WO2021110119A1 - Transposase hautement active et son application - Google Patents

Transposase hautement active et son application Download PDF

Info

Publication number
WO2021110119A1
WO2021110119A1 PCT/CN2020/133796 CN2020133796W WO2021110119A1 WO 2021110119 A1 WO2021110119 A1 WO 2021110119A1 CN 2020133796 W CN2020133796 W CN 2020133796W WO 2021110119 A1 WO2021110119 A1 WO 2021110119A1
Authority
WO
WIPO (PCT)
Prior art keywords
transposase
nucleic acid
amino acid
sequence
seq
Prior art date
Application number
PCT/CN2020/133796
Other languages
English (en)
Chinese (zh)
Inventor
文雯
宋姗姗
刘韬
刘祥箴
金华君
钱其军
Original Assignee
上海细胞治疗集团有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 上海细胞治疗集团有限公司 filed Critical 上海细胞治疗集团有限公司
Publication of WO2021110119A1 publication Critical patent/WO2021110119A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Definitions

  • the invention belongs to the field of molecular biology and biomedicine, and specifically relates to a high-activity transposase and its application.
  • a DNA transposon is a mobile DNA sequence that can be transposed from one position in the genome to another through a series of processes such as cutting and reintegration.
  • PiggyBac (PB) transposon is a DNA transposon isolated from Trichoplusia ni TN368 cell line. It can be specifically inserted into the target site of "TTAA". With the help of transposase, PiggyBac transposes The transposon can accurately excise the target gene from the host without reshooting the host chromosome.
  • PB transposon has no potential viral genotoxicity, can carry a long foreign gene fragment (up to 150kb), and has strong transformability.
  • the transgene mediated by PB transposase has the characteristics of high integration efficiency, stable integration, long-term expression, single copy integration, insertable site location, and easy manipulation. It is often used in the production of transgenic mice and the genetic manipulation of mouse embryonic stem cells. , Gene mutagenesis and other genetic manipulation, pluripotent stem cell induction and other fields.
  • PB transposase The transposition activity of PB transposase is the highest among existing mammalian DNA transposons, and it has a very broad application prospect.
  • PB transposon system There have been many studies at home and abroad that use the PB transposon system as a method of gene editing to carry out transgene and gene mutation in a variety of organisms, including insect cells, protists, plants and vertebrates.
  • hDHFR human dihydrofolate reductase
  • the DNA transposon system consists of two parts, the transposons with inverted repeats (IRs) at both ends that can carry the target DNA fragments, and the transposase that can catalyze the "cut and paste" of the transposon.
  • the transposase first binds the IRs sequences on both sides of the transposon, and then removes the transposon from the host DNA site accurately and seamlessly, and finally integrates the DNA fragment into the new site.
  • the establishment of an efficient transposition system can achieve targeted knockout of target genes or targeted introduction of target genes, providing an effective vector tool for gene editing in mammalian cells.
  • the transposition efficiency of the transposable system determines the efficiency of gene editing, and a large part of the transposition efficiency depends on the expression level of the transposase. Therefore, increasing the transposase activity is a key technical point for increasing the transposable efficiency of transposons.
  • transposase The transposition activity of transposase is affected by the binding site, active site, structure and other factors. At present, the crystal structure of transposase has not been clearly analyzed, but some domains are considered to be important structures, and experiments have proved The activity of transposase can be affected by any non-special amino acid.
  • a hyperactive piggyBac transposase for mammals discloses a transposition efficiency of mPBase( The wild-type PiggyBac transposase optimized by mammalian codons) 10-fold high-activity PiggyBac transposase with amino acid mutations at the following positions (refers to the following existing high-activity transposase hyPBase, as shown in SEQ ID NO:1 Show): I30V, G165S, S103P, M282V, S509G, N570S and N538K.
  • PiggyBac transposon mutants and their applications are reapplications based on the priority of U.S. Provisional Application No. 61/155206.
  • the present invention provides a new high-activity transposase, which exhibits extremely high transposition activity in E. coli, insect cells, yeast cells, mammalian cells and other cells, which is higher than the existing high-activity transposase.
  • the active transposase hyPBase has a broad spectrum of application to host cells, and also has high transposition activity in mammalian cells, especially in human cells. It is the exploration of transposase, especially in human cells. The exploration of transposase provides new clues and basis.
  • the present invention also provides amino acid sequences and peptides that are the basis of the new highly active transposase of the present invention, as well as nucleotide sequences encoding the amino acid sequences, peptides and proteins of the highly active transposase of the present invention, and the nucleoside Acid sequence-based nucleic acids, nucleic acid constructs, recombinant vectors and host cells, and gene transfer systems and applications based on the above peptides, proteins, nucleic acids, nucleic acid constructs, recombinant vectors and host cell components.
  • the amino acid sequence of the existing highly active transposase hyPBase (shown in SEQ ID NO:1) is mutated to asparagine at position 92 and valine at position 119 to Alanine and glutamine at position 601 were mutated to arginine to obtain the target mutant amino acid sequence, as shown in SEQ ID NO: 2.
  • the transposition efficiency (30.9%), the target high-activity enzyme generated based on the amino acid sequence of SEQ ID NO: 2
  • the transposition efficiency of bz-hyPBase (51.7%) is increased by nearly 21%; in PBMC cells, compared with the existing high-activity transposase hyPBase, the transposition efficiency (9.81%) is codon-optimized and added to the nuclear localization signal system.
  • the transposition efficiency (19.4%) of the target high-activity bz-hyPBase enzyme generated based on the amino acid sequence of SEQ ID NO: 2 is increased by nearly 10%. This shows that the target high-activity enzyme based on the mutant amino acid sequence of the present invention exhibits better transposition activity than the existing high-activity transposase hyPBase, especially in mammalian cells and human-derived cells. Block activity.
  • some embodiments of the present invention provide a new highly active transposase, which contains one or more amino acid sequences shown in SEQ ID NO: 2, and the highly active transposase is in Escherichia coli , Insect cells, yeast cells and mammalian cells all show extremely high transposition activity, especially to meet the high transposition activity requirements of mammalian and human-derived cells.
  • Target mutant amino acid sequence containing nuclear localization sequence SEQ ID NO: 2
  • the amino acid sequence of the existing high-activity transposase hyPBase (shown in SEQ ID NO: 1) is the amino acid sequence obtained by performing the above amino acid mutations at positions 92, 119, and 601 alone or at any two positions, with one or Enzymes formed based on multiple mutant amino acid sequences also have the same or similar transposition efficiency as the target high-activity transposase bz-hyPBase described in the Examples of the present invention or the same or similar to the existing hyPBase, and are also protected by the present invention.
  • the mutant amino acid sequence of the new highly active transposase, and the enzyme formed based on the mutant amino acid sequence also belongs to the new highly active transposase to be protected by the present invention.
  • amino acid sequence 92, 119, and 601 of the existing highly active transposase hyPBase (shown in SEQ ID NO: 1), any two positions or three positions alone, any two positions or three positions are subjected to the above amino acid mutations.
  • the mutated amino acid sequence of, and the amino acid sequence obtained by performing one or more amino acid deletion, substitution, insertion or addition operations that still maintain or improve the enzyme activity also belong to the replacement scheme of the technical scheme of the present invention with the same or similar technical effects.
  • mutant amino acid sequence of the new highly active transposase to be protected by the present invention is also included, and enzymes formed on the basis of one or more of this mutant amino acid sequence also belong to the new mutant amino acid sequence to be protected by the present invention. Highly active transposase.
  • the amino acid sequence 92, 119, and 601 of the existing highly active transposase hyPBase (shown in SEQ ID NO: 1), any two positions or three positions alone, any two positions or three positions are subjected to the above amino acid mutations.
  • the mutant amino acid sequence also contains the amino acid sequence of the functional protein.
  • Add functional protein to the new high-activity transposase to improve or increase the function of the new high-activity transposase such as the amino acid sequence and expression of the nuclear localization signal EGFP green fluorescent protein amino acid sequence, tag protein amino acid sequence or antibody amino acid sequence, etc.
  • These functional proteins can improve the transposition activity of new highly active transposases.
  • nuclear localization signals can help improve the transposition activity of transposases; or can enhance the transposition monitoring function of highly active transposases, such as EGFP green Fluorescent protein or tag protein facilitates the qualitative and/or quantitative monitoring of transposase activity; or adds new functions to new highly active transposases, such as antibodies that can additionally increase immune activity.
  • highly active transposases such as EGFP green Fluorescent protein or tag protein facilitates the qualitative and/or quantitative monitoring of transposase activity
  • adds new functions to new highly active transposases, such as antibodies that can additionally increase immune activity such as antibodies that can additionally increase immune activity.
  • the present invention also protects the amino acid sequence 92, 119, and 601 of the existing high-activity transposase hyPBase (shown in SEQ ID NO: 1), any two or three of the above amino acid mutations.
  • the mutant amino acid sequence of the mutant amino acid sequence, and the derivative amino acid sequence obtained by performing one or more amino acid deletion, substitution, insertion or addition operations on the basis of the mutant amino acid sequence, which still maintains or improves the enzyme activity, is connected by peptide bonds after dehydration and condensation of the amino acids
  • the chain compound that is, peptide.
  • the number of peptides containing the above-mentioned mutant amino acids or the above-mentioned derived amino acid sequences can be one or more.
  • the peptide is also connected with the functional protein's amino acid sequence after being dehydrated and condensed by amino acids and then connected by peptide bonds, such as the peptide of nuclear localization signal, the peptide of expressing EGFP green fluorescent protein, and the peptide of tag protein. Segment or antibody peptide segment, etc.
  • the present invention uses the existing high-activity transposase hyPBase (shown in SEQ ID NO: 1) amino acid sequence 92, 119, 601 alone, any two positions or three positions to carry out the above amino acid mutations.
  • the sequence and the protein formed on the basis of the peptide fragment formed on the basis of the derived amino acid sequence belong to the new highly active transposase protected by the present invention.
  • the number of the above-mentioned mutant amino acid sequence, derivative amino acid sequence, and peptide segments formed on the basis of the above-mentioned mutant amino acid sequence and derivative amino acid sequence in the new highly active transposase is one or more.
  • a mutant nucleotide sequence encoding the above-mentioned new highly active transposase, peptide fragment and its amino acid sequence of the present invention a nucleotide sequence complementary to, hybridizing or overlapping with the mutant nucleotide sequence, or the mutant core
  • the nucleotide sequence undergoes base substitution, deletion or addition operations and has a nucleotide sequence encoding a new highly active transposase, or a nucleotide sequence that has at least 80% homology with the mutant nucleotide sequence, Preferably, a nucleotide sequence having at least 90% or more homology with the mutant nucleotide sequence, and preferably a nucleotide sequence having at least 96% or more homology with the mutant nucleotide sequence, all belong to the present invention.
  • the number of protected mutant nucleotide sequences encoding the new highly active transposase, peptides and amino acid sequences of the present invention can be one or multiple repeated copies
  • the nucleotide sequence encoding the amino acid sequence of the existing high-activity enzyme hyPBase (SEQ ID NO:1) is optimized by human codons to obtain a human codon optimized nucleotide sequence, and the nucleotide sequence is optimized with human codons Based on the sequence (SEQ ID NO: 4), the following base mutations were made: base T at 276 was mutated to base C, base T at 356 was mutated to base C, and base G at base 900 was mutated to Base A, base A at position 1802 is mutated to base G; a mutant nucleotide sequence encoding the amino acid sequence of the new highly active transposase bz-hyPBase (shown in SEQ ID NO: 2) of the present invention is obtained, as shown in SEQ ID NO: as shown in 3.
  • nucleotide sequence (SEQ ID NO: 4) of the existing high-activity enzyme hyPBase with nuclear localization sequence optimized by human-derived codons:
  • mutant nucleotide sequence (shown in SEQ ID NO: 3) undergoes base substitution, deletion or addition operations and has a nucleotide sequence encoding a new highly active transposase bz-hyPBase;
  • nucleotide sequence complementary to the mutant nucleotide sequence shown in SEQ ID NO: 3 and its base substitution, deletion or addition operation and a new highly active transposase
  • nucleotide sequence of bz-hyPBase The nucleotide sequence of bz-hyPBase
  • the same mutant nucleotide sequence has more than 80% homology and has a nucleotide sequence encoding the new highly active transposase bz-hyPBase; specifically, the same mutant nucleoside is preferred
  • the acid sequence has more than 90% homology and has a nucleotide sequence encoding the new highly active transposase bz-hyPBase; more preferably a homomutated nucleotide sequence (SEQ ID NO: 3) It has more than 96% homology and has a nucleotide sequence encoding the new highly active transposase bz-hyPBase;
  • the mutant nucleotide sequence encoding it also contains a nucleotide sequence encoding the functional protein, such as a nucleotide sequence encoding a nuclear localization signal , The nucleotide sequence expressing EGFP green fluorescent protein, the nucleotide sequence encoding the peptide of the tag protein or the nucleotide sequence encoding the antibody, etc.
  • the present invention also provides the above-mentioned nucleic acid polymerized from the mutant nucleotide sequence encoding the new highly active transposase of the present invention, or its peptide fragment, or its amino acid sequence.
  • the nucleic acid also contains a nucleotide sequence encoding the functional protein (nuclear localization signal, EGFP green fluorescent protein, tag protein or antibody).
  • the present invention also provides a nucleic acid construct to which one or more regulatory sequences are operably linked, and the regulatory sequences direct the target sequence to be expressed and coded in a host cell.
  • the expression codes include those involved in the production of proteins or polypeptides. Any step of the process, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion, etc.
  • the nucleic acid construct also contains the above-mentioned mutant nucleotide sequence encoding the new highly active transposase of the present invention, or its peptide fragment, or its amino acid sequence, or a nucleic acid polymerized from the mutant nucleotide sequence.
  • the present invention also provides a recombinant vector containing the above-mentioned mutant nucleotide sequence encoding the new highly active transposase of the present invention, or its peptide fragment, or its amino acid sequence, or polymerized by the mutant nucleotide sequence.
  • the recombinant vector includes a recombinant cloning vector, a recombinant eukaryotic expression vector or a recombinant viral vector.
  • the recombinant cloning vector includes a pRS vector, a T vector or a pUC vector, etc.
  • the recombinant eukaryotic expression vector includes pEGFP, pCMVp-NEO-BAN Or pSV2, etc.
  • the recombinant virus vector includes a recombinant adenovirus vector or a lentivirus vector.
  • the present invention also provides a host cell, which contains the above-mentioned mutant nucleotide sequence encoding the new highly active transposase of the present invention, or its peptide fragment, or its amino acid sequence, or is polymerized from the mutant nucleotide sequence.
  • the host cells include E. coli cells, insect cells, yeast cells, mammalian cells, and the like.
  • the present invention provides a new high-activity transposase used in the transposition system to improve the transposable activity of transposons, or a peptide segment constituting a new high-activity transposase, or a nucleic acid encoding the new high-activity transposase Construct, or recombinant vector encoding the new high-activity transposase or nucleic acid construct containing the new high-activity transposase and/or encoding the new high-activity transposase and/or encoding the new high-activity transposase Enzyme recombinant vector host cells (E.
  • the stable expression of the original host genes can be used to construct new gene transfer systems, and can also be used to prepare or use as drugs and/or preparations for genome research, gene therapy, cell therapy, or the induction and/or differentiation of pluripotent stem cells. It can be prepared or used as a tool for genome research, gene therapy, cell therapy, or multifunctional stem cell induction and/or differentiation.
  • the gene transfer system also contains a transposon gene, a nucleic acid or nucleic acid construct encoding a new highly active transposase integrated with the transposon gene; or a nucleic acid or nucleic acid construct encoding a new highly active transposase It is independent of the transposon gene; or the nucleic acid or nucleic acid construct encoding the new highly active transposase is located on the same recombinant vector as the transposon gene; or the nucleic acid or nucleic acid construct encoding the new highly active transposase and The transposon gene is located on a different recombinant vector; or the transposon gene is integrated into the nucleic acid construct encoding the new highly active transposase; or the transposon gene is integrated into the recombinant vector encoding the new highly active transposase ; Or the transposon gene is independent of the recombinant vector encoding the new high-activity transposase
  • the nucleic acid construct or the recombinant vector encoding the new high-activity transposase or the nucleic acid construct containing the new high-activity transposase and/or the nucleic acid construct encoding the new high-activity transposase and/or the new high-activity transposase The host cell of the recombinant vector of the transposase, or the above-mentioned gene transfer system.
  • the medicine used for genome research, gene therapy, cell therapy, or multifunctional stem cell induction and/or differentiation also contains pharmaceutically acceptable excipients, and can be prepared into any pharmaceutically feasible dosage form, and can also be supplemented at the same time Auxiliary treatment components.
  • a tool for genome research, gene therapy, cell therapy, or induction and/or differentiation of pluripotent stem cells containing the new highly active transposase of the present invention, or a nucleic acid construct encoding the new highly active transposase , Or a recombinant vector encoding the new high-activity transposase or a nucleic acid construct containing a new high-activity transposase and/or a nucleic acid construct encoding a new high-activity transposase and/or a new high-activity transposase
  • the host cell of the recombinant vector, or the above-mentioned gene transfer system is not limited to the recombinant vector, or the above-mentioned gene transfer system.
  • Figure 1 is a vector map of PRS316-URA-PBase in step (3) of Example 1.
  • Figure 2 is a schematic diagram of the flow of multiple accumulation error-prone PCR mutations of the transposase in step (3) of Example 1 (above) and the transposase fragments and linearized vectors recovered by the error-prone PCR are transformed into a 10:1 molar ratio
  • Schematic diagram of the ura-deficient yeast strain (the figure below).
  • Figure 3 is a schematic diagram of the mutant library and screening of high-efficiency transposase in step (3) of Example 1.
  • Figure 4 is a diagram of the plasmid PRS316-URA-PBase in Example 2 and the working principle diagram of the plasmid (A), WT PBase, hyPBase, optimized hyPBase, and bz-hyPBase in the yeast transposition visual diagram (B), WT PBase, hyPBase, Statistical graph of the transposition of optimized hyPBase, bz-hyPBase in yeast (C) Statistic histogram of the transposition of WT PBase, hyPBase, optimized hyPBase, and bz-hyPBase in yeast (D).
  • Example 5 is a schematic diagram of the structure of ploxP-bz-HyPB plasmid in Example 3.
  • Figure 6 is a schematic diagram of the pSAD-EGFP plasmid structure in Example 3.
  • FIG. 7 is a comparison diagram of the efficiency of editing CHO cell genome using optimized hyPBase and bz-hyPBase transposase in Example 3. It can be seen that the transposition efficiency of bz-hyPBase in CHO cells is significantly increased.
  • FIG. 8 is a comparison diagram of the efficiency of preparing CAR T cells using optimized hyPBase and bz-hyPBase transposase in Example 4. It can be seen that the transposition efficiency of bz-hyPBase in multiple PBMC donors is significantly increased.
  • the highly active transposase provided by the present invention exists in one, any two or all three positions selected from the 92nd, 119th and 601th positions Amino acid mutations, including amino acid insertions, deletions or substitutions; or compared to the transposase shown in SEQ ID NO: 11, in one, any two or all three selected from the 82nd, 109th and 591th positions There are amino acid insertions, deletions or substitutions at these positions.
  • a preferred mutation is a substitution mutation.
  • the highly active transposase of the present invention has mutations in the above three positions, especially amino acid substitutions have occurred.
  • the amino acid residues at the remaining positions of the transposase of the present invention are the same as the amino acid residues at the corresponding positions of SEQ ID NO: 1 or 11 except for the mutation at the position.
  • the amino acid sequence of the highly active transposase of the present invention has one, any two or all three of the following substitution mutations compared with the sequence shown in SEQ ID NO:1: Isoleucine at position 92
  • the acid mutation is asparagine, the valine at position 119 is mutated to alanine, and the glutamine at position 601 is mutated to arginine; further preferably, the highly active transposase of the present invention has all the above three positions.
  • the substitution mutation has occurred.
  • the amino acid sequence of the highly active transposase of the present invention has one, any two or all three of the following substitution mutations compared with the sequence shown in SEQ ID NO: 11: Isoleucine at position 82
  • the acid mutation is asparagine, the valine at position 109 is mutated to alanine, and the glutamine at position 591 is mutated to arginine; further preferably, the highly active transposase of the present invention has all the above three positions.
  • the substitution mutation has occurred.
  • the amino acid residues at the remaining positions of the transposase of the present invention are the same as the amino acid residues at the corresponding positions of SEQ ID NO: 1 or 11 except for the mutation at the position.
  • the amino acid sequence of the highly active transposase of the present invention is shown in SEQ ID NO: 12. In a particularly preferred embodiment, the amino acid sequence of the highly active transposase of the present invention is shown in SEQ ID NO: 2.
  • the amino acid sequence of the transposase shown in SEQ ID NO: 11 and 12 herein does not contain a nuclear localization sequence.
  • the present invention also includes the following transposase: Compared with SEQ ID NO: 1, except for one, any two or all three positions of the 92nd, 119th and 601th positions, the transposase described in any of the embodiments herein In addition to the mutations, there are one or more insertion, deletion and/or substitution mutations in the other one or more amino acid positions of SEQ ID NO: 1, or compared with SEQ ID NO: 11, except in the 82, 109 and In addition to the mutations described in any of the embodiments herein in one, any two or all three positions of position 591, there are one or more insertions in the other one or more amino acid positions of SEQ ID NO: 11, Deletion and/or substitution mutation, and the transposase still has the transposase activity described herein.
  • substitution mutations are substitution mutations, and more preferred are conservative substitutions.
  • substitution of amino acid residues with the same or similar properties usually does not significantly change the transposase activity of the resulting mutant.
  • amino acids whose side chain groups have the same polarity can be used for substitution.
  • amino acids can be divided into non-polar amino acids (hydrophobic amino acids) and polar amino acids (hydrophilic amino acids); among them, non-polar amino acids include alanine, valine, leucine, iso Leucine, proline, phenylalanine, tryptophan and methionine; polar amino acids include neutral amino acids, basic amino acids and acidic amino acids, among which neutral amino acids include serine, threonine, and cysteine , Tyrosine, asparagine and glutamine, basic amino acids include lysine, arginine and histidine, acidic amino acids include aspartic acid and glutamic acid.
  • non-polar amino acids include alanine, valine, leucine, iso Leucine, proline, phenylalanine, tryptophan and methionine
  • polar amino acids include neutral amino acids
  • basic amino acids and acidic amino acids among which neutral amino acids include serine, threonine, and cysteine
  • basic amino acids include ly
  • this type of transposase has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least SEQ ID NO:1. 99% sequence identity, and at least one, any two or all three of the 92nd, 119th and 601th positions have the substitution mutations described in any of the embodiments herein, or are similar to SEQ ID NO: 11.
  • the present invention provides a fusion protein, which contains the highly active transposase described in any embodiment of the present invention and a functional protein, or is formed or formed by the highly active transposase and the functional protein. composition. It should be understood that the fusion protein should at least retain the transposition activity of the highly active transposase described herein.
  • the functional protein is used to improve or increase the biological activity or biological function of the highly active transposase of the present invention.
  • Exemplary functional proteins include, but are not limited to, functional proteins used to increase the transposable activity of transposases, used to monitor the transposable function of transposases, and/or used to add new functions to transposases.
  • functional proteins include, but are not limited to, nuclear localization signal proteins/sequences, which can guide transposase to accumulate in the nucleus, thereby helping to improve the transposition efficiency of transposase; labeled proteins (such as fluorescent labeled proteins, such as green fluorescent protein (such as EGFP), red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, etc.) or tag protein (such as His6, Flag, GST, MBP, HA, Myc, His-Myc, etc.), used to enhance the transposition of transposase
  • the monitoring function facilitates the qualitative and/or quantitative monitoring of the transposase activity of the transposase; the antibody of interest is used to increase the new function of the transposase, such as increasing the immunogenicity.
  • An exemplary nuclear localization signal protein or sequence is the c-myc nuclear localization signal sequence, and its sequence may be as shown in the amino acid residues 3-11 of SEQ ID NO:1.
  • the amino acid sequence of the transposase has one, any two or all three substitution mutations as compared with the sequence shown in SEQ ID NO:1: position 92
  • the isoleucine is mutated to asparagine, the valine at position 119 is mutated to alanine, and the glutamine at position 601 is mutated to arginine; further preferably, the transposase is at the above three positions All have the substitution mutation; and further preferably, the amino acid residue at the remaining position of the transposase is the same as the amino acid residue at the corresponding position of SEQ ID NO:1.
  • the amino acid sequence of the transposase has one, any two or all three substitution mutations as compared with the sequence shown in SEQ ID NO: 11: Isoleucine at position 82
  • the transposase is mutated to asparagine, the valine at position 109 is mutated to alanine, and the glutamine at position 591 is mutated to arginine; further preferably, the transposase has been mutated at the above three positions.
  • Substitution mutation; and further preferably, the amino acid residue at the remaining position of the transposase is the same as the amino acid residue at the corresponding position of SEQ ID NO:1.
  • the amino acid sequence of the transposase in the fusion protein of the present invention is shown in SEQ ID NO: 2 or 12.
  • the transposase and the functional protein can be connected via a linker sequence.
  • the linker sequence may be a conventional linker, such as a linker sequence containing glycine and serine.
  • the transposase can be located at the N-terminal or C-terminal of the fusion protein; or, when the fusion protein has more than two functional proteins, the fusion protein can also be located between two or more functional proteins.
  • the present invention includes nucleic acid molecules whose polynucleotide sequence is the coding sequence of the transposase described herein or the complementary sequence of the coding sequence, or the coding sequence of the fusion protein described herein or the complementary sequence thereof.
  • the coding sequence of the transposase of the present invention has a base at one, any two, or all three of positions 276, 356, and 1802. Base mutation, optionally there is a base mutation at base 900.
  • base T at position 276 is mutated to base C
  • base T at position 356 is mutated to base C
  • base G at position 900 is mutated to base A
  • base A at position 1802 is mutated. Mutation to base G.
  • the polynucleotide sequence of the nucleic acid molecule of the present invention is shown in SEQ ID NO: 3.
  • the polynucleotide sequence of the nucleic acid molecule of the present invention is present at one, any two, or all three positions among the 246th, 326th, and 1772th positions.
  • Base mutation optionally there is a base mutation at base 870; preferably, the mutation at position 246 is a base T mutation to base C, and the mutation at position 326 is a base T mutation to a base C, the mutation at position 870 is a mutation of base G to base A, and the mutation at position 1772 is a mutation of base A to base G; more preferably, the polynucleotide sequence is as shown in SEQ ID NO: 14. Show. Here, the polynucleotide sequences shown in SEQ ID NOs: 13 and 14 do not contain the coding sequence of the nuclear localization sequence.
  • the polynucleotide sequence of the nucleic acid molecule of the present invention has at least 80% homology, preferably at least 90% homology, and more than the polynucleotide sequence described in SEQ ID NO: 4 or 13.
  • the base mutation is present at three positions, and the base mutation is optionally present at the 900th or 870th base.
  • nucleic acid construct containing the coding sequence of the transposase described in any embodiment herein or its complement, or the coding sequence of the fusion protein described in any embodiment herein or its complement.
  • the nucleic acid construct is an expression cassette, and in addition to the coding sequence, the expression cassette also contains a transcription termination sequence such as a PolyA tailing signal sequence and a promoter.
  • a transcription termination sequence such as a PolyA tailing signal sequence
  • promoters are well known in the art, and those skilled in the art can select a suitable promoter capable of promoting the expression of the transposase described herein or its fusion protein in the host according to the host used for expression.
  • the nucleic acid construct sequentially includes the following elements: a transposon 5'terminal repeat sequence (5'ITR), a polyclonal insertion site, a polyA tailing signal sequence, a transposon 3'terminal repeat sequence (3'ITR), the nucleic acid molecule described in any of the embodiments herein, and a promoter that controls the expression of the nucleic acid molecule.
  • the direction and/or order referred to in “sequentially” in the “sequentially including the following elements” refers to from upstream to downstream. In the present invention, unless otherwise specified, the direction along the aforementioned “forward direction” is from upstream to downstream, and the direction along the aforementioned “reverse direction” is from downstream to upstream.
  • the 5'end repeat sequence of the transposon is the 5'end repeat sequence of the PiggyBac transposon, and its nucleotide sequence is, for example, as shown in SEQ ID NO: 15; the 3'end of the transposon The repeat sequence is the 3'terminal repeat sequence of the PiggyBac transposon, and its nucleotide sequence is, for example, as shown in SEQ ID NO: 16.
  • the polyA tailing signal sequence has a polyA tailing signal function in both forward and reverse directions.
  • each of the above 6 elements is independently a single copy or multiple copies.
  • the above-mentioned 6 elements may be directly connected, or may contain other sequences such as linker or restriction site.
  • the above-mentioned "the polyA tailing signal sequence has a polyA tailing signal function in both forward and reverse directions" includes but is not limited to the following situations:
  • a polyA tailing signal sequence which has the function of polyA tailing signal in both forward and reverse directions;
  • the solution in 1) above is adopted.
  • the exogenous gene expression cassette and the PiggyBac transposase expression cassette can share a polyA tailing signal sequence, thereby reducing a polyA tailing signal sequence, embodying the principle of intensiveness, reducing the size of the plasmid, and helping in Under the premise of ensuring transfection efficiency, increase the capacity of the foreign gene expression cassette.
  • the PB expression cassette is placed in the same direction as the exogenous gene expression cassette, and two polyA tailed signal sequences are used, where the PB expression cassette is in front, and the polyA tailed signal sequence is placed in one of the ITRs and the exogenous gene.
  • gene promoters For example: the promoter that controls the expression of PB transposase, PB transposase coding sequence, transposon 5'terminal repeat sequence, polyA tail signal sequence 1, foreign gene promoter and foreign gene (multiple clone insertion site ), polyA tailing signal sequence 2, transposon 3'terminal repeat sequence; and the direction of the expression cassette of the PB transposase is the same as the direction of the expression cassette of the foreign gene.
  • the position of the 5'end repeat of the transposon and the 3'end of the transposon can be interchanged.
  • nucleotide sequence of the polyclonal insertion site is shown in SEQ ID NO: 17;
  • the nucleotide sequence of the polyA tailing signal sequence is shown in SEQ ID NO: 18; the sequence shown in SEQ ID NO: 18 has a polyA tailing signal function in both forward and reverse directions.
  • Exemplary promoters include, but are not limited to, CMV promoter, EF1 ⁇ promoter, SV40 promoter, Ubiquitin B promoter, CAG promoter, HSP70 promoter, PGK-1 promoter, ⁇ -actin promoter, TK promoter And GRP78 promoter.
  • One or more identical or different foreign genes of interest and optionally a promoter that controls the expression of the foreign gene can be operably inserted into the multiple cloning site of the nucleic acid construct of the present invention, or its multiple clones
  • the site is replaced with one or more identical or different exogenous gene coding sequences and optionally a promoter that controls the expression of the exogenous gene; the exogenous gene is independently a single copy or multiple copies.
  • the direction of the expression cassette of the transposase is opposite to the direction of the expression cassette of the foreign gene.
  • the exogenous gene is selected from a luciferin reporter gene (such as green fluorescent protein, red fluorescent protein, yellow fluorescent protein, etc.), luciferase genes (such as firefly luciferase, Renilla luciferase, etc.) ), natural functional protein genes (such as TP53, GM-CSF, OCT4, SOX2, Nanog, KLF4, c-Myc), RNAi genes and artificial chimeric genes (such as chimeric antigen receptor genes, Fc fusion protein genes, full length One or more of antibody genes, Nanobody genes).
  • a luciferin reporter gene such as green fluorescent protein, red fluorescent protein, yellow fluorescent protein, etc.
  • luciferase genes such as firefly luciferase, Renilla luciferase, etc.
  • natural functional protein genes such as TP53, GM-CSF, OCT4, SOX2, Nanog, KLF4, c-Myc
  • RNAi genes and artificial chimeric genes such as
  • expression cassette refers to the complete elements required to express a gene, including promoters, gene coding sequences, and PolyA tailing signal sequences.
  • nucleic acid construct is defined herein as a single-stranded or double-stranded nucleic acid molecule, and preferably refers to an artificially constructed nucleic acid molecule.
  • the nucleic acid construct further comprises one or more control sequences operably linked, and the control sequences can direct the coding sequence to be expressed in a suitable host cell under compatible conditions. Expression should be understood to include any steps involved in the production of a protein or polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • operably inserted/linked is defined herein as a conformation in which the regulatory sequence is located at an appropriate position relative to the coding sequence of the DNA sequence so that the regulatory sequence directs the expression of the protein or polypeptide.
  • the foreign gene promoter and the foreign gene coding sequence are placed at the multiple cloning site by DNA recombination technology.
  • the "operably linked” can be achieved by means of DNA recombination, specifically, the nucleic acid construct is a recombinant nucleic acid construct.
  • coding sequence is defined herein as the part of a nucleic acid sequence that directly determines the amino acid sequence of its protein product.
  • the boundary of the coding sequence is usually determined by the ribosome binding site immediately upstream of the 5'open reading frame of the mRNA (for prokaryotic cells) and the transcription termination sequence immediately downstream of the 3'open reading frame of the mRNA.
  • Coding sequences can include, but are not limited to DNA, cDNA, and recombinant nucleic acid sequences.
  • regulatory sequence herein is defined as including all components necessary or advantageous for expressing the peptide of the present invention.
  • Each control sequence may be naturally contained or foreign to the nucleic acid sequence encoding the protein or polypeptide.
  • regulatory sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal sequences, and transcription terminator. At a minimum, regulatory sequences should include promoters and termination signals for transcription and translation.
  • a regulatory sequence with a linker can be provided.
  • the control sequence may be a suitable promoter sequence, that is, a nucleic acid sequence recognized by the host cell expressing the nucleic acid sequence.
  • the promoter sequence contains transcriptional regulatory sequences that mediate the expression of the protein or polypeptide.
  • the promoter can be any nucleic acid sequence that is transcriptionally active in the host cell of choice, including mutant, truncated and hybrid promoters, and can be derived from extracellular or intracellular encoding homologous or heterologous to the host cell Protein or peptide gene.
  • the regulatory sequence can also be a suitable transcription termination sequence, that is, a sequence that can be recognized by the host cell to terminate transcription.
  • the termination sequence can be operably linked to the 3'end of the nucleic acid sequence encoding the protein or polypeptide. Any terminator that can function in the host cell of choice can be used in the present invention.
  • the control sequence can also be a suitable leader sequence, that is, an untranslated region of mRNA that is important for translation by the host cell.
  • the leader sequence is operably linked to the 5'end of the nucleic acid sequence encoding the polypeptide. Any leader sequence that can function in the host cell of choice can be used in the present invention.
  • the control sequence can also be a signal peptide coding region, which encodes an amino acid sequence linked to the amino terminus of a protein or polypeptide, which can guide the encoded polypeptide into the secretory pathway of cells.
  • the 5'end of the coding region of the nucleic acid sequence may naturally contain a signal peptide coding region in which the translation reading frame is naturally linked to the fragment of the coding region of the secreted polypeptide.
  • the 5'end of the coding region may contain a signal peptide coding region that is foreign to the coding sequence.
  • the coding sequence normally does not contain a signal peptide coding region, it may be necessary to add a foreign signal peptide coding region.
  • the natural signal peptide coding region can be simply replaced with a foreign signal peptide coding region to enhance polypeptide secretion.
  • any signal peptide coding region that can guide the expressed polypeptide into the secretory pathway of the host cell used can be used in the present invention.
  • the control sequence can also be a propeptide coding region, which encodes an amino acid sequence located at the amino terminus of the polypeptide.
  • the resulting polypeptide is called a zymogen or a propolypeptide.
  • the pro-polypeptide is usually inactive and can be converted into a mature active polypeptide by cleaving the pro-polypeptide from the pro-polypeptide through catalysis or autocatalysis.
  • the pro-peptide region is adjacent to the amino terminus of the polypeptide, and the signal peptide region is adjacent to the amino terminus of the pro-peptide region.
  • regulatory sequences that can regulate the expression of the polypeptide according to the growth of the host cell.
  • regulatory systems are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds) to turn on or turn off gene expression.
  • regulatory sequences are those that enable gene amplification.
  • the nucleic acid sequence encoding the protein or polypeptide should be operably linked to the regulatory sequence.
  • the invention provides recombinant vectors.
  • the recombinant vector may contain the nucleic acid molecule or nucleic acid construct described in any of the embodiments herein.
  • the recombinant vector can be a recombinant cloning vector, a recombinant eukaryotic expression vector or a recombinant virus vector.
  • the recombinant vector may contain other regulatory elements, including but not limited to leader sequence, polyadenylation sequence, propeptide sequence, enhancer, transcription terminator, resistance gene, etc.
  • the corresponding recombinant vector can be selected and constructed according to different purposes, so that it contains the required regulatory elements.
  • the recombinant cloning vector is preferably a pRS vector, a T vector or a pUC vector
  • the recombinant eukaryotic expression vector is preferably pEGFP, pCMVp-NEO-BAN or pSV2
  • the recombinant viral vector is preferably a recombinant adenovirus vector or a lentiviral vector.
  • the recombinant cloning vector is the nucleic acid construct according to any one of the embodiments of the present invention and pUC18, pUC19, pMD18-T, pMD19-T, pGM-T vector, pUC57, pMAX or pDC315 series vector A recombinant vector obtained by recombination;
  • the recombinant expression vector is the nucleic acid construct according to any embodiment of the present invention and the pCDNA3 series vector, pCDNA4 series vector, pCDNA5 series vector, pCDNA6 series vector, pRL series vector, pUC57 vector, pMAX A vector or a recombinant vector obtained by recombination of the pDC315 series vector;
  • the recombinant virus vector is a recombinant adenovirus vector, a recombinant adeno-associated virus vector, a recombinant retrovirus vector, a recomb
  • nucleic acid constructs and recombinant vectors can be constructed by methods well known in the art, and expressed by conventional methods, so as to prepare the transposase and fusion proteins described herein.
  • the present invention also provides a host cell, which contains the nucleic acid molecule, nucleic acid construct and/or recombinant vector described in any of the embodiments herein, or expresses the transposase and/or the transposase described in any of the embodiments herein Or fusion protein.
  • the host cell of the present invention is preferably an E. coli cell, an insect cell, a yeast cell or a mammalian cell.
  • the host cell is a recombinant mammalian cell; for example, a recombinant primary culture T cell, Jurkat cell, K562 cell, tumor cell, HEK293 cell or CHO cell.
  • the present invention also provides a gene transfer system, which contains the transposase, fusion protein, nucleic acid molecule, nucleic acid construct, recombinant vector or host cell described in any of the embodiments herein.
  • the gene transfer system further contains a transposon gene.
  • the nucleic acid molecule or nucleic acid construct described in any of the embodiments herein is integrated with a transposon gene; in some embodiments, the nucleic acid molecule or nucleic acid construct is relatively independent of the transposon gene In some embodiments, the nucleic acid molecule or nucleic acid construct and the transposon gene are located on the same recombinant vector; in some embodiments, the nucleic acid molecule or nucleic acid construct and the transposon gene are located On different recombinant vectors; in some embodiments, the transposon gene is integrated into the nucleic acid construct; in some embodiments, the transposon gene is integrated into the recombinant vector described in any of the embodiments herein On; In some embodiments, the transposon gene is transferred into the host cell described in any of the embodiments herein; in some embodiments, the transposon gene is located in the host described in any of the embodiments herein Extracellular.
  • the present invention also provides the use of the transposase, fusion protein, nucleic acid molecule, nucleic acid construct, recombinant vector, host cell or gene transfer system described in any of the embodiments herein in any of the following:
  • the present invention also provides a medicine and/or preparation for genome research, gene therapy, cell therapy, or induction and/or differentiation of pluripotent stem cells, containing the transposase, fusion protein, and nucleic acid described in any of the embodiments herein Molecules, nucleic acid constructs, recombinant vectors, host cells or gene transfer systems.
  • the present invention also provides a tool for genome research, gene therapy, cell therapy, or multifunctional stem cell induction and/or differentiation, which contains the transposase, fusion protein, nucleic acid molecule, and nucleic acid construct described in any of the embodiments herein Food, recombinant vector, host cell or gene transfer system.
  • the present invention includes the following items 1 to 18:
  • amino acid sequence of a highly active transposase containing one or more of the following amino acid sequences: (1) Amino acid mutations at the following positions of the amino acid sequence shown in SEQ ID NO:1 have transposase activity Amino acid sequence: at least one of amino acid 92, amino acid 119, or amino acid 601; preferably amino acid 92, amino acid 119, and amino acid 601 are simultaneously subjected to amino acid mutations; more preferably the isoleucine at 92 position Mutations to asparagine, valine at position 119 to alanine, and glutamine at position 601 to arginine; (2) In (1) the amino acid at position 92, amino acid 119 or amino acid 601 One or more amino acids other than amino acid mutations are deleted, substituted, inserted or added to obtain an amino acid sequence with transposase activity; preferably one or more of amino acid mutations other than amino acid 92, amino acid 119 and amino acid 601 are simultaneously undergone mutation The amino acid sequence with transposas:
  • amino acid sequence according to item 1 wherein the amino acid sequence also contains the amino acid sequence of a functional protein; the amino acid sequence of the functional protein is preferably an amino acid sequence for nuclear localization signal, an amino acid sequence for expressing EGFP green fluorescent protein , Tag protein amino acid sequence or antibody amino acid sequence, etc.
  • amino acid sequence of a highly active transposase containing one or more of the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence shown in SEQ ID NO: 2 at amino acid 92, amino acid 119, and amino acid 601
  • the amino acid sequence with transposase activity is obtained by deleting, replacing, inserting or adding one or more other amino acids.
  • Base C base G at position 900 is mutated to base A, base A at position 1802 is mutated to base G; or (2) a nucleotide sequence complementary to the mutated nucleotide sequence in (1); Or (3) a nucleotide sequence that overlaps with the mutated nucleotide sequence in (1) and has the same coding function; or (4) hybridizes with the mutated nucleotide sequence in (1) and has the same coding function (5) Substitution, deletion or addition of one or more bases in the nucleotide sequence of (1), (2), (3) or (4) except for the gene mutation site Nucleotides with the same coding function; or (6) Nucleosides that have at least 80% homology with the nucleotide sequence in (1), (2), (3) or (4) and have the same coding function Acid sequence; preferably a nucleotide sequence with at least 90% homology and the same coding function; more preferably a nucleotide sequence with at least 96% homology and the same coding function.
  • the nucleotide sequence described in item 6 or 7 also contains a nucleotide sequence encoding a functional protein, preferably a nucleotide sequence encoding a nuclear localization signal, a nucleotide sequence expressing EGFP green fluorescent protein, The nucleotide sequence encoding the peptide of the tag protein or the nucleotide sequence encoding the antibody.
  • a nucleic acid construct encoding the amino acid sequence described in any one of items 1 to 3 or the peptide fragment described in item 4 or the protein described in item 5.
  • a nucleic acid construct according to item 10 which contains the nucleotide sequence according to any one of items 6 to 8, or contains the nucleic acid according to item 9.
  • a recombinant vector containing the nucleotide sequence of any one of items 6-8, or the nucleic acid of item 9, or the nucleic acid construct of any one of items 10-11 The recombinant vector is preferably a recombinant cloning vector, a recombinant eukaryotic expression vector or a recombinant viral vector, the recombinant cloning vector is preferably a pRS vector, a T vector or a pUC vector, and the recombinant eukaryotic expression vector is preferably pEGFP, pCMVp-NEO- BAN or pSV2, the recombinant virus vector is preferably a recombinant adenovirus vector or a lentivirus vector.
  • a gene transfer system characterized in that it contains the peptide of item 4, or the protein of item 5, or the nucleic acid of item 9, or any one of items 10-11 The nucleic acid construct described in item 12, or the recombinant vector described in item 12, or the host cell described in item 13.
  • a gene transfer system characterized in that it further contains a transposon gene, the nucleic acid of item 9 or the nucleic acid construct of any one of items 10-11 and Transposon gene integration; or the nucleic acid of item 9 or the nucleic acid construct of any one of items 10-11 and the transposon gene are relatively independent; or the nucleic acid of item 9 or the nucleic acid of item 10-
  • the nucleic acid construct according to any one of items 11 and the transposon gene are located on the same recombinant vector; or the nucleic acid according to item 9 or the nucleic acid construct according to any one of items 10-11 and the transposon
  • the daughter gene is located on a different recombinant vector; or the transposon gene is integrated into the nucleic acid construct described in any one of items 10-11; or the transposon gene is integrated into the recombinant vector described in item 12; or
  • the transposon gene is transferred into the host cell described in item 13; or the transposon gene is located outside the host
  • a drug and/or preparation for genome research, gene therapy, cell therapy, or induction and/or differentiation of pluripotent stem cells containing the peptide described in item 4, or the protein described in item 5, Or the nucleic acid of item 9, or the nucleic acid construct of any one of items 10-11, or the recombinant vector of item 12, or the host cell of item 13, or the host cell of item 13 or 14- The gene transfer system described in any one of 15 items.
  • a tool for genome research, gene therapy, cell therapy, or induction and/or differentiation of pluripotent stem cells containing the peptide described in item 4, or the protein described in item 5, or item 9
  • the nucleic acid, or the nucleic acid construct described in any one of items 10-11, or the recombinant vector described in item 12, or the host cell described in item 13, or any one of items 14-15 The gene transfer system described in one item.
  • a human c-myc nuclear localization signal is added after the start codon to improve the integration efficiency of foreign genes in the host cell;
  • the resistance gene G418 is inserted between the 5'IR and 3'IR of the original transposon by means of gene synthesis to form the transposon G418-IR.
  • the transposon was inserted into the TTAA in the URA3 gene by recombination after PCR, and the transposase with an inducible promoter was inserted into the PRS316 polyclonal restriction site to finally constitute the screening report vector PRS316-URA- PBase.
  • the specific operations are as follows:
  • PCR was performed on the template PRS316 using primers pURA-F (SEQ ID NO: 5: aagccgctaaaggcattatccgcc) and pURA-R (SEQ ID NO: 6: aactgtgccctccatggaaaaatcagtc) to obtain linearized fragment 1 of plasmid PRS316.
  • transposase ORF open reading frame
  • the transposase ORF has a homologous sequence of about 50 bp at both ends.
  • the transposase is mutated using clonth's error-prone PCR kit, and the number of mutations can be accumulated by recovering PCR fragments as a template for multiple mutations (as shown in the flow chart above in Figure 2).
  • the screening report vector PRS316-URA-PBase uses XbaI and EcoRI for linearization, and removes the original unmutated transposase.
  • the transposase fragments and linearized vectors recovered by PCR are transformed into ura-deficient yeast strains at a molar ratio of 10:1 (shown in the flow chart below in Figure 2 and shown in Figure 3), and the yeast will use its own homologous recombination to repair
  • the mechanism allows the exogenous target fragment to be replaced by the homology arm into the DNA plasmid carrying the gap, thereby automatically combining into a complete plasmid with the target fragment in the yeast cell.
  • the screening process is divided into two screenings.
  • the first screening all mutants were screened on a large scale, and mutants with significantly higher transposition efficiency than those in the unmutated control group were obtained.
  • the second screening was carried out in the yeast obtained in the first screening, and the exact transposition was calculated.
  • bz-hyPBase SEQ ID NO: 2 amino acid sequence, SEQ ID NO: 3 nucleotide sequence.
  • the transformed mutant library is picked up and activated in YPD medium containing G418 antibiotics in a 96-well plate. After 24 hours of activation, it is transferred using a replicator and inoculated to a concentration of 2% Induce in YPD medium with galactose. After 24 hours of induction, dilute the bacterial solution to 10-2 or 10-3 (determined according to the growth of yeast), take 10 ⁇ l of the dot plate on the ura-deficient solid medium, and observe the growth of the mutant after 48 hours of cultivation , And compared with the clones without mutations, the clones with significantly higher transposition efficiency were screened out, and the second screening was carried out.
  • Second screening Activate the suspected mutants obtained in the first screening for 24 hours, adjust the OD600 value after activation to be consistent, and inoculate them into YPD medium containing 2% galactose at a ratio of 1:100 for induction for 24 hours After induction, adjust the OD600 value to be consistent again, and dilute to 10-2, 10-3, 10-4, take 20 ⁇ l diluted to 10-2, 10-3 and spread on the ura-deficient solid medium for 24 hours. Count the number of clones, and the clones grown on the ura-deficient solid medium are the clones that have undergone transposition. At the same time, take 20 ⁇ l diluted to 10-3, 10-4 and spread the YPD complete solid medium on the para-position control.
  • the grown clones are the total number of yeast.
  • amino acid sequence of bz-hyPBase with nuclear localization sequence SEQ ID NO: 2
  • amino acid sequence of the existing highly active transposase hyPBase (SEQ ID NO:1) is mutated from isoleucine at position 92 to asparagine, valine at position 119 is mutated to alanine, and glutamine at position 601
  • the amide was mutated to arginine to obtain the amino acid sequence of bz-hyPBase as shown in SEQ ID NO: 2.
  • nucleotide sequence of human codon-optimized hyPBase transposase containing nuclear localization sequence SEQ ID NO: 4.
  • Nucleotide sequence of bz-hyPBase transposase containing nuclear localization sequence SEQ ID NO: 3:
  • the nucleotide sequence of the existing high-activity enzyme hyPBase has been optimized by human codons to obtain a human codon optimized nucleotide sequence.
  • SEQ ID NO: 4 Based on the human codon optimized nucleotide sequence (SEQ ID NO: 4), the following is performed Base mutation at position: base T at position 276 was mutated to base C, base T at position 356 was mutated to base C, base G at position 900 was mutated to base A, and base A at position 1802 was mutated to Base G; to obtain a mutated nucleotide sequence that encodes the new high-activity transposase bz-hyPBase of the present invention as shown in SEQ ID NO: 3.
  • Example 2 bz-hyPBase has higher transposition efficiency in yeast
  • the transposase is turned on and expressed under the regulation of the inducer galactose, which promotes the transposition of the transposon, the transposition of the transposon, the normal expression of the URA gene, and the clone that undergoes the transposition resumes normal growth in the ura-deficient medium .
  • the transposable efficiency of transposase in Saccharomyces cerevisiae can be calculated.
  • WT PBase is a plasmid carrying a mammalian codon-optimized piggybac transposase
  • hyPBase is a plasmid carrying the existing highly active piggybac transposase (obtained by mutation of 7 amino acid sites for WTPBase described in the background art)
  • optimized hyPBase In order to carry the existing high-activity piggybac transposase through the human source codon optimization and nuclear positioning signal system to obtain the transposase plasmid, bz-hyPBase is a new high-activity transposase screened in the present invention (i.e. optimized hyPBase A plasmid obtained by carrying out the three amino acid site mutations described in the Examples of the present invention).
  • Example 3 bz-hyPBase has higher gene editing efficiency in CHO cells
  • the transposon carrying the EGFP gene was cloned into the vector pSAD-EGFP ( Figure 6) to express green fluorescent protein.
  • the two plasmids expressing transposase and transposon are jointly electrotransformed into CHO cells.
  • the transposon with EGFP will be inserted into the genome under the action of transposase to make it stably express green fluorescent protein.
  • the cells expressing green fluorescent protein were counted by flow cytometry technology. The more cells that can express the fluorescent protein, the higher the efficiency of transposase transposition. From the statistical results in Figure 7, the transposition activity of bz-hyPBase is significantly better than hyPBase.
  • Example 4 bz-hyPBase has higher gene editing efficiency in T cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne une transposase hautement active et une application de celle-ci, la séquence d'acides aminés de la transposase étant telle que présentée dans SEQ ID NO: 2 ou 12, la transposase utilisée pour un système de transposon pouvant améliorer significativement l'activité de transfert de gène du transposon. L'enzyme transposase et sa séquence nucléotidique de codage peuvent être utilisées pour construire un système de transfert de gène, pour préparer ou pour être utilisé en tant que médicament, préparation ou instrument pour la recherche génomique, la thérapie génique, la thérapie cellulaire ou l'induction et/ou la différenciation de cellules souches multifonctionnelles.
PCT/CN2020/133796 2019-12-04 2020-12-04 Transposase hautement active et son application WO2021110119A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201911227263.5 2019-12-04
CN201911227263 2019-12-04

Publications (1)

Publication Number Publication Date
WO2021110119A1 true WO2021110119A1 (fr) 2021-06-10

Family

ID=76110908

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2020/133796 WO2021110119A1 (fr) 2019-12-04 2020-12-04 Transposase hautement active et son application

Country Status (2)

Country Link
CN (1) CN112899252A (fr)
WO (1) WO2021110119A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115058398B (zh) * 2021-07-01 2023-06-20 温州医科大学 一种精氨酸突变的核酸连接酶
CN116286713A (zh) * 2022-05-10 2023-06-23 翌圣生物科技(上海)股份有限公司 高活性Tn5转座酶突变体

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010099296A1 (fr) * 2009-02-26 2010-09-02 Transposagen Biopharmaceuticals, Inc. Transposases piggybac hyperactives
CN102421902A (zh) * 2009-02-25 2012-04-18 约翰·霍普金斯大学 Piggybac转座子变异及其使用方法
WO2012074758A1 (fr) * 2010-11-16 2012-06-07 Transposagen Bioharmaceuticals, Inc. Transposases piggybac hyperactives

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102421902A (zh) * 2009-02-25 2012-04-18 约翰·霍普金斯大学 Piggybac转座子变异及其使用方法
WO2010099296A1 (fr) * 2009-02-26 2010-09-02 Transposagen Biopharmaceuticals, Inc. Transposases piggybac hyperactives
WO2012074758A1 (fr) * 2010-11-16 2012-06-07 Transposagen Bioharmaceuticals, Inc. Transposases piggybac hyperactives

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
WEN WEN, SONG SHANSHAN, HAN YUCHUN, CHEN HAIBIN, LIU XIANGZHEN, QIAN QIJUN: "An efficient Screening System in Yeast to Select a Hyperactive piggyBac Transposase for Mammalian Applications", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 21, no. 9, 26 April 2020 (2020-04-26), XP055819123, DOI: 10.3390/ijms21093064 *
ZHOU QINQIAN, ZHOU MINGBING: "Modification and decoration of transposase: a review", CHINESE JOURNAL OF BIOTECHNOLOGY, vol. 30, no. 10, 25 October 2014 (2014-10-25), pages 1504 - 1514, XP055819126, DOI: 10.13345/j.cjb.130653 *

Also Published As

Publication number Publication date
CN112899252A (zh) 2021-06-04

Similar Documents

Publication Publication Date Title
US20230322956A1 (en) Compositions and methods for making antibodies based on use of an expression-enhancing locus
WO2017215619A1 (fr) Protéine de fusion produisant une mutation ponctuelle dans une cellule, sa préparation et son utilisation
AU2013279333B2 (en) Site-specific integration
Balasubramanian et al. Rapid recombinant protein production from piggyBac transposon-mediated stable CHO cell pools
JP2016523084A (ja) 標的組込み
WO2021110119A1 (fr) Transposase hautement active et son application
TW200914612A (en) Promoter
CA2568788A1 (fr) Production de polypeptides par stimulation de la capacite secretoire
JP2002512015A (ja) 迅速分解性ｇｆｐ融合タンパク質および使用方法
US11427932B2 (en) Materials and methods for protein production
CN106589134A (zh) 嵌合蛋白pAgoE及构建方法、应用以及使用向导的嵌合蛋白pAgoE及构建方法、应用
Landgraf et al. Scarless gene tagging with one-step transformation and two-step selection in Saccharomyces cerevisiae and Schizosaccharomyces pombe
CN112162096A (zh) 用于检测细胞线粒体自噬的双荧光蛋白定位检测系统及应用
JP5304275B2 (ja) アポクライティン−ｉｉをコードするコドン最適化核酸およびその使用方法
JP6824594B2 (ja) 合成遺伝子の設計方法
JP2004538002A (ja) 停止コドン抑制による組み換え遺伝子発現の新規方法
CN111718929B (zh) 利用环形rna进行蛋白翻译及其应用
JPWO2008044794A1 (ja) 遺伝子導入補助試薬
US8338134B2 (en) Expression of polypeptides from the nuclear genome of Ostreococcus sp
CN114957433B (zh) 一种热带爪蛙Fosl1蛋白突变体及其应用
US20240141310A1 (en) Methods for producing cas3 proteins
CN111218476B (zh) 哺乳动物细胞表达载体及其构建方法与应用
EP1957660B1 (fr) Matieres et methodes destinees a renforcer l'expression d'une chaine peptidique
JP2019187453A (ja) 合成遺伝子の設計方法
CN115161306A (zh) 绿盲蝽rna降解酶、其编码基因、载体、菌株及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20895297

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20895297

Country of ref document: EP

Kind code of ref document: A1