gene may be complementary to SEQ ID NO: 11, and the polynucleotide specific for the RdRp gene may be complementary to SEQ ID NO: 13.
  • the length of each polynucleotide may be 15 to 30 bp.
  • the polynucleotide specific for the N gene may have the nucleotide sequence of SEQ ID NO: 10
  • the polynucleotide specific for the ORF1ab gene may have the nucleotide sequence of SEQ ID NO: 12
  • a polynucleotide specific for the RdRp gene The nucleotide may have the nucleotide sequence of SEQ ID NO: 14.
  • the polynucleotide specific for the N gene in the probe may have the nucleotide sequence of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20.
  • the annealing temperature of PCR may vary depending on the probe, for example, it may be appropriately adjusted within 30 to 60 °C, 40 to 60 °C, 50 to 60 °C, or 55 to 60 °C.
  • the polynucleotide of the probe can be modified to further include additional features in the range that does not change the basic properties for operating as a probe. Accordingly, the polynucleotide of the probe may further include an additional nucleotide sequence of about 1 to 20 bp, 1 to 15 bp, 1 to 10 bp, or 1 to 5 bp while including the nucleotide sequence of each defined SEQ ID NO. .
  • the composition for detecting SARS-Cov-2 may further include a control material or a standard material.
  • the control material or standard material can be used to accurately read a diagnostic result, such as a reverse transcription-real-time PCR test.
  • Control materials include, for example, no template control (NTC), positive template control (PTC), internal control material, and negative extraction control (NEC). It may be one or more selected from the group consisting of. These control substances can be applied to the gene amplification reaction together or individually in one tube as needed.
  • NTC no template control
  • PTC positive template control
  • NEC negative extraction control
  • Negative control material means that only molecular grade nuclease-free water is added and no sample or control genetic material is added. This is prepared for the purpose of discriminating whether the sample is contaminated or not, and it is applied together in all steps from RNA extraction from the sample to RT-PCR.
  • any positive control material that has been used as a diagnostic tool in the past may be used, and it may also be used as a standard material.
  • the positive control material is, for example, the viral genomic RNA of SARS-Cov-2 (Total genomic RNA of SARS-Cov-2; MT007544.1 and MN908947.3 Genbank; Twist Bioscience, San Francisco, CA, 10 ⁇ 6 copies/ul) of some or all of it can be used diluted to an appropriate concentration.
  • the kit according to one embodiment may further include two or more genes selected from the group consisting of N gene, ORF1ab, and RdRp of coronavirus SARS-Cov-2 in a separate container, which is a positive control material to standard materials.
  • the gene used as a standard material may be prepared as an in vitro transcript such as post mRNA using a general method such as cloning into a plasmid vector in which the SARS-Cov-2 gene is inserted into E. coli.
  • the internal control material is used to confirm the presence of RNA in the sample, and the negative sample also shows the presence of RNA, so it can be used to determine that the RNA extraction process has been properly performed.
  • the internal control material for example, human beta-actin gene or RNA transcribed in vitro of PBGD may be mixed with nuclease-free water at an appropriate concentration.
  • Negative extraction control material refers to a sample or RNA of a patient who has been confirmed to be free of COVID-19 in a previous test. Cross-contamination between samples that may occur during the RNA extraction process can be checked by using the negative extraction control material. In addition, it is possible to check whether the RNA extract quality is titrated and whether the RNA extraction is successful.
  • the composition for detecting SARS-Cov-2 comprises a primer pair specific for human beta-actin gene; and a probe comprising a polynucleotide specific for human beta-actin gene, a reporter and a quencher.
  • the human beta-actin gene may serve as an internal control material in the composition for detection.
  • the human beta-actin gene may have the nucleotide sequence of SEQ ID NO: 16, and the specific probe polynucleotide may have the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 23, but the human beta-actin gene is Since it is a well-known gene, various primers and probes can be used.
  • the composition for detecting SARS-Cov-2 is a reagent for detecting the amplified SARS-Cov-2 gene and/or control material, for example, a polymerase, a buffer for storage and reaction of the enzyme, dNTP mixture, RNase-free It may further include distilled water and the like.
  • the reagents may be mixed in a single container or may be contained in separate containers as needed.
  • the amplification of the SARS-Cov-2 gene and/or control material is a polymerase chain reaction (PCR), more specifically, a reverse transcription real time polymerase chain reaction (RT real time PCR) is available.
  • the composition for detecting SARS-Cov-2 may further include a reverse transciptase and/or a hot start Taq DNA polymerase.
  • a composition and kit for detecting SARS-Cov-2 uses a sample isolated from an individual.
  • the specimen is obtained from an individual, obtained through swabs or nasal lavage from the nasopharynx or middle larynx, bronchial lavage or aspirate, intertracheal aspirate and bronchial biopsy, sputum, bronchoalveolar lavage, saliva , blood, urine, feces, etc. can be used.
  • the SARS-Cov-2 detection method can qualitatively analyze whether SARS-Cov-2 is present in a sample, and a programmed and commonly known analysis such as a titration curve It is also possible to perform a semi-quantitative analysis using the method.
  • a programmed and commonly known analysis such as a titration curve
  • Ct is 80 or less, 60 or less, 50 or less, or 40 or less during fluorescence analysis Only the RNA of the gene can be considered to be present in a significant amount.
  • RNA DNA or RNA, and more specifically, RNA.
  • the method may further include a step of reverse transcription into cDNA before amplifying the target gene.
  • a primer, a probe, and a sample specific for SARS-Cov-2 are put in a single tube, and a fluorescence signal measurement, qualitative test, and quantitative test can be performed without a separate separation step.
  • primers and probes are put into a specimen or a tube containing a gene obtained from the specimen, and PCR amplification is performed in real time while reverse transcribed into cDNA.
  • the attached probe is degraded due to the 5' nuclease activity of Taq polymerase, and at this time, the reporter is separated from the quencher and a fluorescence signal is generated.
  • the fluorescence intensity can be checked in real time for each PCR cycle, and the presence or absence of each gene can be confirmed and its concentration can be predicted by looking at the Ct value. Therefore, the composition for detecting SARS-Cov-2 does not require a separate separation step after it is mixed with a specimen or a gene obtained from the specimen.
  • the detection method according to an embodiment may primarily be a qualitative test and may include a secondary quantitative test.
  • Real-time PCR equipment applicable to this method is, for example, Rotor-Gene Q 5 plex HRM Real Time PCR cycler (Qiagen), CFX96 Real Time PCR Detection System (Bio-Rad), Applied Biosystems 7500 Real Time PCR System ( Thermo Fisher Scientific), and the LineGene 9600 Plus real-time PCR detection system (FQD-96A, Bioer).
  • the detection method of SARS-Cov-2 may be for providing information for diagnosis of COVID-19.
  • diagnosis means identifying a pathological condition.
  • diagnosis is to confirm the presence or absence of a COVID-19 disease by using a sample isolated from an individual to check the presence or absence of expression of a gene specific for coronavirus SARS-Cov-2.
  • N, RdRp, and ORF1ab are all positive as a positive control, and an internal control gene such as beta-actin is positive as an internal control (IC), and negative
  • IC internal control
  • the control material satisfies all negative conditions, it may be determined as a valid test and proceed to sample analysis. If all of the above conditions are not satisfied, the method may further include classifying the test as an invalid test and classifying it as a retest.
  • the next step can be performed.
  • Orf1ab, N, RdRp, and IC are all positive, it is determined as COVID-19 positive, and when Orf1ab, N, and RdRp are all negative and only IC is positive, it can be determined as COVID-19 negative. If the IC is positive and two of the three SARS-Cov-2 genes, ORF1ab, N, and RdRp, are positive and one is negative, it can be judged as presumptive positive for COVID-19. If the IC is positive and only one of the three ORF1ab, N, and RdRp is positive, it can be judged as an “inconclusive result”, and in this case, a retest may be ordered.
  • the SARS-Cov-2 detection composition and detection method have a limit of detection (LoD) of 1 cp/ ⁇ l or more and a SARS-Cov-2 RNA copy number of 100 cp/ ⁇ l or less. , 80 cp/ ⁇ l or less, 50 cp/ ⁇ l or less, 20 cp/ ⁇ l or less, or 10 cp/ ⁇ l or less.
  • the LoD of the internal control (IC) used herein is also 1 cp/ ⁇ l or more, and 100 cp/ ⁇ l or less, 80 cp/ ⁇ l or less, 50 cp/ ⁇ l or less, 20 cp/ ⁇ l or less, or 10 cp/ ⁇ l or less It may be detectable in ⁇ l or less.
  • the term “LoD” may mean a minimum detection concentration capable of confirming the presence of a target gene or SARS-Cov-2 in a sample.
  • composition and the detection method for detecting SARS-Cov-2 may have a positive Ct value of 80 or less, 60 or less, 50 or less, or 40 or less.
  • the Ct value refers to the cycle required to reach a certain threshold value in the gene amplification reaction (ie, PCR cycle conditions). Since the composition for detecting SARS-Cov-2 of the present invention has a low Ct value, the target gene When the expression level is low, the presence or absence of the target gene can be determined significantly and accurately, which is advantageous in terms of time and economy.
  • composition and detection method for detecting SARS-Cov-2 may be applied to both human nasopharyngeal and middle larynx swabs and sputum to show excellent performance.
  • composition and detection method for detecting SARS-Cov-2, etc., SARS-Cov-2 and an internal control material may be detectable within 100 minutes by reverse transcription-real-time PCR.
  • SARS-Cov-2 can be accurately and quickly detected by using the composition and kit for detecting SARS-Cov-2 of the present invention. It has been proven that 100% of analysis sensitivity and specificity can be obtained when the composition and kit for detecting SARS-Cov-2 of the present invention are used, and since the accuracy does not change depending on the type of equipment or sample, the reliability of the detection result is high. In addition, since the composition and kit for detection can be performed by a single sample processing step without a separate separation step, it can be detected quickly as well as at a low price, so that it can be widely used for COVID-9 diagnosis.
  • FIG. 4 shows SARS using the kit of the present invention for serial dilutions of samples collected from human nasopharyngeal and middle larynx swabs from 1 x 10 ⁇ 6 copy/ ⁇ l to 1 cp/ ⁇ l at 1/10 serial dilutions.
  • FIG. 5 shows an example of reading the result of quadruple reverse transcription-real-time PCR using a kit according to an embodiment for SARS-Cov-2.
  • SARS-Cov-2 The genomic structure of SARS-Cov-2 is summarized in Table 1 below, and the positions of primers and probes for the N gene, ORF1ab site, and RdRp site recommended by the US Centers for Disease Control and Prevention, WHO, and world societies, and the The positions of primers and probes designed by the developers are indicated.
  • the division of the region was set with reference to GenBank No. MN908947.3 (Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome GenBank: MN908947.3).
  • primers and probes of the ORF1ab gene are located at 13348-13452 of ORF1ab and 15441-15226 of RdRp.
  • the famous RdRp primer region for this is 15361-15460 Helicase (NTPase/helicase domain) (15972-17774) Applicable 3-to-5 exonuclease (17775-19395) - EndoRNAase (19356-20393) - 2-O-ribose methyltransferase (20394-21297) - structural protein Spike, S (21563-25384) Applicable Envelope, E (26245-26472) Applicable M (26523-27191) - Nucleocapsid protein, N (28274-29903) Applicable (Used in the famous USA CDC kit among many kits) In the kit according to the present invention, the primers and probes of the N gene are located at 28863-28980, and the famous N primer region is 28555-28,682*.
  • the in vitro diagnostic kit to be prepared is for testing all three regions of ORF1ab, N gene, and RdRp.
  • SARS-Cov-2 target genes and internal controls (ICs) for detecting SARS-Cov-2 were selected, and dedicated primers and probes were prepared for each.
  • the sequences of the prepared primers and probes are summarized in Table 2 below.
  • a primer pair and a probe for the target gene can be used interchangeably within the same function for the target gene.
  • a specific preparation method is as follows.
  • novel primers and probes for the N region were prepared. Based on the genome information of SARS-Cov-2 of GenBank MN908947.3 (the first COVID-19 virus in Wuhan), the primers and probes at the N site are located at 28863-28980 nt. This is different from the previously reported primers and probes (N1, N2, N3) recommended by the US Centers for Disease Control and Prevention (2019-novel Coronavirus Real time rRT-PCR panel primers and probes. Department of Health and human services, Center for Disease) Control and Prevention, Atlanata, GA, USA 30333).
  • nucleotide sequences of the primers for the N gene used in this Example are shown in Table 3 below.
  • SEQ ID NO: nucleotide position (GenBank: MN908947.3) order Forward primer for N gene of SARS-Cov-2 SEQ ID NO: 1 Nt 28863-28882 5'- CAACTCCAGGCAGTAGG -3' Reverse primer for N gene of SARS-Cov-2 SEQ ID NO: 2 NT 28960-28980 5' CCAGACATTTTGCTCTCAAGC -3'
  • the nucleotide sequence of the oligonucleotide probe for detecting the N gene of SARS-Cov-2 is shown in Table 4.
  • Texas Red was attached to the 5' side of SEQ ID NO: 10 as a reporter and BHQ2 was attached to the 3' side as a quencher. can do.
  • SEQ ID NO: nucleotide position (GenBank: MN908947.3) order Probe candidate region for N gene of SARS-Cov-2
  • SEQ ID NO: 9 NT 28885-28951 5'- GGAACTTCTC CTGCTAGAAT GGCTGGCAAT GGCGGYGATG CTGCTCTTGC TTTGCTGCTG CTTGACAGAT TGAACCA -3'
  • Probes for the N gene region used in this example SEQ ID NO: 10 NT 28929-28953 5'-/TexRed/TTG CTG CTG CTT GAC AGA TT/BHQ_2/-3'
  • Primer production was commissioned by primer oligonucleotide manufacturers such as Cosmogenetec and Bionics, OPC purification was requested by Cosmogintech, and HAP purification was requested by Bionics to remove impurities and incorrect sequences during synthesis, thereby obtaining high-purity primer oligonucleotides. And CoA data taken from the manufacturer's mass spectrum was confirmed.
  • the purchased primers were diluted with sterilized tertiary distilled water so as to be 100 ⁇ M each at the volume indicated on the raw material tube and data sheet, and then 10 ⁇ L of each 100 ⁇ M primer was added to 720 ⁇ l of sterilized tertiary distilled water to a final 5 pmol/ ⁇ l.
  • Probe production was commissioned by manufacturers of dual label modification probe oligos such as IDT, Bioneer, BioBasic, and Bionics, and high-purity double label modification by requesting HPLC purification to remove impurities and incorrect sequences during synthesis.
  • a probe oligo was obtained.
  • CoA data taken from the manufacturer's mass spectrum was confirmed.
  • sterilized tertiary distilled water was added to 100 ⁇ M, respectively, and diluted, and then 4 ⁇ l of 100 ⁇ M probe was put into 784 ⁇ l of sterilized tertiary distilled water to make a final 2 pmol/ ⁇ l.
  • primers and probes for the ORF1ab region were prepared. Based on the genome information of SARS-Cov-2 of GenBank MN908947.3, the primers and probes of the ORF1ab region are located at nt 13348 - 13452. This is different from the previously reported primers and probes as mentioned in Table 1 above.
  • nucleotide sequences of the primers for the ORF1ab site used in this Example are shown in Table 5 below.
  • the nucleotide sequence of the oligonucleotide probe for detecting the N gene of SARS-Cov-2 is shown in Table 6.
  • Cy-5 was attached to the 5' side of SEQ ID NO: 12 as a reporter and BHQ2 was attached to the 3' side as a quencher. can be applied.
  • nucleotide sequences of the primers for the RdRp region used in this Example are shown in Table 7 below.
  • SEQ ID NO: nucleotide position (GenBank: MN908947.3) order Forward primer for RdRP region of SARS-Cov-2 SEQ ID NO: 5 Nt 15441 - 15460 5'- CATGTGTGGCGGTTCACTAT- -3' Reverse primer for RdRP region of SARS-Cov-2 SEQ ID NO: 6 Nt 15500 - 15526 5' TGTTAAAAACACTATTAGCATAAGCAG -3'
  • the nucleotide sequence of the oligonucleotide probe for detection of the RdRP region of SARS-Cov-2 is shown in Table 8.
  • FAM was attached to the 5' side of SEQ ID NO: 14 as a reporter and BHQ2 was attached to the 3' side as a quencher.
  • Human beta-actin is for use as an internal control material, and the nucleotide sequences of the primers and probes are shown in Table 9 below.
  • HEX was attached to the 5' side of SEQ ID NO: 15 as a reporter and BHQ2 was attached to 3' as a quencher, but any site in the sequence reported as a beta-actin gene (eg, SEQ ID NO: 16) All oligonucleotides of 15-30 bp can be applied to the probe. Preparation of primers and probes was performed in the same manner as in Example 1.
  • a standard material and a control material for accurately reading the results of the reverse transcription-real-time PCR test were prepared. Only the positive control material was used as the standard material, and only the internal control material was used as the control material.
  • a specific manufacturing method is as follows.
  • a positive control material was used by diluting a standard material approved by the US CDC.
  • viral genomic RNA of SARS-Cov-2 Total genomic RNA of SARS-Cov-2 ; MT007544.1 and MN908947.3 Genbank; Twist Bioscience, San Francisco, CA , 10 ⁇ 6 copies/ul
  • total genomic RNA of SARS-Cov-2 MT007544.1 and MN908947.3 Genbank; Twist Bioscience, San Francisco, CA , 10 ⁇ 6 copies/ul
  • it was diluted to 1 x 10 ⁇ 2 copy/ ⁇ l, and mixed with an RNA carrier to positively affect the ORF1ab, N gene, and RdRp genes of SARS-Cov-2. It was prepared and used as a control material.
  • RNA was prepared as an in vitro transcript after a plasmid clone of the beta-actin gene was prepared, and 1X10 ⁇ 2 copy/ ⁇ l was prepared and used.
  • RNA in the plasmid pGEM T-Easy Vector (promega) amplified with E. coli was extracted using the TransciptAid T7 high-yield transcription kit, and the concentration was measured using a nanophotometer.
  • sterile tertiary distilled water was diluted to 1.575ng/ ⁇ l (1X10 ⁇ 10 copy/ ⁇ l), and serially diluted to 1X10 ⁇ 2 cp/ ⁇ l using sterile tertiary distilled water. Then, performance and efficacy tests were performed. , 20 ⁇ l per vial was put into each vial and labeled.
  • the base sequence is shown in Table 10 below.
  • RNA length (mer) base sequence beta-actin 102 5'-GCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCTGAACCCCAAGGCCAACCGCG AGAAGATGAC-3'
  • Double reverse transcription-real time PCR (Duplex RT-real time PCR) reaction Efficient cDNA synthesis in a single tube and human-derived internal control with one of the RdRp, ORF1ab, and N genes of coronavirus-19 (Internal Control )
  • the composition of the kit used for the double reverse transcription-real time PCR reaction in which real-time PCR of the gene (bet-actin) is simultaneously possible is shown in Table 11 below, and the reaction solution is Table 12 was set as And the reaction conditions are shown in Table 13.
  • Each of the SARS-CoV-2 RdRp, ORF1ab, and N gene targets were amplified and detected in the FAM channel. Internal control is detected on the Hex channel.
  • a positive control and a human-derived negative control were used to prove that the PCR amplification was working efficiently with the supplied components.
  • Solutions for reverse transcription-real time PCR include: a primer mixture comprising 5 pmol/ ⁇ l each of SARS-Covid-2 forward and zero primers and 5 pmol/ ⁇ l each of IC forward and reverse primers; a probe mixture comprising 2 pmol/ ⁇ l of SARS-Covid-2 dual label probe and 2 pmol/ ⁇ l of IC double label probe; Hotstart Taq Hotstart Taq enzyme solution containing 5U / ⁇ l, glycerol, Tris-Cl, KCl, dithiothreitol (Dithiothreitol), EDTA, Nonidet P -40 and Tween ® -20; RNase-free distilled water; IC control containing 1x10 ⁇ 2 copy/ ⁇ l of IC RNA; positive control containing N RNA, ORF1ab RNA, and RdRp RNA at each 1x10 ⁇ 2 copy/ ⁇ l; Onestep RT-PCR enzyme mixture comprising reverse transciptase, glycerol,
  • Onestep RT-enzyme mixture and 2xOnestep RT-PCR buffer were prepared from Takara's One Step RT-PCR kit (One Step PrimeScript RT-PCR kit, Cat No: RR064A, RR064B, Takara Bio, Nojihigashi 7-4-38, Kusatsu, Shiga, 525-0058, Japan) was used. If necessary, it can be manufactured using various products such as QIAGEN's PREMIX, NANOHELIX's PREMIX, and PCRBIO's PREMIX as raw materials. In this case, it may be desirable to change the reverse transcription reaction temperature. For example, when using PCR BIO's reverse transcription real-time PCR reaction reagent, the temperature of the reverse transcription step is about 45 ° C. .
  • FIGS. 1 to 3 the results of double reverse transcription-real-time PCR reaction for each of RdRp, ORF1ab, and N genes in a sample containing SARS-Covid-2 RNA are shown in FIGS. 1 to 3 .
  • human beta-actin RNA was used, and both the target gene and the positive control group were set at 100 cp/ ⁇ L, and the Ct cut-off value was set to ⁇ 40.
  • composition of the COVID-19 RTPCR kit (100 tests/kit) (stored at -20 °C) volume ( ⁇ l) primer mixture 200 probe mixture 200 positive control RNA 20 IC RNA 20
  • RT-PCR enzyme mixture 50 RT-PCR buffer (5x) 250 dNTP mixture 50 RNase-free distilled water 300
  • the solution for the reverse transcription-real-time PCR reaction was prepared by using 3x10 ⁇ 2 copy/ ⁇ l of each of N RNA, ORF1ab RNA, and RdRp RNA as a positive control, Hotstart Taq enzyme solution
  • Hotstart Taq enzyme solution Onestep RT-PCR enzyme mixture, Hotstart Taq and reverse transcriptase It was used in the same manner as in Test Example 1, except that it was prepared with an RT-PCR enzyme mix containing
  • the primer mixture and probe mixture include primers and probes for both the N gene, ORF1ab and RdRp.
  • kit Composition (stored at -20°C) volume ( ⁇ l) RT-PCR reagent
  • RT-PCR reagent Onestep RT-PCR Enzyme Mixture 50 RT-PCR buffer (2x) 1250 Hotstart taq enzyme 50 Primer/Probe/Control Set Primer mixture (ORF1ab, N, RdRp, IC) 400 Probe mixture (ORF1ab, N, RdRp, IC) 400 Positive control (ORF1ab, N, RdRp) 60 Inner Control (IC) 20 RNase-free distilled water 500
  • RNA isolation, reagent preparation, and PCR were performed in separate rooms, and proceeded step by step as follows. 1) RNA extraction
  • kits that can be used are Exgene Viral DNA and RNA Extraction Kit (GeneAll, Catalog Number. 128-150, Seoul Jeshin No. 16-748), QIAamp Viral Mini Kit (Qiagen, Catalog Number 52904), Quick-RNA Viral kit ( Zymo Research, Catalog Number R1034).
  • RNase removal reagent RNaseoff, etc.
  • the Dectector fluorescence is FAM, HEX (VIC or JOE), Texas Red, and Cy-5, and labels RdRp, IC, N gene, and ORF1ab, respectively.
  • the RT-PCR reaction solution is shown in Table 15, and the reaction solution was prepared in 25 ⁇ l.
  • Test Example 2-2 Quadruple Reverse Transcription-Real-Time PCR Reaction Results Reading
  • amplification occurs with a sigmoidal curve and the gene is said to be positive only when the Ct value is ⁇ 40 (that is, the gene is RNA was present enough to be positive), and when not, it was judged negative.
  • test results of the control material are negative control material (NTC), positive control material (PTC; containing N, ORF1ab, and RdRp genes of SARS-Cov-2), internal control material (containing only IC gene), and extraction step control material ( NEC) were divided into 4 categories, and specifically determined as follows.
  • NTC negative control material
  • the positive control material must be positive for the target SARS-Cov-2 Orf1a/b, N gene, and RdRp (Ct ⁇ 40), otherwise the PCR result was judged to be unreliable. In this case, reverse transcription-real-time PCR was performed again with the remaining RNA sample, and if the same result was obtained here, RNA was re-extracted from the sample. IC must be negative (Ct value 40). That is, when the N gene, RdRp, and ORF1ab were all positive in the positive control material, but the IC was weakly positive (Ct value 38 to 40), the next step was carried out.
  • IC positive Ct ⁇ 40
  • SARS-Cov-2 Orf1a/b and N, RdRp were all confirmed to be negative. If the results of the positive control material and the internal control material were different from the expected results, the reverse transcription-real-time PCR reaction was judged to be unreliable, and the RT-PCR step was repeated using the residual extracted sample. If the repeated test results did not yield the expected results, RNA was re-extracted from all samples and the test was performed again.
  • control material As a control material (NEC) for the extraction step, only those that were negative for Orf1a/b, N gene, and RdRp of SARS-Cov-2 and positive for the IC beta-actin were selected (Ct ⁇ 40). If positive results were obtained for the target Orf1a/b and N genes, it was judged that the RNA extraction and RT-PCR reactions were invalid and unreliable, and the residual patient samples were used for repeated testing.
  • ORF1ab all three are positive voice two out of three positive one out of three positive positive or negative N voice positive or negative RdRp voice positive or negative result SARS-Cov-2 detection SARS-Cov-2 not detected SARS-Cov-2 detection Undefined invalidity Judgment COVID-19 positive COVID-19 negative COVId-19 Presumptive positive reexamination (presumed negative if only ORF1ab is consistently positive) reexamination
  • RNA product was analyzed for amplification of SARS-Cov-2's N gene, ORF1ab, and RdRp gene and beta-actin, an internal control (IC) gene, and Ct level with the COVID-19 quadruple RT PCR kit.
  • the reactant prepared with each copy number was measured 20 times repeatedly, and the minimum concentration (viral genomic copy number, cp/ ⁇ l) that can be determined to be 95% or more positive is set as the limit of detection (LoD). decided.
  • the testers' nasopharyngeal and oropharyngeal swabs were repeatedly collected 10 times to collect samples, and reverse transcription real-time PCR was performed with a COVID-19 quadruple RT PCR kit to confirm the absence of SARS-Cov-2.
  • a clinical matrix artificial sample was prepared by spiking the viral RNA of the standard SARS-Cov-2 standard material from 1 x 10 ⁇ 6 cp/ ⁇ l to this sample while serial dilution was started.
  • the amplification and Ct values of the N, ORF1ab, and RdRp genes of SARS-Cov-2 and the internal control (IC) gene were analyzed with the COVID-19 quadruple RT PCR kit.
  • the viral RNA of SARS-Cov-2 was tested by serial dilution in 1/10 increments from 1 x 10 ⁇ 6 cp/ml to 1 cp/ul. As a result, it was determined that the LoD was at a level between 1 and 100 cp/ ⁇ l (Table 17). Accordingly, as a result of performing reverse transcription real-time PCR by repeating 20 times for each concentration of 0, 1, 3, 10, 30, 100, and 300 cp/ ⁇ l, LoD was predicted to be 10 cp/ ⁇ l (Table 18). Then, as a result of performing reverse transcription real-time PCR by repeating 20 times for each concentration of 3, 10, and 30 cp/ ⁇ l, LoD was determined to be 10 cp/ ⁇ l (Table 19). The cut off level of Ct was determined to be ⁇ 40.
  • RdRP N Mean SD CV Mean SD CV 300 29.14 0.12 0.40 15/15 31.45 0.21 0.67 15/15 100 31.92 0.24 0.75 20/20 33.60 0.37 1.11 20/20 30 33.65 0.36 1.06 20/20 35.75 0.77 2.14 20/20 10 37.28 0.97 2.60 10/10 36.51 0.66 1.81 10/10 3 N.D. 0/20 39.53 1/20 One N.D. 0/20 N.D.
  • the N gene, ORF1ab, and RdRp genes of SARS-Cov-2 and the internal control (IC) gene were amplified and Ct values were analyzed with the COVID-19 quadruple RT-real-time PCR kit.
  • LoD was 10 cp/ ⁇ l, and 100% of the N gene, ORF1ab, and RdRp were detected in LoD, showing 100% assay sensitivity (Table 20).
  • Test Example 6-1 In silico analysis
  • BLASTn analysis was performed on known nucleic acid sequences of respiratory bacteria in Table 21 under basic conditions (settings). At this time, the match scores and mismatch scores were set to 1 and 3, the penalty to create and extend a gap in an alignment were set to 5 and 2, and the search parameter was automatically adapted to the short input sequence. The expected threshold was set to 1000.
  • the primers and probes of SARS-CoV-2 ORF1ab and N genes did not show more than 80% homology with any bacteria.
  • the only exception is the existing SARS virus (SARS-Cov-1), provided that homology is resolved by simultaneously analyzing both the front and back primers and probes, and the SARS-CoV-2 ORF1ab, N gene, and There is little possibility that SARS-Cov-1 is misdiagnosed as positive due to the primers and probes of RdRp.
  • SARS-Cov-1 infection is no longer being reported on Earth, it can be seen that the present invention is unlikely to cause cross-reaction with respiratory bacteria other than SARS-Cov-2.
  • Reverse transcription-real-time PCR using the primers and probes of SARS-CoV-2 ORF1ab, N gene, and RdRp of the present invention was used to analyze cross-reactivity against 31 respiratory viruses and strains. At this time, PFU was higher than 10 ⁇ 5 /ml, and CFU was higher than 10 ⁇ 6/ml, respectively.
  • CFX96 Touch Real time PCR Detection System (hereinafter referred to as CFX96) (BioRad, Hercules, CA, USA with CFX Maestro software) was analyzed and the results were compared with the case using RotorGene-Q (Qiagen).
  • LoD was determined as in Test Example 3, and only the equipment was changed to CFX96 and RotorGene-Q.
  • SARS-Cov-2 standard positive material Total genomic RNA of SARS-Cov-2 ; MT007544.1 and MN908947.3 Genbank; Twist Bioscience, San Francisco, CA ) was mixed and used as a positive standard.
  • the LoD was determined to be at the level of 1-100 cp/ml, and again each of 0, 1, 10, 30, and 100 cp/ml Reverse transcription real-time PCR was performed by repeating each concentration 20 times.
  • LoD was determined to be 10 copies/ ⁇ l, showing the same results as when using each of CFX96 and RotorGene-Q equipment. Therefore, the kit of the present invention is applicable to various equipment.
  • the repeatability of the quadruple RT-real-time PCR kit of the present invention was evaluated. Specifically, for the sample, LoD was identified as in Test Example 3, and amplified using CFX96. From 20 healthy adults, 20 nasopharyngeal and oropharyngeal swab samples were obtained and confirmed that COVID-19 was negative . MT007544.1 and MN908947.3 Genbank; Twist Bioscience, San Francisco, CA ) was prepared by spiking an artificial positive sample, and RT-PCR was performed by applying a quadruple RT-real-time PCR kit as in Test Example 2. As a result, as shown in Table 26, 100% of N, ORF1ab, and RdRp were detected in LoD (10 cp/ml), showing 100% analytical sensitivity.
  • viral genomic RNA of SARS-Covid-2 Total genomic RNA of SARS-Covid-2 ; MT007544.1 and MN908947.3 Genbank; Twist Bioscience, San Fransisco, CA , 10 ⁇ 6 copies/ ⁇ l
  • kits of the present invention has excellent performance in the diagnosis of COVID-19.
  • a clinical trial using sputum as a sample was performed by comparing the PowerCheck 2019-nCoV Assay (Kogene, Korea) with a double-blind type of comparative analysis, and additionally comparing it with the Allplex TM 2019-nCoV assay.
  • the sample was previously determined for SARS-Cov-2 infection by using the PowerCheck 2019-nCoV assay, and a quadruple RT-real-time PCR kit such as Allplex TM 2019-nCoV assay and Test Example 2 was applied to the remaining sputum sample.
  • PowerCheck 2019-nCoV assay is summarized in Table 29 below
  • Allplex TM 2019-nCoV assay is summarized in Table 30 below.
  • kits of the present invention When comparing the kit of the present invention based on the Power Check 2019-nCoV assay, 4 out of 5 cases of COVID-19 positive sputum samples were consistent. In the case of these 4 cases, all three genes of RdRp, N, and E were found to be positive in Power Check 2019-nCoV assay in 4 of 4 positive cases. In contrast, in the kit analysis result of the present invention, all three genes of RdRp, N, and ORF1ab were found to be positive in 3 out of 4 cases. In the remaining 1 case, only RdRp was positive, and the result of the retest came out exactly the same, and the final judgment was “presumed positive”. This was thought to be due to the time-dependent RNA destruction of the sputum sample.
  • the results were inconsistent.
  • the Power Check 2019-nCoV assay showed that all three genes, RdRp, N, and E, were positive. It was determined as “positive” and in the kit of the present invention, IC was positive and all three genes, RdRp, N, and ORF1ab, were negative, so it was determined as “negative”. The result of additional testing with Allplex TM 2019-nCoVassay was also negative, so it was finally determined to be negative.
  • the kit of the present invention showed an accurate result value even for a sputum sample with frequent RNA degradation. Therefore, it can be seen that the kit of the present invention is superior to the existing kit for sputum samples.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne une composition servant à détecter le nouveau coronavirus-19, ainsi qu'un kit de détection associé. En particulier, l'utilisation de cette composition et du kit de détection selon l'invention permet de détecter le nouveau coronavirus-19 (SRAS-Cov-2) avec une plus grande précision et de diagnostiquer la maladie à coronavirus-19 (COVID-19) rapidement et à faible coût.
PCT/KR2021/005774 2020-05-08 2021-05-08 Composition pour la détection du coronavirus-19 et kit de détection associé WO2021225424A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20200055198 2020-05-08
KR10-2020-0055198 2020-05-08
KR1020200067307A KR20210136779A (ko) 2020-05-08 2020-06-03 코로나바이러스-19 검출용 조성물 및 이의 검출용 키트
KR10-2020-0067307 2020-06-03

Publications (1)

Publication Number Publication Date
WO2021225424A1 true WO2021225424A1 (fr) 2021-11-11

Family

ID=78468167

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/005774 WO2021225424A1 (fr) 2020-05-08 2021-05-08 Composition pour la détection du coronavirus-19 et kit de détection associé

Country Status (2)

Country Link
KR (1) KR20230062511A (fr)
WO (1) WO2021225424A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023076639A1 (fr) * 2021-10-28 2023-05-04 Jung Joo Moon Amorce, sonde et contrôles pour la détection et la discrimination de la covid-19 et essai diagnostique d'autres coronavirus pour le virus humain provoquant la covid-19 (covid-19-cov-2) et ses variants

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070008504A (ko) * 2003-08-22 2007-01-17 버치 바이오메디칼 리서치 엘엘씨 사스-관련 코로나바이러스의 복대립 분자 검출

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070008504A (ko) * 2003-08-22 2007-01-17 버치 바이오메디칼 리서치 엘엘씨 사스-관련 코로나바이러스의 복대립 분자 검출

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ALCOBA-FLOREZ JULIA, GONZÁLEZ-MONTELONGO RAFAELA, ÍÑIGO-CAMPOS ANTONIO, GARCÍA-MARTÍNEZ DE ARTOLA DIEGO, GIL-CAMPESINO HELENA, CIU: "Fast SARS-CoV-2 detection by RT-qPCR in preheated nasopharyngeal swab samples", 11 April 2020 (2020-04-11), pages 1 - 8, XP055863562, Retrieved from the Internet <URL:https://www.medrxiv.org/content/10.1101/2020.04.08.20058495v1.full.pdf> DOI: 10.1101/2020.04.08.20058495 *
ANONYMOUS: "Real-Time Fluorescent RT-PCR Kit for Detecting SARS-CoV-2", 21 April 2020 (2020-04-21), pages 1 - 65, XP055863566, Retrieved from the Internet <URL:https://www.fda.gov/media/136472/download> *
JUNG YU JIN; PARK GUN-SOO; MOON JUN HYE; KU KEUNBON; BEAK SEUNG-HWA; KIM SEIL; PARK EDMOND CHANGKYUN; PARK DAEUI; LEE JONG-HWAN; B: "Comparative analysis of primer-probe sets for the laboratory confirmation of SARS- CoV-2", pages 1 - 13, XP055854850, Retrieved from the Internet <URL:http://dx.doi.org/10.1101/2020.02.25.964775> DOI: 10.1101/2020.02.25.964775 *
RENFEI LU; JIAN WANG; MIN LI; YAQI WANG; JIA DONG; WEIHUA CAI: "SARS-CoV-2 detection using digital PCR for COVID-19 diagnosis, treatment monitoring and criteria for discharge", 30 March 2020 (2020-03-30), pages 1 - 21, XP055748454, Retrieved from the Internet <URL:https://www.medrxiv.org/content/10.1101/2020.03.24.20042689v1.full.pdf> DOI: 10.1101/2020.03.24.20042689 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023076639A1 (fr) * 2021-10-28 2023-05-04 Jung Joo Moon Amorce, sonde et contrôles pour la détection et la discrimination de la covid-19 et essai diagnostique d'autres coronavirus pour le virus humain provoquant la covid-19 (covid-19-cov-2) et ses variants

Also Published As

Publication number Publication date
KR20230062511A (ko) 2023-05-09

Similar Documents

Publication Publication Date Title
CN110982943B (zh) 一种新型冠状病毒rt-pcr检测方法及试剂盒
CN112063756A (zh) 多重检测呼吸道病毒核酸的方法及试剂盒
CN113652505B (zh) 检测新型冠状病毒及其voc-202012/01突变株的方法和试剂盒
JP2023516472A (ja) 重症急性呼吸器症候群コロナウイルス２（ｓａｒｓ－ｃｏｖ－２）、インフルエンザａ及びインフルエンザｂを検出するための組成物及び方法
WO2017122897A1 (fr) Marqueur génétique servant à détecter le virus responsable de l&#39;iridovirose de la daurade japonaise, et procédé de détection du virus causal utilisant le marqueur
WO2021225424A1 (fr) Composition pour la détection du coronavirus-19 et kit de détection associé
WO2021177773A2 (fr) Composition pour le diagnostic du sars-cov-2, kit, et procédé pour le diagnostic du sars-cov-2 l&#39;utilisant
WO2022005255A2 (fr) Kit et méthode de diagnostic simultané du sars-cov-2 induisant la maladie à coronavirus-19 et du sarbecovirus faisant appel à une sonde pna
KR20230006569A (ko) 신종 코로나바이러스(SARS-CoV-2)를 검출하기 위한 수단 및 방법
WO2012148024A1 (fr) Amorce et sonde pour détecter la résistance au tamiflu dans une nouvelle souche de la grippe a/h1n1, et procédé de diagnostic utilisant celles-ci
CN113981140B (zh) 新型冠状病毒德尔塔突变株的检测方法及核酸检测试剂盒
WO2011142646A9 (fr) Procédé de détection de hpv (papillomavirus humain) et de son génotype
EP4308726A2 (fr) Compositions et procédés pour détecter des variants de coronavirus 2 à syndrome respiratoire aigu sévère (sars-cov-2) ayant des mutations de protéine spike
WO2012002598A1 (fr) Amorce et sonde pour le diagnostic de la tuberculose, trousse comprenant celles-ci et méthode de diagnostic de la tuberculose à l&#39;aide de la trousse
KR20210136779A (ko) 코로나바이러스-19 검출용 조성물 및 이의 검출용 키트
WO2022163967A1 (fr) Composition pour diagnostiquer la maladie de lyme et kit la comprenant
WO2013147352A1 (fr) Procédé utilisant un polymorphisme de masse des fragments de restriction pour détecter une mutation génétique qui provoque une résistance à un médicament du vih
WO2021215556A1 (fr) Procede de preparation d&#39;un kit de diagnostic de coronavirus, kit de diagnostic de coronavirus ainsi preparé, et procédé de diagnostic de coronavirus l&#39;utilisant
WO2021201601A1 (fr) Sonde anp et amorce pour la détection par rt-lamp du sars-cov-2 provoquant la covid-19 et procédé de détermination d&#39;une infection à l&#39;aide de celles-ci
WO2022035033A1 (fr) Ensemble d&#39;amorces pour détecter une fièvre grave avec un virus de la thrombocytopénie, et kit de diagnostic l&#39;utilisant
WO2024014734A1 (fr) Procédé et kit de qpcr présentant une spécificité et une sensibilité accrues
CN114262758B (zh) 检测新型冠状病毒突变株的试剂盒及检测方法
WO2024101758A1 (fr) Nouveau procédé d&#39;amplification isotherme d&#39;acides nucléiques utilisant l&#39;autorepliement par allongement
WO2021201462A1 (fr) Oligonucléotide et plasmide pour détecter un rétrovirus endogène porcin et procédé pour le gène de rétrovirus endogène porcin
KR102643238B1 (ko) 2019 신종 코로나 바이러스 및 이의 돌연변이 동시 감별 검출용 프라이머 및 프로브 세트

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21800279

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21800279

Country of ref document: EP

Kind code of ref document: A1