WO2021103695A1 - Single-base continuous extension flow-type targeted sequencing method - Google Patents

Abstract

Disclosed is a single-base continuous extension flow-type targeted sequencing method. The method uses a single-stranded nucleotide fragment containing a complementary sequence of a nucleic acid fragment to be tested, a primer, microspheres, nucleic acid polymerase, a fluorescently labeled ddNTP, a fluorescently labeled dNTP in which ribose 3'-OH is protected, a dNTP in which ribose 3'-OH is protected, a ribose 3'-OH deprotecting agent, and so on, and, by means of the single base extension of the primer, a series of sequencing microspheres suitable for using a flow cytometer to detect a nucleic acid base sequence is obtained. Said sequencing microspheres further perform detection by using a flow cytometer, and the base sequence of said nucleic acid fragment can be obtained.

Description

Single-base continuous extension flow-based targeted sequencing method Technical field

The invention relates to a single-base continuous extension flow-type targeted sequencing method, in particular to a method for preparing sequencing microspheres suitable for flow cytometry detection and a method for detecting nucleic acid base sequences using the sequencing microspheres, and belongs to The field of gene sequencing technology.

Background technique

The genome carries all the genetic information of living individuals. Gene sequencing can not only deepen the understanding of the molecular mechanisms of diseases, especially malignant tumors, but also play an important role in guiding targeted drug delivery. After the completion of the human genomics project, the development of gene sequencing technology has become more rapid, and its application in clinical practice and basic research has become more extensive. At present, the nucleic acid sequencing method has developed to three generations, from the first generation of direct detection technology represented by Sanger sequencing and indirect sequencing technology represented by linkage analysis, to 2005 Solexa technology of Illumina company and SOLiD technology of ABI company The next-generation sequencing (NGS), which is a symbol, to the third-generation sequencing represented by SMRT and Nanopore methods. Although these sequencing methods continue to improve the efficiency and accuracy of gene sequencing, there are still operations. Problems such as complexity and difficult interpretation of data (such as gene structure rearrangement and repetitive regions) restrict its large-scale clinical application.

Flow cytometry is a technology that uses flow cytometry to perform multi-parameter and rapid quantitative analysis of single cells or particles. It has the advantages of fast speed, high precision, and good accuracy. It is one of the advanced biosensing technologies. The existing flow cytometry based on primers or probe-coated microspheres can only be used for the recognition of single bases and nucleotide fragments, but cannot be used for base sequencing. Therefore, it is of great value to develop a single-base continuous extension flow cytometry targeted sequencing method suitable for flow cytometry.

Summary of the invention

The purpose of the present invention is to provide a single-base continuous extension flow-based targeted sequencing method suitable for flow cytometry to detect nucleic acid base sequences. The method prepares sequencing microspheres for the nucleic acid sequence to be tested, and then uses the flow cytometer to detect nucleic acid base sequences. The cytometer detects the sequencing microsphere and can accurately identify the base sequence of the nucleic acid fragment to be tested.

At present, genetic testing has important applications in medical fields such as genetics, prenatal diagnosis, and companion diagnosis. For example, determining the mutation site of a patient's specific gene segment through genetic testing can guide targeted drug delivery and improve the therapeutic effect of tumors. However, the existing flow cytometry technology can only identify single bases and oligonucleotide fragments, but cannot be used for base sequencing. The present invention provides a single-base continuous extension flow-type targeted sequencing method suitable for nucleic acid sequencing by a flow cytometer. The method is used to prepare sequencing microspheres and use a flow cytometer to detect the sequencing microspheres to obtain specific nucleic acid bases. Sequences, in turn, can interpret the information of gene mutations, which are of great significance to the elaboration of pathogenesis and the diagnosis and treatment of diseased individuals.

The technical scheme of the present invention is as follows:

A single-base continuous extension flow-type targeted sequencing method, the method includes the following steps:

(1) Coat the surface of the microsphere with the modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested to obtain the coated microsphere;

(2) Mix the coated microspheres, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested, and the resulting mixture is incubated and hybridized;

(3) Wash and suspend the microspheres in buffer, divide the microspheres into two parts. One part of the microspheres is combined with nucleic acid polymerase, buffer, and ribose 3'-OH protected dNTP (deoxynucleoside triphosphate, deoxynucleoside triphosphate). ) Mix, and incubate the resulting mixture; another part of the microspheres are mixed with nucleic acid polymerase, buffer, fluorescently labeled ddNTP (dideoxynucleoside triphosphate, dideoxynucleoside triphosphate) or/and ribose 3'-OH protected fluorescently labeled dNTPs are mixed, and the resulting mixture is incubated;

(4) Wash the microspheres incubated in the previous step with the ribose 3'-OH protected dNTP and then add the ribose 3'-OH deprotectant, and mix well;

(5) Wash and suspend the microspheres from the previous step with buffer solution, divide the microspheres into two parts, one part of the microspheres is mixed with nucleic acid polymerase, buffer, and ribose 3'-OH protected dNTP, and the resulting mixture is incubated ; The other microsphere is mixed with nucleic acid polymerase, buffer, fluorescently labeled ddNTP or/and fluorescently labeled dNTP protected by ribose 3'-OH, and the resulting mixture is incubated;

(6) Repeat the steps of (4) and (5) above, and sequence the n bases of the nucleic acid fragment to be tested, and a total of n groups of microspheres must be prepared continuously, and a total of fluorescently labeled ddNTP or/and ribose 3'-OH are obtained. N groups of microspheres incubated after mixing the protected fluorescently labeled dNTPs;

(7) If all the bases cannot be detected by using the n-group microspheres in the above step (6), replace the fluorescently labeled ddNTP or/and ribose 3'-OH protected fluorescence in steps (3) and (5) Labeled dNTP, change the container, and continue to prepare microspheres using steps (2)-(6) to obtain a total of 4×n or 2×n groups of microspheres;

(8) After washing and suspending the 4×n, or 2×n, or n clusters of microspheres obtained in steps (6) and (7), the sample is detected by the flow cytometer to obtain the nucleic acid fragment to be tested The base sequence.

Further, in the above method, the n is the number of bases of the nucleic acid fragment to be tested.

Furthermore, in the above method, only when the types of fluorescently labeled ddNTP or/and ribose 3'-OH protected fluorescently-labeled dNTP added in steps (3) and (5) are 4 types, the resulting sequencing can be theoretically used. The microsphere obtains all the base sequences of the nucleic acid fragment to be tested. According to the different types of fluorescently-labeled ddNTPs or/and fluorescently-labeled dNTPs protected by ribose 3'-OH added in steps (3) and (5), the final population number of sequencing microspheres is also different. Group means that the microspheres obtained each time are not one, but multiple, so it is called a group. According to the different ways of adding the fluorescently labeled ddNTP or/and the fluorescently labeled dNTP with ribose 3'-OH protected, the final population of sequencing microspheres can be n clusters, or 2n clusters, or 4n clusters.

Further, when the microsphere is coated with a modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested is added in step (2); When it is a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, the one-way primer that guides the synthesis of the nucleic acid fragment to be tested is added in step (2).

Further, the present invention uses a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested as a template. Under the catalysis of a nucleic acid polymerase, a portion of the microsphere is made one-way primer by adding a dNTP protected by ribose 3'-OH. A single non-fluorescent labeled base is extended at the end, and a single fluorescent labeled base is extended to the end of the unidirectional primer by adding fluorescently labeled ddNTP or/and fluorescently labeled dNTP protected by ribose 3'-OH. The microspheres are reserved for base sequencing. After extending a single non-fluorescent labeled base at the end of the unidirectional primer, the ribose 3'-OH at the end of the unidirectional primer extension chain is deprotected by adding ribose 3'-OH deprotecting agent, and then the microsphere is divided into two parts. One part continues to add ribose 3'-OH protected dNTP, the other part adds fluorescently labeled ddNTP or/and ribose 3'-OH protected fluorescently labeled dNTP, after adding ribose 3'-OH protected dNTP , The end of the one-way primer again extends a single non-fluorescent labeled base, and after adding fluorescently labeled ddNTP or/and fluorescently labeled dNTP protected by ribose 3'-OH, a single fluorescent labeled base is extended to the end of the one-way primer, resulting in microspheres Reserved for sequencing. Add the ribose 3'-OH protected dNTPs to the microspheres incubated with the ribose 3'-OH deprotection agent again for deprotection, then divide it into two parts, and add the ribose 3'-OH protected microspheres according to the same steps above. dNTP and fluorescently-labeled ddNTP or/and ribose 3'-OH protected fluorescently-labeled dNTP, and so on, repeat the above operation continuously until all the sequencing microspheres required to sequence n bases are obtained. In the present invention, the microspheres obtained by incubating with fluorescently labeled ddNTP or/and fluorescently labeled dNTP protected by ribose 3'-OH are selected as sequencing microspheres. These sequencing microspheres can be detected by a flow cytometer and used for identification Determine the base sequence of nucleic acid fragments.

Further, in the above preparation method, the microspheres are microspheres used in flow cytometry, such as polystyrene microspheres, and the microspheres can be purchased on the market. The microspheres used in the present invention can be microspheres with uniform size or scale coding, or microspheres without fluorescence or fluorescence coding. The diameter of the microspheres can be selected in the range of 0.5-50 μm, preferably 1-10 μm.

Further, the microspheres of the present invention are microspheres modified by one or more of the following methods: carboxyl, amino, hydroxyl, hydrazide, aldehyde, chloromethyl, ethylene oxide, antibody, nucleic acid Ligand, streptavidin, polythymidylic acid (poly T), polyadenylic acid (poly A), polyguanylic acid (poly G), poly At least one of cytidylic acid (poly C), polyuridylic acid (poly U), methylated CpG binding domain (MBD) protein, dimethylamine, and sulfhydryl group is modified. The purpose of the microsphere modification is to introduce a group that can bind to the modified one-way primer or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested on the surface of the microsphere, so as to modify the one-way primer or complementary to the nucleic acid fragment to be tested. The single-stranded nucleotide fragments of the sequence are coated on the surface of the microspheres. Generally, the most widely used microspheres are carboxylated microspheres, that is, carboxylated microspheres. The modification of the microspheres can be carried out by the methods reported in the prior art, or the modified microspheres can be purchased directly.

Further, in the above preparation method, the nucleic acid fragment to be tested is a single-stranded deoxyribonucleic acid (DNA) fragment, and the nucleic acid fragment to be tested in the present invention refers to a certain fragment that is specifically required, for example The whole human genome sequence has been published, and the whole genome sequence of other animals or microorganisms has also been reported. If you want to detect a certain sequence of a human, animal, or microorganism whose whole genome sequence is known, then the sequence you want to detect is Is the nucleic acid fragment to be tested. A one-way primer is designed for the complementary sequence of the nucleic acid fragment to be detected.

Further, in the above preparation method, the one-way primer refers to a primer that uses a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested as a template and is catalyzed by a nucleic acid polymerase to extend bases at the end. If the one-way primer is to be coated on the surface of the microsphere, it needs to be modified so that a group capable of binding to the modified group on the microsphere is formed on the one-way primer. Therefore, the modified unidirectional primer coated on the surface of the microspheres used in the present invention is at least one of amino group, carboxyl group, digoxigenin, biotin, poly A, poly G, poly C, poly T, poly U, and methyl. A modified one-way primer. The design and modification of one-way primers can be sent to the corresponding company, such as Shanghai Shenggong Company.

Further, in the above preparation method, a modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested or a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested is coated on the surface of the microsphere, and the “coating” refers to Modified one-way primers or single-stranded nucleotide fragments are fixed on the surface of the microspheres through covalent or non-covalent bonds. Those skilled in the art can coat the surface of the microspheres with modified unidirectional primers or single-stranded nucleotide fragments containing complementary sequences of nucleic acid fragments to be tested, for example, by electrostatic adsorption, chemical bonding, and the like.

Further, in the above preparation method, the nucleic acid polymerase is a DNA-dependent DNA polymerase, including Taq DNA polymerase, Klenow fragment, and Sequenase.

Further, in the above preparation method, the dNTP is deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxycytidine triphosphate (dCTP), and deoxycytidine triphosphate (dCTP). One of uridine triphosphate (deoxyuridine triphosphate, dUTP), deoxythymidine triphosphate (dTTP), or a combination of two or more of them, deoxyuridine triphosphate and deoxythymidine triphosphate do not appear at the same time.

Further, in the above preparation method, the ddNTP is dideoxyadenosine triphosphate (ddATP), dideoxyguanosine triphosphate (ddGTP), dideoxycytidine triphosphate (ddCTP) ), dideoxyuridine triphosphate (ddUTP), dideoxythymidine triphosphate (dideoxythymidine triphosphate, ddTTP) or a combination of two or more of them, dideoxyuridine triphosphate and dideoxythymidine Triphosphoric acid does not appear at the same time.

Further, in the above preparation method, among the fluorescently labeled ddNTPs and ribose 3'-OH protected fluorescently labeled dNTPs, the ddNTPs and ribose 3'-OH protected dNTPs are fluorescently labeled for subsequent sequencing. In the present invention, ddNTP and ribose 3'-OH protected dNTP can be labeled with any one or more of the following fluorescent substances: fluorescein isothiocyanate (FITC), Alexa Fluor 610, Alexa Fluor 488, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 700, cyanine dye Cy5 (cyanine 5), Texas Red (Texas Red), cyanine dye Cy3 (cyanine 3), cyanine dye Cy7 (cyanine 7 ), hydroxyfluorescein (FAM), lucifer yellow, cyanine dye Cy5.5 (cyanine 5.5), rhodamine 110 (rhodamine 110, R110), ROX, rhodamine 6G (rhodamine 6G, R6G), TAMRA .

Further, in the above preparation method, the ribose 3'-OH protected dNTPs, fluorescently labeled ddNTPs, and ribose 3'-OH protected fluorescently labeled dNTPs can be purchased from the market. You can also refer to "Protecting Groups Chemistry" (edited by Wu Qinpei and Li Shanmao, Chemical Industry Press, Beijing, 2007), "Bioconjugate Techniques" (second edition, Greg T. Hermanson, Elsevier press, 2008) prepared by the method.

Further, in the above preparation method, the basic components of the buffer solution are Tris-HCl (pH 7-7.5), MgCl ₂ , and NaCl.

Further, in the above steps (2), (3), (5), different components are added to form an incubation system, and then suitable conditions are controlled for incubation. Incubation can be carried out in containers such as 24-well plate wells, 24-well filter plate wells, 96-well plate wells, 96-well filter plate wells, 384-well plate wells, 384-well filter plate wells, centrifuge tubes, EP tubes, etc., used for each incubation The containers can be the same or different. During each incubation, the total volume of the incubation system is 10 μl-10 ml, preferably 10 μl-1000 μl. The incubation system refers to a mixture formed by mixing various components required for each incubation. During each incubation, the final concentration of microspheres in the incubation system is 5×10 ² to 2.5×10 ⁸ /ml, the final concentration of nucleic acid polymerase is 2-480 units/ml, and each ribose 3' The final concentration of -OH protected dNTPs is 0.1-50μmol/L, the final concentration of each fluorescently labeled ddNTP is 0.1-50μmol/L, and the final concentration of each ribose 3'-OH protected fluorescently labeled dNTP The concentration is 0.1-50μmol/L. Ribose 3'-OH protected dNTPs are: ribose 3'-OH protected dATP, ribose 3'-OH protected dTTP/dUTP (dTTP/dUTP means dTTP or dUTP, the same below), ribose 3' -OH protected dGTP and ribose 3'-OH protected dCTP mixture, ribose 3'-OH protected dATP, ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected dGTP The final concentration of any one of dCTP protected by ribose 3'-OH and ribose is 0.1-50μmol/L. The fluorescently labeled ddNTP is any one or more of fluorescently labeled ddATP, fluorescently labeled ddTTP/ddUTP, fluorescently labeled ddGTP, and fluorescently labeled ddCTP, fluorescently labeled ddATP, fluorescently labeled ddTTP/ddUTP, fluorescently labeled The final concentration of either ddGTP and fluorescently labeled ddCTP (if added) is 0.1-50μmol/L. Ribose 3'-OH protected fluorescent labeled dNTPs are ribose 3'-OH protected fluorescent labeled dATP, ribose 3'-OH protected fluorescent labeled dTTP/dUTP, ribose 3'-OH protected fluorescent labeled dNTP Any one or more of labeled dGTP and ribose 3'-OH protected fluorescently labeled dCTP, ribose 3'-OH protected fluorescently labeled dATP, ribose 3'-OH protected fluorescently labeled dTTP The final concentration of any one of /dUTP, ribose 3'-OH protected fluorescently labeled dGTP, and ribose 3'-OH protected fluorescently labeled dCTP (if added) is 0.1-50 μmol/L.

Further, in the above steps (2), (3), (5), the temperature of each incubation is 20-95°C, preferably 32-70°C. The time of each incubation can be selected according to actual needs.

Further, in the above step (4), the ribose 3'-OH deprotecting agent is added to the incubated microspheres to deprotect the ribose 3'-OH. The ribose 3'-OH deprotection agent can be purchased from the market. The final concentration of ribose 3'-OH deprotector is 0.1-10mol/L.

Furthermore, in the above steps (3) and (5), the microspheres are divided into two parts, one part of the microspheres is added with ribose 3'-OH protected dNTP, and the other part of the microspheres is added with fluorescently labeled ddNTP Or/and ribose 3'-OH protected fluorescently labeled dNTP. According to the number of bases of the nucleic acid fragment to be tested, the above method of the present invention continuously repeats steps (4) and (5) to obtain sequencing microspheres with the same group number as the number of bases of the nucleic acid fragment to be tested, for example, the nucleic acid fragment to be tested When the number of bases in is n, repeat steps (4) and (5) to obtain n groups of sequencing microspheres. Use flow cytometry to detect these n groups of sequencing microspheres. The sequence of the microsphere groups corresponds to the sequence of the bases From this, the base sequence of the nucleic acid fragment to be tested can be obtained. When adding 4 kinds of fluorescently labeled ddATP, ddTTP/ddUTP, ddGTP, ddCTP or/and ribose 3'-OH protected dATP, dTTP/dUTP, dGTP, dCTP in step (3) and (5), only prepare N groups of sequencing microspheres can be sequenced to obtain the base sequence of the fragment to be tested. For example, when 4 kinds of fluorescently labeled ddATP, ddTTP/ddUTP, ddGTP, ddCTP are added at the same time, n groups of microspheres are prepared and tested. The base sequence of the nucleic acid fragment can be obtained. When step (3) and (5) add 1-2 kinds of fluorescently labeled ddATP, ddTTP/ddUTP, ddGTP, ddCTP or/and ribose 3'-OH protected dATP, dTTP/dUTP, dGTP, dCTP , Then the base sequence of the entire nucleic acid fragment to be tested cannot be obtained with only n groups of sequencing microspheres, and step (7) is required, which is to replace the fluorescently labeled ddNTP or/and the fluorescently labeled dNTP with ribose 3'-OH protected , Replace the container, repeat steps (2)-(6) to obtain 4×n or 2×n sequencing microspheres to ensure that all possible bases at all sites can be detected. In a specific embodiment of the present invention, when only two fluorescently labeled ddNTPs or two fluorescently labeled ribose 3'-OH protected dNTPs are added, the resulting n-group sequencing microspheres can only detect these two types. Specific bases, so in order to obtain the entire base sequence, you need to replace the fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP, and then repeat the experiment to obtain an n-group sequencing microarray that detects the other two bases. Balls, these microspheres can be combined to get the full base sequence.

Furthermore, in the above step (7), the number of sequencing repetitions depends on the number of fluorescently labeled ddNTPs or/and ribose 3'-OH protected fluorescently labeled dNTPs added each time, and the number of types added each time is large. The number of repetitions will be less, and the number of repetitions will be more. When only preparing n populations of sequencing microspheres to detect all possible bases at one time, the configuration requirements for the flow cytometer are relatively high. In order to reduce costs, the method of the present invention is suitable for existing flow cytometers, and 2n is preferably prepared. Group of sequencing microspheres. When using the above method to prepare 2n clusters of microspheres, first add any two fluorescently labeled ddNTPs or ribose 3'-OH protected fluorescently labeled dNTPs in steps (3) and (5) to obtain n clusters of microspheres, and then Replace the two fluorescently labeled ddNTPs or ribose 3'-OH protected fluorescent dNTPs in steps (3) and (5) with the other two fluorescently labeled ddNTPs or ribose 3'-OH protected fluorescent labels DNTP, replace the container, repeat steps (2)-(6) to obtain n groups of microspheres, a total of 2n groups of microspheres. Compared with the 4n group of microspheres, the 2n group of microspheres is easy to operate. Compared with the n group of microspheres, the configuration requirements for the flow cytometer are lower and the sequencing cost is lower. Two kinds of fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP can be combined at will. For example, you can add fluorescently labeled ddTTP/ddUTP and ddATP to obtain n groups of microspheres, and then replace them with Fluorescently labeled ddGTP and ddCTP can be used to obtain n groups of microspheres; you can also add fluorescently labeled ddTTP/ddUTP and ddGTP to obtain n groups of microspheres, and then replace them with fluorescently labeled ddATP and ddCTP to obtain n groups of microspheres; Add fluorescently labeled ddTTP/ddUTP and ddCTP to obtain n groups of microspheres, and then replace them with fluorescently labeled ddATP and ddGTP to obtain n groups of microspheres and so on.

Further, the present invention provides a specific method for single-base continuous extension flow-based targeted sequencing, which includes the following steps:

(1) Coat the surface of the microsphere with the modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested to obtain the coated microsphere;

(2) Add the coated microspheres, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested, mix well, and perform incubation and hybridization;

(3) Wash and suspend the microspheres with buffer solution, save part of the microspheres in container I, and move the other part of the microspheres from container I to container II. Add ribose 3'-OH protected dNTP and nucleic acid polymerization to container I. Enzyme, buffer solution, incubate; add fluorescently labeled ddNTP, ribose 3'-OH protected fluorescently labeled dNTP or a combination of them, nucleic acid polymerase, buffer, and incubate (preferably, each The final volume of the liquid in the container is 10μl to 10ml, mix well, and incubate at 20°C to 95°C);

(4) Wash the microspheres in container I, add ribose 3'-OH deprotectant to container I, and mix well;

(5) Wash and suspend the microspheres in container I with buffer solution, save part of the microspheres in container I, and move the remaining microspheres from container I to container III. Add ribose 3'-OH protected dNTP to container I , Nucleic acid polymerase, buffer, and incubate; add fluorescently labeled ddNTP, ribose 3'-OH protected fluorescently labeled dNTP or a combination of them, nucleic acid polymerase, buffer, and incubate (preferably Yes, the final volume of the liquid in each container is 10μl to 10ml, mix well, and incubate at 20°C to 95°C);

(6) Repeating operations similar to (4) to (5), sequencing nucleic acid fragments with n bases requires continuous preparation of n containers of microspheres; (the microspheres are fluorescently labeled ddNTP or/and ribose 3' -OH protected fluorescently labeled dNTPs incubated with microspheres);

(7) If all the bases cannot be detected by using the microspheres of the n containers, you need to replace the fluorescently labeled ddNTP or/and the fluorescently labeled ribose 3'-OH protected in steps (3) and (5). dNTP, replace the container, repeat steps (2)-(6) to obtain a total of 4×n or 2×n containers of microspheres, and the microspheres in all these containers are sequencing microspheres;

(8) After washing and suspending the 4×n, or 2×n, or n clusters of microspheres obtained in steps (6) and (7), they are further detected by a flow cytometer, and the test nucleic acid fragments can be obtained. Base sequence.

Further, the present invention also provides a preferred single-base continuous extension flow-based targeted sequencing method, which includes the following steps:

(1) Coat the surface of the microsphere with the modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested to obtain the coated microsphere;

(2) Add the coated microspheres obtained in step (1), the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested, and mix well. Perform an incubation cross;

(3) Wash and suspend the microspheres with buffer solution, save part of the microspheres in container I, and move the other part of the microspheres from container I to container II. Add nucleic acid polymerase, buffer, and ribose 3'-OH into container I. Incubate the protected dNTP; add nucleic acid polymerase, buffer, two fluorescently-labeled ddNTPs or two fluorescently-labeled dNTPs protected by ribose 3'-OH into container II, and incubate. The sequencing microbe obtained in container II The ball is marked as A1; the ribose 3'-OH protected dNTP is ribose 3'-OH protected dATP, ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected dGTP and ribose 3'-OH protected dCTP; preferably, the final volume of the reaction in each container is 10 μl to 10 ml, mix well, and incubate at 20°C to 95°C;

(4) Wash the microspheres in container I, add ribose 3'-OH deprotectant to container I, and mix well;

(5) Wash and suspend the microspheres in container I with buffer solution, save part of the microspheres in container I, and move the other part of the microspheres from container I to container III. Add nucleic acid polymerase, buffer, and ribose into container I. Incubate with 3'-OH protected dNTP; add nucleic acid polymerase, buffer, two fluorescently labeled ddNTPs or two fluorescently labeled dNTPs protected by ribose 3'-OH into container III, and incubate, container III The resulting sequencing microspheres are denoted as A2; the ribose 3'-OH protected dNTP is ribose 3'-OH protected dATP, ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected DGTP and ribose 3'-OH protected dCTP; preferably, the final volume of the reaction in each container is 10 μl to 10 ml, mix well, and incubate at 20°C to 95°C;

(6) Repeat the steps similar to (4) and (5) to obtain a total of n groups of sequencing microspheres incubated with fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP, and finally a group of sequencing microspheres Denote as An, where n is the number of bases of the nucleic acid fragment to be tested;

(7) Add the coated microspheres obtained in step (1), the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested into the container ①, and mix well , Carry out incubation and hybridization;

(8) Wash and suspend the microspheres with buffer solution, save part of the microspheres in the container ①, and move the other part of the microspheres from the container ① to the container ②, and add the nucleic acid polymerase, buffer, and ribose 3'-OH to the container ① Incubate the protected dNTPs; add nucleic acid polymerase, buffer, two other fluorescently labeled ddNTPs different from those in step (3) or two other riboses different from those in step (3) into the container ②3 '-OH protected fluorescently labeled dNTPs are incubated, and the sequencing microspheres obtained in container ② are marked as B1; the ribose 3'-OH protected dNTPs are ribose 3'-OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3'-OH protected dGTP and ribose 3'-OH protected dCTP; preferably, the final volume of the reaction in each container is 10μl to 10ml, mix well, 20°C to 95 Incubate at ℃;

(9) After washing the microspheres in the container ①, add ribose 3'-OH deprotectant to the container ① and mix well;

(10) Wash and suspend the microspheres in the container ① with buffer solution, save part of the microspheres in the container ①, and move the other part of the microspheres from the container ① to the container ③, and add the nucleic acid polymerase, buffer, and ribose to the container ① 3'-OH protected dNTPs are incubated; the container ③ is added with nucleic acid polymerase, buffer, two other fluorescently labeled ddNTPs different from those in step (5) or other fluorescently-labeled ddNTPs different from those in step (5) Two types of ribose 3'-OH protected fluorescently labeled dNTPs were incubated, and the sequencing beads obtained in container ③ were marked as B2; the ribose 3'-OH protected dNTP was ribose 3'-OH protected dATP , Ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected dGTP, and ribose 3'-OH protected dCTP; preferably, the final volume of the reaction in each container is 10 μl to 10 ml, mix well, Incubate at 20°C to 95°C;

(11) Repeat the steps similar to (9) and (10) to obtain a total of n groups of sequencing microspheres incubated with fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP, and finally a group of sequencing microspheres Denoted as Bn, where n is the number of bases of the nucleic acid fragment to be tested;

(12) Wash and suspend the microspheres A1-An and B1-Bn, and then perform detection by a flow cytometer to obtain the base sequence of the nucleic acid fragment to be tested.

Further, the present invention also provides a more preferred single-base continuous extension flow-based targeted sequencing method, which includes the following steps:

(1) Coat the surface of carboxylated polystyrene microspheres with a diameter of 1 μm to 10 μm using an amino-modified one-way primer or a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested to guide the synthesis of the nucleic acid fragment to be tested. Be microspheres

(2) Based on the automatic pipetting workstation, add coated microspheres, single-stranded nucleotide fragments containing complementary sequences of the nucleic acid fragments to be tested or one-way primers to guide the synthesis of the nucleic acid fragments to be tested into well I of 96-well filter plate A , Buffer, mix well, and carry out incubation and hybridization;

(3) Wash and suspend the microspheres with buffer solution, save part of the microspheres in well I of 96-well filter plate A, and move the other part of the microspheres from well I of 96-well filter plate A to well I of 96-well filter plate B , Continue to add nucleic acid polymerase, buffer, ribose 3'-OH protected dATP, ribose 3'-OH protected dUTP/dTTP, and ribose 3'-OH protected dUTP/dTTP into well I of 96-well filter plate A dGTP, ribose 3'-OH protected dCTP, continue to add nucleic acid polymerase, buffer, fluorescently labeled ddATP, fluorescently labeled ddUTP/ddTTP to well I of 96-well filter plate B, 96 filter wells A and B The total reaction volume in well Ⅰ is 10μl-1000μl, and the two wells are evenly mixed and incubated at 37°C for 60 seconds. The sequencing microspheres obtained after incubation in well Ⅰ of 96-well filter plate B are marked as A1;

(4) Suction and wash the microspheres in well I of 96-well filter plate A, and then add ribose 3'-OH deprotectant to well I of 96-well filter plate A, and mix well;

(5) Wash and suspend the microspheres in well Ⅰ of 96-well filter plate A with buffer solution, retain part of the microspheres in well Ⅰ of 96-well filter plate A, and transfer the other part of microspheres from well Ⅰ of 96-well filter plate A. To the hole II of 96-well filter plate B;

(6) Nucleic acid polymerase and buffer are added to well I of 96-well filter plate A and well II of 96-well filter plate B, and ribose 3'-OH protected by ribose 3'-OH is added to well I of 96-well filter plate A. dATP, ribose 3'-OH protected dUTP/ddTTP, ribose 3'-OH protected dGTP, ribose 3'-OH protected dCTP, continue to add fluorescently labeled ddATP to well II of 96-well filter plate B, Fluorescence-labeled ddUTP/ddTTP, 96-well filter plate A well I, 96-well filter plate B well II, the total reaction volume is 10μl-1000μl, the two wells are evenly mixed and incubated at 37°C for 60 seconds, of which 96-well filter plate B Sequencing microspheres obtained after incubation in well II of, are marked as A2;

(7) Repeat operations similar to (4) to (6) to obtain a total of n groups of sequencing microspheres incubated with fluorescently labeled ddATP and fluorescently labeled ddUTP/ddTTP. The last group of sequencing microspheres is recorded as An, where n is The number of bases of the nucleic acid fragment to be tested;

(8) Replace "fluorescently labeled ddATP, fluorescently labeled ddUTP/ddTTP" in (3) and (6) above with "fluorescently labeled ddGTP, fluorescently labeled ddCTP", repeat the similar in 96-well filter plate C From (2) to (7), a total of n groups of sequencing microspheres incubated with fluorescently labeled ddGTP and fluorescently labeled ddCTP were obtained. The first group of sequencing microspheres was marked as B1, and the last group of sequencing microspheres was marked as Bn. Where n is the number of bases of the nucleic acid fragment to be tested; the A1-An microspheres prepared in the above step (7) are used to identify thymine (T) and adenine (A) in the nucleic acid fragment to be tested, step The B1-Bn group of microspheres prepared in (8) are used to identify cytosine (C) or guanine (G) in the nucleic acid fragment to be tested;

(9) Wash and suspend the microspheres of A1-An and B1-Bn, and then perform detection by a flow cytometer to obtain the base sequence of the nucleic acid fragment to be tested.

Further, in the above-mentioned sequencing method, the obtained sequencing microspheres are group n, or 2n group, or 4n group, which ensures that the correct base of each site of the nucleic acid fragment can be detected. During detection, the sequence of preparation of the sequencing microspheres Corresponding to the sequence of bases and integrating the detection results, the entire base sequence of the nucleic acid fragment can be obtained.

Further, in the above-mentioned sequencing method, the nucleic acid fragment is a single-stranded DNA fragment. The nucleic acid fragment may be a nucleic acid fragment of any organism, and may be human, animal, or microorganism. The method of the invention is concise, the result is accurate, the data is easy to interpret, and it has good application prospects in the fields of gene detection, disease screening, gene-guided targeted drug delivery, single nucleotide polymorphism and the like.

Further, in the above-mentioned sequencing method, multiple nucleic acid fragment sequences can be detected in parallel by selecting the coding microspheres and regulating the preparation process of the sequencing microspheres.

The present invention establishes a single-base continuous extension flow-type targeted sequencing method through the continuous extension of single-base primers. The method can be used to obtain sequencing microspheres. These sequencing microspheres can be tested by flow cytometry. The base sequence of the nucleic acid fragment. Compared with existing sequencing methods, the single-base continuous extension flow-based targeted sequencing method of the present invention for nucleic acid targeted sequencing has significant advantages such as simplicity, accuracy, and easy interpretation, and is suitable for the detection of nucleic acid base sequences by flow cytometry. It can be widely used in nucleic acid sequencing fields such as genetic testing, microbial inspection, genetics, exons, single nucleotide polymorphisms (SNP), genomics and proteomics, in disease screening, gene guidance and targeted drug delivery , Especially in the field of tumor companion diagnosis.

Description of the drawings

Figure 1 is a flow chart of the single-base continuous extension flow-based targeted sequencing method of Example 1. A. Modified one-way primer coated microspheres; B. Hybridization of a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested with the modified one-way primer; C. Using a single-stranded nucleotide containing the complementary sequence of the nucleic acid fragment to be tested The fragment is a template. Under the catalysis of nucleic acid polymerase, the primer end of the microsphere is coated with a continuous extension of a single fluorescent label base; D. Flow cytometry detects the microsphere to identify the base sequence.

Figure 2 is a Sanger sequencing image of the T790M nucleic acid fragment of the EGFR gene, wherein Figure 2A is a Sanger sequencing image of the wild-type T790M nucleic acid fragment; Figure 2B is a Sanger sequencing image of the mutant T790M nucleic acid fragment.

Figure 3 shows the parallel targeted sequencing of the EGFR gene exon 21 L858R nucleic acid fragment (wild-type plasmid DNA fragment) and exon 18 G719X nucleic acid fragment (a mixture of wild-type and mutant plasmid fragments) to start the first base sequencing of a mixed sample Flow cytometric diagram, where Figure 3(i) is the detection result of thymine (T), Figure 3(ii) is the detection result of adenine (A), and Figure 3(iii) is the detection result of cytosine (C) , Figure 3(iv) is the detection result of guanine (G); from the results, exon 21 the first base of L858R is thymine (T), exon 18 G719X is the first allele of the beginning The bases are adenine (A) and guanine (G).

Detailed ways

Specific embodiments of the present invention are given below, which are a further description of the present invention, rather than limiting the scope of the present invention.

The functionalized polystyrene microspheres used in the examples were purchased from Spherotech, Inc., USA, cyanine dye Cy3 labeled ddATP, cyanine dye Cy3 labeled ddGTP, cyanine dye Cy5 labeled ddGTP, FITC labeled ddUTP, FITC labeled ddCTP , ROX-labeled ddCTP was purchased from PE company in the United States, ribose 3'-OH protected dNTP and ribose 3'-OH deprotectant were purchased from Shandong Xinlike Biotechnology Co., Ltd., DNA polymerase Sequenase, DNA polymerase klenow fragments It is a product of ThermoFisher Scientific.

Unless otherwise specified, the following asymmetric PCR products, modified one-way primers, and one-way primers are obtained according to the PCR amplification methods reported in the prior art or commissioned by the corresponding company.

Example 1. Single-base continuous extension flow-based targeted sequencing of EGFR gene T790M nucleic acid fragment [Figure 1]

(1) Find the base sequence of the T790M fragment of the EGFR gene from NCBI Genebank, design a one-way primer based on the sequence, and modify the amino group. The one-way primer modified with the amino group is: 5'GGAAGCCTACGTGATGG CCA3', modify the amino group Unidirectional primers are coated on the surface of carboxylated polystyrene microspheres with a diameter of 7μm;

(2) Based on the automatic pipetting workstation, 4×10 ⁵ primer-coated microspheres, T790M fragment (wild-type/mutant plasmid mixture) asymmetric PCR product, buffer are added to well I of 96-well filter plate A, Perform incubation and hybridization at 65°C for 2 minutes and natural cooling for 45 minutes; wash with buffer, suspend the microspheres, draw 4000 microspheres from well I of 96-well filter plate A to well I of 96-well filter plate B, 96-well filter plate Continue to add 10units of DNA polymerase Sequenase, buffer, 10μM ribose 3'-OH protected dATP, 10μM ribose 3'-OH protected dUTP, 10μM ribose 3'-OH protected dGTP, into well I of A. 10μM ribose 3'-OH protected dCTP, add 10 units of DNA polymerase Sequenase, buffer, 0.5μM cyanine dye Cy3 labeled ddATP, 0.5μM FITC labeled ddUTP to well I of 96-well filter plate B, each well The final volume is 10μl-1000μl, mix well, and incubate at 37°C for 60 seconds;

(3) Suction and wash the microspheres in well I of 96-well filter plate A, add ribose 3'-OH deprotectant to well I of 96-well filter plate A, and mix well;

(4) Buffer suction, wash and suspend the microspheres in well I of 96-well filter plate A, and draw 4000 microspheres from well I of 96-well filter plate A to well II of 96-well filter plate B;

(5) Add 10 units of DNA polymerase Sequenase and buffer to well I of 96-well filter plate A and well II of 96-well filter plate B. Add 10μM ribose 3'- to well I of 96-well filter plate A. OH protected dATP, 10μM ribose 3'-OH protected dUTP, 10μM ribose 3'-OH protected dGTP, 10μM ribose 3'-OH protected dCTP, continue to add to well II of 96-well filter plate B 0.5μM cyanine dye Cy3 labeled ddATP, 0.5μM FITC labeled ddUTP, final volume of each well is 10μl-1000μl, mix well, and incubate at 37°C for 60 seconds;

(6) According to the operation of steps (3) to (5), wash the microspheres in well I of 96-well filter plate A, add ribose 3'-OH deprotectant, and re-divide into two wells after washing, 96 wells Add 10 units of DNA polymerase Sequenase, buffer, 10 μM ribose 3'-OH protected dATP, 10 μM ribose 3'-OH protected dUTP, 10 μM ribose 3'-OH protected dGTP to well I of filter plate A , 10μM ribose 3'-OH protected dCTP, add 10 units of DNA polymerase Sequenase, buffer, 0.5μM cyanine dye Cy3 labeled ddATP, 0.5μM FITC labeled ddUTP to well III of 96-well filter plate B, press ( 3)-(5) steps are repeated, and 76-well microspheres are continuously prepared in 96-well filter plate B;

(7) Replace "0.5μM cyanine dye Cy3 labeled ddATP, 0.5μM FITC labeled ddUTP" in (2), (5), (6) above with "0.5μM cyanine dye Cy3 labeled ddGTP, 0.5μM FITC-labeled ddCTP", repeat similar operations in 96-well filter plate C according to the procedures of steps (2)-(6) to continuously prepare 76-well microspheres.

(8) The 76-hole microspheres prepared in step (6) and the 76-hole microspheres prepared in step (7) are suction filtered and washed, and the samples are respectively loaded on a flow cytometer for detection.

Because the DNA fragment does not contain uracil (U), when the test result shows uracil, the base is thymine (T). The 76-well microspheres in the 96-well filter plate B prepared in (6) above are used to sequence the thymine (T) and adenine (A) in the T790M fragment. The 96-well filter plate prepared in (7) above The 76-well microspheres in C are used to sequence cytosine (C) and guanine (G) in the T790M fragment.

Integrate all the inspection results to get the sequencing result of the T790M nucleic acid fragment: GCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCC ACCGTGCAGC TCATCAC(C→T,T790M)GCCA GCTCA T, the 67th base appears at the same time The results of T and T indicate that both the wild type and the mutant type are present in the nucleic acid fragment. The detection result is consistent with the sample Sanger sequencing method. It can be seen from Figure 2A that the target base of the wild-type T790M plasmid DNA fragment is C (in the bar); it can be seen from Figure 2B that the mutant T790M plasmid The target base of the DNA fragment is T (inside the bar).

Example 2. Single-base continuous extension flow-based targeted sequencing of EGFR gene T790M nucleic acid fragment

(1) Find the base sequence of EGFR gene T790M from NCBI Genebank, and artificially synthesize wild-type/mutant plasmids based on this sequence, and use the plasmid as a template to synthesize a single-stranded DNA fragment containing the complementary sequence of the T790M target fragment by asymmetric PCR , Design a one-way primer based on the single-stranded DNA fragment, and coat the single-stranded DNA fragment on the surface of a dimethylamine modified polystyrene microsphere with a diameter of 5 μm to obtain the coated microsphere;

(2) Based on the fully automatic pipetting workstation, add 4×10 ⁵ coated microspheres, one-way primers, and buffer to well I of 96-well filter plate A, and perform incubation and hybridization at 65°C for 2 minutes and natural cooling for 45 minutes; Wash and suspend the microspheres with buffer solution, draw 4000 microspheres from well I of 96-well filter plate A into well I of 96-well filter plate B, and continue to add 100 units of DNA polymerase Sequenase to well I of 96-well filter plate A , Buffer, 20μM ribose 3'-OH protected dATP, 20μM ribose 3'-OH protected dUTP, 20μM ribose 3'-OH protected dGTP, 20μM ribose 3'-OH protected dCTP, 96 wells Continue to add 100 units of DNA polymerase Sequenase, buffer, 2μM cyanine dye Cy3 labeled ddATP, 2μM FITC labeled ddUTP, 2μM cyanine dye Cy5 labeled ddGTP, and 2μM ROX labeled ddCTP into well I of filter plate B. At the end of each well Volume 10μl-1000μl, mix well, incubate at 37°C for 60 seconds;

(3) Suction and wash the microspheres in well I of 96-well filter plate A, add ribose 3'-OH deprotectant to well I of 96-well filter plate A, and mix well;

(4) Buffer suction, wash and suspend the microspheres in well I of 96-well filter plate A, and draw 4000 microspheres from well I of 96-well filter plate A to well II of 96-well filter plate B;

(5) Add 100 units of DNA polymerase Sequenase and buffer to well I of 96-well filter plate A and well II of 96-well filter plate B. Add 20μM ribose 3'- to well I of 96-well filter plate A. OH protected dATP, 20μM ribose 3'-OH protected dUTP, 20μM ribose 3'-OH protected dGTP, 20μM ribose 3'-OH protected dCTP, continue to add to well II of 96-well filter plate B 2μM cyanine dye Cy3 labeled ddATP, 2μM FITC labeled ddUTP, 2μM cyanine dye Cy5 labeled ddGTP, 2μM ROX labeled ddCTP, the final volume of each well is 10μl-1000μl, mix well, and incubate at 37°C for 60 seconds;

(6) According to the operation of steps (3) to (5), wash the microspheres in well I of 96-well filter plate A, add ribose 3'-OH deprotectant, and re-divide into two wells after washing, 96 wells Add 100units of DNA polymerase Sequenase, buffer, 20μM ribose 3'-OH protected dATP, 20μM ribose 3'-OH protected dUTP, 20μM ribose 3'-OH protected dGTP to well I of filter plate A , 20μM ribose 3'-OH protected dCTP, add 100units of DNA polymerase Sequenase, buffer, 2μM cyanine dye Cy3 labeled ddATP, 2μM FITC labeled ddUTP, 2μM cyanine dye Cy5 into well III of 96-well filter plate B Labeled ddGTP, 2μM ROX-labeled ddCTP, repeat the steps (3)-(5), and continuously prepare 76-well microspheres in 96-well filter plate B;

(7) Wash the 76-well microspheres in the 96-well filter plate B prepared in step (6), and load the flow cytometer for detection to obtain the detection result at one time.

After data analysis, the sequencing result of the T790M nucleic acid fragment is: GCGTGGACAACCCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCC ACCGTGCAGC TCATCAC(C→T,T790M)GCCA GCTCA T, the base at position 67 appears at the same time C and T As a result, it shows that both wild type and mutant type exist in the nucleic acid fragment.

The Sanger method sequencing result of the EGFR gene T790M nucleic acid fragment sample is consistent with the sequencing result of the present invention.

Example 3, EGFR gene exon 21 L858R, exon 18 G719X point mutation single base continuous extension flow-based targeted sequencing (1) Checked from NCBI Genebank that the EGFR gene contains exon 21 L858R, exon 18 G719X target bases According to these two sequences, one-way primers are designed separately and biotin modified at the end of the one-way primer. The biotin-modified exon 21 L858R one-way primer is: 5'TGTCAAGATCACAGATTTTGGGC3'; biotin-modified exon 18 G719X The one-way primers are: 5'CTGAATTCAAAAAGATCAAAGTGCTG3', the two one-way primers modified by biotin are respectively coated on the surface of two groups of polystyrene microspheres modified with streptavidin encoded by PE-Cy5 with a diameter of about 3μm;

(2) Based on the automatic pipetting workstation, 20,000 exon 21 L858R primer-coated microspheres, 20,000 exon 18 G719X primer-coated microspheres, exon 21 L858R fragment (wild-type plasmid) were added to well I of 96-well filter plate A. Fragment) and exon 18 G719X fragment (mixture of wild-type/mutant plasmid fragments) of the sample’s two-fold asymmetric PCR product and buffer, and incubate and hybridize at 65°C for 2 minutes and natural cooling for 45 minutes; wash with buffer, and suspend micro Sphere, pipette 2000 microspheres from well I of 96-well filter plate A to well I of 96-well filter plate B, and continue to add 50 units of DNA polymerase klenow fragment, buffer, 5 μM to well I of 96-well filter plate A Ribose 3'-OH protected dATP, 5μM ribose 3'-OH protected dUTP, 5μM ribose 3'-OH protected dGTP, 5μM ribose 3'-OH protected dCTP, wells of 96-well filter plate B Continue to add 50units of DNA polymerase Klenow fragment, buffer, 5μM cyanine dye Cy3 labeled ddATP, 5μM FITC labeled ddUTP, final volume per well 10μl-1000μl, mix well, and incubate at 37°C for 15 minutes;

(3) Suction and wash the microspheres in well I of 96-well filter plate A, add ribose 3'-OH deprotectant to well I of 96-well filter plate A, and mix well;

(4) The buffer was filtered, washed, suspended microspheres in well I of 96-well filter plate A, and 2,000 microspheres in well I of 96-well filter plate A were drawn into well II of 96-well filter plate B;

(5) Add 50 units of DNA polymerase klenow fragment and buffer to well I of 96-well filter plate A and well II of 96-well filter plate B. Add 5μM ribose 3'to well I of 96-well filter plate A. -OH protected dATP, 5μM ribose 3'-OH protected dUTP, 5μM ribose 3'-OH protected dGTP, 5μM ribose 3'-OH protected dCTP, continue in well II of 96-well filter plate B Add 5μM cyanine dye Cy3-labeled ddATP and 5μM FITC-labeled ddUTP, with a final volume of 10μl-1000μl per well, mix well, and incubate at 37°C for 15 minutes;

(6) According to the operation of steps (3) to (5), wash the microspheres in well I of 96-well filter plate A, add ribose 3'-OH deprotectant, and re-divide into two wells after washing, 96 wells Add 50units of DNA polymerase klenow fragment, buffer, 5μM ribose 3'-OH protected dATP, 5μM ribose 3'-OH protected dUTP, 5μM ribose 3'-OH protected dUTP to well I of filter plate A dGTP, 5μM ribose 3'-OH protected dCTP, add 50units of DNA polymerase klenow fragment, buffer, 5μM cyanine dye Cy3 labeled ddATP, 5μM FITC labeled ddUTP to well III of 96-well filter plate B, press ( 3)-(5) The steps are repeated, and 10-well microspheres are continuously prepared in 96-well filter plate B;

(7) Replace "5μM cyanine dye Cy3 labeled ddATP, 5μM FITC labeled ddUTP" in (2), (5), (6) above with "5μM cyanine dye Cy3 labeled ddGTP, 5μM FITC labeled ddCTP" ", repeat similar operations in the 96-well filter plate C according to the procedures of steps (2)-(6) to continuously prepare 10-well microspheres.

(8) The 76-hole microspheres prepared in step (6) and the 76-hole microspheres prepared in step (7) are suction filtered and washed, and the samples are respectively loaded on a flow cytometer for detection.

The 10-well microspheres in 96-well filter plate B prepared in (6) above are used for parallel sequencing of exon 21 L858R, exon 18 G719X fragments of thymine (T) and adenine (A), prepared in (7) above The 10-well microspheres in the obtained 96-well filter plate C were used for parallel sequencing of cytosine (C) and guanine (G) in exon 21 L858R and exon 18 G719X mutant fragments.

Integrating all flow cytometry results, the sequencing result of exon 21 L858R nucleic acid fragment is: TGGCCAAACT; the sequencing result of exon 18 G719X nucleic acid fragment is: G(G→A,G719X)GCTC CGGTG. The detection results of the first base of these two nucleic acid fragments are shown in Figure 3. The first base of exon 21 L858R nucleic acid fragment is T, and there is no mutation; while the first base of exon 18 G719X fragment is the first The simultaneous occurrence of G and A in the bases indicates that both wild-type and mutant types are present in the nucleic acid fragment.

The Sanger sequencing result of the EGFR gene nucleic acid fragment sample is consistent with the sequencing result of the present invention.

Example 4

The EGFR gene T790M nucleic acid fragment was sequenced according to the method of Example 1. The difference is: in each incubation system, the final concentration of nucleic acid polymerase is 200 units/ml, and the final concentration of each fluorescently labeled ddNTP is 10 μmol/ L, the final concentration of each ribose 3'-OH protected dNTP is 10μmol/L. The test results are the same as in Example 1.

Example 5

The EGFR gene T790M nucleic acid fragment was sequenced according to the method of Example 1. The difference is that in each incubation system, the final concentration of nucleic acid polymerase is 2 units/ml, and the final concentration of each fluorescently labeled ddNTP is 50 μmol/ L, the final concentration of each ribose 3'-OH protected dNTP is 50μmol/L, which prolongs the incubation time. The test results are the same as in Example 1.

Claims (10)

1. The single-base continuous extension flow-based targeted sequencing method is characterized by including the following steps:

   (1) Coat the surface of the microsphere with the modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested to obtain the coated microsphere;

   (2) Mix the coated microspheres, the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested, and the resulting mixture is incubated and hybridized;

   (3) Wash and suspend the microspheres in buffer, divide the microspheres into two parts, one part of the microspheres is mixed with nucleic acid polymerase, buffer, and ribose 3'-OH protected dNTPs, and the resulting mixture is incubated; the other The microspheres are mixed with nucleic acid polymerase, buffer, fluorescently labeled ddNTP or/and fluorescently labeled dNTP protected by ribose 3'-OH, and the resulting mixture is incubated;

   (4) Wash the microspheres incubated in the previous step with the ribose 3'-OH protected dNTP and then add the ribose 3'-OH deprotectant, and mix well;

   (5) Wash and suspend the microspheres from the previous step with buffer solution, divide the microspheres into two parts, one part of the microspheres is mixed with nucleic acid polymerase, buffer, and ribose 3'-OH protected dNTP, and the resulting mixture is incubated ; The other microsphere is mixed with nucleic acid polymerase, buffer, fluorescently labeled ddNTP or/and fluorescently labeled dNTP protected by ribose 3'-OH, and the resulting mixture is incubated;

   (6) Repeat the steps of (4) and (5) above, and sequence the n bases of the nucleic acid fragments to be tested. A total of n groups of microspheres must be prepared continuously to obtain a total of fluorescently labeled ddNTP or/and ribose 3'-OH N groups of microspheres incubated after mixing the protected fluorescently labeled dNTPs;

   (7) If all the bases cannot be detected by using the n-group microspheres in the above step (6), replace the fluorescently labeled ddNTP or/and ribose 3'-OH protected fluorescence in steps (3) and (5) Labeled dNTP, change the container, and continue to prepare microspheres using steps (2)-(6) to obtain a total of 4×n or 2×n groups of microspheres;

   (8) After washing and suspending the 4×n, or 2×n, or n clusters of microspheres obtained in steps (6) and (7), the sample is detected by the flow cytometer to obtain the nucleic acid fragment to be tested The base sequence.
2. The method according to claim 1, wherein the fluorescently labeled ddNTP is at least one of fluorescently labeled ddATP, ddGTP, ddCTP, and ddUTP/ddTTP;

   Preferably, the fluorescently labeled dNTP with protected ribose 3'-OH is at least one of dATP, dGTP, dCTP and dUTP/dTTP with protected fluorescently labeled ribose 3'-OH;

   Preferably, the dNTP protected by ribose 3'-OH is a mixture of dATP, dTTP/dUTP, dGTP and dCTP protected by ribose 3'-OH;

   Preferably, when the microsphere is coated with a modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested, what is added in step (2) is a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested; When it is a single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, the one-way primer that guides the synthesis of the nucleic acid fragment to be tested is added in step (2).
3. The method according to claim 1 or 2, wherein the fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP is labeled with any one or more of the following fluorescent substances: Fluorescein thiocyanate, Alexa Fluor 610, Alexa Fluor 488, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 700, cyanine dye Cy5, Texas red, cyanine dye Cy3, cyanine dye Cy7, hydroxyfluorescein, fluorescence Yellow, cyanine dye Cy5.5, rhodamine 110, ROX, rhodamine 6G, TAMRA.
4. The method according to claim 1 or 2, characterized in that: in steps (3) and (5), any two kinds of fluorescently-labeled ddNTPs or fluorescently-labeled dNTPs protected by ribose 3'-OH are added to obtain n groups of micro Then replace the two fluorescently labeled ddNTPs or ribose 3'-OH protected fluorescently labeled dNTPs in steps (3) and (5) with the other two fluorescently labeled ddNTPs or ribose 3'-OH protected Fluorescence-labeled dNTPs, replace the container, and use steps (2)-(6) to obtain n groups of microspheres, resulting in a total of 2n groups of microspheres.
5. The method according to claim 1 or 4, characterized by comprising the following steps:

   (1) Coat the surface of the microsphere with the modified one-way primer that guides the synthesis of the nucleic acid fragment to be tested or the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested to obtain the coated microsphere;

   (2) Add the coated microspheres obtained in step (1), the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested, and mix well. Perform an incubation cross;

   (3) Wash and suspend the microspheres with buffer solution, save part of the microspheres in container I, and move the other part of the microspheres from container I to container II. Add nucleic acid polymerase, buffer, and ribose 3'-OH into container I. Incubate the protected dNTP; add nucleic acid polymerase, buffer, two fluorescently-labeled ddNTPs or two fluorescently-labeled dNTPs protected by ribose 3'-OH into container II, and incubate. The sequencing microbe obtained in container II The ball is marked as A1; the ribose 3'-OH protected dNTPs are ribose 3'-OH protected dATP, ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected dGTP and ribose 3'-OH protected dCTP;

   (4) After washing the microspheres in container I, add ribose 3'-OH deprotection agent to container I and mix well;

   (5) Wash and suspend the microspheres in container I with buffer solution, save part of the microspheres in container I, and move the other part of the microspheres from container I to container III. Add nucleic acid polymerase, buffer, and ribose into container I. Incubate with 3'-OH protected dNTPs; add nucleic acid polymerase, buffer, two fluorescently labeled ddNTPs or two fluorescently labeled dNTPs protected by ribose 3'-OH into container III, and incubate, container III The resulting sequencing microspheres are denoted as A2; the ribose 3'-OH protected dNTP is ribose 3'-OH protected dATP, ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected DGTP and ribose 3'-OH protected dCTP;

   (6) Repeat the steps similar to (4) and (5) to obtain a total of n groups of sequencing microspheres incubated with fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP, and finally a group of sequencing microspheres Denote as An, where n is the number of bases of the nucleic acid fragment to be tested;

   (7) Add the coated microspheres obtained in step (1), the single-stranded nucleotide fragment containing the complementary sequence of the nucleic acid fragment to be tested, or the one-way primer and buffer that guide the synthesis of the nucleic acid fragment to be tested, and mix well. Perform an incubation cross;

   (8) Wash and suspend the microspheres with buffer solution, save part of the microspheres in the container ①, and move the other part of the microspheres from the container ① to the container ②, and add the nucleic acid polymerase, buffer, and ribose 3'-OH to the container ① Incubate the protected dNTPs; add nucleic acid polymerase, buffer, two other fluorescently labeled ddNTPs different from those in step (3) or two other riboses different from those in step (3) into the container ②3 '-OH protected fluorescently labeled dNTPs are incubated, and the sequencing microspheres obtained in container ② are marked as B1; the ribose 3'-OH protected dNTPs are ribose 3'-OH protected dATP, ribose 3' -OH protected dTTP/dUTP, ribose 3'-OH protected dGTP and ribose 3'-OH protected dCTP;

   (9) After washing the microspheres in the container ①, add the ribose 3'-OH deprotectant to the container ① and mix well;

   (10) Wash and suspend the microspheres in the container ① with buffer solution, keep part of the microspheres in the container ①, and move the other part of the microspheres from the container ① to a new container ③, and add nucleic acid polymerase and buffer to the container ① , Ribose 3'-OH protected dNTP, incubate; add nucleic acid polymerase, buffer, two other fluorescently labeled ddNTPs different from those in step (5) or different from those in step (5) into container ③ The other two kinds of ribose 3'-OH protected fluorescently labeled dNTPs were incubated, and the sequencing bead obtained in container ③ was marked as B2; the ribose 3'-OH protected dNTP was ribose 3'-OH protected DATP, ribose 3'-OH protected dTTP/dUTP, ribose 3'-OH protected dGTP, and ribose 3'-OH protected dCTP;

   (11) Repeat the steps similar to (9) and (10) to obtain a total of n groups of microspheres incubated with fluorescently labeled ddNTP or ribose 3'-OH protected fluorescently labeled dNTP. The last group of microspheres is marked as Bn, where n is the number of bases of the nucleic acid fragment to be tested;

   (12) Wash and suspend the microspheres of A1-An and B1-Bn, and then perform detection by a flow cytometer to obtain the base sequence of the nucleic acid fragment to be tested.
6. The method according to claim 5, characterized in that: in steps (3) and (5), the two kinds of fluorescently labeled ddNTPs are fluorescently labeled ddATP and fluorescently labeled ddTTP/ddUTP, and the two kinds of ribose 3 '-OH protected fluorescently labeled dNTPs are ribose 3'-OH protected fluorescently labeled dATP and ribose 3'-OH protected fluorescently labeled dTTP/dUTP; in steps (8) and (10), The fluorescently labeled ddNTPs are fluorescently labeled ddGTP and fluorescently labeled ddCTP, and the fluorescently labeled dNTPs with protected ribose 3'-OH are fluorescently labeled dGTP and ribose 3'-OH protected by ribose 3'-OH. Protected fluorescently labeled dCTP.
7. The method according to any one of claims 1-5, wherein the microspheres are microspheres of uniform size, scale-encoded microspheres, non-fluorescence-free microspheres, or fluorescent-encoded microspheres;

   Preferably, the diameter of the microspheres is 0.5-50 μm, more preferably 1-10 μm;

   Preferably, the microspheres have a carboxyl group, amino group, hydroxyl group, hydrazide group, aldehyde group, chloromethyl group, ethylene oxide, antibody, nucleic acid aptamer, streptavidin, poly T, poly A, Microspheres modified with at least one of polyG, polyC, polyU and methylated CpG binding domain proteins, dimethylamine, and sulfhydryl groups, and more preferably carboxylated microspheres.
8. The method according to any one of claims 1-5, wherein the nucleic acid fragment to be tested is a single-stranded DNA fragment;

   Preferably, the nucleic acid polymerase is a DNA-dependent DNA polymerase;

   Preferably, the modified unidirectional primer is a unidirectional primer modified by at least one of amino, carboxyl, digoxigenin, biotin, poly A, poly G, poly C, poly T, poly U, and methyl , More preferably a unidirectional primer modified by amino group.
9. The method according to claim 1, 2 or 5, characterized in that: during each incubation, the final concentration of the microspheres in the incubation system is 5×10 ^{2 /ml-2.5×10 8} /ml, and the nucleic acid polymerizes The final concentration of the enzyme is 2-480units/ml, the final concentration of each fluorescently labeled ddNTP is 0.1-50μmol/L, and the final concentration of each fluorescently-labeled dNTP protected by ribose 3'-OH is 0.1- 50μmol/L, the final concentration of each ribose 3'-OH protected dNTP is 0.1-50μmol/L.
10. The method according to claim 1 or 9, wherein the incubation is carried out in the following containers: 24-well plate wells, 24-well filter plate wells, 96-well plate wells, 96-well filter plate wells, 384-well plate wells, 384 The wells of filter plates, centrifuge tubes or EP tubes, the same or different containers are used for each incubation;

    Preferably, the temperature of each incubation is 20-95°C, more preferably 32-70°C;

    Preferably, during each incubation, the total volume of the incubation system is 10 μl-10 ml, more preferably 10 μl-1000 μl.

Images