CN107973842B

CN107973842B - Application of protein PpPYL2 in regulation and control of plant stress resistance

Info

Publication number: CN107973842B
Application number: CN201610912834.9A
Authority: CN
Inventors: 何奕騉; 胡勇; 包方
Original assignee: Capital Normal University
Current assignee: Capital Normal University
Priority date: 2016-10-19
Filing date: 2016-10-19
Publication date: 2019-12-13
Anticipated expiration: 2036-10-19
Also published as: CN107973842A

Abstract

The invention discloses application of a protein PpPYL2 in regulation and control of plant stress resistance. The protein PpPYL2 is a1) or a2) or a 3): a1) the amino acid sequence is protein shown as a sequence 2 in a sequence table; a2) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 2 in the sequence table; a3) the protein related to stress resistance is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table. Experiments prove that the transgenic plant obtained by introducing the coding gene of the protein PpPYL2 into the wild Chlamydomonas CC-1690wild type mt + [21gr ] has increased stress resistance. Therefore, the protein PpPYL2 has important application value in regulating and controlling the stress resistance of plants.

Description

Application of protein PpPYL2 in regulation and control of plant stress resistance

Technical Field

The invention relates to the technical field of biology, in particular to application of a protein PpPYL2 in regulation and control of plant stress resistance.

Background

Stress factors such as drought, high salt and the like in the natural environment have important influence on the growth and development of plants, and the large-scale yield reduction of the plants can be caused in severe cases. Bioreactors are producers of cell products of modern biotechnology genetic engineering, which are used to introduce a gene of interest into an organism for the production of the product of the gene of interest. Many plants are used as bioreactors, especially unicellular algae plants. At present, algae plants serving as bioreactors are widely applied to the aspects of oil production, secondary metabolite extraction, medicine production and the like, but the improvement of the stress resistance of the plants is a technical problem which needs to be solved urgently because the algae plants are susceptible to the influence of the environment in the large-scale culture process to affect the growth and face the infection of other organisms (such as other wild algae) and various diseases.

Bryophytes are land pioneer plants appearing 5 million years ago in ancient Otaotan, and gametophytes of 'stem-leaf bodies' are used as main vegetative growth stages in the life history of the bryophytes. The leaf of the 'stem leaf body' consists of a single layer of cells, only consists of a few layers of cells at the 'middle rib' position, has no tissue structures for regulating and controlling water metabolism, such as a conduction tissue, an air hole and the like, and keeps obvious characteristics of aquatic plants. Due to the lack of water transport and regulation systems, the original moss when leaving water and landing must face the stresses of water loss and sudden temperature change. The enormous selection pressure forces bryophytes to evolve stress response mechanisms different from vascular plants (e.g. ferns, spermatophytes), e.g. some stress resistance genes present in bryophyte cells can protect the cells from stress damage.

physcomitrella patens is a bryophyte and is an ideal species for researching the evolution process of aquatic plants to terrestrial plants.

Disclosure of Invention

The invention aims to solve the technical problem of how to improve the stress resistance of plants.

In order to solve the technical problems, the invention firstly provides the application of the protein PpPYL2 in regulating and controlling the stress resistance of plants; the protein PpPYL2 is a1) or a2) or a 3):

a1) The amino acid sequence is protein shown as a sequence 2 in a sequence table;

a2) A fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 2 in the sequence table;

a3) The protein related to stress resistance is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table.

Wherein, the sequence 2 in the sequence table can be composed of 194 amino acid residues.

In order to facilitate the purification of the protein in a1), the amino terminal or the carboxyl terminal of the protein shown in the sequence 2 in the sequence table can be connected with a label shown in the table 1.

TABLE 1 sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein PpPYL2 of a3) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

the protein PpPYL2 of a3) above may be synthesized by the hand of man, or may be obtained by synthesizing the coding gene and then expressing it biologically.

The gene encoding the protein PpPYL2 of a3) above may be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in sequence 1 of the sequence listing, and/or performing missense mutation of one or several base pairs, and/or connecting the coding sequence of the tag shown in table 1 above to the 5 'end and/or 3' end thereof.

The application of the nucleic acid molecule for coding the protein PpPYL2 in regulating and controlling the stress resistance of plants also belongs to the protection scope of the invention.

The nucleic acid molecule for coding the protein PpPYL2 can be a DNA molecule shown as b1) or b2) or b3) as follows:

b1) The nucleotide sequence is a DNA molecule shown as a sequence 1 in a sequence table;

b2) A DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by b1) and codes the protein PpPYL 2;

b3) A DNA molecule which is hybridized with the nucleotide sequence limited by b1) or b2) under strict conditions and codes the protein PpPYL 2.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

wherein, the sequence 1 in the sequence table is composed of 585 nucleotides, and the amino acid sequence shown as the sequence 2 in the coding sequence table.

The nucleotide sequence of the protein PpPYL2 of the invention can be easily mutated by a person skilled in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of the protein PpPYL2 isolated in the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the protein PpPYL2 and have the function of the protein PpPYL 2.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein consisting of the amino acid sequence shown in sequence No.2 of the sequence Listing of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

in the above application, the plant may be any one of the following c1) to c 5): c1) a dicotyledonous plant; c2) a monocot plant; c3) physcomitrella patens; c4) chlamydomonas sp; c5) wild type Chlamydomonas CC-1690wild type mt + [21gr ].

In the above application, the stress resistance may be salt resistance and/or drought resistance.

In order to solve the problems, the invention also provides a method for cultivating the stress-resistant transgenic plant.

The method for cultivating the stress-resistant transgenic plant provided by the invention can be specifically a method I, and comprises the following steps: increasing the expression level of the coding gene of the protein PpPYL2 in a receptor plant to obtain a transgenic plant with higher stress resistance than the receptor plant.

The method for cultivating the stress-resistant transgenic plant provided by the invention can be specifically a method II, and comprises the following steps: increasing the activity of the protein PpPYL2 as defined in claim 1 in a recipient plant to obtain a transgenic plant with higher stress resistance than the recipient plant.

In the above method, the encoding gene of the protein PpPYL2 may be a DNA molecule represented by b1) or b2) or b3) as follows:

In the above method, the recipient plant may be any one of the following c1) to c 5): c1) a dicotyledonous plant; c2) a monocot plant; c3) physcomitrella patens; c4) chlamydomonas sp; c5) wild type Chlamydomonas CC-1690wild type mt + [21gr ].

In the above method, the stress resistance is salt resistance and/or drought resistance.

In the above method, the "increasing the expression level of the gene encoding the protein PpPYL2 in the recipient plant" or the "increasing the activity of the protein PpPYL2 in the recipient plant" may be performed by introducing a recombinant vector into the recipient plant; the recombinant vector can be a recombinant plasmid obtained by inserting the coding gene of the protein PpPYL2 into a starting plasmid.

The recombinant vector can be specifically a recombinant plasmid pChlam-PpPYL 2. The recombinant plasmid pChlam-PpPYL2 can be specifically a fragment between restriction endonucleases Nde I and Xba I recognition sequences of a vector pChlamiRNA3int1 (the vector pChlamiRNA3int1 is cut into a large fragment and a small fragment by the restriction endonucleases Nde I and Xba I, and the DNA is the small fragment) and is replaced by a DNA molecule shown as a sequence 3in a sequence table.

The application of the method in plant breeding or bioreactor preparation also belongs to the protection scope of the invention.

Experiments prove that the protein PpPYL2 provided by the invention can improve the stress resistance of plants: compared with wild type chlamydomonas or empty vector chlamydomonas, the drought resistance and salt resistance of the chlamydomonas with the PpPYL2 gene are obviously improved. The result shows that the protein PpPYL2 can be used for improving the stress resistance of the chlamydomonas and has an important effect on breeding new stress-resistant materials. The protein PpPYL2 has important application value in regulating and controlling the stress resistance of plants.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification products.

FIG. 2 is a schematic diagram of the structure of the recombinant plasmid pChlam-PpPYL 2.

FIG. 3 is a comparison between before and after screening of Chlamydomonas paramomycin transgenic for PpPYL2 gene.

FIG. 4 shows the results of molecular detection.

FIG. 5 shows the real-time quantitative detection results.

Fig. 6 is a plot of a growth curve.

FIG. 7 shows the identification of salt resistance of Chlamydomonas transformed with PpPYL2 gene in solid medium.

FIG. 8 shows the identification of salt resistance of Chlamydomonas transformed with PpPYL2 gene in liquid medium.

FIG. 9 shows the identification of salt resistance of Chlamydomonas transformed with PpPYL2 gene in liquid medium.

FIG. 10 shows the identification of drought resistance of PpPYL2 transgenic Chlamydomonas in solid medium.

FIG. 11 shows the identification of drought resistance of Chlamydomonas transformed with PpPYL2 gene in liquid medium.

FIG. 12 shows the identification of drought resistance of Chlamydomonas transformed with PpPYL2 gene in liquid medium.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention.

The experimental procedures in the following examples are conventional unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

the quantitative tests in the following examples, all set up three replicates and the results averaged.

Physcomitrella patens and BCD solid media are described in the following references: cove DJ, Perroud PF, Charron AJ, McDaniel SF, Khandelwal A, Quatrao RS. isolation of DNA, RNA, and protein from the mobile Physcomitrella tissues, proteins, Cold Spring Harb protocol.2009Feb; 2009(2) pdb.prot5146.doi:10.1101/pdb.prot5146. Physcomitrella patens is available to the public from university of capital (i.e. at the applicant) for the purpose of repeating the experiments of the present application.

The wild type Chlamydomonas CC-1690wild type mt + [21gr ] is a product (the website is http:// www.chlamycollection.org /) of the Chlamydomonas center of the American Duke university, and the wild type Chlamydomonas CC-1690wild type mt + [21gr ] is hereinafter abbreviated as 21gr or wild type Chlamydomonas or WT.

The vector pChlamiRNA3int1 is described in the following documents: molnar A, Bassett A, Thuenemann E, Schwach F, Karkare S, Ossowski S, Weigel D, Baulcombe D. Highly specific genetic engineering by specific microRNAs in the unsolluminater alga Chlamydomonoreinharmorph [ J ]. Plant Journal, 2009, 58(1):165-174.

The agarose gel recovery kit is a product of Tiangen Biotechnology (Beijing) Co. RNeasy plant mini Kit is a product of QIAGEN. The reverse transcription kit is a product of TAKARA company.

TAP liquid Medium: NH (NH)₄Cl 0.4g/L，MgSO₄·7H₂O 0.1g/L，CaC1₂·2H₂O 0.05g/L，K₂HPO₄ 0.108g/L，KH₂PO₄0.056g/L, Trisbase 2.423g/L, Hunter's trace elements (1 mL/L), glacial acetic acid (1 mL/L); the balance of water; the Hunter's trace elements are formulated as follows: h₃BO₄ 11.4g/L，ZnSO₄·7H₂O 22.0g/L，MnCl₂·4H₂O 5.06g/L，CoCl₂·6H₂O 1.61g/L，CuSO₄·5H₂O 1.57g/L，(NH₄)₆Mo₇O₂₄·4H₂O 1.10g/L，FeSO₄·7H₂O4.99g/L, and the balance of water.

TAP solid Medium: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL to obtain a medium.

paromomycin plate: TAP solid medium containing 10. mu.g/mL of paromomycin was poured into a petri dish while it was hot, to obtain a paromomycin plate.

TAP solid plate: agar powder was added to the TAP liquid medium to a concentration of 1.5g/100mL, and the mixture was poured into a petri dish while it was hot to obtain a TAP solid plate.

Salted TAP solid plate 1: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, NaCl was added to a concentration of 150mM, and the mixture was poured into a petri dish while it was hot to obtain a salted TAP solid plate 1.

Salted TAP solid plate 2: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, NaCl was added to a concentration of 200mM, and the mixture was poured into a petri dish while it was hot to obtain a salted TAP solid plate 2.

Salted TAP solid plate 3: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, NaCl was added to a concentration of 250mM, and the mixture was poured into a petri dish while it was hot to obtain a salted TAP solid plate 3.

Drought TAP solid plate 1: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, mannitol was added to a concentration of 300mM, and the mixture was poured into a petri dish while it was hot to obtain a dry TAP solid plate 1.

Drought TAP solid plate 2: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, mannitol was added to a concentration of 450mM, and the mixture was poured into a petri dish while it was hot to obtain a dry TAP solid plate 2.

Drought TAP solid plate 3: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, mannitol was added to a concentration of 600mM, and the mixture was poured into a petri dish while it was hot to obtain a dry TAP solid plate 3.

Drought TAP solid plate 4: agar powder was added to TAP liquid medium to a concentration of 1.5g/100mL, mannitol was added to a concentration of 750mM, and the mixture was poured into a petri dish while it was hot to obtain a dry TAP solid plate 4.

Example 1 cloning of PpPYL2 Gene

The applicant of the present invention cloned the PpPYL2 gene from physcomitrella patens. The specific method comprises the following steps:

1. Obtaining a template

Culturing in BCD solid culture medium under illumination (temperature 25 deg.C, relative humidity 70%, continuous illumination, illumination intensity 40-60 μmol/m)².s^-1)7 days old Physcomitrella patens, then total RNA of the Physcomitrella patens is extracted by Trizol method, and then first strand cDNA is reverse transcribed by reverse transcriptase.

2. Artificially synthesizing a primer F: 5' -GTCATGCAGGAGAAACAGGGGCGG-3' (double underlined recognition sequence for restriction enzyme Nde i) and R: 5'

-GTC CTAAGCGTAATCTGGAACATCGTATGGGTACGGTGCCGCTGGTTTCTCGTTG-3' (box is the recognition sequence of restriction enzyme Xba I, single underlined is the coding sequence of molecular tag Ha tag).

3. After completion of steps 1 and 2, PCR amplification was carried out using the cDNA obtained in step 1 as a template and F and R as primers to obtain a double-stranded DNA molecule of about 630bp (see FIG. 1), which was then recovered with an agarose gel recovery kit to obtain DNA fragment 1. The DNA fragment 1 contains a double-stranded DNA molecule (PpPYL 2 gene for short) shown as a sequence 1 in a sequence table and codes a protein (PpPYL 2 protein or protein PpPYL2 for short) shown as a sequence 2 in the sequence table.

example 2 obtaining of Chlamydomonas transformed with PpPYL2 Gene

Construction of recombinant plasmid

1. Construction of recombinant plasmid pChlam-PpPYL2

(1) the DNA fragment 1 obtained in step 3 of example 1 was digested simultaneously with restriction enzymes Nde I and Xba I, and the DNA fragment 2 of about 630bp was recovered.

(2) The vector pChlamiRNA3int1 was digested with restriction enzymes Nde I and Xba I to recover about 6.2Kb of vector backbone.

(3) And connecting the DNA fragment 2 with a vector skeleton to obtain a recombinant plasmid pChlam-PpPYL 2.

According to the sequencing results, the recombinant plasmid pChlam-PpPYL2 was structurally described as follows: the fragment between the restriction enzyme Nde I and Xba I recognition sequences of the vector pChlamiRNA3int1 was replaced with the DNA molecule shown in sequence 3 of the sequence listing. The structure of the recombinant plasmid pChlam-PpPYL2 is schematically shown in FIG. 2. The recombinant plasmid pChlam-PpPYL2 has two selection markers of ampicillin and paromomycin.

Obtaining of di-and transgenic PpPYL2 gene Chlamydomonas

1. taking 300 mu L of wild type chlamydomonas culture solution (about 20 ten thousand chlamydomonas cells), putting the wild type chlamydomonas culture solution into a 250mL conical flask filled with 100mL of TAP liquid culture medium, and culturing for 4-5 days at 22 ℃ to obtain culture solution 1; the whole amount of the culture broth 1 was transferred to a 1L Erlenmeyer flask and cultured at 22 ℃ for 24 hours to obtain a culture broth 2.

2. Centrifuging the culture solution 2 at 3000rpm for 5-10min, discarding the supernatant, and collecting the precipitate 1.

3. 1mL of TAP liquid medium containing 60mM sorbitol was added to pellet 1, and resuspended to obtain resuspension 1.

4. a mixed solution was obtained by adding 300. mu.L of the resuspension solution 1 and 1. mu.g of the linearized recombinant plasmid pChlam-PpPYL2 (obtained by digesting the recombinant plasmid pChlam-PpPYL2 with the restriction enzyme NotI) to an electric cuvette (diameter: 4 mm). Placing the electric shock cup containing the mixed solution on ice for 5min, then placing the electric shock cup in an electric shock conversion instrument for conversion (the electric shock time is 9-13s), and finally placing the electric shock cup on ice for 15 min.

Electric shock parameters: voltage 800V, Capacitance 25 μ F; resistance (shunt Resistance) none, Cuvette: and 4 mm.

5. The mixture that completed step 4 was added to a 15mL test tube containing 10mL of TAP liquid medium containing 60mM sorbitol, and cultured overnight (rotation speed 30-40rpm) at 22 ℃ on a shaker to obtain culture solution 3.

6. Centrifuging the culture solution 3 at 3000rpm for 5-10min, discarding the supernatant, and resuspending the precipitate with the residual liquid to obtain resuspension solution 2. The heavy suspension 2 was uniformly spread on a paromomycin plate or TAP solid plate, dried, and then cultured overnight at 22 ℃ in an inverted manner, and then cultured normally (22 ℃) for 7 days, followed by observation.

The results are shown in FIG. 3 (TAP solid plate on the left and paromomycin plate on the right). 100 pieces of Chlamydomonas pseudotransferred PpPYL2 genes are obtained by screening paromomycin, each piece of Chlamydomonas and the descendant thereof are a strain, and the 100 pieces of Chlamydomonas pseudotransferred PpPYL2 gene strains are sequentially named as No. 1-No. 100.

Thirdly, obtaining the pseudo-transfer empty carrier chlamydomonas

Replacing the recombinant plasmid pChlam-PpPYL2 with the vector pChlamiRNA3int1 according to the method of the second step, and obtaining the pseudo-transfer empty vector Chlamydomonas in the other steps.

Four, molecular detection

Genomic DNA of wild type chlamydomonas, pseudo-transferred empty vector chlamydomonas, or pseudo-transferred PpPYL2 gene chlamydomonas was extracted and used as template, respectively, with F and R1: 5'-CAATCAGCGAAATCGGCCATCC-3' is used as a primer for PCR amplification.

The results of the PCR amplification are shown in FIG. 4(WT is wild type Chlamydomonas, M is Marker, No.1 is 1, No.2 is 2, No.3 is 3, No.4 is 4, No.5 is 5, No.6 is 6, No.7 is 7, No.8 is 8, No.9 is 9, No.10 is 10, No.11 is 11, No.12 is 12, No.13 is 13, No.14 is 14, No.15 is 15, No.16 is 16, No.17 is 17, No.18 is 18, No.19 is 19, No.20 is 20, No.21 is 21, No.22 is 22, No.23, No.24 is 24, No.25 is 25, No.26 is 26, No.26 is 27, No.27 is 28, No.29 is 29, No.30 is 30, No.31 is 31, No.32 is 32, No.33 is 33, No.26 is 37, No.35 is No.56, No.46 is No.46, No.56, No.46 is No.55, No.46 is No.56, No.46 is No.35, No.55, No.35, No.48, No.55, No.46 is No.55, No.35, No.46 is No.35, No.55, no.60, No.61, No.62, No.63, No.64, No.65, No.66, No.67, No.68, No.69, No.70, No.71, No.72, No.73, No.74, No.75, No.76, No.77, No.78, No.79, No.80, No.81, No.82, No.83, No.84, No.85, No.86, No.87, No.88, No.90, No.92, No.95, No.100, No.95 and No.100, respectively, and the extended band 691bp of the Chlamydomonas strain. The results showed that neither wild type Chlamydomonas nor the empty vector-pseudotrans Chlamydomonas could amplify the band of about 691bp, whereas 50 of the 92 randomly selected Chlamydomonas pseudotrans PpPYL2 genes amplified the band of 691 bp. Thus, No.1, No.2, No.3, No.5, No.6, No.9, No.10, No.11, No.12, No.15, No.17, No.23, No.24, No.26, No.27, No.28, No.29, No.30, No.31, No.32, No.33, No.34, No.35, No.38, No.39, No.41, No.42, No.43, No.44, No.45, No.46, No.48, No.51, No.57, No.59, No.64, No.67, No.68, No.70, No.71, No.72, No.73, No.74, No.75, No.78, No.79, No.81, No.85, No.86 and No.92 were identified as vectors for the transfer of PpPL 2, and the P.8978 were identified as vectors for the P.g.

Fifth, transcriptional analysis

Three replicates were performed, each replicate following the following procedure:

(1) obtaining a sample

mu.L of No.1 culture medium (about 10) was taken⁵Individual chlamydomonas cells), centrifuging, and collecting the precipitate, wherein the precipitate is the sample 1.

Sample 2, sample 3, sample 4, sample 5, sample 6, sample 7, sample 8, sample 9, sample 10, sample 11 and sample 12 were obtained by replacing sample 1 with sample 2, sample 3, sample 5, sample 6, sample 9, sample 15, sample 17 and sample 23, respectively, according to the above method, and the other steps were not changed.

take 300. mu.L of wild type algal strain culture medium (about 10)⁵Individual chlamydomonas cells), centrifuging, and collecting the precipitate, wherein the precipitate is the sample 13.

Collecting 300 μ L of the culture solution (about 10 μ L) of the Pericaceae⁵Individual chlamydomonas cells), centrifuging, and collecting the precipitate, wherein the precipitate is the sample 14.

(2) Real-time quantitative detection

Extracting total RNA of the samples (sample 1, sample 2, sample 3, sample 4, sample 5, sample 6, sample 7, sample 8, sample 9, sample 10, sample 11, sample 12, sample 13 or sample 14) in the step (1) by using an RNeasy plant mini Kit, and performing reverse transcription on the total RNA to obtain a cDNA solution, wherein the concentration of DNA in the cDNA solution is 200 ng/. mu.L.

The cDNA solution is used as a template to quantitatively detect the relative expression quantity of the PpPYL2 gene in the sample in real time (the CBLP gene is used as an internal reference gene).

Primers for identifying the PpPYL2 gene were 5'-GCCGGATTTCCAGTTCCTGTT-3' and 5'-AGCAACTCGTGCTTGTGGAACC-3'. Primers for identifying the CBLP gene were 5'-TGGGACAAGATGGTCAAGGTCTG-3' and 5'-CACCAGGTTGTTCTTCAGCTTGC-3'.

The relative expression level of the PpPYL2 gene in different strains was analyzed by the 2-Delta CT method. The results showed (FIG. 5) that the PpPYL2 gene of No.11 was expressed in the highest relative amount. No significant difference exists in the relative expression amounts of the PpPYL2 genes of the wild type strains, No.1, No.5, No.6 and No.10 and the empty vector chlamydomonas. No.2 and No.23 were selected for the following experiments.

Sixth, growth Curve analysis

mu.L of a wild-type strain culture solution (about 10 ten thousand Chlamydomonas cells) was taken and placed in a 250mL Erlenmeyer flask containing 100mL of TAP liquid medium, and cultured at 22 ℃ for 6 days. The absorbance at 750nm of the culture was measured every 24 hours from the time when wild type Chlamydomonas was placed in a 250mL Erlenmeyer flask (day 1). And drawing a growth curve of the wild type chlamydomonas by taking the culture time as an abscissa and taking the light absorption value at 750nm as an ordinate. The experiment was repeated three times and the mean value was taken.

According to the method, the wild type chlamydomonas is replaced by No.2, and other steps are not changed, so that the No.2 growth curve is obtained.

According to the method, the wild type chlamydomonas was replaced by No.23, and the other steps were not changed, to obtain the growth curve of No. 23.

According to the method, the wild type chlamydomonas is replaced by the empty carrier chlamydomonas, and other steps are not changed, so that the growth curve of the empty carrier chlamydomonas is obtained.

The results of the experiment are shown in FIG. 6. The results show that the growth curves of wild type chlamydomonas, empty carrier chlamydomonas, No.2 and No.23 are S-shaped; on the 2 nd to 3 rd days of the experiment, all four algae strains are in logarithmic growth phase; on the 4 th day of the experiment, the four algal strains are in the stable period; on the 4 th day of the experiment, the absorbance values of the four algal strains are completely consistent. Thus, PpPYL2 gene had no effect on the growth of wild type chlamydomonas under normal culture conditions.

Example 3 characterization of stress resistance of Chlamydomonas transformed with PpPYL2 Gene

The Chlamydomonas to be detected is wild type Chlamydomonas, empty carrier-transferred Chlamydomonas, No.2 or No. 23.

first, identifying the salt resistance of Chlamydomonas transformed with PpPYL2 gene on solid plate

The experiment was repeated three times, each repetition of the steps as follows:

1. Inoculating 300 μ L of Chlamydomonas to be tested (about 10 ten thousand Chlamydomonas cells) in TAP liquid medium, and culturing at 22 deg.C to OD₇₅₀The yield was 1.3, and a culture broth was obtained.

2. Taking a culture solution, and diluting the culture solution by 1 time by using a TAP liquid culture medium to obtain a culture solution diluent A; taking a culture solution, and diluting the culture solution by 10 times by using a TAP liquid culture medium to obtain a culture solution diluent B; and (3) taking the culture solution, and diluting the culture solution by 100 times by using TAP liquid culture medium to obtain a culture solution diluent C.

3. mu.L of culture medium diluent (culture medium diluent A, culture medium diluent B, or culture medium diluent C) was uniformly applied to a solid plate, cultured at 22 ℃ for 7 days, and observed. The solid plate is TAP solid plate, salt-added TAP solid plate 1, salt-added TAP solid plate 2 or salt-added TAP solid plate 3.

Some experiments are shown in FIG. 7(A is TAP solid plate; B is SALT solid plate 3; wherein no-load is transferred empty carrier Chlamydomonas, WT is wild type Chlamydomonas, Ha 2 is No.2, Ha 23 is No.23, a is culture solution diluent A, B is culture solution diluent B, and c is culture solution diluent C): on the TAP solid plate, the growth state of each algae strain has no obvious difference; with the increase of the NaCl concentration, the more obvious the inhibition effect of the growth of the chlamydomonas to be detected is; on the TAP solid plate 3 with salt, the inhibiting effect of NaCl on transgenic algae strains No.2 and No.23 is obviously lower than that of wild Chlamydomonas; on each solid plate, there was no significant difference in the growth state of wild type chlamydomonas and empty vector chlamydomonas. The results show that the salt resistance of No.2 or No.23 is improved compared with the wild type Chlamydomonas.

Secondly, identifying the salt resistance of the Chlamydomonas transformed with PpPYL2 gene in a liquid culture medium

The experiment was repeated three times, each repetition of the steps as follows: mu.L of a culture solution of Chlamydomonas test (about 10 ten thousand Chlamydomonas cells) was inoculated into a TAP liquid medium or a TAP liquid medium containing 150mM NaCl, cultured at 22 ℃ for 4 days, and then the growth state of Chlamydomonas test was observed and the absorbance at 750nm thereof was measured.

The growth state of Chlamydomonas under test is shown in FIG. 8 (the left panel is TAP liquid medium, the right panel is TAP liquid medium containing 150mM NaCl), and the absorbance at 750nm of Chlamydomonas under test is shown in FIG. 9. In TAP liquid culture medium, the growth state of each algae strain has no obvious difference; in the TAP liquid medium containing 150mM NaCl, wild type Chlamydomonas and the empty vector-transferred Chlamydomonas were hardly able to grow, and the growth states of No.2 and No.23 were good.

the above results show that the salt resistance of No.2 or No.23 is improved as compared with that of the wild type Chlamydomonas.

Thirdly, identifying the drought resistance of the Chlamydomonas transformed with PpPYL2 gene on a solid plate

3. mu.L of culture medium diluent (culture medium diluent A, culture medium diluent B, or culture medium diluent C) was uniformly applied to a solid plate, cultured at 22 ℃ for 7 days, and observed. The solid plate is TAP solid plate, drought TAP solid plate 1, drought TAP solid plate 2, drought TAP solid plate 3 or drought TAP solid plate 4.

Some experiments are shown in figure 10(A is TAP solid plate, B is drought TAP solid plate 1, C is drought TAP solid plate 2, D is drought TAP solid plate 3, E is drought TAP solid plate 4, wherein vector is emptying-carrier chlamydomonas, WT is wild type chlamydomonas, Line2 is No.2, Line23 is No.23, a is culture solution diluent A, B is culture solution diluent B, and C is culture solution diluent C): on the TAP solid plate, the growth state of each algae strain has no obvious difference; with the increase of the concentration of the mannitol, the more obvious the inhibition effect of the growth of the chlamydomonas to be detected is; on the drought TAP solid plate 4, the suppression effect of mannitol on transgenic algae strains No.2 and No.23 is obviously lower than that of wild Chlamydomonas; on each solid plate, there was no significant difference in the growth state of wild type chlamydomonas and empty vector chlamydomonas. The results show that the drought resistance of No.2 or No.23 is improved compared with wild type Chlamydomonas.

4. Identification of drought resistance of PpPYL 2-transgenic Chlamydomonas in liquid culture medium

The experiment was repeated three times, each repetition of the steps as follows: mu.L of a culture solution of Chlamydomonas test (about 10 ten thousand Chlamydomonas cells) was inoculated into TAP liquid medium or TAP liquid medium containing 450mM mannitol, cultured at 22 ℃ for 5 days, and then the growth state of Chlamydomonas test was observed and the absorbance at 750nm thereof was measured.

The growth state of Chlamydomonas under test is shown in FIG. 11 (the left panel is TAP liquid medium, the right panel is TAP liquid medium containing 450mM mannitol), and the absorbance at 750nm of Chlamydomonas under test is shown in FIG. 12. In TAP liquid culture medium, the growth state of each algae strain has no obvious difference; in TAP liquid medium containing 450mM mannitol, the growth state of wild type Chlamydomonas and empty vector-transferred Chlamydomonas was poor, and the growth state of No.2 and No.23 was good.

The above results show that the drought resistance of No.2 or No.23 is improved as compared with that of wild type Chlamydomonas.

Claims

1. The application of the protein PpPYL2 in regulating and controlling the stress resistance of plants; the protein PpPYL2 is a protein shown in a sequence 2 in a sequence table;

The plant is chlamydomonas;

The stress resistance is salt resistance and/or drought resistance.

2. Use of a nucleic acid molecule encoding the protein PpPYL2 of claim 1 for modulating stress resistance in a plant;

The plant is chlamydomonas;

the stress resistance is salt resistance and/or drought resistance.

3. Use according to claim 2, characterized in that: the nucleic acid molecule for coding the protein PpPYL2 in the claim 1 is a DNA molecule shown as a sequence 1 in a sequence table;

4. Use according to any one of claims 1 to 3, wherein: the Chlamydomonas is wild type Chlamydomonas CC-1690wild type mt + [21gr ].

5. A method for breeding stress-resistant transgenic plants, comprising the steps of: increasing the expression level of the coding gene of the protein PpPYL2 in the receptor plant as shown in claim 1 to obtain a transgenic plant with higher stress resistance than the receptor plant; the plant is chlamydomonas; the stress resistance is salt resistance and/or drought resistance.

6. The method of claim 5, wherein: the Chlamydomonas is wild type Chlamydomonas CC-1690wild type mt + [21gr ].