WO2021158565A2 - Poxvirus-based vectors produced by natural or synthetic dna and uses thereof - Google Patents

Poxvirus-based vectors produced by natural or synthetic dna and uses thereof Download PDF

Info

Publication number
WO2021158565A2
WO2021158565A2 PCT/US2021/016247 US2021016247W WO2021158565A2 WO 2021158565 A2 WO2021158565 A2 WO 2021158565A2 US 2021016247 W US2021016247 W US 2021016247W WO 2021158565 A2 WO2021158565 A2 WO 2021158565A2
Authority
WO
WIPO (PCT)
Prior art keywords
fragments
dna
poxvirus
sequence
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/016247
Other languages
English (en)
French (fr)
Other versions
WO2021158565A3 (en
Inventor
Don J. Diamond
Felix WUSSOW
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
City of Hope
Original Assignee
City of Hope
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020227030182A priority Critical patent/KR20220148823A/ko
Priority to US17/759,254 priority patent/US20230097513A1/en
Priority to BR112022014738A priority patent/BR112022014738A2/pt
Priority to CA3168836A priority patent/CA3168836A1/en
Priority to MX2022009200A priority patent/MX2022009200A/es
Priority to CN202180025623.2A priority patent/CN115397998A/zh
Priority to EP21750239.2A priority patent/EP4100514A4/en
Priority to JP2022547055A priority patent/JP2023512294A/ja
Priority to AU2021217073A priority patent/AU2021217073A1/en
Priority to IL294926A priority patent/IL294926A/en
Application filed by City of Hope filed Critical City of Hope
Publication of WO2021158565A2 publication Critical patent/WO2021158565A2/en
Publication of WO2021158565A3 publication Critical patent/WO2021158565A3/en
Anticipated expiration legal-status Critical
Priority to US19/076,904 priority patent/US20250215456A1/en
Priority to AU2025287330A priority patent/AU2025287330A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001148Regulators of development
    • A61K39/00115Apoptosis related proteins, e.g. survivin or livin
    • A61K39/001151Apoptosis related proteins, e.g. survivin or livin p53
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16111Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24151Methods of production or purification of viral material
    • C12N2710/24152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/50Vectors for producing vectors

Definitions

  • Poxviruses are large double-stranded, enveloped DNA viruses that replicate entirely in the cytoplasm of infected cells by encoding their own enzymes for DNA transcription and replication 2027 .
  • One of the greatest achievements in medical history was the eradication of the causative agent of smallpox (Variola virus) by mass vaccination with replication-competent, attenuated Vaccinia virus vaccine strains.
  • Vaccinia virus is used as the prototype member to study poxvirus replication and has been further developed to generate recombinant vaccines and oncolytic agents.
  • Modified Vaccinia Ankara is a highly attenuated orthopoxvirus that was derived from its parental strain Chorioallantois Vaccinia Ankara (CVA) by 570 passages on chicken embryo fibroblasts (CEF) 1 .
  • CVA Chorioallantois Vaccinia Ankara
  • CAF chicken embryo fibroblasts
  • MVA has acquired six major genome deletions (Dell -6) as well as multiple shorter deletions, insertions, and point mutations, leading to gene fragmentation, truncation, short internal deletions, and amino acid substitutions 2 .
  • MVA has severely restricted host cell tropism, allowing productive assembly only in avian cells, e.g. CEF and baby hamster kidney (BHK) cells, whereas in human and most other mammalian cells, MVA assembly is abortive due to a late block in virus assembly 45 . Although non-pathogenic and highly attenuated, MVA maintains excellent immunogenicity as demonstrated in various animal models and humans 67 .
  • MVA was used as a priming vector for the replication competent vaccinia- based vaccine in over 120,000 individuals in Germany and no adverse events were reported 8 .
  • MVA has been developed as a stand-alone smallpox vaccine and is currently pursued by the United States (US) government as a safer alternative to substitute the existing vaccinia-based vaccine stocks as a preventative countermeasure in case of a smallpox outbreak 9 11 .
  • US United States
  • the identical MVA vaccine using the trade name Imvamune was approved in Europe as a smallpox vaccine.
  • MVA vectors or derivatives thereof are licensed or owned by academic, commercial, or governmental entities, which greatly restricts their use to develop MVA-based vaccine vectors. Therefore, there is a need to develop alternative MVA vectors for various research, prophylactic, and therapeutic uses. In addition, novel technologies are urgently needed to accelerate the development of recombinant poxvirus vectors for pathogen preparedness and disease prevention.
  • this disclosure relates to a method of producing a poxvirus vector or a recombinant poxvirus vector.
  • the method entails the steps of transfecting one or more DNA fragments into a host cell, wherein the one or more DNA fragments comprise the entire genomic DNA sequence of a desired poxvirus, such that the poxvirus is reconstituted in the host cell.
  • two or more DNA fragments are co-transfected into the host cell, each DNA fragment comprises a partial sequence of the poxvirus genome such that the two or more DNA fragments are assembled sequentially by homologous recombination and comprise the full-length sequence of the poxvirus genome when reconstituted in the host cell.
  • the method further entails infecting the host cell with a helper virus before, during, or after the transfection of the one or more DNA fragments to initiate the transcription of the one or more DNA fragments.
  • the helper virus is Fowl pox virus (FPV), sheep fibroma virus, vaccinia virus, or cowpox virus.
  • the one or more DNA fragments are circularized before transfection or transfected in circular forms into the host cell.
  • the one or more DNA fragments are cloned into a plasmid or a bacterial artificial chromosome (BAC) vector.
  • BAC bacterial artificial chromosome
  • the one or more DNA fragments are linearized before co-transfection or transfected in linearized forms into the host cell.
  • the one or more DNA fragments are naturally derived, chemically synthesized, or a combination of naturally derived and chemically synthesized DNA fragments.
  • the poxvirus genomic sequence comprises the sequence of Modified Vaccinia Ankara (MVA) Accession No. #1194848 or #AY603355.
  • the poxvirus genomic sequence comprises the sequence of Vaccinia virus genome.
  • two adjacent DNA fragments have an overlapping sequence to facilitate homologous recombination. In certain embodiments, the overlapping sequence is between about 100 bp and about 5000 bp in length.
  • the one or more DNA fragments further comprise an inverted terminal repeat (ITR) region.
  • the one or more DNA fragments further comprise a poxvirus terminal hairpin loop (HL) sequence, a poxvirus genome resolution (CR) sequence, or both, wherein the HL or the CR sequence is added to one or both ends of the DNA fragment as single stranded or double stranded DNA sequences in sense or antisense orientation.
  • the one or more DNA fragments further comprise one or more HL sequences and one or more CR sequences. In certain embodiments, each HL sequence is flanked by two CR sequences at both ends of the HL sequence.
  • the one or more DNA fragments further comprise one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof or other heterologous DNA sequences.
  • two or more DNA fragments comprise the DNA sequence of the same antigen, a subunit or fragment thereof or the same heterologous DNA sequence.
  • two or more DNA fragments comprise the DNA sequences of different antigens, subunits, or fragments thereof or other heterologous DNA sequences.
  • the DNA sequences of the antigens, subunits, or fragments thereof or other heterologous DNA sequences are codon optimized for expression in the host cell.
  • the one or more DNA fragments further comprise a virus promoter upstream of the DNA sequences of the antigens, subunits, or fragments thereof or other heterologous DNA sequences, a transcription termination signal downstream the DNA sequences of the antigens, subunits, or fragments thereof or other heterologous DNA sequences, or both.
  • the DNA sequences encoding the antigens, subunits, or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites such as intergenic regions, non-essential genes and regions, and deletion sites.
  • an expression system comprising: (i) a single DNA fragment comprising the entire genome of a desired poxvirus, or two or more DNA fragments each comprising a partial sequence of the genome of the desired poxvirus such that the two or more DNA fragments, when transferred into the host cell upon co-transfection, are assembled sequentially and comprise the full- length sequence of the poxvirus genome and enable reconstitution of the poxvirus, and (ii) one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof or other heterologous DNA sequences inserted in one or more insertion sites of the poxvirus, wherein the antigens or subunits thereof or other heterologous DNA sequences are expressed in the host cell upon transfection of the one or more poxvirus DNA fragments and reconstitution of the poxvirus.
  • the one or more DNA fragments are circularized before transfection or transfected in circular forms into the host cell. In certain embodiments, the one or more DNA fragments are cloned into a plasmid or a BAC vector. In certain embodiments, the one or more DNA fragments are linearized before transfection or transfected in linearized forms into the host cell. In certain embodiments, the one or more DNA fragments are naturally derived, chemically synthesized, or a combination of naturally derived and chemically synthesized DNA fragments. In certain embodiments, the genomic sequence of the poxvirus comprises the sequence of MVA Accession No. #1194848 or #AY603355.
  • the two adjacent DNA fragments have an overlapping sequence to facilitate homologous recombination.
  • the overlapping sequence is between about 100 bp and about 5000 bp in length.
  • the one or more DNA fragments further comprise an inverted terminal repeat (ITR) region.
  • the one or more DNA fragments further comprise a poxvirus terminal hairpin loop (HL) sequence, a poxvirus genome resolution (CR) sequence, or both, wherein the HL or the CR sequence is added to one or both ends of the DNA fragment as single stranded or double stranded DNA sequences in sense or antisense orientation.
  • HL poxvirus terminal hairpin loop
  • CR poxvirus genome resolution
  • the one or more DNA fragments further comprise one or more HL sequences and one or more CR sequences.
  • each HL sequence is flanked by two CR sequences at both ends of the HL sequence.
  • only a subset of the one or more DNA fragments comprises the HL or CR sequence.
  • the one or more DNA fragments further comprise a virus promoter upstream of the DNA sequences encoding the antigens, subunits or fragments thereof or other heterologous DNA sequences, a transcription termination signal downstream of the DNA sequences encoding the antigens, subunits or fragments thereof or other heterologous DNA sequences, or both.
  • the DNA sequences encoding one or more antigens, subunits or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites.
  • a vaccine composition for preventing or treating cancer or an infectious disease comprising: (i) a single DNA fragment comprising the entire genome of a desired poxvirus, or two or more DNA fragments each comprising a partial sequence of the genome of the desired poxvirus such that the two or more DNA fragments, when transferred into the host cell upon co-transfection, are assembled sequentially and comprise the full-length sequence of the poxvirus genome and enable reconstitution of the poxvirus, and (ii) one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof or other heterologous DNA sequences inserted in one or more insertion sites of the poxvirus, wherein the antigens, subunits or fragments thereof or other heterologous DNA sequences are expressed in the host cell upon transfection of the one or more DNA fragments and reconstitution of the poxvirus.
  • the antigens, subunits or fragments thereof or other heterologous DNA sequences are inserted in one or more poxvirus insertion sites.
  • the vaccine composition further comprises a pharmaceutically acceptable carrier, adjuvant, additive or combination thereof.
  • a method of preventing or treating cancer or a viral infection in a subject comprising administering a prophylactically or therapeutically effective amount of a vaccine composition to the subject, wherein the vaccine comprises: (i) a single DNA fragment comprising the entire genome of a desired poxvirus, or two or more DNA fragments each comprising a partial sequence of the genome of the desired poxvirus such that the two or more DNA fragments, when transferred into the host cell upon co-transfection, are assembled sequentially and comprise the full-length sequence of the poxvirus genome and enable reconstitution of the poxvirus, and (ii) one or more DNA sequences encoding one or more antigens, subunits or fragments thereof or other heterologous DNA sequences inserted in one or more insertion sites of the poxvirus, wherein the antigens, subunits, or fragments thereof or other heterologous DNA sequences are expressed in the host cell upon transfection of the one or more DNA fragments and reconstitution of the poxvirus.
  • the vaccine comprises: (i) a single DNA
  • Figures 1A-1C show the design of the sMVA construction.
  • Figure 1A Schematic of MVA genome. The MVA genome is approximately 178 kbp in length and contains an internal unique region (UR) flanked by large ⁇ 9.6 kbp long inverted terminal repeats (ITRs).
  • Figure 1B Schematic of sMVA fragments. Each of the three sMVA fragments is approximately 60 kbp in length.
  • sMVA fragment 1 (F1) contains the sequence of the left part of the MVA genome, including the left ITR;
  • sMVA fragment 2 (F2) contains the sequence of the middle part of the MVA genome;
  • sMVA fragment 3 (F3) contains the sequence of the right part of the MVA genome, including the right ITR.
  • sMVA F1 and F2 as well as sMVA F2 and F3 share ⁇ 3 kbp overlapping sequences for homologous recombination (dotted crossed lines). Indicated are the approximate positions of commonly used MVA insertion sites, including Del2, IGR44/45 (44/45), and IGR64/65 (69/70) within sMVA F1 , IGR69/70 (69/70) and the TK insertion site within sMVA F2, and Del3 within sMVA F3.
  • Figure 1 C Schematic of the terminal HL and CR sequences. Each of the sMVA fragments contains at both ends a sequence composition comprising a duplex copy of the MVA terminal HL and flanking CR sequences to promote genome resolution and packaging.
  • Sfil and Fsel restriction sites are included as indicated at both ends of each of the sMVA fragments to release the fragments from the bacterial vector backbone (pCCI-Brick) with or without the terminal CR/HL/CR sequences by enzymatic digestion.
  • FIG. 2 shows reconstitution of sMVA.
  • a schematic for the generation of sMVA (sMVA) using the three sMVA fragments (F1-F3) as shown in Figure 1 is depicted.
  • the three sMVA fragments are stably maintained in E. coli , then isolated from the bacteria and transferred by transfection as circular or linearized DNA molecules into MVA permissive BHK or CEF cells.
  • the transfected cells are subsequently infected with Fowl pox virus (FPV) as a helper virus to initiate MVA genome transcription and replication and consequently the reconstitution of the viral form of sMVA.
  • FPV Fowl pox virus
  • FIG. 3 depicts the construction of recombinant sMVA with one antigen.
  • a schematic is shown for an example of the construction of recombinant sMVA (rsMVA) with one introduced antigen sequence, heterologous gene sequence, or other genome alteration.
  • the antigen or heterologous gene sequence black circle
  • the modified sMVA fragment F1 and the unmodified sMVA fragments F2 and F3 are isolated from E. coli and co-transfected as circular or linearized forms into FPV-infected BHK or CEF cells to initiate the reconstitution of rsMVA expressing one antigen or heterologous gene sequence.
  • Nucl. cell nucleus.
  • FIG. 4 illustrates the construction of recombinant sMVA with three antigens.
  • a schematic is shown for an example of the generation of a recombinant sMVA (rsMVA) with 3 introduced antigen sequences, heterologous gene sequences, or other genome alterations.
  • An antigen or heterologous gene sequence (shown in square, circle, or rectangle) is inserted into each of the three sMVA fragments (F1- F3) by bacterial recombination techniques in E. coli using linear PCR-derived products or other forms of linear DNA constructs.
  • the modified F1 , F2, and F3 sMVA fragments are isolated from E.
  • coli and co-transfected in circular or linearized forms into permissive BHK or CEF cells, where rsMVA virus expressing three antigen or heterologous gene sequences are reconstituted in the presence of FPV as a helper virus.
  • Nucl. cell nucleus.
  • FIG. 5 illustrates the sMVA reconstitution process.
  • a schematic is shown for an example of the tissue culture reconstitution process of sMVA or rsMVA using the three sMVA fragments (F1-F3) or modified forms thereof.
  • BHK cells seeded in 6-well tissue culture format are co-transfected with the three sMVA fragments (unmodified, modified, or a combination thereof) and subsequently infected with FPV as a helper virus to initiate the transcription and replication of the sMVA fragments and, consequently, the reconstitution of sMVA virus.
  • the transfected/infected BHK cells are transferred every other day (at 2, 4, and 6 days post transfection/infection (dpt/i)) into larger tissue culture formats as indicated to promote sMVA reconstitution. Plaque development and progression can be detected after the day 2 and day 4 cell transfers, resulting in 90-100% infected BHK cells at 7 or 8 dpt/i after the day 6 transfer.
  • Figures 6A-6B show sMVA infectivity analysis.
  • Figure 6A is a plaque analysis showing representative bright field microscopy images of 5 individual plaques in BHK cell monolayers infected with sMVA or MVA NIH clone 1 at 1 day post infection (dpi).
  • Figure 6B shows the progression of infection. Shown are representative bright field microscopy images of BHK cell monolayers infected with sMVA or MVA NIH clone 1 at 1 , 2, and 3 dpi. Mock-infected (uninfected) BHK cell monolayers were analyzed as control. Plaques and infected areas were visualized by immunostaining for the Vaccinia virus B5R protein.
  • Figures 7A-7L show PCR analysis of the reconstituted sMVA.
  • BHK cells were infected at MOI 5 with sMVA virus reconstituted from the three sMVA fragments (F1-F3) or MVA NIH clone 1 and DNA extracted from infected BHK cells was evaluated by PCR. DNA extracted from mock-infected (uninfected) BHK cells (BHK) as well as H2O only (Ctrl) was analyzed for control.
  • the PCR analysis included sequence detection of the inverted terminal repeats (ITR) ( Figure 7A); the transition from the left ITR into the internal unique region (LITR/UR) ( Figure 7B) and the MVA Deletion 2 site (Del2) ( Figure 7C) located in sMVA F1 -derived DNA; the intergenic region (IGR) between MVA 69R and 70L (IGR69/70) ( Figure 7D) located in sMVA F2-derived DNA; the MVA Deletion 3 site (Del3) ( Figure 7E) and the transition from the internal UR into the right ITR (UR/RITR) ( Figure 7F) located in sMVA F3-derived DNA; the reconstitution of the recombination site of sMVA F1 and F2 (F1/F2) ( Figure 7G) as well as of F2 and F3 (F2/F3) ( Figure 7H); and the MVA genome positions containing the five nucleotide polymorphism (Polym. 1 , 2, 3, 4/5) ( Figure
  • Figure 8 shows reconstitution of sMVA with a single fluorescence marker. Shown are representative immunofluorescence and bright field microscopy images of BHK cell monolayers at 6 and 7 days post transfection/infection (dpt/i) using unmodified sMVA fragments F1 and F3 and modified sMVA fragment F2 with inserted red fluorescence protein (RFP) marker (F2-RFP). The sMVA reconstitution procedure from these fragments is illustrated in Figure 5 and FPV was used as a helper virus. Mock-transfected/infected BHK cell monolayers were analyzed as control.
  • Figure 9 shows reconstitution of sMVA with double fluorescence markers. Shown are representative immunofluorescence and bright field microscopy images of BHK cell monolayers at 6 and 7 days post transfection/infection (dpt/i) using unmodified sMVA fragment F1 , modified sMVA fragment F2 with inserted red fluorescence protein (RFP) marker (F2-RFP), and modified sMVA fragment F3 with inserted blue fluorescence protein (BFP) marker (F3-BFP).
  • RFP red fluorescence protein
  • BFP blue fluorescence protein
  • FIGS 10A-10H illustrate various examples of rsMVA HCMV vector construction. Shown are examples for the use of the sMVA fragments F1-F3 to generate rsMVA vectors with inserted HCMV antigen sequences based on the five subunits of the pentamer complex (PC; including UL128, UL130, UL131A, gH, and gl_), glycoprotein B (gB), phosphoprotein 65 (pp65), and/or the immediately-early proteins 1 and 2 (IE1 and IE2).
  • PC pentamer complex
  • gB glycoprotein B
  • pp65 phosphoprotein 65
  • IE1 and IE2 immediately-early proteins 1 and 2
  • HCMV antigen sequences are inserted as indicated either separately or combined as 2A-linked polycistronic expression constructs into different MVA insertion sites, including the MVA Deletion 3 (Del3) site or intergenic regions between open reading frames 044/045 (44/45), 064/065 (64/65), or 069/070 (69/70).
  • Del3 MVA Deletion 3
  • rsMVA vectors expressing all PC subunits (sMVA-PC1 ( Figure 10A) and SMVA-PC2 ( Figure 10B)), all PC subunits together with gB and pp65 (sMVA-7Ag1 ( Figure 10C) and sMVA-7Ag2 ( Figure 10D)), or all PC subunits, gB, and pp65 together with IE1/IE2 antigens (sMVA-8Ag1/2 ( Figures 10E-10F)) and sMVA-9Ag2 ( Figures 10G-10H)).
  • mH5 represents Vaccinia modified H5 promoter
  • ITR represents inverted terminal repeats.
  • Figures 11A-11B show sMVA characterization.
  • Figure 11 A PCR analysis. CEF infected with sMVA, derived with FPV HP1.441 (sMVA hp) or TROVAC from two independent virus reconstitutions (sMVA tv1 and sMVA tv2), were investigated by PCR for several MVA genome positions (ITR sequences, transition left or right ITR into internal unique region (left ITR/UR; UR/right ITR), Del2, IGR69/70 and Del3 insertion sites, and F1/F2 and F2/F3 recombination sites) and absence of BAC vector sequences.
  • ITR sequences transition left or right ITR into internal unique region
  • Del2 IGR69/70 and Del3 insertion sites
  • F1/F2 and F2/F3 recombination sites F1/F2 and F2/F3 recombination sites
  • PCR reactions with wtMVA-infected and uninfected cells, without sample (mock), or with MVA BAC were performed as controls.
  • Figure 11 B Restriction fragment length analysis. Viral DNA isolated from ultra-purified sMVA (sMVA tv1 and sMVA tv2) or wtMVA virus was compared by Kpnl and Xhol restriction enzyme digestion.
  • Figures 12A-12D show sMVA replication properties.
  • the replication properties of sMVA derived with FPV HP1.441 (sMVA hp) or TROVAC from two independent sMVA virus reconstitution (sMVA tv1 and sMVA tv2) were compared with wtMVA.
  • Figure 12A Viral foci. CEF infected at low multiplicity of infection (MOI) with the reconstituted sMVA virus or wtMVA were immunostained using anti- Vaccinia polyclonal antibody (aVAC).
  • Figure 12B Replication kinetics.
  • BHK or CEF cells were infected at 0.02 MOI with sMVA or wtMVA and viral titers of the inoculum and infected cells at 24 and 48 hours post infection were determined on CEF. Mixed-effects model with the Geisser-Greenhouse correction was applied; at 24 and 48 hours post-infection differences between groups were not significant.
  • Figure 12C Viral foci size analysis. BHK or CEF cell monolayers were infected at 0.002 MOI with sMVA or wtMVA and areas of viral foci were determined at 24 hours post infection following immunostaining with aVAC antibody.
  • Figure 12D Host cell range analysis.
  • Various human cell lines HEK293, A549, 143b, and HeLa
  • CEF or BHK cells were infected at 0.01 MOI with sMVA or wtMVA and virus titers were determined at 48 hours post infection on CEF.
  • Dotted lines indicate the calculated virus titer of the inoculum based on 0.01 MOI.
  • FIGS 13A-13D demonstrate sMVA in vivo immunogenicity.
  • sMVA derived either with FPV HP1 .441 (sMVA hp) or TROVAC from two independent virus reconstitution (sMVA tv1 and sMVA tv2) was compared by in vitro analysis with wtMVA.
  • C57BL/6 mice were immunized twice at three-week interval with low (1x10 7 PFU) or high (5x10 7 PFU) dose of sMVA or wtMVA. Mock-immunized mice were used as controls.
  • Figure 13A Binding antibodies.
  • MVA-specific binding antibodies (IgG titer) stimulated by sMVA or wtMVA were measured after the first and second immunization by ELISA.
  • Figure 13B NAb responses.
  • MVA-specific NAb titers induced by sMVA or wtMVA were measured after the booster immunization against recombinant wtMVA expressing a GFP marker.
  • Figures 13C-13D T cell responses.
  • MVA-specific IFNy, TNFa, IL-4, and IL-10-secreting CD8+ (13C) and CD4+ (13D) T cell responses induced by sMVA or wtMVA after two immunizations were measured by flow cytometry following ex vivo antigen stimulation using B8R immunodominant peptides. Differences between groups were evaluated using one way ANOVA with Tukey’s multiple comparison test ns not significant.
  • Figures 14A-14D demonstrate sMVA immunogenicity in vivo.
  • sMVA derived either with FPV strain HP1.441 (sMVA hp) or with FPV strain TROVAC from two independent virus reconstitution (sMVA tv1 and sMVA tv2) was compared by in vitro analysis with wtMVA.
  • Figure 14A Binding antibodies.
  • FIG. 14A Shown is the absorbance at 450 nm at different serum dilutions of MVA-specific binding antibodies (IgG titer) measured by ELISA after the first and second immunization in mice receiving sMVA or wtMVA.
  • Figure 14B NAb responses. MVA-specific NAb titers induced by sMVA or wtMVA were measured after the booster immunization against wtMVA expressing a GFP marker. Shown is the measured GFP area of infected cells in square pixels (pix 2 x10 3 ) at different serum dilutions.
  • Figures 14C-14D T cell responses.
  • sMVA sMVA
  • rsMVA recombinant sMVA
  • MVA Because of its excellent safety profile in addition to its versatile expression system and large capacity to accommodate foreign DNA sequences (up 30 kbp) 1 , MVA is widely used to develop recombinant vaccine vectors against infections disease and cancer 7 ’ 12 ’ 13 . MVA has been pursued to develop different vaccine strategies for cancer treatment 14 15 as well as various vaccine approaches to prevent human cytomegalovirus (HCMV) infection 16-18 , a common cause of permanent birth defects in newborns and complications in transplant recipients 19 . Some of these vaccines have completed clinical phase I or II evaluation 14 17 . As a member of the poxvirus family, MVA replicates entirely in the cytoplasm of infected cells, providing its own enzymes for transcription and DNA replication 1 20 .
  • HCMV human cytomegalovirus
  • MVA virus production is abortive because of a late block in assembly in mammalian cells, MVA can efficiently infect most mammalian cells, including human cells, and initiate robust gene expression and DNA replication, making MVA an ideal vehicle to efficiently deliver and express foreign antigens in vitro and in vivo 1 ⁇ 5 .
  • the most commonly used method to generate MVA recombinants is based on the so-called transfection/infection method using a transfer plasmid, which is co-delivered together with MVA into permissive cells (CEF or BHK), thereby inserting a desired antigen together with an upstream promoter sequence and downstream transcription termination signal into the MVA genome by spontaneous homologous recombination 1 ⁇ 5 ’ 21 .
  • a single DNA fragment is derived from viral DNA or chemically synthesized and comprises the entire genome sequence of a poxvirus. This single DNA fragment can be used to transfect a host cell such that the poxvirus is reconstituted.
  • two or more naturally derived or chemically synthesized DNA fragments, or a combination thereof are used to co-transfect a host cell, wherein each DNA fragment comprises a partial sequence of the poxvirus genomic DNA with overlapping sequences at the ends of two adjacent DNA fragments, such that when the two or more DNA fragments are co-transfected into the host cell, they assemble with each other by homologous recombination to form a poxvirus comprising a full-length sequence of the desired poxvirus genome.
  • the overlapping sequence is between about 100 bp and about 5000 bp in length.
  • a shortened genomic sequence rather than the entire genomic sequence or an altered genomic sequence with deletion(s) or modification(s) in non-essential genes or regions of the genomic sequence of a poxvirus, or a hybrid derivative comprising the genomic sequences from two or multiple different poxviruses can be used to produce vectors disclosed herein.
  • one or more naturally derived or chemically synthesized DNA fragment(s) comprising the poxvirus genome or subgenomic DNA may be further modified to form artificial hybrid fragments composed of natural and synthetic poxvirus genomic DNA sequences.
  • the naturally derived or chemically synthesized one or more DNA fragment(s) maybe composed of sequences derived from two different poxviruses to form poxvirus hybrid sequences.
  • One or more DNA fragment(s) can be composed of poxvirus sequences or sequences composed of different poxvirus sequences derived from MVA (NCBI accession #1194848, #AY603355), Vaccinia virus (#NC_006998, #LT966077), Camelpox virus (#NC_003391), Cowpox virus (#NC_003663) Ectromelia virus (#NC_004105), Monkeypox virus (#NC_003310), Racoonpox virus (#NC_027213), Skunkpox virus (#NC_031038), Taterapox virus (#NC_008291), Variola virus (#NC_001611 , #L22579), Velopox virus (#NC_031033), Canarypox virus
  • the host cell is infected with a helper virus such as FPV before, during, or after the transfection of one or more DNA fragments comprising the sequence of the poxvirus genome or subgenomic DNA.
  • a helper virus can be any suitable virus that infects the host cell and allows initiation of the transcription and replication of the poxvirus. Used herein as an example is FPV in the host cell without undergoing homologous recombination with the poxvirus DNA. The helper virus is unable to replicate in the host cell.
  • the helper virus itself is not a component of the reconstituted poxvirus, e.g., FPV for the purposes of this application.
  • cowpox virus, Shope fibroma virus, or other suitable poxviruses can be used as a helper virus.
  • one or more DNA fragments for transfection can be linearized, circularized, or a combination of linearized and circularized DNA fragments.
  • one or more DNA fragments for transfection are cloned into a vector such as a plasmid or a BAC and/or maintained in a host cell such as a bacterial cell, e.g., E. coli.
  • one or more DNA fragment(s) further comprise one or both of the inverted terminal repeat (ITR) regions of the poxvirus.
  • the sequence of the ITR may contain one or more alterations or variations, which do not affect the design scheme of the reconstituted poxvirus.
  • the one or more DNA fragments that reconstitute the poxvirus may contain only parts of the ITR sequences.
  • the sMVA fragments F1 and F3 as well as the reconstituted sMVA vectors or recombinant sMVA vectors ( Figure 1-4) may contain only parts of the MVA ITR sequences.
  • one or more DNA fragment(s) are further modified to add a poxvirus terminal hairpin loop (HL) sequence at one end or both ends as a duplex copy (double stranded DNA) or the 5’ and/or 3’ ends as a single stranded nucleotide sequence.
  • HL sequence can be added to either end or both ends of a synthetic DNA fragment as double-stranded or single-stranded DNA sequence in sense (5’ - 3’) or anti-sense (3’ - 5’) orientation.
  • one or more DNA fragment(s) are further modified to add a poxvirus concatemeric resolution (CR) sequence at one end or both ends as double stranded DNA sequence or at the 5’ and/or 3’ ends as a single stranded nucleotide sequence.
  • the CR sequence can be based on any sequence derived from the consensus sequence 5’-T 6 -N 7-9 -T/C-A 3 - T/A-3’, wherein A is adenine, C is cytosine, G is guanine, T is thymine, and N is any nucleotide.
  • two CR sequences can be added to both ends of the HL sequence to form a CR-HL-CR sequence.
  • the CR-HL-CR sequence can be added to one or more DNA fragment(s) to one end or both ends as double stranded DNA sequences, or to the 5’ end, 3’ end, or both ends as single stranded nucleotide sequences. In other embodiments, only the HL or CR sequence is added to one end or both ends of one or more DNA fragment(s) as double or single stranded DNA sequence. In certain embodiments, all the DNA fragments contain the HL or CR sequence or a combination thereof at one or both ends. In other embodiments, not all the DNA fragments contain the HL or CR sequence. In certain embodiments, only a subset or a subpopulation of the DNA fragments contain the HL or CR sequence, or a combination thereof.
  • the ITR, HL or CR sequences maybe derived from MVA (NCBI accession #U94848, #AY603355), Vaccinia virus (#NC_006998, #LT966077), Camelpox virus (#NC_003391), Cowpox virus (#NC_003663) Ectromelia virus (#NC_004105), Monkeypox virus (#NC_003310), Racoonpox virus (#NC_027213), Skunkpox virus (#NC_031038), Taterapox virus (#NC_008291), Variola virus (#NC_001611 , #L22579), Velopox virus (#NC_031033), Canarypox virus (#NC_005309), Swinepox virus (#NC_003389), FPV (#NC_002188, #MH734528), Myxoma virus (#GQ409969), Sheeppox virus (NC_004002), Goatpo
  • HL or CR sequences used herein are disclosed as follows:
  • Sequence 1 of the Vaccinia virus terminal hairpin loop (HL, S-form, 104 nt in length, 5’ ® ⁇ 3’) (SEQ ID NO: 7): tagtaaaattaaattaat insectsaaatta insectstataatttactaactttagttagataaattaataatatataagttttagtacat taatattatattttaaat
  • Sequence 2 of the Vaccinia virus terminal hairpin loop (HL, F-form, 104 nt in length, 5’ ® ⁇ 3’) (SEQ ID NO: 8): atttaaaatataatattaatgtactaaaacttatatattattaatttatctaactaaagttagtaaattatatatataattttataat taatttaattttacta
  • Sequence 1 of the MVA concatemer resolution sequences OR, 20 bp in length, 5’ - 3’) (SEQ ID NO: 9, sense orientation), included at the left end of the hairpin duplex copy in the working example: tttttttctagacactaaat
  • Sequence 2 of the MVA concatemer resolution sequences (CR, 20 bp in length, 5’ - 3’) (SEQ ID NO: 10, antisense orientation), included at the right end of the hairpin duplex copy in the working example: atttagtgtctagaaaaaaaaaa
  • sMVA and rsMVA recombinants disclosed herein are generated based on chemical synthesis of three ⁇ 60 kbp long DNA fragments that encompass the entire -178 kbp of the MVA genome published by Antoine and colleagues (Accession# U94848) 26 . This includes the internal unique region (UR) and the flanking -9.6 kbp long inverted terminal repeat (ITR) regions as illustrated in Figure 1.
  • UR internal unique region
  • ITR inverted terminal repeat
  • MVA strain Antoine differs precisely in five base pairs in the internal UR from the MVA genome of the licensed and commercially available National Institute of Health clone 1 from 1974 (MVA NIH clone 1), which is identical in sequence to the published genome of MVA strain Acambis (Accession# AY603355).
  • sMVA fragment 1 encompasses the left ITR and -50 kbp of the left end of internal UR of the MVA genome; sMVA fragment 2 (F2) contains -60 kbp of the middle part of the internal UR of the MVA genome; and sMVA fragment 3 (F3) encompasses -50 kbp of the right end of the internal UR and the right ITR of the MVA genome ( Figure 1).
  • sMVA F1 and F2 as well as sMVA F2 and F3 are designed to share -3 kbp overlapping sequences to allow the reconstitution of the complete MVA genome by homologous recombination ( Figure 1).
  • a duplex copy of the 165-nucleotide long MVA terminal HL flanked by MVA CR sequences is added to both ends of each of the three fragments to promote MVA genome resolution and packaging 26 ( Figure 1).
  • Sfil and Fsel restriction sites are included at both ends of each of the three fragments in a way that the fragments can be released or linearized with or without the HL and CR sequences.
  • the sole exception is the HL and CR sequences at the ITR of F1 and F3 that are fused to the ends in identical arrangement as it occurs at the junctions of MVA concatemeric replication intermediates 26 ( Figure 1).
  • the three sMVA fragments with flanking HL and CR sequences as well as overlapping homologous recombination sequences as depicted in Figure 1 were synthesized and generated using a yeast-based recombination system by Genscript Biotech. All three sMVA fragments were cloned into a yeast shuttle vector, termed pCCI-Brick, which contains a bacterial mini-F replicon element that can be used as a BAC vector to stably propagate the three fragments at low copy number in bacteria ( Figure 1). The sMVA fragments were ultimately cloned into recombination defective DH10B or EPI300 E. coli cells.
  • a duplex copy of the HL with flanking CR sequences at both ends of each of the three MVA fragments is included - as opposed to only at the ends at the ITR of F1 and F3 where they occur naturally in concatemeric replication intermediates.
  • This design is based on the intrinsic functions that these sequence elements have during poxvirus DNA replication.
  • the terminal HL in packaged poxvirus genomes connects the two DNA strands at the genomic termini to a continuous polynucleotide chain, where they exist at both ends in inverted and complementary forms that are incompletely base-paired and AT- rich 26 29 .
  • Poxvirus HL sequences are important for the replication of the double- stranded DNA genomes into multimeric head-to-tail or head-to-head concatemeric replication intermediates, in which the HL sequences are present at the concatemeric junctions as precise duplex copies 30 32 .
  • the CR elements are comprised of a highly conserved poxvirus resolution sequence and can be found in packaged genomes at both ends of the large ITRs directly adjacent to the terminal l_ll_ 26,27,33,34 p 0 xvirus CR elements in concatemeric replication intermediates are present on either site of the HL duplex copies at the genomic junctions, and these CR/HL/CR sequence arrangements are essential for the resolution of unit-length genomes and subsequent genome packaging 33 36 .
  • circular plasmids containing poxvirus concatemeric junctions which are composed of an HL duplex copy flanked by CR elements, are transfected into poxvirus infected cells they are spontaneously resolved into linear minichromosomes with terminal HL 36 ⁇ 37 .
  • the circularized sMVA fragments when transfected into the host cell, can immediately replicate in the host cell in an origin independent manner. It was reported that any circular DNA molecule transfected into poxvirus infected cells is replicated in an origin independent manner, and this non-specific sequence replication is not enhanced by insertion of any viral DNA fragments 38 .
  • the circularized sMVA fragments when transfected into the host cell, can be replicated by a eukaryotic or viral origin of replication inserted into the vector or MVA sequences.
  • the disclosed construction technique of the synthetic poxvirus such as sMVA includes the HL and CR sequences such that transfection of circular plasmids or DNA molecules containing the three synthetic MVA fragments with flanking concatemeric genomic junctions (CR-HL-CR) and overlapping genome sequences into FPV-infected BHK or CEF cells will promote (1) the transcription and replication of the three sMVA fragments, (2) the resolution of the three sMVA fragments from the plasmid vector sequences, and (3) the recombination of the three sMVA fragments into full-length genomes, ultimately leading to the packaging of vector-free genomes with terminal HL into preformed virus particles ( Figures 1 and 2).
  • the reconstitution process of the sMVA from the three sMVA fragments may be initiated without FPV or other helper virus.
  • the reconstitution of sMVA may also be promoted by an approach based on linearized forms of the three sMVA fragments using for example the added Fsel and Sfil restriction sites as shown in Figures 1 and 2.
  • the ends of the fragments may or may not contain HL and CR sequences.
  • only a subset of the fragments may contain the HL and CR sequences, or they may be added to only one end or two ends of the fragments as single or double stranded DNA sequences in sense or antisense orientation, for example in a way that they are only present at the MVA partial sequences of F1 and F3 where they occur naturally in putative concatemeric replication intermediates.
  • not all F1 fragments contain the HL and CR sequences; rather, F1 fragments with or without the HL and CR sequences may be mixed in the construction process.
  • F1 fragments with or without the HL and CR sequences may be mixed in the construction process.
  • F2 or F3 fragments are required to contain the HL and CR sequences but a subset or a subpopulation of F2 or F3 fragments may contain the HL and CR sequences.
  • HL and/or CR sequences may also be chemically ligated as single or double stranded DNA sequences in linearized forms of the three fragments.
  • the sMVA virus reconstituted from the sMVA fragments may be modified by introducing insertions, deletions, or point mutations, or by insertion with one or more heterologous DNA sequences encoding one or more antigens, subunits or fragments thereof.
  • modifications or antigen sequences may be introduced into the sMVA DNA fragment by conventional transfection/infection methods using a transfer plasmid with homology flanks that mediate homologous recombination.
  • the one or more nucleotide sequences encoding the one or more antigens, subunits or fragments thereof may be codon optimized for eukaryotic or vaccinia expression.
  • the antigens, subunits or fragments thereof may be optimized for stability in transcription or expression in the host cell.
  • Various codon optimization techniques may be used, including but not limited to the alteration of four of the same nucleotides in a row (e.g. GGGG, CCCC, TTTT, AAAA) by introducing silent point mutations that do not lead to amino acid changes in the encoded protein, or the adaption of the codon usage to a specific host species.
  • the sMVA virus reconstituted from the sMVA fragments in a host cell may be used to generate an sMVA bacterial artificial chromosome (BAC) containing a full length sMVA genome.
  • the BAC vector sequences may be inserted into the sMVA genome by a transfer construct containing the BAC sequences with flanking homology sequences that mediate homologous recombination.
  • Circular replication intermediates with inserted BAC sequences may be isolated from host cells such as BHK or CEF cells and transferred by electroporation or chemical transformation into E. coli cells that allow stable propagation of large DNA constructs, such as DH10B or EPI300.
  • the sMVA BAC may be transferred into GS1783 E. coli cells and manipulated by Red-recombination techniques such as En passant mutagenesis.
  • the sMVA fragments may be used to reconstitute a complete or full-length sMVA genome by in vitro ligation methods or by other in vitro DNA assembly methods such as Gibson or Golden Gate assembly.
  • in vitro ligation methods or by other in vitro DNA assembly methods such as Gibson or Golden Gate assembly.
  • the technology disclosed herein has the flexibility of inserting various antigens, subunits or fragments thereof, or other heterologous DNA sequences into the one or more naturally derived or chemically synthesized DNA fragment(s) before transfection such that upon reconstitution, a synthetic poxvirus expressing the antigens, subunits or fragments thereof is obtained.
  • antigens, subunits or fragments thereof may be derived from or based on viruses such as cytomegalovirus (CMV), Epstein-Barr virus (EBV), Kaposi-Sarcoma-associated herpesviruses (KSHV), other herpesviruses, Zika virus, Lassa virus, Hepatitis C virus (HCV), Hepatitis (HBV), Coronaviruses (such as 2019-nCoV, SARS, MERS), Influenza, or any other viral, bacterial, or other forms of infectious pathogen.
  • the antigen sequences may also be derived from or based on cancer-associated proteins (e.g., p53, Retinoblastioma, neoantigens).
  • heterologous gene sequences may be inserted into the naturally derived or chemically synthesized poxvirus DNA fragment(s).
  • heterologous gene sequences include but are not limited to fluorescence markers, cDNA copies of RNAs such as RNAi, shRNA, LNCRNA, miRNA, etc., interferons, cytokines, antibodies or fragments thereof, or other proteins expressed in prokaryotic or eukaryotic cells.
  • the antigen sequences or heterologous gene sequences maybe inserted into the sMVA fragments with an upstream natural or synthetic poxvirus promoter (pSyn, P11 , H5, mH5, P28, ATI, pHyb, p7.5) and a downstream transcription termination signal (TTTTTAT), such that the antigen sequences or heterologous gene sequences are expressed when the poxvirus fragments are transfected into a host cell.
  • an upstream natural or synthetic poxvirus promoter pSyn, P11 , H5, mH5, P28, ATI, pHyb, p7.5
  • TTTTTAT downstream transcription termination signal
  • the DNA sequences of the antigens, subunits or fragments thereof, or other heterologous gene sequences can be inserted into one or more poxvirus insertion sites within the one or more DNA fragment(s).
  • sMVA the DNA sequence of one antigen or fragment thereof can be inserted in a single MVA insertion site located on one sMVA DNA fragment, e.g., sMVA F2, before transfection of the host cell ( Figure 3).
  • the DNA sequences of two or more antigens or fragments thereof can be inserted into a single MVA insertion site located on one DNA fragment, e.g., sMVA F2, before transfection of the host cell.
  • antigen DNA sequences may be under the control of a single promoter or two or more promoters. Likewise, the antigen DNA sequences may share the same transcription termination signal or have different transcription termination signals.
  • the nucleotide sequences encoding two or more antigens may also be linked by 2A sequences of picornaviruses (P2A, T2A, F2A, etc.) mediating ribosomal skipping or by internal ribosomal entry sites (IRES) such that the antigens are processed following translation and self-assembled to form a multi-component antigen complex.
  • P2A, T2A, F2A, etc. 2A sequences of picornaviruses
  • IVS internal ribosomal entry sites
  • one or more DNA sequences encoding one or more antigens, subunits or fragments thereof, or other heterologous DNA sequences are inserted in frame at the 5’ end, 3’ end, or any internal position of one or more essential or non-essential poxvirus open reading frames (ORFs) such that when the one or more naturally-derived or chemically synthesized poxvirus DNA fragments are transfected into the host cell, one or more fusion proteins composed of a poxvirus protein with one more antigens, subunits or fragments thereof, or other heterologous protein sequences added to the C-terminus, N-terminus, or any internal position of the poxvirus proteins are expressed.
  • ORFs essential or non-essential poxvirus open reading frames
  • the one or more DNA sequences encoding one or more antigens, subunits or fragments thereof, or other heterologous DNA sequences are linked to the one or more poxvirus ORFs by 2A encoding sequences of picornaviruses (P2A, F2A, T2A etc,) such that the expressed one or more fusion proteins composed of a poxvirus protein with one more antigens, subunits or fragments thereof, or other heterologous protein sequences added to the C-terminus, N-terminus, or any internal position of the poxvirus proteins are processed (“cleaved”) into the individual components at the 2A linker sequences by a ribosomal skipping mechanism.
  • 2A encoding sequences of picornaviruses P2A, F2A, T2A etc,
  • the one or more DNA sequences encoding one or more antigens, subunits or fragments thereof, or other heterologous DNA sequences are linked to one or more essential or non-essential poxvirus ORFs by internal ribosomal entry site sequences such that when the one or more naturally-derived or chemically synthesized poxvirus DNA fragments are transfected into the host cell, one or more poxvirus proteins and one more antigens, subunits or fragments thereof, or other heterologous protein sequences are simultaneously expressed through chimeric polycistronic expression constructs with multiple translation initiation sites at the 5’ end of each of the ORFs within the expression constructs.
  • the DNA sequences of two or more antigens, subunits or fragments thereof or other heterologous gene sequences may be inserted into two or more MVA insertion sites, which may be located on the same sMVA fragment or on different sMVA fragments.
  • the DNA sequences of two or more antigens, subunits or fragments thereof can be inserted in two different MVA insertion sites, both located on sMVA F1.
  • the DNA sequences of two or more antigens, subunits or fragments thereof can be inserted into two different MVA insertion sites, one located on sMVA F1 and the other located on sMVA F2 ( Figure 4).
  • DNA fragments may be inserted with the DNA sequence of the same antigen, subunits or fragments thereof.
  • different sMVA fragments may be inserted with the DNA sequences of different antigens, subunits or fragments thereof such that upon reconstitution after transfection, the different antigens, subunits or fragments thereof expressed by the synthetic MVA are self-processed and self-assembled into a viral particle, a viral complex, or a complete antigen comprising the subunits or fragments thereof.
  • insertion sites may include commonly used insertion sites such as the MVA deletion 2 (Del2) site, the intergenic region (IGR) between open reading frame (ORF) 44L and 45L (IGR44/45), the IGR between ORF 69R and 70L (IGR69/70), the IGR between 64L and 65L (IGR64/65), the Thymidine Kinase (TK) gene insertion site, or the MVA Deletion 3 (Del3) site ( Figure 1), or any other MVA deletion site, intergenic region, or gene insertion site (ORF numbers are based on MVA strain Antoine (Accession# U94848)).
  • the modified sMVA fragments can be then isolated from E. coli and co-transf erred as circular or linearized DNA molecules by various transfection methods into BHK or CEF cells infected with a helper virus to initiate the reconstitution of rsMVA with single, double, or multiple antigen insertions or genome alterations ( Figures 3 and 4).
  • the rsMVA reconstitution can be initiated without the addition of a helper virus.
  • the three sMVA fragments may also be used to generate sMVA with single or multiple antigen insertion or genome alterations by in vitro ligation methods.
  • one or more antigens, subunits or fragments thereof can be inserted into one or more MVA insertion sites of the sMVA fragments.
  • only one sMVA fragment is inserted with one or more antigens or fragments thereof ( Figure 3).
  • two or more sMVA fragments are inserted with one or more antigens or fragments thereof ( Figure 4).
  • all sMVA fragments are inserted with one or more antigens, subunits or fragments thereof ( Figure 4).
  • the antigens, subunits or fragments thereof may be the same or different for different sMVA fragments.
  • sMVA F1 may be inserted with one type of antigen or fragment thereof
  • sMVA F2 may be inserted with a different type of antigen or fragment thereof.
  • sMVA F1 and F2 may be inserted with the same type of antigen or fragment thereof
  • sMVA F3 may be inserted with the same type of antigen or fragment thereof or with a different type of antigen, subunit or fragment thereof.
  • the poxvirus vectors produced by the technology disclosed herein may be used, for example, to generate multi-antigenic vaccine vectors to stimulate polyfunctional humoral and cellular immune response against various conditions such as viral infections and cancer.
  • the disclosed technology based on the three sMVA fragments F1-F3 may be used to generate multi-antigenic rsMVA vaccine vectors to stimulate polyfunctional humoral and cellular immune response against human cytomegalovirus (HCMV).
  • HCMV human cytomegalovirus
  • This may include immunodominant antigen sequences based on the five subunits of the HCMV pentamer complex (PC), glycoprotein B (gB), phosphoprotein 65 (pp65), and the immediate-early 1 and 2 proteins (IE1 and IE2).
  • the antigen sequences may be inserted separately or combined as 2A-linked polycistronic expression constructs into the sMVA fragments at different commonly used MVA insertion sites (Del2, Del3, IGR44/45, IGR69/70, IGR64/65) to generate rsMVA vaccine vectors expressing 5, 6, 7, 8, or 9 HCMV antigens, as illustrated in Figure 6 and Figure 10.
  • rsMVA vectors expressing only single HCMV antigens or any other number or combination of the above-mentioned nine HCMV antigens may also be generated. All antigen sequences or expression constructs may be inserted together with an upstream mH5 promoter and downstream transcription termination signal. These vectors may be used to stimulate immune responses against HCMV in animal models or humans.
  • an MVA expression system is provided herein.
  • the expression system may express one or more desired antigens, subunits or fragments thereof or other heterologous protein sequences.
  • one or more sMVA fragments may be inserted with the DNA sequences encoding one or more antigens, subunits or fragments thereof such that the reconstituted sMVA simultaneously expresses the antigens, subunits and fragments thereof.
  • the antigen DNA sequences inserted into the sMVA fragments may be based on the natural DNA sequence or from chemical synthesis. In other embodiments, the antigen DNA sequences may be optimized for expression and stability within the expression system.
  • the sMVA described herein may be part of a vaccine composition that may be used in methods to treat or prevent viral infection or to treat cancer, depending on the antigens expressed by the sMVA.
  • the vaccine composition as described herein may comprise a therapeutically effective amount of the sMVA as described herein, and further comprising a pharmaceutically acceptable carrier according to a standard method. Examples of acceptable carriers include physiologically acceptable solutions, such as sterile saline and sterile buffered saline.
  • the vaccine or pharmaceutical composition may be used in combination with a pharmaceutically effective amount of an adjuvant to enhance the prophylactic or therapeutic effects.
  • any immunologic adjuvant that may stimulate the immune system and increase the response to a vaccine, without having any specific antigenic effect itself may be used as the adjuvant.
  • Many immunologic adjuvants mimic evolutionarily conserved molecules known as pathogen-associated molecular patterns (PAMPs) and are recognized by a set of immune receptors known as Toll-like Receptors (TLRs).
  • PAMPs pathogen-associated molecular patterns
  • TLRs Toll-like Receptors
  • adjuvants examples include Freund's complete adjuvant, Freund's incomplete adjuvant, double stranded RNA (a TLR3 ligand), LPS, LPS analogs such as monophosphoryl lipid A (MPL) (a TLR4 ligand), flagellin (a TLR5 ligand), lipoproteins, lipopeptides, single stranded RNA, single stranded DNA, imidazoquinolin analogs (TLR7 and TLR8 ligands), CpG DNA (a TLR9 ligand), Ribi’s adjuvant (monophosphoryl-lipid A/trehalose dicorynoycolate), glycolipids (a-GalCer analogs), unmethylated CpG islands, oil emulsion, liposomes, virosomes, saponins (active fractions of saponin such as QS21), muramyl dipeptide, alum, aluminum hydroxide,
  • MPL monophosphoryl lipid A
  • the amount of adjuvant used can be suitably selected according to the degree of symptoms, such as softening of the skin, pain, erythema, fever, headache, and muscular pain, which might be expressed as part of the immune response in humans or animals after the administration of this type of vaccine.
  • use of various other adjuvants, drugs or additives with the vaccine of the invention may enhance the therapeutic effect achieved by the administration of the vaccine or pharmaceutical composition.
  • the pharmaceutically acceptable carrier may contain a trace amount of additives, such as substances that enhance the isotonicity and chemical stability.
  • Such additives should be non-toxic to a human or other mammalian subject in the dosage and concentration used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids, and salts thereof; antioxidants such as ascorbic acid; low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptide) proteins (e.g., serum albumin, gelatin, and immunoglobulin); amino acids (e.g., glycine, glutamic acid, aspartic acid, and arginine); monosaccharides, disaccharides, and other carbohydrates (e.g., cellulose and derivatives thereof, glucose, mannose, and dextrin), chelating agents (e.g., EDTA); sugar alcohols (e.g., mannitol and sorbitol); counterions (e.g., sodium); nonionic surfactants (e.g., poly
  • the vaccine or pharmaceutical composition containing the sMVA described herein may be stored as an aqueous solution or a lyophilized product in a unit or multiple dose container such as a sealed ampoule or a vial.
  • the poxvirus reconstituted from the one or more naturally derived or chemically synthesized DNA fragment(s), with or without the inserted antigens, subunits or fragments thereof, or other heterologous sequences may be used as a vaccine composition for preventing or treating various viral infections or cancer.
  • a particular viral or cancer antigen for the conditions or diseases to be prevented or treated This may include but is not limited to any infectious disease or cancer antigen that is capable of eliciting an immune response, such as viral envelope glycoproteins or glycoprotein complexes, immunodominant T cell antigens, or mutated cancer neoantigens.
  • antigen sequences or portions thereof maybe derived from or based on viruses such as CMV, EBV, KSHV, other herpesviruses, Zika virus, Lassa virus, HCV, HBV, Coronaviruses, Influenza, or any other viral, bacterial, or other forms of infectious pathogen.
  • viruses such as CMV, EBV, KSHV, other herpesviruses, Zika virus, Lassa virus, HCV, HBV, Coronaviruses, Influenza, or any other viral, bacterial, or other forms of infectious pathogen.
  • the BHK cells were infected with a helper FPV at 0.1 multiplicity of infection (MOI) to initiate MVA transcription and DNA replication.
  • MOI multiplicity of infection
  • FPV-infected BHK cells transfected with only one or a combination of only two of the MVA fragments, mock-infected (uninfected) BHK cells transfected with all three MVA fragments, and mock-transfected BHK cells infected with FPV were used as controls.
  • Transfected/infected BHK cells were grown under appropriate conditions and every 2 days dispersed (passaged) in ⁇ 1 :2 to 1 :3 ratios into larger tissue culture formats using a procedure as illustrated in Figure 5.
  • Cytopathic effects (CPE) and signs of viral plaque formation and progression demonstrating reconstitution of sMVA were detected in FPV-infected BHK cell monolayers transfected with all three synthetic MVA fragments at 3-6 days post transfection/infection (dpt/i). At 7 to 8 dpt/i following dispersion of the FPV-infected BHK cells transfected with all three MVA fragments, the derived BHK cell monolayers showed 90-100% infection. In contrast, CPE or signs of characteristic MVA viral plaque formation were not observed in any of the controls.
  • sMVA was prepared from BHK cell monolayers with 100% CPE by conventional freeze/thaw method, titrated on BHK cells, and used to infect BHK cell monolayers at low MOI to evaluate MVA infection and spreading at 16-72 hpi by immunostaining for the vaccinia virus glycoprotein B5R 16 ⁇ 42 .
  • FPV used as a helper virus, contributes no genetic material or recombines with the MVA genome when introduced into the transfection/infection incubation on BHK or CEF cells 43 ⁇ 44 .
  • PCR products derived from the ITR sequences located within sMVA F1 and F3 ( Figure 7A); (2) PCR products corresponding to sMVA F1 -derived DNA such as the transition of the left ITR into the left end of the internal UR ( Figure 7B), and the Del2 insertion site ( Figure 7C); (3) PCR products corresponding to sMVA F2-derived DNA such as the G1 L/I8R insertion site (IGR69/70) ( Figure 7D); and PCR products corresponding to sMVA F3-derived DNA such as the Del3 insertion site ( Figure 7E), the transition of the right end of the internal UR into the right ITR ( Figure 7F).
  • any of the sequences of the sMVA fragments F1 , F2, and F3 may contain one or more alterations or variations.
  • the sequence of sMVA fragment F1 (deposited at NCBI under Accession No. MW023923, www.ncbi.nlm.nih.gov/nuccore/MW023923.1/) contains 1 nucleotide alteration in a non-coding determining region downstream of open reading frame 021 (SEQ ID NO: 12): [0072] ggcctagcaggccggccctttttttctagacactaaataaatagtaagattaaattaattataaaattatgtgatttactaactttagttagataaattaataatacataaattttagtatattaat attataaattaataatacataaattttagtatattaat at insectsaattaataatacataaattttagtatattaatatattatattttttagttag attata
  • sequence of sMVA F3 may contain 1 nucleotide alteration in a non-coding determining region at 88 bp close to the end of the ITR sequence (deposited with NCBI under Accession No. MW030459, www.ncbi.nlm.nih.gov/nuccore/MW030459.1/) (SEQ ID NO: 15): ggcctagcaggcctttttttctagacactaaataaatagtaagattaaattaattataaaattatgtatataatattaattata aaattatgtatatgatttactaactttagttagataaattaatacataaattttagtatattaatattataaattaataatac ataaattttagtatattaatattaatattaatatattaatattaatatattaataatac ataaattttagtatattaatattaatattaatattaatattaatattaatattaatattaatattaataatac ataaattttag
  • sVAC synthetic Vaccinia virus
  • Example 2 Generation of recombinant sMVA expressing a single heterologous gene sequence
  • En passant mutagenesis was used to insert an expression cassette composed of a red fluorescent protein (RFP) marker with upstream mH5 promoter and downstream TTTTTAT vaccinia virus transcription termination signal into the IGR69/70 (also known as G1 L/I8R) insertion site within sMVA fragment F2 ( Figure 3), resulting in F2-RFP.
  • RFP red fluorescent protein
  • IGR69/70 also known as G1 L/I8R
  • Sequence integrity of the manipulated sMVA fragments was determined by restriction fragment length polymorphism (RFLP) analysis as well as PCR and Sanger sequencing analysis of the gene insertion sites.
  • the modified sMVA fragment F2 with inserted RFP marker as well as unmodified sMVA fragments F1 and F3 were isolated from E. coli and co-transfected into BHK cells to evaluate the reconstitution of rsMVA in the presence of FPV as a helper virus using the procedure as illustrated in Figure 5.
  • immunofluorescence imaging revealed the formation and progression of red fluorescent viral plaques at 3-6 dpt/i in BHK cell monolayers transfected with the F1/F2-RFP/F3 plasmid combination, while at 7 dpt/i RFP expression was visible in the entire BHK cell monolayer. In contrast, no RFP expression was visible in mock-transfected/infected BHK cell monolayers.
  • Example 3 Generation of recombinant sMVA expressing two heterologous gene sequences
  • the resulting modified sMVA fragment F1 with inserted GFP marker (F1- GFP) was then tested in different combinations with the fluorescence tagged forms of F2 and F3 (F2-RFP and F3-BFP) as well as unmodified sMVA fragments of F1 , F2, and F3 to evaluate the single, double, or triple fluorescent sMVA expression vectors using the procedure shown in Figure 5.
  • the fragment combinations used for co-transfection included F1-GFP/F2-RFP/F3-BFP, F1-GFP/F2-RFP/F3, F1- GFP/F2/F3-BFP, F1/F2-RFP/F3-BFP, F1-GFP/F2/F3, F1/F2-RFP/F3, and F1/F2/F3- BFP.
  • Co-transfection of the three non-modified sMVA fragments (F1/F2/F3) into FPV-infected BHK cells was evaluated as a negative control. With the exception of the negative control, fluorescent gene expression was observed by immunofluorescence imaging at 3-6 dpt/i in BHK cell monolayers transfected with any of the different fragment combinations.
  • fluorescence marker expression was observed in most cells of the BHK monolayers, indicating the reconstitution of fluorescent recombinant sMVA expression vectors.
  • the recombinant sMVA expression vectors were prepared by freeze/thaw technique, titrated on BHK cells, and used to infect BHK cell monolayers at low MOI.
  • the infected BHK cell monolayers were evaluated by IF imaging to confirm the formation and reconstitution of sMVA expressing different fluorescent marker sequences.
  • Example 5 Construction and evaluation of an example of an infectious disease antigen modified MVA
  • rsMVA expressing the five-member HCMV envelope pentamer complex (PC) composed of gH, gl_, UL128, UL130, and UL131A is evaluated.
  • Antigen expression cassettes composed of 2A-linked gH/gL and UL128/UL130/UL131A subunits are separately inserted into the IGR69/70 located in sMVA F2 and the Del3 site located sMVA F3 using En Passant mutagenesis in E. coli.
  • the modified sMVA fragments of F2 and F3 are transfected together with the unmodified sMVA fragment of F1 into FPV-infected BHK cells to reconstitute sMVA expressing all five PC subunits (rsMVA-PC).
  • rsMVA-PC PC subunits
  • rsMVA expressing only the gH/gL or UL128/130/131 A subunits is generated as well as sMVA without any inserted antigen sequences.
  • Example 6 Construction and evaluation of 2019-nCoV expressed from sMVA
  • the resulting modified fragment of sMVA F3 is then co-transfected with the unmodified versions of sMVA fragment F1 and F2 into BHK cells to initiate the reconstitution of sMVA expressing the new coronavirus S protein (sMVA-2019-nCoV-S), the S1 domain (sMVA-2019-nCoV-S1), or the RBD domain (sMVA-2019-nCoV-RBD) using the procedure as illustrated in Figure 5.
  • the expression of the S protein, S1 domain, or the RBD domain from the sMVA recombinants is confirmed by Immunoblot and flow cytometry analysis. Convalescent serum from infected humans, mice or rabbits is used as a detection reagent for the immunoblots.
  • tags such as HA are covalently attached at the carboxyl terminus, and antibodies against them are used as detection reagents for either immunoblots or flow cytometry.
  • additional immunogenic proteins e.g. N or M antigens from 2019-nCoV are inserted into unique gene insertion regions of sMVA to develop multi-antigen vaccines.
  • these 2019-nCoV antigens are inserted in one or more insertion sites such as Del3 site of sMVA fragment F3 and IGR69/70 of sMVA fragment F2.
  • mice Given the more severe symptoms observed in elderly individuals, 12 months old Balb/c mice are immunized two times by subcutaneous and intramuscular routes in four-week intervals with 1x10 7 -1x10 8 of sMVA plaque forming units (Pfu); and (2) Considering the potential involvement of human angiotensin-converting enzyme-2 (hACE-2) in nCoV entry into lung cells, transgenic mice expressing the human hACE2 receptor are used to test vaccine efficacy.
  • hACE-2 human angiotensin-converting enzyme-2
  • mice transgenic for angiotensin converting enzyme 2 are immunized two times by subcutaneous and intramuscular routes in four-week intervals with 1x10 7 -1x10 8 of sMVA plaque forming units (Pfu).
  • Neutralizing antibody responses and T cell responses specific for the 2019-nCoV-S protein and derivatives are measured as previously described at 1 week after each immunization.
  • mice are infected with 7 c 10 4 50% tissue culture infective doses (TICD50) of 2019-nCoV that is homologous to the vaccine antigens, and heterologous strains (SARS-CoV and MERS-CoV) and 4 days post challenge, the animals are sacrificed, and their lungs are harvested for measurement of viral loads and for histopathological analysis. Large virus loads, on average, >11 ,000 to >20,000 2019-nCoV genome equivalents/ng of total RNA, are found in both mock-immunized and nonrecombinant MVA-immunized control groups and in animals challenged with heterologous CoV strains.
  • TCD50 tissue culture infective doses
  • SARS-CoV and MERS-CoV heterologous strains
  • the lung tissue of protein (sMVA-nCoV-S) or the S1 domain (sMVA-nCoV-S1) subjects contains significantly lower levels of 2019-nCoV RNA (viral load), indicating efficient inhibition of 2019-nCoV replication by the vaccine-induced immune responses.
  • All placebo control animals (MVA-GFP) succumbed 4 to 8 days postinfection, while MVA-S, MVA-N and MVA-N/S show no or minimal signs of disease, including minimal weight loss. MVA-N/S immunized mice are completely protected.
  • Histopathology is focused on lung damage that is substantially reduced in the 2019-nCoV subunit antigen immunized animals.
  • the potential for antibody- enhancement of disease is also evaluated and found to be absent in these subunit vaccine models.
  • NAb responses to S protein antigens and their S1 and RBD derivatives are assessed using a pseudotyping strategy for nCoV that is robust for recognition by antigen-specific NAb, but the use of pathogenic strains of CoV is avoided.
  • the serum from animals immunized with S proteins and derivatives develops high titer and neutralizing antibodies against homologous 2019-nCoV strains and not heterologous CoV strains such as the etiologic agents for MERS and SARS.
  • IC90 neutralizing titers are calculated for each mouse serum sample. Based on the success of the vaccine studies in transgenic ACE2 Balb/c mouse strains, progressively larger animal species are investigated, i.e. rabbits, ferrets, and rhesus macaques which have susceptibility to 2019-nCoV challenge and are known to respond to MVA-based vaccines.
  • Example 7 Construction and evaluation of an example of a cancer antigen modified sMVA
  • This example demonstrates insertion of a mouse p53 gene that has been previously used in studies with MVA backbones obtained from the ATCC or the NIAID 46 .
  • the mouse p53 cDNA is inserted into the deletion (DEL3) locus using enpulsion such that no additional nucleotide additions or subtractions are made in the exact insertion site of the locus.
  • the insertion is verified by sequence analysis to be accurately made and all pertinent regions are intact and 100% sequence verifiable.
  • Subsequent to the modification of plasmid F3, all three plasmids are combined into a single aliquot and using the identical method as described in Example 2, a modified version of sMVA is generated, and live virus is obtained two days after the transfection/infection with FPV.
  • the live virus is concentrated and expanded on BHK cells and stocks are made, and are sequence verified using the Sanger method to establish that the virus has the correct sequence of the p53 gene insertion in the DEL3 locus. Furthermore, virus stocks are made and are frozen and put into long term storage, while at the same time, working stocks are prepared using the published methods to expand modified sMVA stocks to titers in > 1x10 9 pfu/mL. The verification of the expanded stock is conducted using a combination of qPCR, Sanger sequencing, infectious titer, and Western blot analysis.
  • mice Female 6-8-week old BALB/C mice are obtained from the Jackson Laboratory (Bar Harbor, ME) and maintained in a specific pathogen-free environment. All studies are approved by the Research Animal Care Committee of City of Hope National Medical Center and performed under the American Association for the Accreditation of Laboratory Animal Care guidelines. Meth A sarcoma cells (Meth A) are a kind gift of Dr. LJ Old, Memorial Sloan-Kettering Cancer Center (New York, NY). Meth A is passaged as an ascitic tumor.
  • Anti- CTLA-4 (9H10) is a gift of Dr. James Allison, MD Anderson Cancer Center (Houston, TX). Antibodies are produced using the CELLine device (BD Biosciences, Mountain View, CA).
  • IgG antibodies are purified by absorption over protein G-sepharose (Amersham Biosciences, Uppsala, Sweden) followed by elution with 0.1 M glycine- HCL (pH 2.7). The product is dialyzed against phosphate-buffered normal saline and concentrated using a Sentry Plus centrifugal filter device (Millipore, Bedford, MA). Control Syrian hamster IgG is obtained from Jackson ImmunoResearch (West Grove, PA). The rsMVA titer is determined by immunostaining infected cultures using the VECTASTAIN Elite ABC Kit (Vector Laboratories, Burlingame, CA).
  • Antigen-specific detection of the mouse p53 protein expressed from sMVA uses the anti-p53 antibody, pab122, followed by incubation with a peroxidase-labeled goat anti-mouse secondary antibody provided in the kit.
  • a control sMVA expressing CMV-pp65 is also constructed using the same technique as is used in constructing murine sMVAp53.
  • mice Six-week-old female BALB/C mice are injected by subcutaneous route in the left flank with 5x10 5 METH A cells. On day three, the mice are treated with 5x10 7 pfu of sMVAp53 by intraperitoneal injection. Negative control mice are injected with 5x10 7 pfu of sMVApp65 or phosphate buffered saline. An additional positive control utilizes the identical murine MVAp53 described in the original report. The subcutaneous tumors are evaluated by IVIS imaging methods weekly using a luciferase technique or by calipers if no luciferase gene is inserted into the METH A sarcoma cells.
  • mice are injected intraperitoneally with 5x10 7 pfu of sMVAp53. Controls are the same as described above.
  • Anti-CTLA-4 (9H10) antibody or control hamster antibody are injected intraperitoneally on day six, nine, and twelve post tumor injection at doses of 100, 50, and 50 micrograms, respectively.
  • Example 8 Construction and in vitro and in vivo characterization of sMVA
  • the three sMVA fragments designed as shown in Figure 1 when co transfected as circular DNA plasmids into helper virus infected cells, can resolve into linear minichromosomes, recombine with each other via the shared homologous sequences, and are ultimately packaged as full-length MVA genomes. All three sMVA fragments were cloned in E. coli as bacterial artificial chromosome (BAC) clones.
  • BAC bacterial artificial chromosome
  • sMVA virus was reconstituted with Fowl pox (FPV) as a helper virus upon co-transfection of the three DNA plasmids into BHK cells ( Figure 2), which are non-permissive for FPV.
  • FPV Fowl pox
  • Two different FPV strains HP1.441 and TROVAC were used to promote sMVA virus reconstitution ( Figure 12A).
  • Ultra-purified sMVA virus was produced following virus propagation in CEF, which are commonly used for MVA vaccine production.
  • the virus titers achieved with reconstituted sMVA virus were similar to virus titers achieved with wild-type MVA (wtMVA) (Table 1 below).
  • MVA-specific T cell responses determined after the booster immunization by ex vivo antigen stimulation using immunodominant peptides 47 revealed similar MVA-specific T cell levels in mice receiving sMVA or wtMVA ( Figures 13C-13D and 14C-14D). These results indicate that the sMVA virus has a similar capacity to wtMVA in inducing MVA-specific humoral and cellular immunity in mice.
  • Vaccine 31 , 4223- 4230 doi: 10.1016/j. vaccine.2013.05.091 (2013).
  • Vaccine 31 , 4247-4251 doi: 10.1016/j.vaccine.2013.03.021 (2013).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2021/016247 2020-02-03 2021-02-02 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof Ceased WO2021158565A2 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
AU2021217073A AU2021217073A1 (en) 2020-02-03 2021-02-02 Poxvirus-based vectors produced by natural or synthetic DNA and uses thereof
BR112022014738A BR112022014738A2 (pt) 2020-02-03 2021-02-02 Vetores à base de poxvírus produzidos por dna natural ou sintético e usos dos mesmos
CA3168836A CA3168836A1 (en) 2020-02-03 2021-02-02 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof
MX2022009200A MX2022009200A (es) 2020-02-03 2021-02-02 Vectores a base de poxvirus producidos por acido desoxirribonucleico (adn) natural o sintetico y usos de los mismos.
CN202180025623.2A CN115397998A (zh) 2020-02-03 2021-02-02 由天然或合成dna产生的基于痘病毒的载体及其用途
EP21750239.2A EP4100514A4 (en) 2020-02-03 2021-02-02 POXVIRUS-BASED VECTORS PRODUCED BY NATURAL OR SYNTHETIC DNA AND THEIR USES
JP2022547055A JP2023512294A (ja) 2020-02-03 2021-02-02 天然dnaまたは合成dnaによって作製されたポックスウイルスベースのベクターおよびその使用法
KR1020227030182A KR20220148823A (ko) 2020-02-03 2021-02-02 천연 또는 합성 dna에 의해 생산된 폭스바이러스-기반 벡터 및 그의 용도
US17/759,254 US20230097513A1 (en) 2020-02-03 2021-02-02 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof
IL294926A IL294926A (en) 2020-02-03 2021-02-02 Foxvirus-based vectors produced by natural or artificial DNA and their uses
US19/076,904 US20250215456A1 (en) 2020-02-03 2025-03-11 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof
AU2025287330A AU2025287330A1 (en) 2020-02-03 2025-12-24 Poxvirus-based vectors produced by natural or synthetic DNA and uses thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202062969628P 2020-02-03 2020-02-03
US62/969,628 2020-02-03
US202063113803P 2020-11-13 2020-11-13
US63/113,803 2020-11-13

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US17/759,254 A-371-Of-International US20230097513A1 (en) 2020-02-03 2021-02-02 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof
US19/076,904 Continuation US20250215456A1 (en) 2020-02-03 2025-03-11 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof

Publications (2)

Publication Number Publication Date
WO2021158565A2 true WO2021158565A2 (en) 2021-08-12
WO2021158565A3 WO2021158565A3 (en) 2021-09-16

Family

ID=77200801

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/016247 Ceased WO2021158565A2 (en) 2020-02-03 2021-02-02 Poxvirus-based vectors produced by natural or synthetic dna and uses thereof

Country Status (10)

Country Link
EP (1) EP4100514A4 (cg-RX-API-DMAC7.html)
JP (1) JP2023512294A (cg-RX-API-DMAC7.html)
KR (1) KR20220148823A (cg-RX-API-DMAC7.html)
CN (1) CN115397998A (cg-RX-API-DMAC7.html)
AU (2) AU2021217073A1 (cg-RX-API-DMAC7.html)
BR (1) BR112022014738A2 (cg-RX-API-DMAC7.html)
CA (1) CA3168836A1 (cg-RX-API-DMAC7.html)
IL (1) IL294926A (cg-RX-API-DMAC7.html)
MX (1) MX2022009200A (cg-RX-API-DMAC7.html)
WO (1) WO2021158565A2 (cg-RX-API-DMAC7.html)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022169895A1 (en) 2021-02-02 2022-08-11 Geovax, Inc. Viral constructs for use in enhancing t-cell priming during vaccination
CN115433741A (zh) * 2022-06-23 2022-12-06 广西大学 盖他病毒为载体表达报告蛋白的重组病毒的构建方法
CN119506355A (zh) * 2025-01-15 2025-02-25 中国人民解放军军事科学院军事医学研究院 一种用于重组痘病毒包装的载体系统及其应用
WO2025092883A1 (zh) * 2023-11-01 2025-05-08 上海市重大传染病和生物安全研究院 骨架质粒、重组质粒以及猴痘病毒颗粒和应用
US12577589B2 (en) 2020-02-14 2026-03-17 Geovax, Inc. Vaccines and uses thereof to induce an immune response to SARS-CoV2
US12584146B2 (en) 2020-05-17 2026-03-24 City Of Hope Synthetic modified vaccinia Ankara (SMVA) based coronavirus vaccines

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3788142A4 (en) * 2018-05-02 2022-04-27 Tonix Pharma Holdings Limited SYNTHETIC CHIMERIC VACCINE VIRUS

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12577589B2 (en) 2020-02-14 2026-03-17 Geovax, Inc. Vaccines and uses thereof to induce an immune response to SARS-CoV2
US12584146B2 (en) 2020-05-17 2026-03-24 City Of Hope Synthetic modified vaccinia Ankara (SMVA) based coronavirus vaccines
WO2022169895A1 (en) 2021-02-02 2022-08-11 Geovax, Inc. Viral constructs for use in enhancing t-cell priming during vaccination
CN115433741A (zh) * 2022-06-23 2022-12-06 广西大学 盖他病毒为载体表达报告蛋白的重组病毒的构建方法
WO2025092883A1 (zh) * 2023-11-01 2025-05-08 上海市重大传染病和生物安全研究院 骨架质粒、重组质粒以及猴痘病毒颗粒和应用
CN119506355A (zh) * 2025-01-15 2025-02-25 中国人民解放军军事科学院军事医学研究院 一种用于重组痘病毒包装的载体系统及其应用

Also Published As

Publication number Publication date
KR20220148823A (ko) 2022-11-07
IL294926A (en) 2022-09-01
WO2021158565A3 (en) 2021-09-16
BR112022014738A2 (pt) 2022-10-11
EP4100514A4 (en) 2024-06-12
AU2021217073A1 (en) 2022-08-18
CN115397998A (zh) 2022-11-25
JP2023512294A (ja) 2023-03-24
MX2022009200A (es) 2023-01-04
AU2025287330A1 (en) 2026-01-22
CA3168836A1 (en) 2021-08-12
EP4100514A2 (en) 2022-12-14

Similar Documents

Publication Publication Date Title
AU2025287330A1 (en) Poxvirus-based vectors produced by natural or synthetic DNA and uses thereof
JP6706656B2 (ja) Ul128複合体の送達及びcmv感染の予防のためのmvaワクチン
US7338662B2 (en) Recombinant poxvirus expressing homologous genes inserted into the foxviral genome
ES2256323T5 (es) Variante del virus Vaccinia Ankara Modificado
CN102341120B (zh) 结合重复免疫的优化早晚期启动子辅助对复制缺陷型重组病毒疫苗抗原的细胞毒t细胞应答
US12584146B2 (en) Synthetic modified vaccinia Ankara (SMVA) based coronavirus vaccines
US11844833B2 (en) Expression system for expressing herpesvirus glycoprotein complexes
US20250215456A1 (en) Poxvirus-based vectors produced by natural or synthetic dna and uses thereof
TW202413636A (zh) 嵌合痘病毒
Gao et al. Design and construction of a fast synthetic modified vaccinia virus Ankara reverse genetics system for advancing vaccine development
Smith Vaccinia Virus as a Carrier of Vaccine Antigens
Hall Promoter and leader sequence effects on immunological potency of recombinant modified vaccinia virus Ankara delivering tuberculosis antigens
HK1156979A (en) Recombinant poxvirus expressing homologous genes inserted into the poxviral genome
HK1076642B (en) Recombinant poxvirus expressing homologous genes inserted into the poxviral genome
HK1170772A (en) Recombinant poxvirus expressing homologous genes inserted into the poxviral genome
HK1171249A (en) Recombinant poxvirus expressing homologous genes inserted into the poxviral genome
HK1144700A (en) Recombinant poxvirus expressing homologous genes inserted into the poxviral genome
HK1161677B (en) Optimized early-late promoter combined with repeated vaccination favors cytotoxic t cell response against antigens in replication deficient recombinant virus vaccines

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21750239

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 3168836

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022547055

Country of ref document: JP

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022014738

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2021217073

Country of ref document: AU

Date of ref document: 20210202

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21750239

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2021750239

Country of ref document: EP

Effective date: 20220905

ENP Entry into the national phase

Ref document number: 112022014738

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220726