CN107828790B

CN107828790B - Promoter for inducible expression under acid condition

Info

Publication number: CN107828790B
Application number: CN201711101047.7A
Authority: CN
Inventors: 诸葛斌; 周家豪; 何强; 陆信曜; 宗红
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2017-11-10
Filing date: 2017-11-10
Publication date: 2020-06-09
Anticipated expiration: 2037-11-10
Also published as: CN107828790A

Abstract

The invention discloses a promoter for inducible expression under acidic conditions, and belongs to the field of microbial molecular biology. The promoter sequence provided by the invention is shown as SEQ ID NO.1, is derived from Candida glycerinogenes WL2002-5-59, can drive and/or regulate the expression of effective connecting nucleic acid in the Candida glycerinogenes, and the cloning of the promoter expands gene resources for microbial acid regulation and control research, and also provides an effective method and a new thought for producing organic acid by Candida glycerinogenes through fermentation and other products needing fermentation production under an acidic condition.

Description

Promoter for inducible expression under acid condition

Technical Field

The invention relates to a promoter for inducible expression under acidic conditions, in particular to a promoter derived from Candida glycerinogenes, belonging to the technical field of biological engineering.

Background

Candida glycerinogenes (CCTCC: M93018) is an industrial strain with excellent fermentation performance and independent intellectual property rights in China, is disclosed in Chinese patent CN1070235C, and has the characteristics of high permeability resistance, high yield, high conversion rate, high production strength and the like in 8-29 th of publication day 2001, and occupies a leading position in the world. It can grow normally on high osmotic pressure medium of 25% glucose or 5% NaCl, and in laboratory scale fermentation, the glycerol yield can reach 12%, even in industrial scale, the glycerol yield can also reach 10%. Meanwhile, when the Candida glycerinogenes is fermented to enter the stationary phase of cell growth, the pH value is reduced to about 3.0 or even lower, and the glycerol yield is still maintained at a higher level. Candida glycerinogenes has good growth characteristics at low pH relative to the model strain Saccharomyces cerevisiae.

The promoter is a cis-element for regulating gene expression and is also an important element of a gene engineering expression vector. The important role of the promoter at the transcription level determines not only the expression level of the gene, but also the temporal and spatial sequence of gene expression, and it can be said that the level of the promoter activity largely affects the expression level of the final product of gene expression.

Promoters with different strengths and regulatory mechanisms are important tools in metabolic engineering and synthetic biology, and although there are many constitutive promoters available, the number of inducible promoters is still limited to pathway engineering in s.cerevisiae. The metabolic modification of Saccharomyces cerevisiae is currently carried out, mostly by using constitutive promoters, such as the strong constitutive promoter P in the glycolysis pathway_TDH3(also referred to as P)_GPD)，P_PGK1，P_TPI1And P_PDC1Promoters have been widely used for gene expression in Saccharomyces cerevisiae. Although constitutive promoters facilitate maintenance of gene expression without additional manipulation, they are not suitable for metabolic pathways containing toxic intermediates or for expression of target genes at a particular point in time. The inducible or regulatable promoter can make up for the problems, and does not express the exogenous gene as far as possible in the initial fermentation stage and the thallus growth stage, and induces the promoter to express the target gene along with the increase of the fermentation time and the increase of the intermediate metabolite.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a novel candida glycerinogenes inducible gene and a promoter sequence, wherein the nucleotide sequence is SEQ ID NO. 1.

The nucleotide sequence is SEQ ID NO.1 and is derived from a Candida glycerinogenes mannose transporter gene.

In one embodiment of the invention, the nucleotide sequence of the promoter SEQ ID NO.1, designated P_gmt。

In one embodiment of the present invention, the acid environment of the acid-induced finger is around pH 2.

Vectors comprising such promoters, such as expression vectors, cloning vectors and shuttle vectors, are within the scope of this patent.

The vector provided by the invention can be applied to a yeast expression system; screening functional genes (after the genes are cloned in a promoter), identifying and optimizing, and regulating the expression of the genes; stable expression of functional genes (genes cloned behind promoters) or overexpression (using multiple promoters or initiating stress mechanisms). The conventional application of the promoter is in the protection scope of the invention.

Verifying the expression strength of a candida glycerinogenes mannose transporter gene promoter;

the recombinant expression vector of the expression strength of the mannose transporter gene promoter (figure 1) is constructed by the following steps:

cloning and connecting the exogenous green fluorescent protein gene GFP to a plasmid pUR-5.8S rDNA-URA5 to obtain a vector pUR-5.8S rDNA-GFP-URA 5;

PCR cloning or chemical synthesis of acid-induced promoter fragment of SEQ ID NO.1, and ligation to pUR-5.8S rDNA-gfp-URA5 to obtain pUR-P_CgGMT-GFP；

Through the constructed recombinant expression vector pUR-P_CgGMTGFP, transforming the recombinant plasmid into candida glycerinogenes by adopting a lithium acetate transformation method, coating the candida glycerinogenes on a selective culture medium, and selecting a single colony for PCR verification.

Positive transformants were picked from the plates and inoculated in 10mL YEPD liquid medium. Culturing at 37 deg.C for 24h, extracting genome by glass bead method, and PCR verifying.

Fluorescence analysis was performed using an Olympus fluorescence microscope. The practicability and feasibility of constructing an integrated expression vector are verified by taking the green fluorescent protein as a marker, and the expression strength of the gene promoter of the mannose transporter of the glycerol producing candida is further verified.

The invention has the beneficial effects that:

the acid-induced promoter is successfully cloned from the glycerol-producing candida, and a foundation is laid for metabolic modification of a synthesized product of the glycerol-producing candida under an acidic condition.

Drawings

FIG. 1: pUR-P_CgGMT-a GFP physical map;

FIG. 2: p_CggmtAnd P_gapGfp fluorescence was initiated at different pH conditions.

Detailed Description

Example 1: extraction of Candida Glycerol-producing genomic DNA

The Candida glycerinogenes wild strain is cultured to a stationary phase according to the technical manual of Yeast genetics in the reference literature. The extracted DNA was measured with a nucleic acid protein analyzer, and the purity of the extracted DNA was judged from the ratio of A260/A280, while the quality of the template was judged by agarose gel electrophoresis.

Example 2: acquisition of acid-inducible promoters

The real-time fluorescent quantitative PCR (qRT-PCR) of the mannose transporter gene of the candida glycerinogenes under different pH conditions is studied to study the transcription level condition of the mannose transporter gene under different acid conditions, and the result shows that the relative transcription multiple of the mannose transporter gene is increased along with the reduction of the pH, the upstream base sequence of about 1.5kb of the gene sequence is cloned, and the promoter is predicted.

P_gmtAmplification was performed by primers gmt-F and gmt-R, both containing BamHI and SacII cleavage sites, and the promoter ligated to pMD-19(sample) for sequencing, the primer sequences were as follows:

an upstream primer: CGCGGATCCATACTATACAATTGTAAAATACA

A downstream primer: TCCCCGCGGTTCTAGTATGTTGATAGGAA

Example 3: verification of expression strength of gene promoter of mannose transporter of glycerol-producing candida

Construction of acid-inducible promoter expression vector

Designing primers according to a reference document of a Green Fluorescent Protein (GFP) sequence, introducing enzyme cutting sites of Not I, Sac II and Stu I at the 5 'end of the sequence to ensure that a subsequent promoter has enough enzyme cutting sites for use, introducing a Kpn I enzyme cutting site at the 3' end, cloning to obtain a GFP gene, performing double enzyme cutting by using Not I and Kpn I, connecting pUR-5.8S rDNA-URA5, and obtaining a recombinant vector pUR-5.8S rDNA-GFP-URA 5.

PCR cloning Candida glycerinogenes mannose transport protein gene promoter, enzyme cutting, connecting recombinant vector pUR-5.8S rDNA-gfp-URA5, transforming to Escherichia coli JM109 by heat shock method to obtain pUR-P_CgGMT-GFP。

GFP gene primers:

GFP-F：

ATTTGCGGCCGCCCGCGGAGGCCTATGGTAGATCTGACTAGTAAAGGAGAAGA

GFP-R：CGGGGTACCTCACACGTGGTGGTGGTG

example 4: transformation and screening of recombinant expression vectors

The constructed recombinant expression plasmid pUP-P_CgGMTAfter single enzyme cutting linearization, GFP and Hind III are transformed into a Candida glycerinogenes URA-deficient strain by a lithium acetate transformation method and coated on a selective culture medium. Selecting a single colony from the plate, carrying out colony PCR verification, then selecting a positive transformant, transferring the positive transformant to a YEPD liquid culture medium, culturing to a logarithmic growth phase, extracting a genome by a glass bead method, carrying out PCR verification, and storing a strain.

Example 5: recombinant yeast culture, acid-induced expression and fluorescence intensity analysis

The verified recombinant bacteria were picked from the plate, inoculated in 10mL liquid YEPD medium, cultured to logarithmic phase, transferred to YEPD medium of different pH (pH 2.0, 3.0, 4.0, 5.0 fluorescence respectively), cultured at 37 ℃ at 150r/m for 24 h. Fluorescence observation is carried out by using an Olympus fluorescence microscope, green fluorescent protein is a marker with great potential, and an endogenous fluorescent gene can emit clear visible green light and a fluorescent signal is stable when being excited by ultraviolet light or blue light, so that blue light is used as exciting light in an experiment to detect the fluorescence intensity of recombinant bacteria under different pH conditions. It can be seen that the wild type control has no fluorescence generation under the conditions of pH 2.0 and pH 5.0, the constitutive promoter Pgap transformant has strong fluorescence under the condition of pH 5.0, and also has strong fluorescence generation under the condition of pH 2.0; the Pgmt transformant has weak fluorescence under the condition of pH 5.0, the fluorescence intensity is stronger along with the reduction of pH, and the fluorescence intensity is strongest when the pH is 2.0, which indicates that Pgmt is an acid-induced promoter.

Sequence listing

<110> university of south of the Yangtze river

<120> a promoter for inducible expression under acid conditions

<141>2017-11-10

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>1553

<212>DNA

<213> Glycerol-producing Candida (Candida glycerinogenes)

<400>1

atactataca attgtaaaat acaatccaat acaccgcatc acgtgcgtgc gcacagggca 60

tggctgccca gacaaagccc caattgccgt tttgggcgcc aacgcgctcc ttccaaaaac 120

ggacggcaca gagggcacaa aaaatttcag gcggcgaaat gataatttgt gagggcaaga 180

aaagtttcag tgcggaaagg ggggaacttc agtggggagg aaaaaaaaaa aagcggcgga 240

gtacagagaa attggatggt tttccccccc atcagttgta aaattgacaa ttttttcgag 300

tgtctgtttc acttttgaag ttggtttatg aatcttgtct tgatataatt tgctttactt 360

aagtatattt tatttaactc tattttattt cagtttattt tagtttattt cagtttattt 420

tagtgnattt tatttaactc tattttattt tagtttattt tagtttattt tattttcttc 480

cttctccaac ttgaacgtcc catagagtaa ccatgtctgc agagaagaaa gatatcgagc 540

aaccacaaga tcttaacaag atcagaatca ccttcacctc caccaatgtc agagcattgg 600

aaaaggtttc tggcttagtc atcagaaacg ctagaagaga aggtatcaac aagaagggtc 660

ctgtcagaat gccaaccaag gcgctctcca ttgcaaccag aaagactcct aatggtgaag 720

gttccaagac ctgggaacat tatgaaatga gaatccacaa gagatacatt gacttggaag 780

ctccatccac cttgatcaag aagattactt ccttgaccat tgagccaggt gttgatgtcg 840

aagtcactgt ctctgtctaa ggacatggac aggtgtcgtt attttccttt tttttttctt 900

ttttttttct gttctggcat tgttgttgag tggttgattg cccaataatc ctctgacatc 960

acatatcgca gccgtactcc ggcgtgccgt gttgtgcaca ccctctaggc gtgccgtgta 1020

tgagacaagt ccagcttatc aagttcttca acaattttta gatggttatc tcgtatatga 1080

gacgttgcgg tagacagcta tcagcgtgtg tattccacgg cgcaatatgt atcttgttta 1140

gctttatagt gtcgttaatg ctcttcacac agtactacaa acagcaatat ccaatgtaga 1200

tatttaaaca tgttggtcct tgcctttgta ttgtttttag acttttaacc tatttgcgcc 1260

cgtgtcacgt gacacacatt atcgttagta tgcaagtcac gtgccacgca ccccctcccc 1320

ccaccgagac ttatatttac acactttaac gcggttttct atatttaacg agttcaggca 1380

cctgcatttt cttcacattt ggcctgttta aatgaaattt ctcgcgtttg cgtctctgga 1440

gcgtcgaatt tttcccattc tcataaaaga agctgcattt tccactagtt tggtgtttgt 1500

tactcctttg ttttcacttg tttgatccag ttgttcctat caacatacta gaa 1553

<210>2

<211>32

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

cgcggatcca tactatacaa ttgtaaaata ca 32

<210>3

<211>29

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

tccccgcggt tctagtatgt tgataggaa 29

<210>4

<211>53

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

atttgcggcc gcccgcggag gcctatggta gatctgacta gtaaaggaga aga 53

<210>5

<211>27

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

cggggtacct cacacgtggt ggtggtg 27

Claims

1. A promoter is characterized in that the nucleotide sequence of the promoter is shown as SEQ ID NO. 1.

2. A genetic construct comprising the promoter of claim 1.

3. The genetic construct of claim 2, wherein said genetic construct comprises said promoter, a heterologous nucleotide sequence operably linked to said promoter, and a 3' transcription terminator.

4. An expression vector comprising the promoter of claim 1.

5. Use of the promoter of claim 1 for regulating a gene, wherein the use comprises transforming a genetic construct comprising the promoter into a yeast cell, culturing the genetic construct under acidic conditions, wherein the promoter of the genetic construct is linked to a heterologous nucleotide sequence, wherein the heterologous nucleotide sequence is under the control of the promoter.

6. A recombinant bacterium comprising the promoter according to claim 1.

7. The recombinant bacterium according to claim 6, wherein the recombinant bacterium is obtained by transforming an expression cassette containing a promoter, a heterologous gene sequence, and a terminator into a host cell, using a bacterium, an alga, or a fungus as the host cell.