WO2021114029A1 - Method for increasing yield of metabolic products of saccharomyces cerevisiae - Google Patents

Abstract

Provided is a GAL gene regulation and control system. In the GAL gene regulation and control system, pCTR3 or pCTR1 is operably linked to the GAL80 gene; and pCUP1 is operably linked to the GAL4 gene. Also provided are a Saccharomyces cerevisiae comprising the GAL gene regulation and control system and a method for increasing the yield of metabolic products of the Saccharomyces cerevisiae.

Description

Methods to increase the yield of Saccharomyces cerevisiae metabolite Technical field

The present invention relates to the field of biotechnology. Specifically, the present invention relates to a GAL gene regulation system, Saccharomyces cerevisiae and a method for improving the yield of Saccharomyces cerevisiae metabolites.

Background technique

Saccharomyces cerevisiae is a generally recognized as safe microorganism (GRAS). Humans have relatively clear research on its physiological, biochemical and genetic background, and its genetic manipulation is relatively simple. Therefore, in recent years, synthetic biology and It plays a pivotal role in metabolic engineering research. In addition to fermenting ethanol and making beer, Saccharomyces cerevisiae has become a commonly used host for the synthesis of high value-added natural products.

In most studies, the expression of foreign genes in Saccharomyces cerevisiae uses strong constitutive promoters, such as the commonly used pTEF1 promoter, pHXT7 promoter, pTDH3 promoter, and pPGK1 promoter. The disadvantage of using a constitutive promoter is that its expression intensity cannot be controlled. Too many genes are constitutively expressed strongly or prematurely expressed, which will cause metabolic burden on the host, affect cell growth, and ultimately affect the total yield of the target product. Therefore, the use of inducible promoters for the expression of foreign genes is a common way to maximize cell productivity.

At present, the most commonly used induction expression system in Saccharomyces cerevisiae is the Saccharomyces cerevisiae galactose induction system (GAL induction system). In this system, the transcriptional activation initiated by pGAL1, pGAL7, pGAL10, and pGAL2 is regulated by the positive activation of the GAL4 transcription factor, the activity of the GAL4 transcription factor is inhibited by the GAL80 negative regulatory protein, and the activity of the GAL80 protein is regulated by the galactose in the medium When galactose is present in the cell growth environment, galactose can competitively bind to the GAL80 protein to release the GAL4 transcription factor, and GAL4 further activates the transcription of the pGAL1, pGAL7, pGAL10, and pGAL2 promoters in the system. Therefore, in the GAL regulatory system, galactose is the activator of the GAL promoter. However, because galactose can be used by cells, the induction capacity will decrease as it is used; and galactose is expensive, so the galactose induction method is not suitable for industrial applications due to the high cost.

In order to avoid the use of glucose, some studies have knocked out the GAL80 transcription factor, so that the induction of the GAL promoter does not require galactose, but is inhibited by high glucose and low glucose expression. This strategy solves the problem of excessively high cost of the system in industrial application to a certain extent. However, glucose is a commonly used carbon source in the process of fed-feed fermentation, and the instability of the process flow will cause large fluctuations in the expression of genes controlled by the GAL promoter, and does not take advantage of the stability of batches during large-scale production .

Therefore, in the field of synthetic biology, the development of a simple and highly sensitive method for controlling the expression of exogenous genes to control the production of high value-added products by Saccharomyces cerevisiae is the direction that researchers in this field have been working hard on.

Summary of the invention

The present invention aims to solve one of the technical problems in the related art at least to a certain extent.

In the first aspect of the present invention, the present invention proposes a GAL gene regulation system. According to an embodiment of the present invention, in the GAL gene regulation system, pCTR3 or pCTR1 and GAL80 gene are operably linked; pCUP1 and GAL4 gene are operably linked. The inventor unexpectedly discovered in experiments that the copper ion-suppressed CTR3 gene promoter (pCTR3) or the CTR1 gene promoter (pCTR1) was used to replace the GAL80 gene promoter (pGAL80) and operably linked to the GAL80 gene. The copper ion-inducible CUP1 gene promoter (pCUP1) replaces the GAL4 gene promoter (pGAL4) and is operably linked to the GAL4 gene, which enables the GAL gene regulatory system to control gene expression under the induction of copper ions, and significantly improve The yield of the metabolites of the engineered bacteria carrying the GAL gene regulation system, and the GAL gene regulation is not affected by the glucose concentration in the system.

According to an embodiment of the present invention, the aforementioned GAL gene regulation system may further include at least one of the following additional technical features:

According to an embodiment of the present invention, pCTR3 is operably linked to the GAL80 gene. The inventor found that the selection of copper ion-suppressed CTR3 gene promoter (pCTR3) to replace GAL80 gene promoter (pGAL80) and operably linked to GAL80 gene can improve the metabolic products of engineered bacteria carrying the GAL gene regulatory system. The output effect is better.

According to an embodiment of the present invention, further comprising a combination of a predetermined overexpression gene and at least one of the GAL1 gene promoter (pGAL1), GAL2 gene promoter (pGAL2), GAL7 gene promoter (pGAL7) or GAL10 gene promoter (pGAL10). Operationally connected. It is known that in the natural GAL regulatory system, GAL4 protein is the transcriptional activator in the regulatory system, and GAL80 is the transcriptional repressor protein in the regulatory system. The activities of the promoters pGAL1, pGAL2, pGAL7, and pGAL10 depend on the binding of the transcription factor GAL4 protein to activate. The GAL80 protein can bind to the GAL4 protein and prevent the GAL4 protein from binding to the above-mentioned promoters. Therefore, by operably linking a predetermined overexpressed gene to at least one of pGAL1, pGAL2, pGAL7, or pGAL10, under the control of the GAL gene regulatory system according to an embodiment of the present invention, the induction of the predetermined overexpressed gene in copper ions can be achieved When Cu ions are added to the growth environment of the engineered bacteria, the pCTR3 promoter is inhibited, the GAL80 protein is not expressed, and the GAL4 protein is induced to express, so the genes controlled by pGAL1, pGAL2, pGAL7, and pGAL10 are also induced to express .

In the second aspect of the present invention, the present invention proposes a Saccharomyces cerevisiae. According to an embodiment of the present invention, the Saccharomyces cerevisiae includes the aforementioned GAL gene regulation system. According to the Saccharomyces cerevisiae of the embodiment of the present invention, the expression of the target gene can be achieved under the regulation of copper ions. When Cu ions are added to the growth environment of Saccharomyces cerevisiae according to the embodiment of the present invention, the target genes controlled by pGAL1, pGAL2, pGAL7, and pGAL10 are induced to express without being affected by the glucose concentration in the system, and the metabolites controlled by the target gene can be realized. Significant increase in output.

According to an embodiment of the present invention, the above-mentioned Saccharomyces cerevisiae may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the tHMG1 gene is operably linked to pGAL1, the BtcrtE gene is operably linked to pGAL10, the BtcrtYB gene is operably linked to pGAL1, and the BtcrtI gene is operably linked to pGAL10. In turn, the metabolite β-carotene can be significantly increased.

According to an embodiment of the present invention, the BtcrtE gene has the nucleotide sequence shown in SEQ ID NO: 1, preferably, the BtcrtI gene has the nucleotide sequence shown in SEQ ID NO: 2, preferably, The BtcrtYB gene has a nucleotide sequence shown in SEQ ID NO: 3.

The inventors obtained the sequences of the above-mentioned BtcrtE gene, BtcrtI gene, and BtcrtYB gene through codon optimization. The inventors found that setting the BtcrtE gene, BtcrtI gene, and BtcrtYB gene with the above-mentioned nucleotide sequence under the control of pGAL10 and pGAL1 can further Improve the production of metabolite β-carotene.

According to an embodiment of the present invention, GAL1 gene silencing, GAL7 gene silencing, and GAL10 gene silencing.

In the third aspect of the present invention, the present invention proposes a method for increasing the yield of Saccharomyces cerevisiae metabolites. According to an embodiment of the present invention, Saccharomyces cerevisiae carrying the aforementioned GAL gene regulation system is subjected to fermentation treatment. According to the method of the embodiment of the present invention, the yield of metabolites is not affected by the glucose concentration, and the yield is significantly improved.

According to an embodiment of the present invention, the above method may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the Saccharomyces cerevisiae carrying the GAL gene regulation system is obtained by replacing pGAL80 with pCTR3 or pCTR1, preferably, replacing pGAL80 with pCTR3; replacing pGAL40 with pCUP1.

According to an embodiment of the present invention, further comprising operably linking the predetermined over-expressed gene to at least one of pGAL1, pGAL2, pGAL7, and pGAL10.

According to a specific embodiment of the present invention, the metabolite is β-carotene, further comprising: tHMG1 gene and pGAL1 operably linked, BtcrtE gene and pGAL10 operably linked, BtcrtYB gene and pGAL1 operably linked, and BtcrtI gene It is operably linked to pGAL10; and silences the GAL1 gene, GAL7 gene and GAL10 gene. According to the method of the embodiment of the present invention, Saccharomyces cerevisiae achieves a significant increase in the production of β-carotene under the control of Cu ions.

According to an embodiment of the present invention, the BtcrtE gene has the nucleotide sequence shown in SEQ ID NO: 1, preferably, the BtcrtI gene has the nucleotide sequence shown in SEQ ID NO: 2, preferably, The BtcrtYB gene has a nucleotide sequence shown in SEQ ID NO: 3. The inventors obtained the BtcrtE gene, BtcrtI gene and BtcrtYB gene with the above-mentioned nucleotide sequence through codon optimization, which can further increase the production of β-carotene.

According to an embodiment of the present invention, the silencing of the GAL1 gene, GAL7 gene and GAL10 gene is achieved by knocking out the GAL1 gene, GAL7 gene and GAL10 gene.

According to an embodiment of the present invention, the Saccharomyces cerevisiae is at least one selected from BY4743, BY4742, BY4743, INVSC1, HEC-YLK, and the HEC-YLK was deposited in the China Type Culture Collection on January 29, 2018 The preservation number is CCTCC NO: M2018062, the classification is named: Saccharomyces cerevisiae HEC-YLK, and the preservation address is: Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, China Type Culture Collection Center.

According to an embodiment of the present invention, the Saccharomyces cerevisiae is HEC-YLK. The inventor found that using HEC-YLK as an engineered strain for fermentation, the yield of β-carotene was further significantly increased.

According to an embodiment of the present invention, during the fermentation process, Saccharomyces cerevisiae is contacted with copper ions, so as to realize the regulation of the copper ions on at least one of the control genes of pGAL1, pGAL2, pGAL7, and pGAL10.

According to an embodiment of the present invention, the concentration of the copper ion in the fermentation system is 0.1-100 μM. The inventor found that the concentration of copper ions in the fermentation system is 1-100 μM, and the yield of β-carotene is high.

According to an embodiment of the present invention, when the cell concentration OD ₆₀₀ in the fermentation system is 90-100, the Saccharomyces cerevisiae is contacted with the copper ions. The inventor found that when the cell concentration OD ₆₀₀ in the fermentation system is 90-100, copper ions are added to the fermentation system to achieve a balance between the number of cells and the production of β-carotene, so that the yield of β-carotene reaches a level. Higher water

Description of the drawings

Fig. 1 is a schematic diagram of a Cu ion-induced GAL control system according to an embodiment of the present invention;

Fig. 2 shows the effect of different concentrations of Cu ions on the pigment production and bacterial biomass of strains according to an embodiment of the present invention;

Fig. 3 is a result of gene transcription level calculated by fluorescence quantification according to an embodiment of the present invention;

Figure 4 shows the effect of glucose on the GAL regulatory system in the galactose-inducing strain YLK-GAL-BT2 according to an embodiment of the present invention; and

Figure 5 shows the effect of glucose on the GAL regulatory system in the Cu ion-induced strain YLK-Cu-BT2 according to an embodiment of the present invention.

Detailed ways

The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary, and are intended to explain the present invention, but should not be construed as limiting the present invention.

It should be noted that the “GAL80 gene” and “GAL4 gene” mentioned in this application refer to the sequence from the start codon of the gene to the stop codon of the gene.

The present invention proposes a method for transforming the GAL control system in Saccharomyces cerevisiae: by transforming the GAL control system in the original Saccharomyces cerevisiae, the galactose control system that originally needs to be induced by galactose and is inhibited by glucose in the culture environment can be Only controlled by Cu ions.

In the natural GAL regulatory system, GAL4 protein is the transcriptional activator in the regulatory system, and GAL80 is the transcriptional repressor protein in the regulatory system. The activities of the promoters pGAL1, pGAL2, pGAL7, and pGAL10 depend on the binding of the transcription factor GAL4 protein to activate. The GAL80 protein can bind to the GAL4 protein and prevent the GAL4 protein from binding to the above-mentioned promoters.

The characteristics of the pCTR3 promoter and pCUP1 promoter are: in the presence of Cu ions, the transcription of genes controlled by the pCTR3 promoter will be inhibited, the transcription of genes controlled by the pCUP1 promoter will be activated, and it will appear in the absence of Cu ions. The opposite effect.

Based on the above theory, the principle of the Cu ion-induced GAL control system realized by the present invention is as follows:

In the present invention, by replacing the original promoters of the GAL80 gene and the GAL4 gene, the original galactose induction mode of yeast is changed to become the Cu ion induction mode. When there is no Cu ion in the yeast growth environment: pCTR3 promoter is not inhibited, GAL80 protein is expressed, and GAL4 protein is not induced, so the genes controlled by pGAL1, pGAL2, pGAL7, and pGAL10 are not expressed. But when Cu ions are added to the yeast growth environment, the pCTR3 promoter is inhibited, GAL80 protein is not expressed, and GAL4 protein is induced to express, so the genes controlled by pGAL1, pGAL2, pGAL7, and pGAL10 are also induced to express.

Through the above modification, the goal of Cu ions to control the expression of target genes is achieved. The specific principle can be seen in Figure 1.

The pCTR3 promoter is a copper ion inhibitory promoter derived from Saccharomyces cerevisiae, and the pCUP1 promoter is a copper ion inducible promoter derived from Saccharomyces cerevisiae.

The sequences of the pCTR3 promoter and the pCUP1 promoter are shown in the following nucleotide sequences, and similar sequences that still have the same function through addition, deletion, and substitution of bases are within the protection scope of the present invention.

pCTR3 promoter:

pCUP1 promoter:

In order to realize the embodiments of the present invention, the Saccharomyces cerevisiae used in the present invention is any strain of Saccharomyces. Preferably, HEC-YLK [strain preservation number (CCTCC NO: M2018062)] is used as the starting strain.

In order to realize the replacement of the above-mentioned promoter, the present invention adopts the method of gene editing to replace the pGAL80 promoter with the pCTR3 promoter, and the pGAL4 promoter with the pCUP1 promoter on the genome.

In order to verify the modified GAL regulation system of the present invention, the present invention also constructed a beta-carotene synthesizing strain that can be regulated by Cu ions. On the basis of the above modification, the present invention clones the genes tHMG1, BtcrtE, BtcrtI, and BtcrtYB required for the synthesis of beta-carotene into the GAL starter, and integrates them into the Saccharomyces cerevisiae genome by means of gene editing.

In order to realize the transformation of the GAL regulatory system and the construction of the beta-carotene strain by the method of gene editing, the present invention constructs pCAS9-HO, pCAS9-GAL7, pCAS9-GAL80, pCAS9-GAL4, 4 gene editing vectors. The primers with homology arms were used to amplify the donor DNA of pCTR3 that replaced the pGAL80 promoter, pCUP1 donor DNA that replaced the pGAL4 promoter, and the BtcrtE-tHMG1 gene integration at the HO site. Donor DNA, which has amplified BtcrtI-BtcrtYB donor DNA that has been gene-integrated at GAL1-GAL7 sites. The BtcrtE and tHMG1 genes are expressed under the control of the pGAL10 and pGAL1 promoters, respectively; the BtcrtI and BtcrtYB genes are expressed under the control of the pGAL10 and pGAL1 promoters, respectively.

The YLK-Cu01 strain was constructed by replacing the pCTR3 promoter of the pGAL80 promoter in HEC-YLK; further, replacing the pGAL4 promoter in YLK-Cu-CTR3 with the pCUP1 promoter to construct YLK-Cu02.

In order to prove that YLK-Cu02 can regulate gene expression of engineered strains, thereby controlling the metabolic synthesis pathway and product accumulation, on the basis of YLK-Cu02, the BtcrtE-tHMG1 expression cassette was successively integrated at the HO site to construct YLK-Cu-BT1. GAL1-7 sites integrated BtcrtI-BtcrtYB expression cassette to construct YLK-Cu-BT2. YLK-Cu-BT2 is used for the characterization of Cu ion induction system.

In order to compare the Cu ion-controlled GAL regulatory system with the galactose-induced GAL regulatory system. Taking the HEC-YLK strain as the starting strain, the BtcrtE-tHMG1 expression cassette was integrated into the HO site to construct YLK-GAL-BT1, and the BtcrtI-BtcrtYB expression cassette was integrated into the GAL1-7 site to construct YLK-GAL-BT2.

In order to demonstrate the effectiveness of the constructed Cu ion induction system, the present invention adopts a shake flask experiment to induce Cu ion under the Cu ion induction condition of 0μM-100μM, and the constructed Cu ion controlled YLK-Cu-BT2β- The pigment synthesis ability of the carotene synthesizing strain was investigated.

In order to prove that the transcription mode of GAL4 and GAL80 of the Cu ion induction system and the transcription of GAL1, GAL10, GAL7, and GAL2 promoters controlled by the modified GAL regulatory system are indeed controlled by Cu ions, the present invention uses Real-time PCR. Methods The GAL4, GAL80, BtcrtYB and BtcrtI genes in the YLK-Cu-BT2 strain were compared in the 10μM Cu ion and Cu-free expression mode of the transcription levels of these four genes.

In order to prove that the constructed Cu ion induction system is not inhibited by glucose, the present invention has a beta-carrot-producing strain YLK-Cu-BT2 controlled by the galactose-inducible GAL regulation system and the Cu ion-inducible GAL regulation system. The controlled β-carotene-producing strain YLK-GAL-BT2 was measured between the production time of β-carotene and glucose consumption during the shake flask fermentation process.

In order to further illustrate the beneficial benefits of the constructed Cu ion induction system in the production of high value-added compounds in Saccharomyces cerevisiae, the present invention provides the Cu ion-inducible beta-carotene strain YLK-GAL-BT2 without Cu. The three induction conditions of adding Cu and adding Cu during fermentation were compared.

The present invention combines Cu ion regulation and GAL regulation system to realize a highly sensitive Cu ion-controlled gene expression strategy. For different purposes, the strain can be induced with 0.1μM Cu ions to 100μM copper ions. The beta-carotene strain constructed by the present invention does not depend on galactose for gene induction, is not affected by glucose in the system, and is only controlled by Cu ions. The expression level of genes controlled by the GAL promoter is hundreds to thousands of times The control, the induction cost is low, and it is simple and convenient. The thus constructed β-carotene-producing engineering strain has high yield. Cu ions control gene-induced expression has a good application prospect in protein overexpression and synthesis of high value-added products during metabolism in Saccharomyces cerevisiae.

Example 1 Construction of gene editing vector

In the present invention, all gene integration and the replacement of DNA fragments on the genome adopt the method of gene editing. For this reason, the present invention pre-constructs a series of gene editing vectors for use in subsequent examples. The constructed gene editing vectors all use pCAS9W03 as the starting vector (patent application number: 201910754882.3), and the N20 sequence on the original vector is replaced by fusion PCR to obtain different gene editing targeting vectors. The editing site design adopts sgRNA online design tool, the website link is: http://crispr.dbcls.jp/

The primer sequences required to construct the gene editing vector are shown in Table 1. The underlined part is the N20 replacement region, which is the target region of the corresponding site on the genome.

Table 1:

The construction process of the vector is shown in Table 2.

First use the above primers to amplify the following 4 fragments.

Table 2:

The 4 fragments obtained above were respectively digested with NheI+NotI, and ligated to the pCAS9W03 vector backbone of the same digestion, transformed into E. coli DH5α, and spread on a 100mg/ml ampicillin resistant plate. The positive clones were screened, and the successfully constructed plasmids were named pCAS9-HO, pCAS9-GAL7, pCAS9-GAL80, and pCAS9-GAL4.

Example 2 Modification of Cu ion-induced GAL control system

(1) Preparation of pCRT3 donor DNA and replacement of pGAL80 promoter

Using the Saccharomyces cerevisiae HEC-YLK genome as a template, the nucleic acid sequence: PCTR3-F2: TTTCTTCATTTACCGGCGCACTCTCGCCCGAACGACCTCAAAATGTCTGCGTATTCCAATGAGAATCGCTAG and PCTR3-R2: GGAGCTGCATTAGGCACGGTTGAGACCGAAGATCTTAAAGTTGTAGTCCATCTTT were primers for amplification. The 5'ends of the upstream and downstream primers each have a 50bp homologous region with the upstream and downstream of the pGAL80 promoter.

(2) Preparation of pCUP1 donor DNA and replacement of pGAL4 promoter

The Saccharomyces cerevisiae HEC-YLK genome was used as a template, and the nucleic acid sequence: 046-CUP1p-F: AGGGGCGATTGGTTTGGGTGCGTGAGCGGCAAGAAGTTTCGTAAGCCGATCCCATTACCG and 047-CUP1p-R: AGAAGACAGTAGCTTCATCTTTCAGGAGGCTTGCTTCTTCGTCAGTTTGTTTTTTTTTGTTTGTTTGTTCTA were used as primers for high-confidence PCR amplification. The 5'ends of the upstream and downstream primers each have a 40bp region homologous to the upstream and downstream of the pGAL4 promoter. The amplified DNA is pCUP1 donor DNA.

(3) Gene editing transformation method for replacing DNA fragments on the genome:

According to the method described in Gietz, RD and RHSchiestl (2007). "High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method." Nature Protocols 2(1):31-34. For transformation, the substances shown in Table 3 were added to a centrifuge tube containing 100 μL of yeast cells.

table 3:

Put the above-mentioned mixed system into 42°C for 40 minutes to heat shock. Then add 1ml YPD liquid medium, resuscitate at 30°C and culture for 3h. After resuscitation, take 100μl of transformation solution and spread it on a YPD solid plate containing 200μg/ml G418, culture at 30°C, and pick out the growth on the plate after 3 days The clone of the correct genotype is obtained by genotype verification. The clones were subcultured twice in YPD liquid medium to lose the CAS9 gene editing vector.

(4) Construction of strains

Using the above transformation method, using HEC-YLK as a host, pCAS9-GAL80 as a gene editing vector, and Donor DNA as pCRT3 Donor DNA, a genetically engineered strain YLK-Cu01 with the pGAL80 promoter replaced by the pCRT3 promoter was obtained.

Using the above transformation method, using YLK-Cu01 as a host, pCAS9-GAL4 as a gene editing vector, and Donor DNA as pCUP1 Donor DNA, a genetically engineered strain YLK-Cu02 with pGAL4 promoter replaced by pCUP1 promoter was obtained.

Example 3 Construction of copper ion-inducible Beta-carotene strain

(1) Synthesis of Beta-carotene synthesis pathway genes

According to the codon pair of Saccharomyces cerevisiae, the beta-carotene synthesis pathway genes BtcrtE (GGPP synthase, GenBank:: AFC92798.1), BtcrtI (phytoene dehydrogenase) derived from Blakeslea trispora , GenBank:: AAX20903.1) and BtcrtYB (phytoene synthase/cyclase bifunctional enzyme, GenBank:: Q67GH9.1) for codon optimization and gene synthesis. The optimized gene sequence is shown in Table 4.

Table 4:

(2) Preparation of donor DNA for beta-carotene synthesis pathway gene

When gene synthesis is performed, the upstream and downstream of the BtcrtE gene are respectively added with two restriction sites EcoRI and BglII, the upstream and downstream of the BtcrtI gene are respectively added with two restriction sites EcoRI and BglII, and the upstream and downstream of the BtcrtYB gene are respectively added Two restriction sites, BamHI and HindIII.

The BtcrtE gene EcoRI and BglII were double digested and cloned into the Saccharomyces cerevisiae expression vector pESC-URA, transformed into E. coli DH5a, and cloned by Amp resistance screening to obtain pESC-URA-BtcrtE, using the HEC-YLK yeast genome as a template, tHMG1 -BamHI: CCCGGATCCAAAAATGGACCAATTGGTGAAAACTGAAG and tHMG1-SalI: CCCGTCGACTTAGGATTTAATGCAGGTGACG is a primer to amplify the catalytic region of HMG1 tHMG1 (see https://www.ncbi.nlm.nih.gov/nuccore/NC_001145.3?from 118898734) =genban k&strand=true), digested with BamHI+SalI, recovered by gel electrophoresis, ligated to the pESC-URA-BtcrtE vector recovered by the same enzyme, transformed into E. coli DH5α, Amp resistance screening clone, and obtained pESC-URA-BtcrtE- tHMG1, because the promoter on PESC-URA is a bidirectional pGAL1-PGAL10 promoter, the BtcrtE and tHMG1 genes are expressed under the control of the pGAL10 and PGAL1 promoters, respectively.

In order to integrate BtcrtE and tHMG1 into the HO position by gene editing, the primers HO-donor-F: cttatgatggttttttggaattattattatcctaccatcaagcgtctgacccagctgaattggagcga and HO-donor-R: cgcggactaactacctcagtcagtcattcgactaactcagtcagtcagtcagtcattcagtcagtactcagtactcagccgtactcgcg. BtcrtE-tHMG1 donor DNA was amplified from pESC-URA-BtcrtE-tHMG1 using high-fidelity enzymes.

The BtcrtI gene EcoRI and BglII were double digested and cloned into the Saccharomyces cerevisiae expression vector pESC-URA, transformed into Escherichia coli DH5a, and clones were screened for Amp resistance to obtain pESC-URA-BtcrtI, and the BtcrtYB genes BamHI and HindIII were double digested and connected On the pESC-URA-BtcrtI vector that was digested with the same restriction, E. coli DH5α was transformed, and clones were screened for Amp resistance to obtain pESC-URA-BtcrtI-BtcrtYB. Since the promoter on PESC-URA is a bidirectional promoter of pGAL1-PGAL10, the BtcrtI and BtcrtYB genes are expressed under the control of the pGAL10 and PGAL1 promoters, respectively.

In order to replace the GAL1-GAL7 region on the genome with the BtcrtI and BtcrtYB expression cassettes by gene editing, the primers GAL7-CAS9-F carrying the homologous arms upstream and downstream of the GAL1-GAL7 cleavage site were designed: tgtagataatgaatctgaccatctaaatttcttagtttttcagcagcttgttccgaagctggttaggctttagcttg

GAL1-CAS9-R: gcattttctagctcagcatcagtgatcttagggtacttgaccttgtagaactcattggcaagggcttcttgaccaaacctctggcgaag from pESC-URA-BtcrtI-BtcrtYB using high-fidelity enzyme to amplify BtcrtI-BtcrtDNAYB.

(3) Construction of strains

Using the Saccharomyces cerevisiae transformation method described in Part 4 of Example 2, using YLK-Cu02 as the host, pCAS9-HO as the gene editing vector, and BtcrtE-tHMG1 donor DNA, the HO gene was replaced by the BtcrtE-tHMG1 expression cassette. Genetically engineered strain YLK-Cu-BT1.

Using the Saccharomyces cerevisiae transformation method described in Part 4 of Example 2, using YLK-Cu-BT1 as the host, pCAS9-GAL7 as the gene editing vector, and BtcrtI-BtcrtYB donor DNA, the GAL1-GAL7 region was obtained by BtcrtI-BtcrtYB The genetically engineered strain YLK-Cu-BT2 with replacement of the expression cassette.

Example 4 Construction of Galactose-inducible Beta-Carotene Strain

When GAL80 and GAL4 in the GAL regulatory system are not modified, the transcriptional activity of promoters such as pGAL1, pGAL2, pGAL7, and pGAL10 in the GAL regulatory system need to be induced by galactose. In order to construct a galactose-inducible Beta-carotene synthesizing strain for control experiments, the method of strain construction in part 3 of Example 3 was used, with HEC-YLK as the host, pCAS9-HO as the gene editing vector, and BtcrtE-tHMG1 Donor DNA to obtain the genetically engineered strain YLK-GAL-BT1 with the HO gene replaced by the BtcrtE-tHMG1 expression cassette. Using YLK-GAL-BT1 as the host, pCAS9-GAL7 as the gene editing vector, and BtcrtI-BtcrtYB donor DNA, the genetically engineered strain YLK-GAL-BT2 with the GAL1-GAL7 region replaced by the BtcrtI-BtcrtYB expression cassette was obtained. When the engineered strain YLK-GAL-BT2 grows on the YPD plate with 2% galactose for 3 days, the colony can be seen to turn red, while it is cultivated on the YPD plate without galactose for 3 days, the colony is white, indicating the constructed strain The induction of galactose is indeed required.

Example 5 Shake flask characterization verification of Cu ion-inducible Beta-carotene strain

(1) Shake flask culture and induction of strains

Take YLK-Cu-BT2 glycerol seeds from the refrigerator at -80℃ and inoculate them into 50mL YPD medium, activate at 30℃ and 250rpm for 12-16h to obtain first-grade seeds; secondly, add 15mM in the YPD fermentation medium of the experimental group. Copper sulfate mother liquor, to the final concentration of 0μM, 0.2μM, 0.5μM, 1μM, 2μM, 5μM, 10μM, 30μM, 50μM, 100μM; then transfer the first-level seeds to the above 50ml YPD medium according to the 1% inoculum amount, Fermentation at 30°C and 250 rpm for 72 hours, three repetitions for each concentration.

(2) Extraction and content determination of pigments in bacterial cells (the pigments in this application refer to Beta-carotene)

Beta-carotene extraction: At the end of fermentation, take 1mL of the culture into a 15ml centrifuge tube, centrifuge to remove the supernatant to collect the bacteria; then add 1mL of 3M hydrochloric acid and treat it in a boiling water bath for 3 minutes to destroy the yeast cell wall; The cells were cooled in an ice-water bath for 1 min, centrifuged to remove the supernatant, and washed twice with pure water to remove residual hydrochloric acid; then 5ml of acetone was added, and the pigment was extracted by shaking up and down.

Determination of Beta-carotene content: Detect the OD value at 450nm wavelength, and calculate the β-carotene content in the extract according to the following formula;

A1-----The absorbance value of diluted β-carotene in a cuvette with 1cm optical path at 450nm wavelength

A ^1% -----1% concentration (10mg/mL) of the extinction coefficient of β-carotene, the value here is 2500AU

N-----The dilution factor of β-carotene solution when _{measuring OD 450}

10g/mL----The concentration of β-carotene solution when ^{A 1% is 2500AU}

The content of β-carotene in the fermentation broth = the measured β-carotene concentration C × the number of ml of acetone used for extraction ÷ the number of ml of fermentation broth used.

(3) Analysis of the effect of different Cu ion concentrations on pigment content

The effect of adding different concentrations of Cu ions on the pigment production and bacterial biomass of the strain is shown in Figure 2. The figure shows that through the modification of the GAL regulation system, the control of the expression of foreign genes by Cu ions can be achieved, thereby realizing the control of the product yield. At the same time, this result also shows that an excessively high induction concentration will cause the strain to express excessively foreign genes and inhibit the growth of the bacteria, but the final yield may not necessarily be higher.

This result also shows that the constructed YLK-Cu-BT2 strain has a good response to the carotenoid production in the Cu ion concentration range of 1-100 μM.

Example 6 Real-time PCR verification of gene expression of Cu ion control modification GAL regulatory system

(1) Investigate the choice of genes

In order to investigate the consistency between the genetic table of the modified GAL regulatory system and the design, real-time PCR was used to investigate the response of the transcription of the GAL80 gene and GAL4 gene of the modified YLK-Cu-BT2 strain to copper ions; At the same time, BtcrtYB controlled by the pGAL1 promoter and BtcrtI controlled by the pGAL10 promoter were selected to verify the influence of the modified GAL regulatory system on the transcription level of the target gene. The transcriptional changes of the above genes use ACT1, which is constitutively expressed in yeast, as an internal control.

(2) Real-time PCR process

In order to obtain mRNA with and without Cu ions, according to the culture method of Example 4, two experimental groups, a control group without Cu ions (0 μM) and a 10 μM addition, were set up. After culturing for 12 hours, each 5ml of fermentation broth was centrifuged to remove the supernatant and washed with sterile water once. The RNA of the fermentation sample was extracted with TaKaRa MiniBEST Universal RNA Extraction Kit; and TaKaRa PrimeScript ^TM RT reagent Kit was used to reverse transcription kit. Use oligo dT as primer to obtain cDNA; then use the obtained cDNA as template and use TTB

Premix DimerEraser ^TM (Perfect Real Time) kit to prepare qPCR system, the total volume of the reaction system is 10μL. The forward and reverse primers used in fluorescence quantitative detection are shown in Table 5.

table 5:

Get on the machine; use Master Cycle Rep Realplex (Eppendorf) for real-time fluorescence quantification. The amplification program is 95°C pre-denaturation 30s, 95°C denaturation 5s, 55°C annealing 30s, 72°C extension 30s, 40 cycles, and then run the analysis of 95°C 15s, 60°C 1min, 95°C 15s in the dissolution curve stage, every time Set 3 replicates for each sample, and set up a negative control. The relative transcription levels of genes ^{are calculated according to the 2-△△CT} method [Golay J, Passerini F, Introna MA simple and rapid method to analyze specific mRNAs from few cells in a semi-quantitative way using the polymerase chain reaction.[J]. Pcr Methods & Applications, 1991, 1(2): 144.].

(3) The gene expression results of YLK-Cu-BT2 in the presence and absence of Cu ions

The result of gene transcription level calculated by fluorescence quantification is shown in Figure 3. Numerically speaking, by adding 10μM Cu ions to the culture system, compared with the experimental group without Cu, the transcription level of GAL80 gene was down-regulated by about 59 times, the transcription level of GAL4 gene was up-regulated by 21 times, and the transcription level of BtcrtYB gene. It was up-regulated by 788 times, and the transcription level of BtcrtI gene was up-regulated by 1112 times. This result proves that the expression of the transcriptional activator GAL4 and the inhibitory protein GAL80 is indeed responsive to Cu ions after the modification of the GAL regulatory system. In addition, the activity of promoters such as pGAL1, pGAL10 and the gene expression controlled by the GAL4 transcription factor are also indirectly regulated by Cu ions. This result is consistent with the modified model designed by the present invention.

Example 7 Investigation of the effect of glucose on Cu ion-induced GAL regulatory system

Since the transcription of the pGAL4 promoter itself is affected by the glucose concentration, its expression will be inhibited at high glucose concentrations. Therefore, in general research, when using the GAL regulatory system for exogenous gene expression, it is necessary to induce gene expression after the glucose is used up.

In the present invention, a Cu ion-responsive promoter is used to replace the pGAL80 and pGAL4 promoters. Theoretically, the modified GAL regulatory system is no longer affected by glucose. In order to verify this conclusion, the Cu ion-inducible YLK-Cu-BT2 strain in Example 3 and the galactose-inducible YLK-GAL-BT2 strain in Example 4 were used to conduct a shake flask contrast experiment to investigate the pigment accumulation of the two strains. And the difference between glucose consumption.

The culture of YLK-GAL-BT2 strain is: inoculate glycerol seeds from -80℃ refrigerator into 50ml YPD medium, activate at 30℃ 250rpm for 12-16h to obtain first-class seeds; transfer 0.5ml seed liquid to 50ml YPDG culture Base (YPDG: 2% glucose, 2% galactose, 1% yeast powder, 2% peptone). Fermentation at 30°C and 250 rpm for 72 hours, three repetitions for each concentration.

The culture of YLK-Cu-BT2 strain is: inoculate glycerol seeds from -80℃ refrigerator into 50ml YPD medium, activate at 30℃ 250rpm for 12-16h to obtain first-class seeds; transfer 0.5ml seed solution to 10μM copper In 50ml YPD medium of ions, fermentation was carried out at 30°C and 250rpm for 72h, and each concentration was repeated for three times.

The above experimental groups were all measured at 0h, 8h, 12h, 16h, 20h, 24h, 36h, 48h, 60h, 72h for glucose concentration, cell concentration, and β-carotene content.

The results of the shake flask assay are shown in Figure 4 and Figure 5. The results show that in the galactose-induced strain YLK-GAL-BT2, since the expressions of GAL4 and GAL80 in the GAL regulatory system are both regulated by the original system, the accumulation of pigment shows glucose Inhibition, only after the glucose is consumed, the pigments begin to accumulate gradually; in the Cu ion-induced strain YLK-Cu-BT2, the accumulation of pigments is synchronized with the accumulation of bacterial biomass, and is not affected by the glucose concentration in the fermentation medium . This result shows that the modified GAL regulation system is only regulated by Cu ions, and the glucose in the fermentation system does not have much influence on the system.

Example 8 Investigation of the upper tank of Cu ion induction system

(1) The design of YLK-Cu-BT2 fed-batch fermentation whether to add Cu and Cu ion induction timing experiment

YLK-Cu-BT2 seed solution culture: inoculate YLK-Cu-BT2 glycerol seeds stored at -80°C into 50ml YPD medium (2% glucose, 2% soy peptone, 1% yeast extract), 30°C, 250rpm Cultivate for 12 hours to activate and obtain first-level seeds; then transfer to a new 300ml/L YPD medium according to the 5% inoculum amount and cultivate for 9 hours under the above conditions to obtain second-level seeds; transfer all the obtained seed liquids to The fermentation tank is equipped with 30L fermentation medium. The formula of the fermentation medium is: glucose 30g/L, ammonium sulfate 7g/L, yeast powder 2g/L, peptone 2g/L, corn steep liquor 30g/L, potassium dihydrogen phosphate 5g/L, magnesium sulfate 2g/L, sulfuric acid Zinc 1g/L, Vitamin B1 200mg/L, Vitamin B3 200mg/L, Vitamin B6 200mg/L.

In order to compare the induced effect of Cu ions on the tank, three sets of fermentation test experiments were carried out.

Fermentation test 1: Cu ions are not added for induction during the fermentation process. After the glucose is consumed on the tank, the glucose is fed after the online monitoring of dissolved oxygen rebound, and the glucose content in the control system does not exceed 1g/L. During the fermentation process, ammonia water is used to control the pH between 5-6. After supplementing glucose, the dissolved oxygen is controlled at 30%, the dissolved oxygen is related to the stirring speed, and the fermentation is 84h.

Fermentation test 2: When inoculating in the upper tank, add CuSO4 solution to the fermentation tank. The concentration of Cu ions in the final fermenter was 10 μM. After the glucose is consumed on the tank, the glucose is fed after the online monitoring of dissolved oxygen rebound, and the glucose content in the control system does not exceed 1g/L. During the fermentation process, ammonia water is used to control the pH between 5-6. After supplementing glucose, the dissolved oxygen is controlled at 30%, the dissolved oxygen is related to the stirring speed, and the fermentation is 84h.

Fermentation test 3: CuSO4 solution is not added in the early stage of fermentation. After the fermentation reaches 30h, when the bacteria grow to about OD600 of 90-100, add CuSO4 solution to the fermentor. The concentration of Cu ions in the final fermenter was 10 μM. The glucose feeding strategy in the process is: the glucose is consumed on the tank, and the glucose is fed after the dissolved oxygen rebound is monitored online, and the glucose content in the control system does not exceed 1g/L. During the fermentation process, ammonia water is used to control the pH between 5-6. After supplementing glucose, the dissolved oxygen is controlled at 30%, the dissolved oxygen is related to the stirring speed, and the fermentation is 84h.

(2) The effect of Cu ion induction on the pigment production of YLK-Cu-BT2

The test results of the fermentation process samples are shown in Table 6.

The result shows:

1) The strains that were not supplemented with Cu ions during the whole process did not produce pigments during the whole process. But its cell biomass is the highest, reaching OD600 and reaching 243.

2) In the experimental group where Cu ion induction was carried out at the beginning of fermentation, the fermentation broth was obviously seen to turn red at about 10h, reaching 1.13g/L at 29h, but due to premature induction of pigment production, the product produced on cell growth In the end, the growth of biomass was inhibited. After 84 hours of fermentation, the yield was only 785.8mg/L.

3) In the experimental group that was induced in the middle of the fermentation, the biomass had accumulated about 100 OD in the early stage, and after the induction, the production of beta-carotene continued to increase, and the final yield reached 3 g/L. Although the biomass is lower than that of the non-pigmented group, the strategy of growing the bacteria in the early stage and inducing the accumulation of products in the later stage has achieved the balance between biomass and yield, and the yield has reached a higher level.

Table 6:

In the description of this specification, descriptions with reference to the terms "one embodiment", "some embodiments", "examples", "specific examples", or "some examples" etc. mean specific features described in conjunction with the embodiment or example , Structures, materials or features are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the described specific features, structures, materials or characteristics can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine the different embodiments or examples and the features of the different embodiments or examples described in this specification without contradicting each other.

Although the embodiments of the present invention have been shown and described above, it can be understood that the above-mentioned embodiments are exemplary and should not be construed as limiting the present invention. A person of ordinary skill in the art can comment on the above-mentioned embodiments within the scope of the present invention. The embodiment undergoes changes, modifications, substitutions, and modifications.

Claims (16)

1. A GAL gene regulation system, characterized in that pCTR3 or pCTR1 and GAL80 gene are operably connected; pCUP1 and GAL4 gene are operably connected.
2. The GAL gene regulation system according to claim 1, wherein pCTR3 and GAL80 gene are operably linked.
3. The GAL gene regulation system according to claim 1, further comprising operably linking a predetermined over-expressed gene to at least one of pGAL1, pGAL2, pGAL7, or pGAL10.
4. A Saccharomyces cerevisiae characterized by comprising the GAL gene regulatory system according to any one of claims 1 to 3.
5. The Saccharomyces cerevisiae of claim 4, wherein the tHMG1 gene is operably linked to pGAL1, the BtcrtE gene is operably linked to pGAL10, the BtcrtYB gene is operably linked to pGAL1, and the BtcrtI gene is operably linked to pGAL10.
6. The Saccharomyces cerevisiae of claim 5, wherein the BtcrtE gene has the nucleotide sequence shown in SEQ ID NO: 1, and preferably, the BtcrtI gene has the nucleoside shown in SEQ ID NO: 2. The acid sequence, preferably, the BtcrtYB gene has the nucleotide sequence shown in SEQ ID NO: 3.
7. The Saccharomyces cerevisiae of claim 4, wherein the GAL1 gene is silenced, the GAL7 gene is silenced, and the GAL10 gene is silenced.
8. A method for improving the yield of Saccharomyces cerevisiae metabolites, which is characterized in that Saccharomyces cerevisiae carrying the GAL gene regulation system according to any one of claims 1 to 3 is subjected to fermentation treatment.
9. The method according to claim 8, wherein the Saccharomyces cerevisiae carrying the GAL gene regulatory system is obtained in the following manner:

   Replace pGAL80 with pCTR3 or pCTR1, preferably, replace pGAL80 with pCTR3;

   Replace pGAL40 with pCUP1.
10. The method of claim 9, further comprising operably linking the predetermined over-expressed gene to at least one of pGAL1, pGAL2, pGAL7, and pGAL10.
11. The method of claim 9, wherein the metabolite is β-carotene, further comprising:

    The tHMG1 gene is operably linked to pGAL1, the BtcrtE gene is operably linked to pGAL10, the BtcrtYB gene is operably linked to pGAL1, and the BtcrtI gene is operably linked to pGAL10; and

    Silence the GAL1 gene, GAL7 gene and GAL10 gene.
12. The method according to claim 11, wherein the BtcrtE gene has the nucleotide sequence shown in SEQ ID NO: 1, and preferably, the BtcrtI gene has the nucleotide sequence shown in SEQ ID NO: 2. Sequence, preferably, the BtcrtYB gene has the nucleotide sequence shown in SEQ ID NO: 3.
13. The method according to claim 11, wherein the silencing of the GAL1 gene, GAL7 gene and GAL10 gene is achieved by knocking out the GAL1 gene, GAL7 gene and GAL10 gene.
14. The method according to claim 11, wherein the Saccharomyces cerevisiae is at least one selected from BY4743, BY4742, BY4743, INVSC1, HEC-YLK, and the HEC-YLK was deposited on January 29, 2018 China Center for Type Culture Collection, the deposit number is CCTCC NO: M2018062;

    Preferably, the Saccharomyces cerevisiae is HEC-YLK.
15. The method according to claim 11, characterized in that, during the fermentation process, the Saccharomyces cerevisiae is contacted with copper ions;

    Preferably, the concentration of the copper ion in the fermentation system is 1-100 μM.
16. The method according to claim 15, characterized in that when the OD ₆₀₀ of the bacterial cell in the fermentation system is 90-100, the Saccharomyces cerevisiae is contacted with the copper ions.

Images