WO2021206587A1 - Vaccin à adn de sars-cov-2 basé sur la thérapie génique avec un adn vecteur gdtt1.8nas12 - Google Patents

Vaccin à adn de sars-cov-2 basé sur la thérapie génique avec un adn vecteur gdtt1.8nas12 Download PDF

Info

Publication number
WO2021206587A1
WO2021206587A1 PCT/RU2021/000148 RU2021000148W WO2021206587A1 WO 2021206587 A1 WO2021206587 A1 WO 2021206587A1 RU 2021000148 W RU2021000148 W RU 2021000148W WO 2021206587 A1 WO2021206587 A1 WO 2021206587A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene therapy
cov
sars
therapy dna
dna vector
Prior art date
Application number
PCT/RU2021/000148
Other languages
English (en)
Inventor
Anton GAMOLSKI
Original Assignee
Genetic Diagnostics And Therapy 21 Ltd
Obschestvo S Ogranichennoi Otvetstvennostju "Rekombitekh"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetic Diagnostics And Therapy 21 Ltd, Obschestvo S Ogranichennoi Otvetstvennostju "Rekombitekh" filed Critical Genetic Diagnostics And Therapy 21 Ltd
Publication of WO2021206587A1 publication Critical patent/WO2021206587A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the invention refers to genetic engineering and can be used in biotechnology, medicine as a DNA vaccine for human vaccination against SARS-CoV-2 virus.
  • Vaccines are divided into the following types, depending on the production methods thereof:
  • LAV live attenuated vaccines
  • inactivated vaccines IV (influenza, typhoid fever, tick-borne encephalitis, rabies, hepatitis A, meningococcal disease, etc.),
  • vaccines containing purified components of microorganisms anatoxins, toxoids, e.g. pertussis, diphtheria, tetanus
  • recombinant vaccines containing components of microorganisms obtained via genetic engineering techniques including DNA vaccines (recombinant hepatitis B vaccine).
  • Recombinant DNA-derived vaccine (also known as DNA vaccine, gene vaccine, nucleic acid vaccine) is a genetically engineered construct based, inter alia, on a double-stranded plasmid (plasmid vector, DNA vector, gene therapy DNA vector) carrying the DNA sequence encoding the immunologically relevant protein of the pathogenic microorganism (or tumour antigen DNA) and regulatory genetic elements that ensure the expression of the protein encoded in the cell. Plasmids are produced using the cloning in the bacterial cell culture ( E . colt ), purified from impurities and other bacterial DNA (Anderson R. J.; Schneider J. Plasmid DNA and viral vector-based vaccines for the treatment of cancer (Eng) // Vaccine (Eng)Ru : journal.
  • plasmid vector DNA vector, gene therapy DNA vector
  • Plasmids are produced using the cloning in the bacterial cell culture ( E . colt ), purified from impurities and other bacterial DNA (Anderson R. J.; Schneider J
  • DNA vaccines are the expression of viral agents in their native form. During immunisation with viral proteins, in the process of their production and purification, a three-dimensional protein structure may be changed (misfolding), which will reduce the effectiveness of immunisation.
  • DNA vaccines are significantly superior to live attenuated vaccines or certain recombinant vaccines based on live virus vectors for safety, since the body only produces a single specific protein that featured antigenic properties but is unable to cause disease on its own.
  • DNA vaccines include the following: the expressed antigen can be selectively targeted to HLA-I or HLA-II pathway; long-term antigen expression; ease of production and low production cost; modest storage requirements; can be used both for prevention and treatment; potentially effective against a wide range of diseases, including bacterial, viral, autoimmune, and oncological diseases.
  • S protein (spike protein; protein that forms "spikes”) is the most promising in terms of development of vaccines, including DNA vaccines.
  • this protein is exposed on the virus surface and is directly recognised by the immune system.
  • ACE2 receptor human angiotensin converting enzyme 2
  • S protein fragments feature immunogenic properties (Zhu, X.; Liu, Q.; Du, L.; Lu, L.; Jiang, S. Receptor-binding domain as a target for developing SARS vaccines. J. Thorac. Dis. 2013, 5 (Suppl. 2), S142-S148).
  • M protein membrane protein, intrinsic protein
  • G protein membrane protein, intrinsic protein
  • M protein membrane protein, intrinsic protein
  • M protein membrane protein, intrinsic protein
  • Kunding A.H.
  • Baksh M.F.
  • Connelly S.
  • Droese B.
  • Klaus J.P.
  • Makino S.
  • Sawicki S.G.
  • et al A structural analysis of M protein in coronavirus assembly and morphology. J. Struct. Biol. 2011, 174, 11-22).
  • N protein (nucleocapsid protein) is a highly antigen protein associated with genomic RNA, plays a role in the processes of vRNA replication and transcription (McBride, R.; van Zyl, M.; Fielding, B.C.
  • the coronavirus nucleocapsid is a multifunctional protein. Viruses 2014, 6, 2991-3018).
  • E protein envelope protein, coat protein
  • E protein envelope protein, coat protein
  • the background of the invention indicates that DNA vaccines have the potential for large-scale vaccination of the population, in particular against SARS-CoV-2.
  • a DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 virus was developed within this patent.
  • Gene therapy vectors are divided into viral, cell, and DNA vectors (Guideline on the quality, non-clinical, and clinical aspects of gene therapy medicinal Products EMA/CAT/80183/2014). Recently, gene therapy has paid increasingly more attention to the development of non-viral gene delivery systems with plasmid vectors topping the list. Plasmid vectors are free of limitations inherent in cell and viral vectors. In the target cell, they exist as an episome without being integrated into the genome, while producing them is quite cheap, and there is no immune response or side effects caused by the administration of plasmid vectors, which makes them a convenient tool for gene therapy and prevention of the genetic diseases (DNA vaccination) (Li L, Petrovsky N. // Expert Rev Vaccines. 2016;15(3):313-29).
  • plasmid vectors use in gene therapy and DNA vaccination are: 1) presence of antibiotic resistance genes for the production of constructs in bacterial strains; 2) the presence of various regulatory elements represented by sequences of viral genomes; 3) length of therapeutic plasmid vector that determines the efficiency of vector delivery to the target cell.
  • antibiotic resistance genes also make a fundamental contribution to the method of production of DNA vectors. If antibiotic resistance genes are present, strains for the production of DNA vectors are usually cultured in medium containing a selective antibiotic, which poses risk of antibiotic traces in insufficiently purified DNA vector preparations. Thus, production of DNA vectors for gene therapy without antibiotic resistance genes is associated with the production of strains with such distinctive feature as the ability for stable amplification of therapeutic DNA vectors in the antibiotic-free medium.
  • the European Medicines Agency recommends avoiding the presence of regulatory elements in therapeutic plasmid vectors to increase the expression level of therapeutic genes (promoters, enhancers, post- translational regulatory elements) that constitute nucleotide sequences of genomes of various viruses (Draft Guideline on the quality, non-clinical and clinical aspects of gene therapy medicinal products, http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_ guideline/2015/2017WC500187020.pdf). Although these sequences can increase the expression level of the therapeutic transgene, however, they pose risk of recombination with the genetic material of wild-type viruses and integration into the eukaryotic genome.
  • the size of the therapy vector is also essential. It is known that modern plasmid vectors often have unnecessary, non-functional sites that increase their length substantially (Mairhofer J, Grabherr R. // Mol Biotechnol. 2008.39(2):97-104).
  • ampicillin resistance gene in pBR322 series vectors as a rule, consists of at least 1000 bp, which is more than 20% of the length of the vector itself. A reverse relationship between the vector length and its ability to penetrate into eukaryotic cells is observed; DNA vectors with a small length effectively penetrate into human and animal cells.
  • DNA vector when selecting a DNA vector, for reasons of safety and maximum effectiveness, preference should be given to those constructs that do not contain antibiotic resistance genes, the sequences of viral origin and length of which allows for the effective penetration into eukaryotic cells.
  • a strain for production of such DNA vector in quantities sufficient for the purposes of gene therapy should ensure the possibility of stable DNA vector amplification using antibiotic-free nutrient media.
  • Example of usage of DNA vectors for immunisation is the method of producing plasmid vectors for DNA vaccination in order to induce a protective immune response against influenza virus under patent US 10363302.
  • the vectors are plasmids carrying sequences encoding the hemagglutinin and neuraminidase genes of influenza virus under the control of different regulatory elements.
  • the disadvantage of this invention is the presence of regulatory elements in the composition of DNA vector that constitute sequences of viral genomes and antibiotic resistance genes.
  • Example of usage of the recombinant DNA vectors for DNA vaccination is the method of producing a recombinant vector for genetic immunisation under Patent No. US 9550998 B2.
  • the vector is a supercoiled plasmid DNA vector that is used for the expression of cloned genes in human and animal cells.
  • the vector contains an origin of replication, regulatory elements comprising human cytomegalovirus promoter and enhancer, and regulatory sequences from the human T-cell lymphotropic virus.
  • the vector is accumulated in a dedicated E. coli strain free of antibiotics through antisense complementation of sacB gene inserted into the strain by means of bacteriophage.
  • the disadvantage of this invention is the presence of regulatory elements in the composition of DNA vector that constitute sequences of viral genomes.
  • Patent US 10548971 describes plasmid vectors as a vaccine for MERS CoV coronavirus, the causative agent of Middle East Respiratory Syndrome.
  • the genes encoding the S protein sequences (Spike, protein that forms “spikes”) were cloned to pVAX1 plasmid vector (Life Technologies, USA).
  • the disadvantage of this invention is the presence of sequences of viral origin and antibiotic resistance genes in the vector.
  • Patent RU2678756 describes gene therapy DNA vector VTvaf17, method of its production; Escherichia coli strain SCS110-AF, method of its production; Escherichia coli strain SCS110-AFA/Tvaf17 carrying gene therapy DNA vector VTvaf17, method of its production.
  • the disadvantage of this invention is the considerable length of the vector part, which may have an adverse effect on the efficiency of DNA vector delivery to cells.
  • Patent RU 2332457 describes plasmid vectors comprising one, two or more pgsB, pgsC, and pgsA genes encoding a poly-gamma-glutamic acid synthetase complex, and a gene within the same frame with them encoding spike protein antigen (S) or nucleocapsid protein antigen (N) of SARS coronavirus (Severe acute respiratory syndrome coronavirus).
  • S spike protein antigen
  • N nucleocapsid protein antigen
  • the disadvantage of this invention is the uncertainty of the purposes of this invention and the vague safety requirements applied to the used vectors.
  • Patent RU 2383621 describes a DNA vector for genetic immunisation consisting of several transcription units and including sequences encoding M, E, and S genes of SARS coronavirus.
  • the disadvantage of this invention is the presence of regulatory elements in the composition of DNA vector that constitute sequences of viral genomes and antibiotic resistance genes.
  • a significant disadvantage of this solution is the
  • CoV-2 virus as a composition of gene therapy DNA vectors based on gene therapy DNA vector GDTT1.8NAS12, combining the following properties:
  • DNA vaccine under Item I is ensured by including in its composition the optimal number of gene therapy DNA vectors based on the gene therapy DNA vector GDTT1.8NAS12 carrying sequences that encode the most immunogenic epitopes of SARS-CoV-2 proteins.
  • This approach is desirable due to the fact that when constructing a single gene therapy DNA vector to which several sequences encoding immunogenic epitopes of SARS-CoV-2 proteins have been cloned, the expression level of therapeutic genes encoding viral antigens can be reduced due to an increase of the gene therapy vector length, which reduces the efficiency of DNA vector penetration into the cells.
  • Item II and III are provided for herein in line with the recommendations of the state regulators for gene therapy medicines and, specifically, the requirement of the European Medicines Agency to refrain from adding antibiotic resistance marker genes to newly engineered plasmid vectors for gene therapy (Reflection paper on design modifications of gene therapy medicinal products during development / 14 December 2011
  • the purpose of the invention also includes the construction of strains carrying gene therapy DNA vectors for the development and production of these gene therapy DNA vectors and DNA vaccines on an industrial scale.
  • the specified purpose is achieved by constructing DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 virus, wherein the gene therapy DNA vector GDTT1.8NAS12-S with the nucleotide sequence SEQ ID No. 1 contains the sequence encoding the immunogenic epitope of SARS-CoV-2 S protein cloned to the gene therapy DNA vector GDTT1.8NAS12, gene therapy DNA vector GDTT1.8NAS12-M with the nucleotide sequence SEQ ID No.
  • Each of the constructed gene therapy DNA vectors included in the DNA vaccine namely GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N has the ability to efficiently penetrate human and animal cells and express the therapeutic S protein of SARS-CoV-2 cloned to it, therapeutic M protein of SARS-CoV-2 cloned to it and therapeutic N protein of SARS-CoV-2 cloned to it due to the limited size of GDTT1.8NAS12 vector part not exceeding 2600 bp.
  • each of the constructed gene therapy DNA vectors included in the DNA vaccine namely GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N, uses nucleotide sequences that are not antibiotic resistance genes or regulatory elements of viral genomes are used as the structural elements, which ensures its safe use for gene therapy and human vaccination.
  • the method of production of DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 was also developed that involves obtaining of each of gene therapy DNA vectors: GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N as follows: sequences encoding the immunogenic epitopes of S, M, N proteins of SARS- CoV-2 virus are cloned to the gene therapy DNA vector GDTT1.8NAS12, and gene therapy DNA vector GDTT1.8NAS12-S, SEQ ID No.
  • GDTT1.8NAS12-M is obtained while the sequences of encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 are obtained by enzymatic synthesis from chemically synthesised oligonucleotides, followed by PCR amplification using the obtained oligonucleotides and cleaving the amplification product by corresponding restriction endonucleases, while cloning to gene therapy DNA vector GDTT1.8NAS12 is made by BamHI and EcoRI restriction sites, while the selection is performed without antibiotics; at the same time, the following oligonucleotides produced for this purpose are used during gene therapy DNA vector GDTT1.8NAS12-S, SEQ ID No. 1 production for the PCR amplification:
  • a method of use of the DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of SARS-CoV-2 S, M, and N proteins was developed that involves injection of the patient’s organs and tissues with the DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of SARS-CoV-2 S, M, and N proteins based on the possible concentration of each DNA vectors in the DNA vaccine ranging from 1% to 98% by weight determined by the outcomes of preclinical and clinical studies, combined with the transport system or the injection of the patient’s organs and tissues with the autologous cells of said patient transfected together with gene therapy DNA vectors GDTT1.8NAS12-S,
  • a method of production of strains for construction of gene therapy DNA vectors GDTT 1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N was developed that involves making electrocompetent cells of Escherichia coli JM110-NAS strain and subjecting these cells to electroporation with gene therapy DNA vector GDTT1.8NAS12-S, or DNA vector GDTT1.8NAS12-M, or DNA vector GDTT1.8NAS12-N.
  • the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and 10pg/ml of chloramphenicol, and as a result, Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S, or Escherichia coli strain JM110- NAS/GDTT1.8NAS12-M, or Escherichia coli strain JM110- NAS/GDTT1.8NAS12-N is obtained.
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S carrying the gene therapy DNA vector GDTT1.8NAS12-S for production thereof allowing for antibiotic-free selection during the production of gene therapy DNA vector to be included in the DNA vaccine for human vaccination against SARS-CoV-2 virus
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M carrying the gene therapy DNA vector GDTT1.8NAS12-M for production thereof allowing for antibiotic-free selection during the production of gene therapy DNA vector to be included in the DNA vaccine for human vaccination against SARS-CoV- 2 virus
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12-N carrying the gene therapy DNA vector GDTT1.8NAS12-N for production thereof allowing for antibiotic-free selection during the production of gene therapy DNA vector to be included in the DNA vaccine for human vaccination against SARS-CoV-2 virus are claimed.
  • a method of production on an industrial scale of DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT 1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 was developed that involves production of gene therapy DNA vector GDTT1.8NAS12-S, or gene therapy DNA vector GDTT1.8NAS12-M, or gene therapy DNA vector GDTT1.8NAS12-N by inoculating a culture flask containing the prepared medium with seed culture selected from Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S, Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M, and Escherichia coli strain JM110-NAS/GDTT1.8NAS12-N, then the cell culture is incubated in an incubator shaker and transferred to an industrial fermenter, then grown to a stationary phase, then the fraction containing
  • Figure 1 shows the structure of gene therapy DNA gene vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 that constitutes a circular double-stranded DNA molecule capable of autonomous replication in Escherichia coli cells.
  • Figure 1 shows the structures corresponding to:
  • EF1a pr the promoter region of human elongation factor EF1A with an intrinsic enhancer contained in the first intron of the gene. It ensures efficient transcription of the recombinant gene in most human tissues,
  • Figure 2 shows diagrams of cDNA amplicon accumulation of fragments encoding S, M, and N proteins of SARS-CoV-2 in primary human bronchial epithelial cells (Human Bronchial Epithelial Cells, HBEpC, Cell Applications, Inc., Cat. No. 502-05a) before their transfection and 48 hours after transfection of these cells with the composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N in order to assess the ability to penetrate into eukaryotic cells and functional activity, i.e. expression of the therapeutic gene at the mRNA level.
  • Figure 3 shows the plot of concentration of fragments of SARS-CoV-2 S, M, and N proteins in the cell lysate of the primary human lung fibroblast cell culture (ATCC PCS-201-020) after transfection of these cells with the composition of DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N in order to assess the functional activity of DNA vectors, i.e. expression at the protein level based on changes in the number of fragments of SARS-CoV-2 S, M, and N proteins in the cell lysate.
  • culture A primary human lung fibroblast cell culture transfected with aqueous dendrimer solution without plasmid DNA (reference)
  • culture B primary human lung fibroblast cell culture transfected with DNA vector GDTT1.8NAS12
  • culture C primary human lung fibroblast cell culture transfected with the composition of DNA vector GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N.
  • Figure 4 shows the plot of concentration of fragments of SARS-CoV-2 S, M, and N proteins in the muscle tissue of Wistar rats in three groups after injection of the composition of gene therapy vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N in order to assess the functional activity of DNA vectors and demonstrate the method of use of the composition of gene therapy DNA vectors and the DNA vaccine.
  • Figure 5 shows the plot of concentration of fragments of SARS-CoV-2 S, M, and N proteins in the skin of three groups of C57BL/6 mice after injection of JAWSII (ATCC CRL-11904) immature dendritic cells culture transfected together with gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding the immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 in order to assess the functional activity of DNA vectors ad the DNA vaccine and demonstrate the method of use thereof through injection of the mammal with its autologous cells transfected together with gene therapy DNA vectors.
  • JAWSII ATCC CRL-11904
  • Gene therapy DNA vectors encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 have been produced based on 2591 bp DNA vector GDTT1.8NAS12.
  • the method of production of each gene therapy DNA vector is to clone sequences encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 obtained by enzymatic synthesis from chemically synthesised oligonucleotides followed by amplification to the polylinker of gene therapy DNA vector GDTT1.8NAS12. It is known that the ability of DNA vectors to penetrate into eukaryotic cells is due mainly to the vector size. DNA vectors with the smallest size have higher penetration capability.
  • DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 with no large non-functional sequences and antibiotic resistance genes in the vector, which, in addition to technological advantages and safe use, allowed for the significant reduction of size of the produced gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2.
  • the ability of the obtained gene therapy DNA vector to penetrate into eukaryotic cells is due to its small length.
  • DNA vector GDTT1.8NAS12-S was produced as follows: sequences encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 were cloned to gene therapy DNA vector GDTT1.8NAS12, and gene therapy DNA vector GDTT1.8NAS12-S, SEQ ID No. 1, or GDTT 1.8NAS12-M, SEQ ID No. 2, or GDTT1.8NAS12-N, SEQ ID No. 3, respectively, was produced.
  • the sequence encoding the immunogenic epitope of S protein of SARS-CoV-2 (2022 bp), the sequence encoding the immunogenic epitope of M protein of SARS-CoV-2 (675 bp), and the sequence encoding the immunogenic epitope of N protein of SARS-CoV-2 (1266 bp) was produced through enzymatic synthesis from chemically synthesised oligonucleotides followed by amplification. Amplification was performed using oligonucleotides produced for this purpose by the chemical synthesis method.
  • the amplification product was cleaved by specific restriction endonucleases taking into account the optimal procedure for further cloning, and cloning to the gene therapy DNA vector GDTT1.8NAS12 was performed by BamHI, EcoRI restriction sites located in the
  • GDTT1.8NAS12 vector polylinker The selection of restriction sites was carried out in such a way that the cloned fragment entered the reading frame of expression cassette of the vector GDTT 1.8NAS12, while the protein coding sequence did not contain restriction sites for the selected endonucleases.
  • the methodological implementation of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N production can vary within the framework of the selection of known methods of molecular gene cloning and these methods are included in the scope of this invention.
  • different oligonucleotide sequences can be used to amplify genes, different restriction endonucleases or laboratory techniques, such as ligation independent cloning of genes.
  • Gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N have the nucleotide sequence of SEQ ID No. 1 , SEQ ID No. 2 and SEQ ID No. 3, respectively.
  • degeneracy of genetic code is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences differing by insertion, deletion, or replacement of nucleotides that do not result in a change in the polypeptide sequence encoded by the therapeutic gene, and/or do not result in a loss of functional activity of the regulatory elements of GDTT1.8NAS12 vector.
  • genetic polymorphism is known to the experts in this field and means that the scope of this invention also includes variants of nucleotide sequences of genes encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 that also encode different variants of the amino acid sequences of S, M, and N proteins of SARS-CoV-2 that do not differ from those listed in their functional activity.
  • the ability to penetrate into eukaryotic cells and express functional activity i.e. the ability to express the therapeutic gene of the produced gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N is confirmed by combined injection of the obtained DNA vectors into eukaryotic cells and subsequent analysis of the expression of specific mRNA and/or protein product of the therapeutic gene.
  • the presence of specific mRNA in cells into which the gene therapy DNA vector GDTT1.8NAS12-S, or GDTT1.8NAS12-M, or GDTT1.8NAS12-N was injected shows the ability of the obtained vector to both penetrate into eukaryotic cells and express mRNA of the therapeutic gene.
  • S, M, and N proteins of SARS-CoV-2 confirms the efficiency of expression of therapeutic genes in eukaryotic cells using gene therapy DNA vectors based on the gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS CoV-2.
  • A) real-time PCR i.e. change in cDNA accumulation of therapeutic genes in human cells after transfection of different human cell lines with gene therapy DNA vectors
  • Enzyme-linked immunosorbent assay i.e. change in the quantitative level of therapeutic proteins in the biopsy specimens from animal tissues after the injection of these tissues with autologous cells of this animal transfected together with gene therapy DNA vectors.
  • the ability to penetrate into eukaryotic cells and express functional activity, i.e. the ability to express the therapeutic gene, of the produced gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N is confirmed by combined injection of the obtained DNA vectors into eukaryotic cells and tissues in different ratios ranging from 1% to 98% by weight relative to each other.
  • the ratios of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT 1.8NAS12-N in the DNA vaccine can vary in the range determined by the outcomes of preclinical and clinical studies, and any concentration ratios of each DNA vector relative to each other (from 1% to 98% by weight) in the DNA vaccine determined by the outcomes of preclinical and clinical studies are within the scope of this invention.
  • a method for obtaining strains for production of these gene therapy vectors based on Escherichia coli strain JM110-NAS is proposed as a technological solution for obtaining gene therapy DNA vectors GDTT 1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 in order to scale up the production of gene therapy vectors to an industrial scale.
  • NAS/GDTT 1.8NAS12-M and Escherichia coli strain JM110-NAS/ GDTT1.8NAS12-N involves production of competent cells of Escherichia coli strain JM110-NAS with the injection of gene therapy DNA vector GDTT1.8NAS12-S, DNA vector GDTT1.8NAS12-M, and DNA vector GDTT1.8NAS12-N, respectively, into these cells using transformation
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12-N allow for the use of antibiotic- free media.
  • NAS/GDTT1.8NAS12-M and Escherichia coli strain JM110- NAS/GDTT1.8NAS12-N, transformation, selection, and subsequent biomass growth with extraction of plasmid DNA were performed.
  • GDTT1.8NAS12-N each containing the gene therapy vector DNA GDTT1.8NAS12, encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 was performed.
  • the method of scaling the production of bacterial mass to an industrial scale for the isolation of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N, based on gene therapy GDTT1.8NAS12 DNA vector encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 involves incubation of the seed culture of Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S, Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M, and Escherichia coli strain JM110- NAS/GDTT1.8NAS12-N in the antibiotic-free nutrient medium that provides suitable biomass accumulation dynamics.
  • the bacterial culture Upon reaching a sufficient amount of biomass in the logarithmic phase, the bacterial culture is transferred to an industrial fermenter and then grown to a stationary phase, then the fraction containing the therapeutic DNA product, i.e. gene therapy DNA vector GDTT1.8NAS12-S, gene therapy DNA vector GDTT1.8NAS12-M, and gene therapy DNA vector GDTT1.8NAS12-N is extracted, multi-stage filtered, and purified by chromatographic methods.
  • the fraction containing the therapeutic DNA product i.e. gene therapy DNA vector GDTT1.8NAS12-S, gene therapy DNA vector GDTT1.8NAS12-M, and gene therapy DNA vector GDTT1.8NAS12-N is extracted, multi-stage filtered, and purified by chromatographic methods.
  • the gene therapy DNA vector GDTT1.8NAS12-S was constructed by cloning the sequence encoding the immunogenic epitope of S protein of SARS-CoV-2 (2022 bp) to a 2591 bp gene therapy DNA vector GDTT1.8NAS12 by BamHI and EcoRI restriction sites.
  • the sequence encoding the immunogenic epitope of S protein of SARS-CoV-2 (2022 bp) was obtained through enzymatic synthesis from chemically synthesised oligonucleotides, followed by PCR amplification using the following oligonucleotides:
  • Gene therapy DNA vector GDTT1.8NAS12 was constructed by consolidating six fragments of DNA derived from different sources:
  • hGH-TA transcription terminator was produced by PCR amplification of a site of human genomic DNA using hGH-F and hGH-R oligonucleotides (List of Sequences, (3) and (4)),
  • RNA-OUT regulatory site of transposon Tn10 was synthesised from RO-F, RO-R, RO-1, RO-2, and RO-3 oligonucleotides (List of Sequences, (5)-(9))
  • the kanamycin resistance gene was produced by PCR amplification of a site of commercially available pET-28 plasmid using Kan-F and Kan-R oligonucleotides (List of Sequences, (10) and (11))
  • the polylinker was produced by cining and annealing of four synthetic oligonucleotides MCS1 , MCS2, MCS3, and MCS4 (List of Sequences, (12)— (15)),
  • promoter/regulator region of EF1a human elongation factor gene with its own enhancer was obtained by PCR amplification of a site of human genomic DNA using EF1-Xho and EF1-R oligonucleotides (List of Sequences, (16)— (17)).
  • PCR amplification was performed using the commercially available kit Phusion® High-Fidelity DNA Polymerase (New England Biolabs) as per the manufacturer’s instructions. Fragments (a), (b), (c), and (d) had overlapping regions allowing for their consolidation with subsequent PCR amplification. Fragments (a), (b), (c), and (d) were consolidated using hGH-F and Kan-R oligonucleotides (List of Sequences, (3) and (11)). Afterwards, the obtained DNA fragments were consolidated by restriction with subsequent ligation by BamHI and Ncol sites. This resulted in a vector still devoid of the polylinker.
  • the plasmid was split by restriction endonucleases in BamHI and EcoRI sites with further ligation to the fragment (e). This resulted in a 2408 bp intermediate vector carrying a kanamycin resistance gene, but still without promoter/regulator site of elongation factor EF1a gene with its own enhancer.
  • the vector obtained was split by restriction endonucleases in Sail and BamHI sites with further ligation to the fragment (f). This resulted in a 3608-bp vector carrying a kanamycin resistance gene and promoter/regulator site of elongation factor EF1a gene with its own enhancer.
  • kanamycin resistance gene was cleaved by Spel restriction sites, and the remaining fragment was ligated to itself.
  • DNA vector GDTT1.8NAS12 that is recombinant and allows for antibiotic-free selection.
  • the amplification product of the sequence encoding the immunogenic epitope of S protein of SARS-CoV-2 and the DNA vector GDTT1.8NAS12 was cleaved by BamHI and EcoRI restriction endonucleases (New England Biolabs, USA). This resulted in a 4560 bp DNA vector GDTT1.8NAS12-S with the nucleotide sequence SEQ ID No. 1 and general structure shown in Fig. 1A.
  • Gene therapy DNA vector GDTT1.8NAS12-M was constructed by cloning the sequence encoding the immunogenic epitope of M protein of SARS-CoV-2 (675 bp) to a 2591 bp gene therapy DNA vector GDTT1.8NAS12 by BamHI and EcoRI restriction sites.
  • the sequence encoding the immunogenic epitope of M protein of SARS-CoV-2 (675 bp) was produced through enzymatic synthesis from chemically synthesised oligonucleotides, followed by PCR amplification using the following oligonucleotides:
  • amplification product and DNA vector GDTT1.8NAS12 were cleaved by restriction endonucleases BamHI and EcoRI (New England Biolabs, USA).
  • Gene therapy DNA vector GDTT1.8NAS12-N was constructed by cloning the sequence encoding the immunogenic epitope of N protein of SARS-CoV-2 (1266 bp) to a 2591 bp gene therapy DNA vector GDTT1.8NAS12 by BamHI and EcoRI restriction sites.
  • the sequence encoding the immunogenic epitope of N protein of SARS-CoV-2 (1266 bp) was produced through enzymatic synthesis from chemically synthesised oligonucleotides, followed by PCR amplification using the following oligonucleotides:
  • GDTT1.8NAS12-S Solutions of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-N, and GDTT1.8NAS12-M in 0.9% NaCI were prepared.
  • the DNA vaccine was obtained by mixing solutions of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-N, and GDTT 1.8NAS12-M in a preset concentration ratio relative to each other, based on the possible concentration of each DNA vector in the DNA vaccine ranging from 1% to 98% by weight determined by the outcomes of preclinical and clinical studies.
  • the concentration of gene therapy DNA vectors was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) at a wavelength of 260nm.
  • the primary human bronchial epithelial cell culture was grown under standard conditions (37°C, 5% C02) using the GROWTH MEDIUM KIT (Cell Applications, Inc., Cat. No. 511K-500) and the kit SUBCULTURE REAGENT KIT (Cell Applications, Inc., Cat. No. 090K). The growth medium was replaced every 48 hours during the cultivation process.
  • test tube 1 1mI of the composition of DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N solution in ratio 50% : 35% : 15% (concentration 500ng/pl) by weight and 1mI of P3000 reagent was added to 25mI of Opti-MEM medium (Gibco, USA). The preparation was mixed by gentle shaking. In the test tube 2, 1mI of solution Lipofectamine 3000 was added to 25mI of medium Opti-MEM (Gibco, USA). The preparation was mixed by gentle shaking. The contents from test tube 1 were added to the contents of test tube 2, and the mixture was incubated at room temperature for 5 minutes. The resulting solution was added dropwise to the cells in the volume of 40mI.
  • the primary human bronchial epithelial cell culture transfected with gene therapy DNA vector GDTT1.8NAS12 devoid of the inserted therapeutic gene (cDNA fragments of genes encoding S, M, an N proteins of SARS-CoV- 2 before and after transfection with gene therapy DNA vector GDTT1.8NAS12 devoid of the inserted therapeutic gene fragments are not shown in the figures) was used as a reference.
  • Reference vector GDTT1.8NAS12 for transfection was prepared as described above.
  • RNA from primary human bronchial epithelial cell culture was extracted using Trizol Reagent (Invitrogen, USA) according to the manufacturer’s recommendations. 1ml of Trizol Reagent was added to the well with cells and homogenised and heated for 5 minutes at 65°C. Then the sample was centrifuged at 14,000g for 10 minutes and heated again for 10 minutes at 65°C. Then 200mI of chloroform was added, and the mixture was gently stirred and centrifuged at 14,000g for 10 minutes. Then the water phase was isolated and mixed with 1/10 of the volume of 3M sodium acetate, pH 5.2, and an equal volume of isopropyl alcohol.
  • the sample was incubated at -20°C for 10 minutes and then centrifuged at 14,000g for 10 minutes.
  • the precipitated RNA was rinsed in 1ml of 70% ethyl alcohol, air-dried and dissolved in 10mI of RNase-free water.
  • the level of expression of mRNA fragments of genes encoding S, M, and N proteins of SARS-CoV-2 after transfection was determined by assessing the dynamics of the accumulation of cDNA amplicons by real-time PCR.
  • oligonucleotides For the production and amplification of cDNA fragment encoding S protein, the following oligonucleotides were used:
  • the length of amplification product is 122 bp.
  • oligonucleotides For the production and amplification of cDNA fragment encoding M protein, the following oligonucleotides were used:
  • the length of amplification product is 134 bp.
  • N_SF GCAGTCAAGCCTCTTCTCGT
  • N SR CAAGCAGCAGCAAAGCAAGA.
  • the length of amplification product is 138 bp.
  • Reverse transcription reaction and PCR amplification was performed using SYBR GreenQuantitect RT-PCR Kit (Qiagen, USA) for real-time PCR.
  • the reaction was carried out in a volume of 20mI, containing: 25mI of QuantiTect SYBR Green RT-PCR Master Mix, 2.5mM of magnesium chloride, 0.5mM of each primer, and 5mI of RNA.
  • CFX96 amplifier Bio-Rad, USA
  • B2M (beta-2-microglobuline) gene listed in the GenBank database under number NM 004048.2 was used as a reference gene.
  • Positive control included amplicons from PCR on matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices represented by matrices
  • Negative control included deionised water.
  • Real-time quantification of the dynamics of accumulation of cDNA amplicons of gene fragments encoding S, M, and N proteins of SARS-CoV-2 was conducted using the Bio-RadCFXManager 2.1 software (Bio-Rad, USA). Diagrams resulting from the assay are shown in Figure 2.
  • Figure 2 shows that due to the transfection of the primary human bronchial epithelial cell culture with gene therapy DNA vectors GDTT 1.8NAS12-S, GDTT 1.8NAS12-M, and GDTT1.8NAS12-N included in the DNA vaccine, the level of specific mRNA fragments of genes encoding S, M, and N proteins of SARS-CoV-2 has grown massively, which confirms the ability of DNA vectors to penetrate eukaryotic cells and express S, M, and N proteins of SARS-CoV-2 at the mRNA level. The presented results also confirm the practicability of use of gene therapy DNA vectors included in the DNA vaccine and the DNA vaccines.
  • the human lung fibroblast cell culture was grown in Fibroblast Basal Medium (ATCC PCS-201-030) using the Fibroblast Growth Kit-Low serum (ATCC PCS-201-041).
  • the cells were seeded into a 24-well plate in the quantity of 5x10 4 cells per well.
  • the 6th generation SuperFect Transfection Reagent (Qiagen, Germany) was used for transfection.
  • the aqueous dendrimer solution without DNA vector (A), DNA vector GDTT1.8NAS12 devoid of the therapeutic cDNA (B) were used as a reference, and DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N in ratio 50% : 35% : 15% by weight (C) were used as the transfected agents.
  • the DNA-dendrimer complex was prepared according to the manufacturer’s procedure (QIAGEN, SuperFect Transfection Reagent Handbook, 2002) with some modifications.
  • the culture medium was added to 1pg of DNA vector dissolved in TE buffer to a final volume of 60pl, then 5mI of SuperFect Transfection Reagent was added and gently mixed by pipetting five times.
  • the complex was incubated at room temperature for IQ- 15 minutes. Then the culture medium was taken from the wells, the wells were rinsed with 1ml of PBS buffer. 350mI of medium containing 10pg/ml of gentamicin was added to the resulting complex, mixed gently, and added to the cells. The cells were incubated with the complexes for 2-3 hours at 37°C in the presence of 5% C02.
  • the medium was then removed carefully, and the live cell array was rinsed with 1ml of PBS buffer. Then, medium containing 10pg/ml of gentamicin was added and incubated for 24-48 hours at 37°C in the presence of 5% C02.
  • S, M, and N proteins of SARS-CoV-2 were assayed by enzyme-linked immunosorbent assay (ELISA) using specific S (Abcasm, Cat. No. ab272504), M (Rockland, USA, Cat. No. 100-401 -A55), and N (BioVision, Cat. No. A2061) protein antibodies with optical density detection using ChemWell Automated Chemistry and Immunoassay Analyser (Awareness Technology Inc., USA).
  • R-3.0.2 was used for the statistical treatment of the results and data visualization (https://www.r-project.org/). Diagrams resulting from the assay are shown in Figure 3.
  • Figure 3 shows that the transfection of the primary human lung fibroblast cell culture (ATCC PCS-201-020) by the composition of the gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N included in the DNA vaccine results in expression of S, M, and N proteins of SARS-CoV-2, which confirms the ability of the vector to penetrate eukaryotic cells and express sequences encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2.
  • the presented results also confirm the practicability of use of gene therapy DNA vectors included in the DNA vaccine and the DNA vaccines.
  • Example 7 Proof of the efficiency and practicability of combined use of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, N proteins of SARS-CoV-2 in order to increase the expression of S, M, and N proteins of SARS-CoV-2 in mammalian tissues.
  • composition of gene therapy vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N was injected into gastrocnemius muscle of animals, in group II, DNA vector GDTT1.8NAS12 (placebo) was injected into the gastrocnemius muscle of the animals, in Group III, animals remained intact.
  • Polyethyleneimine Transfection reagent cGMP grade in-vivo- jetPEI (Polyplus Transfection, France) was used as a transport system.
  • the composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N in ratio 40% : 25% : 35% by weight was dissolved in sterile Nuclease-Free water.
  • DNA-cGMP grade in-vivo-jetPEI complexes were prepared according to the manufacturer recommendations.
  • the volume of solution for intramuscular injection was 0.1ml with a total quantity of DNA of 25pg.
  • the solution was injected using an insulin syringe. Rats were decapitated 2 days after the procedure.
  • the samples were taken on the 2nd day after the injection of the gene therapy DNA vectors.
  • Each biopsy sample was placed in a buffer solution containing 50mM of Tris-HCI, pH 7.6, 100mM of NaCI, 1mM of EDTA, and 1mM of phenylmethylsulfonyl fluoride, and homogenised to obtain a homogenised suspension. The resulting suspension was then centrifuged for 10 minutes at 14,000g. Supernatant was collected from all samples and used to quantify the therapeutic S, M, and N proteins of SARS-CoV-2 as described in Example 6.
  • Figure 4 shows that in biopsy samples of animals of target Group I that were injected with the composition of gene therapy vectors GDTT1.8NAS12- S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N, the presence of S, M, and N proteins of SARS-CoV-2 was detected in comparison to similar indicators of Group II animals (placebo) and Group III animals (intact animals) in which these proteins were not detected.
  • the results indicate the ability of DNA vectors in vivo to penetrate into eukaryotic cells of animals and express sequences encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2, which indicates the efficiency of the combined use of gene therapy DNA vectors GDTT1.8NAS12-S , GDTT1.8NAS12-M, and GDTT1.8NAS12-N included in the DNA vaccine.
  • mice were divided into 3 groups (10 animals per group). Mice from Group I were injected with JAWSII immature dendritic cell culture (ATCC CRL-11904) transfected with a combination of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2.
  • JAWSII immature dendritic cell culture ATCC CRL-11904
  • Placebo i.e. the JAWSII immature dendritic cell line transfected with gene therapy DNA vector GDTT 1.8NAS12 not carrying the gene of sequence of immunogenic epitopes of S, M, and N proteins of SARS-CoV-2, was injected into the skin on the back of Group II animals.
  • Group III consists of intact animals.
  • the JAWSII (ATCC CRL-11904) immature dendritic cells of mice were cultured in MEM medium (alpha modification, Sigma, USA) containing ribonucleosides, deoxyribonucleosides, 4mM of L-glutamine, 1mM of sodium pyruvate, 5ng/ml GM-CSF, 20% fetal bovine serum (Gibco).
  • the transfection was performed using the TransIT-TKO transfection reagent (Mirus Bio, Wl). Prior to transfection, the cells were carefully removed from the substrate using a plastic spatula and resuspended in DMEM (Gibco) medium. The cells were poured in 6cm Petri dishes in an amount of 10 7 cells/dish in a volume of 2ml and incubated for 30 min at 37°C in the presence of 5% CO2. The DNA solution, i.e. a composition of gene therapy DNA vectors GDTT 1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N in 40% : 30% : 30% ratio by weight and transfection reagent were gently mixed.
  • 750mI of DMEM medium was added to a 1.5ml tube, then 20mI of TransIT-TKO transfection reagent was added to the medium, gently mixed and incubated at room temperature for 5 min. Then, 14pg of DNA (8pg of each DNA vector) was added dropwise to the mixture and gently mixed by tube inversion. It was incubated at room temperature for 5-10 minutes, then added to the cells. Cells were incubated for 4 hours at 37°C in the presence of 5% CO2, and then 2ml of culture medium was added.
  • Cells were cultured for 72 hours, removed from the substrate using a plastic spatula, centrifuged at 3,000g for 10 minutes, resuspended in 10OmI and then injected into the skin of C57BL/6 mice back using an insulin syringe.
  • mice 48 hours after the injection of cells, the mice were decapitated.
  • Biomaterial was taken from areas of the skin in the back in the region of JAWSII immature dendritic cell line injection, co-transfected with gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 (animals from Group I), in the area of administration of placebo, i.e.
  • Figure 5 shows that in biopsy samples of animals from target Group I injected with JAWSII immature dendritic cells, co-transfected with gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N, encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2, S, M, and N proteins of SARS-CoV-2 were detected in comparison to similar indicators of the amount of proteins in the biopsy samples of animal from Group II (placebo) and Group III (intact) in which these proteins were not detected.
  • the obtained results indicate the ability of DNA vectors to penetrate into eukaryotic cells of animals and express sequences encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2.
  • the obtained results indicate the efficiency of combined use of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N included in the DNA vaccine and confirm the practicability of use in the form of injection of autologous mammalian cells transfected with these gene therapy DNA vectors in mammalian tissue to increase the level of protein antigens in the tissues of said mammals.
  • Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M
  • Escherichia coli strain JM110- NAS/GDTT1.8NAS12-N carrying the gene therapy DNA vectors GDTT1.8NAS12-S, GDTT 1.8NAS12-M, and GDTT1.8NAS12-N and the method of production thereof.
  • strains for production on an industrial scale of gene therapy DNA vectors GDTT 1.8NAS12-S, GDTT 1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2, namely Escherichia coli strain JM110-NAS/GDTT1.8NAS12- S, Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M, and Escherichia coli strain JM110-NAS/GDTT1.8NAS12-N, respectively, for production thereof allowing for antibiotic-free selection, involves making electrocompetent cells of Escherichia coli strain JM110-NAS and subjecting these cells to electroporation with gene therapy DNA vector GDTT1.8NAS12-S, or DNA vector GDTT1.8NAS12-M, or DNA vector GDTT1.8NAS12-N.
  • the cells are poured into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, 6% sucrose, and lOpg/ml of chloramphenicol.
  • production of Escherichia coli strain JM110-NAS for the production of gene therapy DNA vector GDTT1.8NAS12 or gene therapy DNA vectors based on it allowing for antibiotic-free positive selection involves constructing a 64 bp linear DNA fragment that contains regulatory element RNA-IN of Tn10 transposon allowing for antibiotic-free positive selection, a 1422 bp levansucrase gene sacB, the product of which ensures selection within a sucrose-containing medium, a 763 bp chloramphenicol resistance gene catR required for the selection of strain clones in which homologous recombination occurs, and two homologous sequences, 329 bp and 233 bp, ensuring homologous recombination in the region of gene recA concurrent with gene in
  • Each Escherichia coli strain JM110- NAS/GDTT1.8NAS12-S, Escherichia coli strain JM110- NAS/GDTT1.8NAS12-M, and Escherichia coli strain JM110- NAS/GDTT1.8NAS12-N was produced based on Escherichia coli strain JM110-NAS (Genetic Diagnostics and Therapy 21 Ltd, UK) as described in Example 9 by electroporation of competent cells of this strain with the gene therapy DNA vectors GDTT 1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 virus with further inoculation of transformed cells into agar plates (Petri dishes) with a selective medium containing yeastrel, peptone, and 6% sucrose, and selection of individual clones.
  • a medium was prepared containing (per 101 of volume): 100g of tryptone and 50g of yeastrel (Becton Dickinson, USA), then the medium was diluted with water to 8800ml and autoclaved at 121°C for 20 minutes, and then 1200ml of 50% (w/v) sucrose was added. After that, the seed culture of Escherichia coli strain JM110-NAS/GDTT1.8NAS12-S was inoculated into a culture flask in the volume of 100ml. The culture was incubated in an incubator shaker for 16 hours at 30°C.
  • the seed culture was transferred to the Techfors S bioreactor (Infors HT, Switzerland) and grown to a stationary phase. The process was controlled by measuring optical density of the culture at 600nm.
  • the cells were precipitated by centrifugation for 30 minutes at 5,000-10,000g. Supernatant was removed, and the cell precipitate was re-suspended in 10% (by volume) phosphate buffered saline. The cells were centrifuged again for 30 minutes at 5,000-10,000g. Supernatant was removed, a solution of 20mM TrisCI, 1mM EDTA, 200g/l sucrose, pH 8.0 was added to the cell precipitate in the volume of 1000ml, and the mixture was stirred thoroughly to a homogenised suspension.
  • egg lysozyme solution was added to the final concentration of 100pg/ml.
  • the mixture was incubated for 20 minutes on ice while stirring gently.
  • 2500ml of 0.2M NaOH, 10g/I sodium dodecyl sulphate (SDS) was added, the mixture was incubated for 10 minutes on ice while stirring gently, then 3500ml of 3M sodium acetate, 2M acetic acid, pH 5-5.5 was added, and the mixture was incubated for 10 minutes on ice while stirring gently.
  • the resulting sample was centrifuged for 20-30 minutes at 15,000g or a greater value.
  • the solution was decanted delicately, and residual precipitate was removed by passing through a coarse filter (filter paper).
  • RNase A (Sigma, USA) was added to the final concentration of 20pg/ml, and the solution was incubated overnight for 16 hours at room temperature. The solution was then centrifuged for 20-30 minutes at 15,000g and passed through a 0.45pm membrane filter (Millipore, USA). Then ultrafiltration was performed with a 100kDa membrane (Millipore, USA) and the mixture was diluted to the initial volume with a buffer solution of 25mM TrisCI, pH 7.0. This manipulation was performed three to four times. The solution was applied to the column with 250ml of DEAE Sepharose HP (GE, USA), equilibrated with 25mM TrisCI, pH 7.0.
  • DEAE Sepharose HP GE, USA
  • the elution process was controlled by measuring optical density of the run-off solution at 260nm, and the fractions were analysed by agarose gel electrophoresis.
  • the fractions containing gene therapy DNA vector GDTT1.8NAS12-S were joined together and stored at - 20°C. To assess the process reproducibility, the indicated processing operations were repeated five times. All processing operations for Escherichia coli strain JM110-NAS/GDTT1.8NAS12-M, or Escherichia coli strain JM110-NAS/GDTT1.8NAS12-N were performed in a similar manner.
  • the process reproducibility and quantitative characteristics of final product yield confirm the producibility and constructability of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N on an industrial scale.
  • gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N were mixed.
  • solutions of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12- N, GDTT1.8NAS12-M were diluted with 0.9% NaCI to a concentration of 1 mg/ml, then the solutions of gene therapy DNA vectors were mixed in MR Hei-Tec magnetic stirrer (Heidolph, Germany) at 50rpm for 10min in a preset ratio relative to each other based on the possible concentration of each DNA vector in DNA vaccine ranging from 1% to 98% by weight determined by the outcomes of the preclinical and clinical studies.
  • the concentration of gene therapy DNA vectors was measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) at a wavelength of 260nm.
  • the finished composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N was filled in sterile vials, lyophilized in Labconco FreeZone Triad freeze dryer until the residual moisture in the product will be no more than 3%, sealed, and labelled.
  • the constructed DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N protein of SARS-CoV-2 can be used to vaccinate human beings against SARS-CoV-2.
  • the purpose set in this invention namely the construction of DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 each of which combines the following properties:
  • DNA vaccine as a composition of gene therapy DNA vectors GDTT1.8NAS12-S, GDTT1.8NAS12-M, and GDTT1.8NAS12-N based on gene therapy DNA vector GDTT1.8NAS12 encoding immunogenic epitopes of S, M, and N proteins of SARS-CoV-2 for vaccination of human beings against SARS-CoV-2, Escherichia coli strain JM110-NAS/GDTT 1.8NAS12-S, Escherichia coli strain JM110-NAS /GDTT1.8NAS12-M, and Escherichia coli strain JM110-NAS/GDTT1.8NAS12-N carrying gene therapy DNA vectors, and method of gene therapy DNA vector production on an industrial scale.
  • GDTT1.8NAS12 Gene therapy vector devoid of sequences of viral genomes and antibiotic resistance markers DNA - Deoxyribonucleic acid cDNA - Complementary deoxyribonucleic acid
  • RNA - Ribonucleic acid mRNA - Messenger ribonucleic acid bp - base pair
  • SARS-CoV-2 - severe acute respiratory syndrome coronavirus 2

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention se rapporte à l'ingénierie génétique et peut être utilisée en biotechnologie, en médecine en tant que vaccin à ADN pour la vaccination humaine contre le virus SARS-COV-2. L'invention concerne un vaccin à base d'ADN en tant que composition d'ADN vecteurs de thérapie génique GDTT1.8NAS12-S, GDTT1.8NAS12-M, et GDTT1.8NAS12-N basés sur un ADN vecteur de thérapie génique GDTT1.8NAS12 codant pour des épitopes immunogéniques des protéines S, M et N du virus SARS-CoV -2, qui a été construit. Chacun des ADN vecteurs de thérapie génique construits inclus dans le vaccin à ADN a la capacité de pénétrer efficacement dans des cellules humaines et animales et d'exprimer la protéine S thérapeutique du SARS-CoV-2 cloné sur celui-ci, une protéine M Thérapeutique du SARS-CoV -2 clonée à celui-Ci et une protéine N thérapeutique du SARS-CoV -2 clonée à celui-ci en raison de la taille limitée de la partie du vecteur GDTT1.8NAS12 ne dépassant pas 2600 bp. Étant donné qu'une partie de chacun des ADN vecteurs de thérapie génique construits utilise des séquences nucléotidiques qui ne sont pas des gènes de résistance aux antibiotiques ou des éléments régulateurs de génomes viraux en tant qu'éléments structuraux, ceci assure son utilisation sûre pour la thérapie génique et la vaccination humaine.
PCT/RU2021/000148 2020-04-10 2021-04-07 Vaccin à adn de sars-cov-2 basé sur la thérapie génique avec un adn vecteur gdtt1.8nas12 WO2021206587A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
RU2020113297A RU2759227C2 (ru) 2020-04-10 2020-04-10 ДНК-вакцина против вируса SARS-CoV-2 на основе генотерапевтического ДНК-вектора GDTT1.8NAS12, способ ее получения, штаммы, несущие генотерапевтические ДНК-вектора, способ их получения, способ производства в промышленных масштабах генотерапевтических ДНК-векторов
RU2020113297 2020-04-10

Publications (1)

Publication Number Publication Date
WO2021206587A1 true WO2021206587A1 (fr) 2021-10-14

Family

ID=78023685

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/RU2021/000148 WO2021206587A1 (fr) 2020-04-10 2021-04-07 Vaccin à adn de sars-cov-2 basé sur la thérapie génique avec un adn vecteur gdtt1.8nas12

Country Status (2)

Country Link
RU (1) RU2759227C2 (fr)
WO (1) WO2021206587A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113755421A (zh) * 2021-09-28 2021-12-07 萝芊细胞因子有限公司 一种用于covid-19的口服性疫苗及抗体加强剂
EP4316513A1 (fr) * 2022-08-02 2024-02-07 Consejo Superior de Investigaciones Científicas (CSIC) Nouveau vaccin d'adn sars-cov-2

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2526128A1 (fr) * 2003-05-16 2005-03-10 Vical Incorporated Compositions vaccinales d'adn contre le syndrome respiratoire aigu severe et leurs procedes d'utilisation
RU2318019C2 (ru) * 2002-03-02 2008-02-27 Дзе Скриппс Рисерч Инститьют Днк-вакцина против пролиферирующих эндотелиальных клеток и способы ее применения
CN101100680B (zh) * 2007-06-15 2010-07-21 中国科学院武汉病毒研究所 高效表达sars冠状病毒s蛋白的重组杆状病毒及构建

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2712838C1 (ru) * 2018-09-04 2020-01-31 Генетик Диагностик Энд Терапи 21 Лтд Генотерапевтический ДНК-вектор GDTT1.8NAS12, способ его получения, штамм Escherichia coli JM110-NAS, способ его получения, штамм Escherichia coli JM110-NAS/GDTT1.8NAS12, несущий генотерапевтический ДНК-вектор GDTT1.8NAS12, способ его получения, способ производства в промышленных масштабах генотерапевтического ДНК-вектора

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2318019C2 (ru) * 2002-03-02 2008-02-27 Дзе Скриппс Рисерч Инститьют Днк-вакцина против пролиферирующих эндотелиальных клеток и способы ее применения
CA2526128A1 (fr) * 2003-05-16 2005-03-10 Vical Incorporated Compositions vaccinales d'adn contre le syndrome respiratoire aigu severe et leurs procedes d'utilisation
CN101100680B (zh) * 2007-06-15 2010-07-21 中国科学院武汉病毒研究所 高效表达sars冠状病毒s蛋白的重组杆状病毒及构建

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113755421A (zh) * 2021-09-28 2021-12-07 萝芊细胞因子有限公司 一种用于covid-19的口服性疫苗及抗体加强剂
CN113755421B (zh) * 2021-09-28 2024-04-12 梦芊细胞因子有限公司 一种用于covid-19的口服性疫苗及抗体加强剂
EP4316513A1 (fr) * 2022-08-02 2024-02-07 Consejo Superior de Investigaciones Científicas (CSIC) Nouveau vaccin d'adn sars-cov-2
WO2024028416A1 (fr) * 2022-08-02 2024-02-08 Consejo Superior De Investigaciones Científicas (Csic) Nouveau vaccin à adn contre le sars-cov-2

Also Published As

Publication number Publication date
RU2020113297A (ru) 2021-10-11
RU2759227C2 (ru) 2021-11-11
RU2020113297A3 (fr) 2021-10-11

Similar Documents

Publication Publication Date Title
CN112481289B (zh) 一种转录环状rna的重组核酸分子及其在蛋白表达中的应用
CN112266411B (zh) 一种新型冠状病毒疫苗及其应用
Reyes-Sandoval et al. CpG methylation of a plasmid vector results in extended transgene product expression by circumventing induction of immune responses
US20200385743A1 (en) GENE THERAPY DNA VECTOR VTvaf17, METHOD OF PRODUCTION; ESCHERICHIA COLI STRAIN SCS110-AF, METHOD OF PRODUCTION; ESCHERICHIA COLI STRAIN SCS110-AF/VTvaf17 BEARING GENE THERAPY DNA VECTOR VTvaf17, METHOD OF PRODUCTION
WO2021206587A1 (fr) Vaccin à adn de sars-cov-2 basé sur la thérapie génique avec un adn vecteur gdtt1.8nas12
WO2023064907A1 (fr) Compositions et méthodes de vaccination contre des espèces pathogènes de coronavirus et des variants
EP2307575B1 (fr) Produit d'amplification par cercle roulant non traité
WO2023227124A1 (fr) Squelette pour la construction d'un gabarit de transcription in vitro d'arnm
Bolhassani et al. VLP production in Leishmania tarentolae: a novel expression system for purification and assembly of HPV16 L1
US9125845B2 (en) DNA vaccines, uses for unprocessed rolling circle amplification product and methods for making the same
KR101919002B1 (ko) 구제역 바이러스의 가용성 다가 항원단백질 및 이의 용도
CN115427071A (zh) 包含ltb和病原性抗原的组合物及其用途
KR101987775B1 (ko) 구제역 바이러스의 가용성 다가 항원단백질 및 이의 용도
CN110564751A (zh) 微环dna疫苗设计及应用
WO2022116528A1 (fr) Arn circulaire, vaccin contenant un arn circulaire et kit de détection d'un nouvel anticorps neutralisant le coronavirus
Montgomery et al. Design of plasmid DNA constructs for vaccines
WO2022112790A1 (fr) Particules de type viral et procédés de production associés
US20210310011A1 (en) The gene therapy dna vector gdtt1.8nas12 and the method for obtaining thereof
Szécsi et al. DNA vaccination with a single-plasmid construct coding for viruslike particles protects mice against infection with a highly pathogenic avian influenza A virus
RU2741570C1 (ru) Генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора GDTT1.8NAS12, несущий целевой ген, выбранный из группы генов IFNB1, IFNA14, IFNA2, IL12A, IL12B для повышения уровня экспрессии этих целевых генов, способ его получения и применения, штамм Escherichia coli JM110-NAS/GDTT1.8NAS12-IFNB1, или Escherichia coli JM110-NAS/GDTT1.8NAS12-IFNA14, или Escherichia coli JM110-NAS/GDTT1.8NAS12-IFNA2, или Escherichia coli JM110-NAS/GDTT1.8NAS12-IL12A, или Escherichia coli JM110-NAS/GDTT1.8NAS12-IL12B, несущий генотерапевтический ДНК-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического ДНК-вектора
KR20180068936A (ko) 구제역 바이러스의 가용성 다가 항원단백질 및 이의 용도
WO2021137742A1 (fr) Vecteur de thérapie génique adn
RU2730663C2 (ru) Генотерапевтический ДНК-вектор на основе генотерапевтического ДНК-вектора VTvaf17, несущий целевой ген Cas9 для гетерологичной экспрессии этого целевого гена в клетках человека и животных при реализации различных методов геномного редактирования, способ получения и применения генотерапевтического ДНК-вектора, штамм Escherichia coli SCS110-AF/VTvaf17-Cas9, несущий генотерапевтический ДНК-вектор, способ его получения, способ производства в промышленных масштабах генотерапевтического ДНК-вектора
CN116785422B (zh) 含有新型冠状病毒联合抗原的麻疹减毒疫苗及其拯救方法
US20210308282A1 (en) Gene therapy dna vectors based on vtvaf17

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21784772

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21784772

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 19.07.2023)

122 Ep: pct application non-entry in european phase

Ref document number: 21784772

Country of ref document: EP

Kind code of ref document: A1