WO2003020968A2 - Method for analyzing nucleic acid sequences and gene expression - Google Patents

Method for analyzing nucleic acid sequences and gene expression Download PDF

Info

Publication number
WO2003020968A2
WO2003020968A2 PCT/EP2002/009614 EP0209614W WO03020968A2 WO 2003020968 A2 WO2003020968 A2 WO 2003020968A2 EP 0209614 W EP0209614 W EP 0209614W WO 03020968 A2 WO03020968 A2 WO 03020968A2
Authority
WO
Grant status
Application
Patent type
Prior art keywords
nts
primer
characterized
sequence
nacfs
Prior art date
Application number
PCT/EP2002/009614
Other languages
German (de)
French (fr)
Other versions
WO2003020968A3 (en )
Inventor
Dimitri Tcherkassov
Original Assignee
Genovoxx Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation

Abstract

The invention relates to a method for analyzing nucleic acid sequences and gene expression. The method is based on the detection of fluorescence signals of nucleotide molecules inserted into growing nucleic acid chains by means of a polymerase. The reaction occurs on a plane surface, wherein a plurality of individual nucleic acid molecules are immobilized on said surface. All said nucleic acid molecules are exposed to the same conditions so that a build-up reaction can simultaneously take place in all nucleic acid molecules.

Description

The method of analyzing nucleic acid chain sequences and gene expression

The invention relates to a method for the analysis of nucleic acid chains and gene expression. The basis of the method is the detection of fluorescence signals of individual labeled with dyes nucleotide molecules, which are incorporated by a polymerase into a growing nucleic acid chain. The reaction proceeds on a flat surface. On this surface many individual nucleic acid molecules are bound. All these nucleic acid molecules are exposed, so that can run a synthesis reaction simultaneously on all nucleic acid molecules the same conditions.

The method essentially comprises the following steps:

1) binding the nucleic acid chain fragments (NACFs) on a flat surface followed by hybridization of primers, alternatively, binding of primers followed by hybridization of NACFs so that NACF primer complexes are formed.

2) performing a cyclical synthesis reaction, each cycle consisting of the following steps: a) addition of a solution of labeled nucleotides (nts *) and polymerase to the bound NACF primer complexes, b) incubation of the bound NACF primer complexes with these solution under conditions suitable for extension of the complementary strands to a NT, c) washing, d) detection of signals from single molecules, e) removing the tag from the unincorporated nucleotides, f) washing.

If necessary, carried out multiple repetitions of the cycle.

3) Analysis of the detected signals of the individual molecules.

4) reconstruction of the sequences of the individual data. 1. Abbreviations and Definitions

DNA - deoxyribonucleic acid of different origin and different length (genomic DNA, cDNA, ssDNA, dsDNA)

RNA - ribonucleic acid (mostly mRNA)

Polymerases - enzymes, the complementary nucleotides can be incorporated into a growing strand of DNA or RNA (such as DNA polymerases, reverse transcriptases, RNA polymerases)

dNTP - 2 '-deoxi nucleoside triphosphate substrates for DNA polymerases and reverse transcriptase

NTP - nucleoside triphosphate substrates for RNA polymerases

NT - natural nucleotide, usually dNTP, unless expressly stated otherwise.

Abbreviation "NT" is also used in the length of a particular nucleic acid sequence, eg 1000 NT. In this case, "NT" stands for nucleoside monophosphate.

In the text, the plurality at abbreviations formed by use of the suffix "s", "NT M is, for example, for" nucleotide "," NTs "stands for more nucleotides.

NT * - modified nucleotide, usually dNTP, unless expressly stated otherwise. NTs * means: modified nucleotides

NSK - nucleic acid chain. DNA or RNA in their original length

NACF ​​- nucleic acid chain fragment (DNA or RNA) that corresponds to a part of the overall sequence, NACFs nucleic acid chain fragments. The sum of the NACFs forms an equivalent to the total sequence. The NACFs can be, for example fragments of DNA or RNA overall sequence which occur after a fragmentation step.

5

Overall sequence - the sequence used in the sequencing reaction or the sequences used, mostly transferred to NACFs. You may initially consist of one or more NACs. Here, the overall sequence parts or equivalents

0 another sequence or sequence populations represent (eg, mRNA, cDNA, plasmid DNA with insert, BAC, YAC) and from one or different species.

Primer binding site (PBS) - part of the sequence in the 5 NSK or NACF to which the primer binds.

Reference sequence - an already known sequence, to which the deviations in the sequence to be examined or to be examined in the sequence (total sequence) are determined. D As reference sequences can be used to access databases in sequences such as from the NCBI database.

Tm - melting temperature

5 Plane surface - the surface, which preferably has the following characteristics: 1) It allows a plurality of individual molecules, preferably to detect more than 100, more preferably greater than 1000, concurrently with the respective given lens-to-surface distance at a lens position. 2)

D immobilized individual molecules are in the same focal plane, which can be reproducibly adjusted.

Wide-field optics detection system - detection system that can detect fluorescence signals of individual, on a surface 5 distributed molecules simultaneously, the surface is about 100 microns 2 and greater. An example of wide-field detection optical system is a fluorescence microscope Axiovert 200 or Axioplan 2e (Zeiss) with a Planneofluar lens LooX NA 1.4 Ölim ersion (Zeiss), or a planapochromat lens LooX NA 1.4 oil immersion (Zeiss); the excitation of fluorescence can be carried out with a lamp, for example, mercury vapor lamp, or a laser or diode. Both Epifluoreszenzmdus and in total internal reflection fluorescence microscopy mode (total internal reflection fluorescence microscopy, TIRF microscopy) or laser scanning microscopy mode can be used. In this application use is made of the wide-field optical detection system

Definition of Termination: The termination is referred to in this application, the reversible stop the installation of the modified un-split NTs *.

This term must be distinguished from the usual use of the word "Termination" by dideoxy NTP in a conventional sequencing.

The termination comes after the installation of a modified NT *. A termination for leading Substituent- or a modification of the 3 ". -OH position of the deoxyribose of a nucleotide that results in the termination The substituent can be cleaved under mild conditions, so that 3 '- OH function again for the installation of a NT * is available. In these substituents, a fluorescent dye is coupled.

Gene Products - The gene is the primary gene products of the genes. Essentially, these are RNA transcripts of said genes, which are also referred to as target sequences (or target nucleic acid sequences). These target sequences include, besides mRNA also derived single-stranded and double-stranded cDNA derived from RNA or cDNA from a cDNA plifizierte a DNA.

Einzelnukleotidpoly orphismen (single nucleotide polymorphisms, SNPs) - changes in the sequences, which may occur as substitution (transition or transversion), or as deletion or insertion of individual NT.

2. Prior Art

The nucleic acid chain sequence analysis and

Gene expression analysis has become in many areas of science, medicine and industry become an important tool. For the analysis, several methods have been developed.

The best known methods are the chains - (.. F. Sanger et al PNAS 1977 v.74 s 5463) termination Sanger sequencing, which is based on the incorporation of chain terminators, and the Maxam-Gilbert method based on base- specific modification and cleavage of nucleic acid chains based (AM Maxam and W. Gilbert PNAS 1977, v.74 S.560). Both methods provide a number of nucleic acid chain fragments of various lengths. These fragments are separated in a gel lengthwise. Here, all the disadvantages of electrophoresis (such as long life, relatively short stretches of sequences that can be determined in one batch, limited number of parallel approaches and relatively large amounts of DNA) must be taken into account. These methods are very labor intensive and slow.

Another method of sequencing is based on the hybridization of nucleic acid chains with short oligonucleotides. It is calculated using mathematical methods, like many oligonucleotides of a particular length shall be provided to determine a complete sequence (ZT Strezoska et al. PNAS 1991 V.88 S.10089, RSDrmanac et al. Science 1993 v.260 S.1649 ). Also, this method is fraught with problems: It may be determined only one sequence in one approach, secondary structures interfere with hybridization and repeats prevent correct analysis.

Another possibility for sequencing have working groups for example (Dower US Patent 5,547,839, Canard et al. US Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v.18 S.1021, Metzker et al. NAR 1994 v.22 , S.4259, Welch et al. Nucleosides & Nucleotides 1999, v.18, p.197) developed. This method is abbreviated as BASS (base addition sequencing Scheme) or SBS (Sequecing by Synthesis), respectively. In this case, a large number of the same is fixed single-stranded pieces of DNA at a defined location on a surface and analyzes the signal from the totality of these many identical pieces of DNA. To this a solution with fixed DNA polymerase and nucleotides is added, so that a complementary strand can be synthesized. In this case, to operate step by step the polymerase: in each step only a single nucleotide is incorporated. This is detected, then the polymerase incorporates the next nucleotide in a next cycle.

Despite of the success of some individual steps of the method it has not developed into a functional method. This may for example be based on the following facts: In the construction of the complementary strands desynchronization synthesis occurs very rapidly, so that at every step accumulate the error. Therefore, only very short fragments can be sequenced. It should be emphasized that all described BASS methods are not based on the detection of individual molecules. The signal is instead registered by a large number of identical molecules immobilized at a defined location. The usual in these methods, use of the terms "single molecule" and "molecules" does not aim to individual, separate molecules but on a population consisting of many identical molecules. Identical in this case means that the molecules have the same sequence. Analysis of gene expression spectrum has become an important tool in science. The comparison of the gene expression spectra between different cell lines, tissues or developmental stages allows conclusions on the processes occurring in specific biological processes. So you can expect, for example, that the comparison between tumor cells and healthy cells are of the same origin information on participating in the event tumor genes. It is important that the activity of as many or all genes will be analyzed simultaneously.

The analysis of gene expression is a complex task: The number of active genes in a cell type may be several thousand. but the analysis should be as all the genes contained in the genome of the species considered (about 32,000 in humans). In addition, the active in each cell type Gene firstly usually are not completely known and secondly differentially expressed.

There have been developed many methods for gene expression analysis, such as differential display (Nature 1984, v.308 p.149, Science 1992 v.257 S.967), expressed sequence tags (EST) (Science 1991 v.252, S.1656 Nature Genetics, 1992, v.2 p.173), Northern blotting or RT-PCR (PNAS 1977, v.74, S.5350, Cell 1983 v.34 S.865, "The PCR Technique, RT-PCR" 1998 , Ed. Paul Suebert, Eaton Publishing). All of these methods can analyze only a very limited number of genes per reaction and are very labor intensive part.

The most widely used method for parallel analysis of gene expression pattern is the hybridization of an analyte mixture of cDNA molecules with bound to a surface of oligonucleotides, which are fixed in a certain arrangement, usually called "microarray" ( "Microarray Biochip Technology" 2000, Ed . M.Schena, Eaton Publishing, Zhao et al Gene 1995, v 156, p.207, Schena et al Science 1995 v.270, S.467, Lockhart et al -... US Patent 6,040,138, US Patent Wang 6,004,755, Arlinghaus et al. US Patent 5,821,060, US Patent 5,700,637 Southern, Fodor et al. US Patent 5,871,928).

are among the major disadvantages of the hybridization method: The production of surface-bound oligonucleotides is expensive. The analysis is limited to genes whose sequences are already known. Several larger mismatch controls the number of oligonucleotides that have to be immobilized.

The object of the present invention is to provide a method of sequence analysis of nucleic acid chains and the analysis of gene expression which does not have the disadvantages of the methods mentioned above, and especially a cheaper, faster and more efficient analysis of nucleic acid sequences permits. Specifically, the method should be able to determine many sequences in parallel. It can then, for example for the analysis of very long nucleic acid chains (several Mb) or for the Variantenalyse many short chains (mutation analysis, SNP analysis) used in a single assay.

3. Brief description

The present invention is achieved a method for parallel sequence analysis of nucleic acid sequences (nucleic acid chains, NACs), in which

Fragments (NACFs) single NACs with a length of about 50 to 1000 nucleotides generated representing overlapping partial sequences of the total sequences, one

The NACFs using a single or a plurality of different primers in the form of NACF primer complexes binds to a reaction surface in a random arrangement, by carrying out a cyclic build-up reaction of the complementary strand of the NACFs using one or more polymerases by

a) to the surface bound NACF primer complexes adding a solution containing one or more polymerases and one (or four modified nucleotides NTs *) that are labeled with fluorescent dyes, the simultaneous use of at least two NTs * * located at each of the NTs fluorescent dyes are selected so that allow the NTs used * by measuring different fluorescent signals different from each other, wherein the NTs * are structurally modified so that the polymerase after incorporation of such NT * into a growing complementary strand not in is able to incorporate an additional NT * in the same strand, wherein the leading to the termination substituent with the fluorescent dye is split off, one

b) incubating the obtained in step a) the stationary phase under conditions suitable for extension of the complementary strands, wherein the complementary strands are extended by one NT *, one

c) washing the obtained in step b) the stationary phase under conditions which are not suitable for removing a complementary strand in a built NTs *, one

d) * by measuring the characteristic for each fluorescent dye signal detek- advantage the individual, built-in complementary strands NTs, where it also determines the relative position of the different fluorescent signals on the reaction surface, one

e) for producing unlabeled (or NTs) NACFs * cleaves leading to the termination substituents and the fluorescent dyes of the appended on the complementary strand NTs, one

f) washing the obtained in stage e) the stationary phase under conditions which are suitable for the removal of the fluorescent dyes and the ligand, one

the steps a) optionally repeated several times to f),

wherein one determines the relative position of individual NACF primer complexes on the reaction surface and the sequence of these NACFs by specific association of the detected in step d) in successive cycles at the respective positions fluorescence signals to the NTs.

From the determined partial sequences can beispielsweie the overall sequence of the NACs determine. Under a parallel sequence analysis, the simultaneous analysis of many sequence NACFs is understood in this context (for example 1 million to 10 million), said NACFs derived from a uniform population or NSK NSK of several different populations.

The population of overlapping sub-sequences obtained can be, for example, in de novo sequencing using commercially available programs to the overall sequence of NSK together (Huang et al. Genome Res. 1999 v.9 S.868, Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J. Comput. Biol. 1994 vl p.257).

In the analysis of variants of a known reference sequence, mutations or single nucleotide polymorphisms by comparing the obtained overlapping part sequences can be observed with the reference sequence.

According to a particular embodiment of the invention, the method being able to be carried out by the steps of a) is repeated several times to f) of the cyclical synthesis reaction, one

a) in each cycle only one labeled NT *, labeled differently b) in each cycle two NTs * or c) in each cycle of four differently labeled NTs *

starts.

When the NACs variants of a known reference sequence, the method may also be carried out by the steps of a) is repeated several times to f) of the cyclical synthesis reaction, used alternately in cycles two differently labeled NTs respectively * and two unlabeled NTs and to the total sequences determined by comparison with the reference sequence.

The present invention further provides a method for the highly parallel analysis of gene expression, in which

providing single-gene products, one

the gene products of a single or a plurality of different primer in the form of gene product binds primer complexes using on a reaction surface in a random arrangement, one

a cyclic build-up reaction of the complementary strand of the gene products using one or more polymerases is carried out by a) the bound on the surface gene product primer complexes adding a solution containing one or more polymerases and one (or four modified nucleotides NTs *) includes that are labeled with fluorescent dyes, said fluorescent dyes at the same time using at least two NTs * respectively to the NTs * located are selected such that let the NTs used * by measuring different fluorescent signals different from each other, wherein the NTs * structurally 'so are modified such that the polymerase after incorporation of such NT * is in a growing complementary strand is not able to incorporate * NT another in the same strand, wherein the leading to the termination substituent with the fluorescent dye is split off, one

b) incubating the obtained in step a) the stationary phase under conditions suitable for extension of the complementary strands, wherein the complementary strands are extended by one NT *, one

c) washing the obtained in step b) the stationary phase under conditions which are not suitable for removing a complementary strand in a built NTs *, one

d) * by measuring the characteristic for each fluorescent dye signal detek- advantage the individual, built-in complementary strands NTs, where it also determines the relative position of the different fluorescent signals on the reaction surface, one

e) for producing unlabeled (or NTs) NACFs * cleaves leading to the termination substituents with the fluorescent dyes of the appended on the complementary strand NTs, one

f) washing the obtained in stage e) the stationary phase under conditions which are suitable for the removal of the fluorescent dyes and the ligand, one

the steps a) optionally repeated several times to f),

wherein one determines the relative position of individual gene product primer complexes on the reaction surface and the sequence of these gene products by specific association of the detected in step d) in successive cycles at the respective positions fluorescence signals to the NTs and one from the determined partial sequences of the identity of the gene products certainly.

When the gene is the primary gene products of genes whose expression is to be analyzed. Essentially, these are RNA transcripts of said genes as target sequences (or target nucleic acid sequences) are referred to. These target sequences include, in addition to RNA also derived single-stranded and double-stranded cDNA derived from RNA or cDNA of cDNA amplified DNA a.

The gene or target sequences can be either isolated as mRNAs directly from a biological sample (eg, cell extract, tissue extract or extract of whole organisms), or obtained as cDNAs by reverse transcription of mRNAs.

Under a highly parallel analysis, the simultaneous analysis of many gene sequence molecules is understood in this context (for example 1 million to 10 million), said gene product molecules represent a complex heterogeneous population, for example, a complete expression profile or an expression of a tissue spectrum equivalent.

According to a particular embodiment of the invention, the method being able to be carried out by the steps of a) is repeated several times to f) of the cyclical synthesis reaction, one

a) in each cycle only one labeled NT *, labeled differently b) in each cycle two NTs * or c) in each cycle of four differently labeled NTs *

starts.

The method may also be carried out by the steps of a) is repeated several times to f) of the cyclical synthesis reaction, used alternately two differently labeled NTs respectively * and two unlabeled NTs in the cycles and to the identity of the gene by comparison with the reference sequences determined.

The invention further provides a kit for performing the method which includes a reaction surface, to perform the method required reaction solutions, one or more polymerases, and nucleotides (nts), of which one are marked to four fluorescent dyes, wherein the NTs * at the 3 'position are structurally modified so that the polymerase after incorporation of such NT * is in a growing complementary strand not able * incorporate another NT in the same strand, wherein the leading to the termination substituent with the fluorescent dye is split off. According to a particular embodiment of the invention, the kit further includes for producing single strands of double strands reagents required, single stranded nucleic acid molecules which are introduced as a PBS in the NACFs, oligonucleotide primers for the removal of the fluorescent dyes and leading to the termination substituents required reagents and / or washing solutions.

The inventive method is used to determine the nucleic acid sequences and can be used in various fields of genetics. These include in particular the determination of unknown, long sequences, analysis of sequence polymorphisms and point mutations and the parallel analysis of a large number of gene sequences, and the analysis of gene expression.

In the analysis of long nucleic acid chains (eg, 100 Kb or more) depends on the preparation of the material to be analyzed (single and double stranded nucleic acid sequences) of the task, and has the goal of a long nucleic acid chain a population of relatively small, single-stranded nucleic acid chain fragments (NACFs) to form, these fragments to be provided with a suitable for the start of the sequencing reaction primer (NSKF- primer complexes) and to fix it on a flat surface.

Here, individual NACFs are fixed on a plane surface in such a manner that can run an enzymatic reaction on these molecules. In principle, different types of immobilization are possible, depending on the objectives, the type of NSK and the polymerase used for the reaction. The NACFs be distributed randomly in the immobilization or binding on the surface, that is, it need not be paid to accurate positioning of the individual chains. NSKF- primer complexes can be attached via the NACFs or primer to the surface. The NACF primer complexes must be fixed in such a density on the surface is that an unambiguous assignment of the later detected signals from the built-in NT * s is guaranteed to individual NACFs.

After preparing the immobilized NACFs NACF primer complex molecules one starts with all the sequencing reaction on the surface. the synthesis of the complementary strand to each bound NACF serves as the basis for sequencing. Here are in newly synthesized strand labeled NTs * incorporated. The polymerase builds only a single labeled NT * in the growing chain in a cycle.

The sequencing reaction proceeds in several cycles. A cycle comprising the steps of:

a) adding a solution (containing labeled nucleotides NTs *) and polymerase to the bound NACF primer complexes, b) incubation of the bound NACF primer complexes with this solution, under conditions suitable for extension of the complementary strands to a NT , c) washing, d) detection of signals from single molecules, e) removing the tag from the unincorporated nucleotides, f) washing.

If appropriate, a multiple repetition of the cycle (af).

The reaction conditions of step (b) in one cycle are chosen so that the polymerases of more than 50% of the NACFs involved in the sequencing reaction (ext ENSIONS capable NACF primer complexes) in one cycle of a labeled NT * can incorporate, preferably at more than 90%.

The number of cycles administered depends on the particular task from, is theoretically not limited, and is preferably between 20 and 5000th

After that, his specific sequence is determined from the order of the built-NTs * for each fixed NACF.

From the overlapping NACF sequences, the original NSK sequence Huang et al genome can in one embodiment be reconstructed ( "Automated DNA sequencing and analysis" page 231 et seq. 1994 M. Adams et al., Academic Press. Res. 1999 v. 9 S.868, Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J.Comput .Biol. 1994 vl p.257). Here you are looking at the entire population of NSKF- sequences for matches / overlaps in the sequences of NACFs. Through these agreements / overlaps can bring the NACF in a series, such as:

ACTGTGCGTCCGTATGATGGTCATTCCATG

CATTCCATGGTACGTTAGCTCCTAG

TCCTAGTAAAATCGTACC.

In practice it has been proven in a Sequencing of unknown sequences, to achieve a length of the sequenced pieces of more than 300 bp. This allows the sequencing of genomes from eukaryotes in the shotgun method.

The error of the method can be detected by various means and corrected. All steps of the process can be largely automated.

By working with individual molecules, large advantages over the previously described method BASS result:

1. Since the molecules are individually detected, there is no risk that the signal is in error by the desynchronization in the population. own sequence is created for each fixed NACF. Therefore, it does not matter whether the synthesis of more advanced at an adjacent molecule or is retarded. This highly parallel sequencing long NACF is possible.

It is not necessary to fix the molecules in a defined arrangement on the surface, since the signal emanates from single molecules and not from a spatially defined population (which in BASS methods is necessary). It is not absolutely necessary to produce multiple copies of the analyte nucleic acid chains so that PCR and cloning or or may be omitted. This leads to an enormous acceleration of the analysis in comparison to existing methods.

The inventive method for analysis of gene expression is obtained by a simultaneous sequencing of individual Genproduktmoleküle several advantages over known methods of analysis of gene expression:

1) The gene can bind to the surface in any arrangement. A previous complex synthesis of different oligonucleotides at particular positions (such as in the hybridization method) is therefore not necessary.

2) The material can be analyzed in a standardized surface.

3) The expression of unknown genes can be determined because all the gene products contained in the mixture to be analyzed.

4). The large number of analyzed molecules also permits the detection of weakly expressed genes.

5) Minimum amounts of starting material can be used: mRNA from a single cell may be sufficient for the analysis. 6) All steps of the process can be largely automated.

The method is based on several principles:

1. Brief nucleotide sequences (10-50 NTs) contain enough information to identify the corresponding gene, if the gene sequence itself is already contained in a database.

A sequence of example 10 NTs can be more than 10 δ form various combinations. That is, for example, for most genes in the human genome contains 32,000 genes, according to current estimates, sufficient. For organisms with fewer genes, the sequence may be even shorter.

2. The method is based on a new method for sequencing single nucleic acid chain molecules.

3. It can be examined nucleic acid chains mixtures.

4. The sequencing reaction occurs at many molecules from the same time, the sequence of each individual bound nucleic acid chain is analyzed.

It is known that for the investigation of gene expression mRNAs or mRNA derived from the nucleic acid chains (eg, single-stranded cDNAs, double-stranded cDNAs derived from RNA or cDNA of cDNA amplified DNA) can be used. Regardless of the exact composition they are referred to as gene products. Even partial sequences of these gene products are referred to as gene products.

These gene products represent a mixture of different nucleic acid chains.

the synthesis of a complementary strand to the gene product serves as a basis of analysis. The goal of the preparation to provide gene product primer complexes on a flat surface in a random manner in which the installation of NT * s can take place by the polymerase (extension enabled gene product primer complexes).

These linked gene product primer complexes sequencing reaction is carried out.

It runs in several cycles. Only a single labeled NT * incorporated into the growing strand per cycle. One cycle comprises the following steps: a) addition of a solution of labeled nucleotides (nts *) and polymerase to bound gene primer complexes, b) incubation of the bound gene primer complexes with this solution under conditions suitable for extension of the complementary strands are suitable for a NT, c) washing, d) detection of signals from single modified, incorporated in the newly synthesized strands NTs * molecules, e) removing the tag from the unincorporated nucleotides, f) washing.

This cycle can be repeated several times, so that by each participating in the sequencing reaction primer complex gene product preferably 10 to 50 NTs are determined. Thereafter, the reconstruction of the nucleic acid sequences from the detected signals is performed. The determined sequences of the bound gene products are compared with each other to determine the abundance and assigned by comparison with gene sequences in databases certain genes.

4. Detailed description

General principles of the reaction, material selection and material preparation (generation of short NACFs, introduction of a PBS, single strand preparation, primer selection, fixation of NACFs), and the detection apparatus and detection are shown for sequencing long NACs the example of the method. The method for analysis of gene expression will be described in Example 3. FIG.

4.1 General principles of reaction

In the following, with reference to the sequencing of several Mb long DNA piece, the general principles will be exemplified of the reaction (Fig. 1). The sequencing and the reconstruction of nucleic acid sequences is the shotgun underlying principle ( "Automated DNA sequencing and analysis" page 231 et seq. 1994 M. Adams et al., Academic Press, Huang et al. Genome Res. 1999 v.9 S.868 Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J.Comput .Biol. 1994 vl p.257). The sequence of a long DNA piece is in this case determined by the sequencing of small DNA fragments and subsequent reconstruction. The material to be analyzed (1) is prepared for the sequencing reaction by being broken into fragments of preferably 50 to 1000 bp in length (2). Each fragment is then provided with a primer binding site and a primer (3). This mixture of various DNA fragments is then fixed on a flat surface (4). The non-bound DNA fragments are removed by a washing step. Thereafter, the sequencing reaction is performed on the entire reaction surface. This reaction proceeds cyclically. In Step 1 of the cycle, labeled with a fluorescent dye NT * is incorporated into the growing strand: The reaction is controlled so that in each cycle only one labeled NT * may be incorporated by a polymerase into the growing strand in each case. This is achieved by the use of NTs * which bear at the 3 'position of the deoxyribose a reversibly coupled, leading to the termination substituents. The incorporation of a further labeled NT * is rendered impossible Polymerase and the labeled NTS simultaneously. in the reaction eigesetzt (5) .Danach the reaction mixture is removed and the surface washed in a suitable manner (6) Now follows a detection step (7). the surface is covered with a form suitable for single-molecule detection apparatus (consisting of light source, microscope , camera, scanning table, computer scanned with control and image recognition and image processing software) and the signals of the individual, built-labeled NTs * identified. After the detection step, the mark and the leading to the termination substituent is all built NTs * removed (8) . After a subsequent washing step can begin a new cycle. To reconstruct a larger original DNA sequence (eg several Mb long piece of DNA) should be several hundred NT long DNA fragments, if one carries out the reconstruction after the shotgun principle ( "Automated DNA sequencing and analysis" S. 231 ff . 1994 M. Adams et al. Academic Press, Huang et al. Genome Res. 1999 v.9 S.868, Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J. Comput. Biol. 1994 vl p.257). Since each cycle only one labeled NT * is incorporated, at least 300 cycles of sequencing is necessary.

4.2 Selection of the material

Using the method according to the invention, it is possible both preselected DNA sequences (eg, YAC, PAC or BAC vectors (R. Anand et al. NAR 1989 v.17 S.3425, H. Shizuya et al. PNAS 1992 V.89 S.8794, "Construction of bacterial artificial chromosome libraries using the modified PAC system" in "Current Protocols in Human genetics" 1996 John Wiley & Sons Inc.) cloned sections of a genome) and non-preselected DNA (eg genomic to analyze DNA, cDNA mixtures). By a pre-selection, it is possible in advance relevant information, such as sequence portions of a genome, or populations of gene products to filter out from the large amount of genetic information, thereby limiting the analyzed sequences, the amount of '. Particularly noteworthy are the embodiments in which methods of the invention without Vorselektionierung and without a reproduction of the material are used. Waiver of PCR and cloning brings a decisive acceleration in the highly parallel analysis of Nukleinsäuresequezen, which until now was not possible with other methods.

4.3 Preparation of material

The aim of the material preparation is to obtain single-bonded NACFs with a length of preferably 50-1000 NTs, a single primer binding site and a primer hybridized (bound NACF primer complexes). This NACF primer complexes, for example, have the structure shown in Fig. 2. Specifically highly variable structures can be derived from this general structure. To improve clarity following are some examples that can be used in combination with the methods listed separately or together.

4.3.1 production of short nucleic acid chain fragments (50-1000 NTs) (fragmentation step)

It is important that the fragmentation of the NACs is such that fragments are obtained representing overlapping partial sequences of the total sequences. This is achieved by methods in which fragments of different lengths are formed as fission products in random even distribution.

According to the invention the generation of the nucleic acid chain fragments (NACFs) can be prepared by several methods take place, for example by the fragmentation of the starting material with ultrasound, or by endonucleases ( "Molecular cloning". 1989 j.Sambrook et al. Cold Spring Harbor laborotary Press), such as by non-specific Endonukleasegemische , According to the ultrasonic fragmentation is preferred. One can adjust the conditions so that fragments with an average length of 100 bp to 1 kb formed. These fragments are then at their ends by the Klenow fragment (E. coli polymerase I) or filled by T4 DNA polymerase ( "Molecular cloning" 1989 J.Sambrook et al. Cold Spring Harbor Press laborotary).

In addition, complementary short NACFs can be synthesized from a long NSK using randomized primers. this method is particularly preferred in the analysis of gene sequences. In this case, single-stranded DNA fragments J.Biol.Chem be at the mRNA formed with randomized primers and a reverse transcriptase (Zhang-J et al. Biochem. 1999 p.231 v.337, Ledbetter et al., 1994 v.269 S.31544, Rolls et al. Anal. 1993 v.208 p.264, Decraene et al. Biotechniques 1999 V.27 S.962).

4.3.2 Introduction of a primer binding site in the NACF.

The primer binding site (PBS) is a sequence portion to allow selective binding of the primer to the NACF.

In one embodiment, the primer binding sites may be different, so that several unterschiedlche primer must be used. In this case, specific sequence segments of Gesamtsequez can serve as natural PBSs for specific primers. This embodiment is particularly suitable for the study of known SNP sites, s. Example 4 "SNP analysis using sequence-specific primers".

In another embodiment, it is advantageous for the sake of simplification of analysis when a single primer binding site is present in all NACFs. According to a preferred embodiment of the invention the primer binding sites are thus introduced separately into the NACFs. In this manner, primers can be used with a uniform structure for the reaction. In the following, this embodiment is described in detail.

The composition of the primer binding site is not restricted. Its length is preferably between 20 and 50 NTs. The primer binding site may carry a functional group to immobilize the NACF. This functional group can be eg a biotin group.

As an example for the introduction of a single primer binding site in the following ligation the nucleotide and tailing are described DNA fragments.

a) Ligation:

Here, a double-stranded oligonucleotide complex is treated with a primer binding site used (Fig. 3a). This is reacted with commercially available ligases ligated to the DNA fragments ( "Molecular cloning" 1989 J.Sambrook et al. Cold Spring Harbor Press laborotary). It is important that only a single primer binding site is ligated to the DNA fragment. This is achieved for example by a modification of a side of the oligonucleotide complex on both strands (Fig. 3b). The results after ligation and after subsequent denaturation are shown in Fig. 3c and 3d. The modifying groups on Oligonukleotidkompex can be used for immobilization. The synthesis and modification of such oligonucleotide complex can be carried out according to standardized rules. For the synthesis, for example, the DNA synthesizer 380 A Applied Biosystems may be used. Oligonucleotides having a specific composition with or without modification but are commercially available as custom synthesis, for example, from MWG-Biotech GmbH, Germany.

b) nucleotide Tailing:

Instead of ligation to an oligonucleotide with a terminal deoxynucleotidyl transferase can be several (eg between 10 and 20) nucleoside monophosphates to the 3 'end of a DNA fragment ss- tie ( "Molecular cloning" 1989 J.Sambrook et al. Cold Spring (several guanosine monophosphate (G (Fig. 4), for example) n-called tailing laborotary Harbor Press, "Method in Enzymology" in 1999, v.303, p.37-38)). The resulting fragment is capable of binding the primer used in this example of a (C) n-primer.

4.3.3 single-stranded preparation

For the sequencing reaction single NACFs are needed. If the starting material is present in double-stranded form, there are several ways to create a single stranded form of double-stranded DNA (for example, heat denaturation or alkaline denaturation) ( "Molecular cloning" 1989 J.Sambrook et al. Cold Spring Harbor Press laborotary).

4.3.4 primer for the sequencing reaction

This has the function of enabling the launch of a single point of NACF. It binds to the primer binding site in the NACF. The composition and length of primer are not limited. Besides the start function, the primer can also perform other functions, such as creating, for example, to connect to the reaction surface. Primers should be so adapted to the length and composition of the primer binding site that the primers allows the start of the sequencing reaction with the respective polymerase.

When different, for example, naturally occurring in the original overall sequence primer binding sites, the sequence specific for the respective primer binding site primers are used. In this case, a primer mixture is used for sequencing.

In a uniform, coupled for example, by ligation to the NACFs primer binding site, a single primer is used.

Preferably, the length of the primer 6-100 NTs, optimally 15-30 NTs. The primers may carry a functional group which serves to immobilize the NACF, for example, such a functional group is a biotin group (see Fig. Portion immobilization). They should not interfere with the sequencing. The synthesis of such a primer may be carried out, or as a custom synthesis from a commercial provider, such as MWG-Biotech GmbH for example with the DNA synthesizer 380 A Applied Biosystems, are created Germany).

The primer can be fixed on the surface using different techniques or synthesized directly on the surface to be analyzed prior to hybridization to the NACFs, for example after (McGall et al. US Patent 5,412,087, Barrett et al. US Patent 5,482,867, Mirzabekov et al. US Patent 5981734, "microarray biochip technology" in 2000 M.Schena Eaton Publishing, "DNA microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 S.767, Timofeev et al. Nucleic Acids Research (NAR) 1996 v.24 S.3142, Ghosh et al. 1987 NAR v.15 S.5353, Gingeras et al. NAR 1987 v.15 S.5373, Maskos et al. NAR 1992 v.20 S.1679).

The primers are bound to the surface, for example, in a density of between 10 to 100 microns per 100 2, 100 to 10,000 per 100 microns 2 or 10,000 to 1,000,000 per lOOμm. 2

The primer or the Primergemiseh is incubated with NACFs under hybridization conditions that can bind it selectively to the primer binding site of NACF. This primer hybridization (annealing) can occur before (1), while (2) or (3) the binding of the NACFs carried to the surface. The optimization of hybridization conditions will depend on the exact structure of the primer binding site and the primer and can be determined by Rychlik et al. calculate NAR 1990 v.18 S.6409. In the following these hybridization conditions are called standard hybridization conditions.

If a common for all NACFs primer binding site is eigeführt of known structure, for example by ligation, primers can be used with uniform structure. The primer binding site may carry a functional group at its 3 'end, for example, is used for immobilization. For example, this group is a biotin group. The primer was complementary to the primer binding site structure.

An example of a primer binding site and a primer is shown below.

5 'TAATACGACTCACTATAGG3' primer (primer T7-19) Biotin-3 ΑTTATGCTGAGTGATATCC5 'primer binding site

4.3.5 Fixation of NACF primer complexes to the surface (binding or immobilization of NACFs).

Target fixation (immobilization) is to fix NACF primer complexes on a suitable flat surface in a manner that a cyclic enzymatic sequencing reaction can proceed. This may (see above) for example, by binding of the primer or the NACF to the surface.

The sequence of steps in fixing NSKF- Pri he complexes can be variable:

1) The NACF primer complexes may be formed initially in a solution (by hybridization annealing) and then bound to the surface.

2) primer can first be bound to a surface and NACFs then hybridized to the bound primer, wherein NACF primer complexes are formed (NACFs indirectly bound to the surface) 3) The NACFs can be initially bonded to the surface (NACFs directly the surface-bound) and the primers are hybridised to the bound NACFs in the subsequent step, where NACF primer complexes arise.

The immobilization of NACFs to the surface can therefore be done by direct or indirect binding.

Surface and response surface are to be understood herein as equivalent terms, unless it is explicitly stated on a different meaning. the surface of a solid phase of any material serving as a reaction surface. This material is preferably inert to enzymatic reactions and does not cause interference of the detection. Silicon, glass, ceramic, plastic (such as polycarbonate or polystyrene), metal (gold, silver, or aluminum, powder) or any other material that meets these functional requirements may be used. Preferably, the surface is not deformed, because otherwise be expected with a distortion of the signals in the repeated detection.

If a gel-like solid phase (the surface of a gel) is used, this gel may be for example, an agarose or polyacrylamide gel. Since the gel is freely passable for molecules preferably having a molecular mass below 5000

(For example, a 1 to 2% agarose gel, or 10 to 15% polyacrylamide gel may be used). Such a gel surface has other solid surfaces against the advantage that there is a much lower non-specific binding of NT * s to the surface. The binding of the NACF primer complexes on the surface of the detection of the fluorescent signals of built NTs * is possible. The signals of free NTs * are not detected because they do not bind to the material of the gel and thus are not immobilized. The gel is preferably fixed on a solid support

(Fig. 5a). This solid support may be silicone, glass, ceramics, be plastic (eg, polycarbonates or polystyrenes), metal (gold, silver, or aluminum, powder) or any other material.

The thickness of the gel is preferably not more than 0.1 mm. The gel thickness is preferably greater than the simple depth of focus of the lens be so that non-specifically bound to the solid support NTs * out of the focal plane and are detected thereby. If the depth of field is, for example 0.3 micron, the gel thickness is preferably between 1 .mu.m and 100 .mu.m. The surface can be produced (5 b) as a continuous surface or composite as discontinuous, made up of individual small components (for example, agarose beads) surface. The reaction surface must be large enough to immobilize the necessary number of NACFs with appropriate density. The reaction surface should preferably be no greater than 20 cm 2.

The various cycle steps require an exchange of the different reaction solutions above the surface. The reaction surface is preferably part of a reaction vessel. The reaction vessel is again preferably a component of a reaction apparatus with flow-through device. The flow device allows replacement of the solutions in the reaction vessel. The exchange can with a controlled by a computer pumping device or manually. It is important that the surface does not dry out. Preferably, the volume of the reaction vessel is less than 50 ul. Ideally, its volume is less than 1 ul. An example of such Duchflußsystems is given in Figure 6.

If the fixing of the NACF primer complexes takes place on the surface on the NACFs, this can be done, for example, by the binding of the NACFs to one of the two chain ends. This can be achieved by appropriate covalent, affine or other bonds. There are many examples of immobilization of nucleic acids known (McGall et al. US Patent 5,412,087, Nikiforov et al. US Patent 5,610,287, Barrett et al. US Patent 5,482,867, Mirzabekov et al. US Patent 5,981,734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, p.138, Allemand et al. 1997 Biophysical Journal, V.73, S.2064, Trabesinger et al. Analytical Chemistry 1999, V.71, p.279, Osborne et al. Analytical Chemistry 2000, V.72, S.3678, Timofeev et al. Nucleic Acid Research (NAR) 1996 v.24 S.3142, Ghosh et al . NAR 1987 v.15 S.5353, Gingeras et al. NAR 1987 v.15 S.5373, Maskos et al. NAR 1992 v.20 S.1679). The fixing can also be achieved by non-specific binding, such as by drying of the sample containing NACFs on the planar surface.

The NACFs be bound to the surface, for example, at a density between 10 and 100 microns NACFs per 100 2, 100 to 10,000 per 100 micron 2, 10,000 to 1,000,000 per lOOμrn. 2

The time required for the detection density of extension capable NACF primer complexes is about 10 to 100 per 100 microns. 2 You can take place before, during or reached after hybridization of the primers to the gene products.

By way of example, some methods for binding NACF primer complexes are shown in more detail in the following: In one embodiment, the immobilization of the NACFs via biotin-avidin or biotin-streptavidin binding occurs. In this case, avidin or streptavidin on the surface is covalently bound to the 5 'end of the primer contains biotin. After hybridization of the labeled primer with the NACFs (in solution) they are fixed on the surface coated with avidin / streptavidin surface. The concentration of biotin-labeled hybridization products and the time of incubation of this solution with the surface is that a suitable density for the sequencing is already achieved in this step is selected.

In another preferred embodiment, suitable for the sequencing reaction primer before the sequencing reaction to be fixed on the surface by suitable methods (see above). The single NACFs, each with a primer binding site per NACF are incubated therewith (annealing) under hybridization conditions. They bind to the fixed primer and thereby bound (indirect connection), said primer NACF complexes are formed. The concentration of the single-NACFs and the hybridization conditions are selected so that one achieves a suitable for sequencing Immobilisationsdichte of 10 to 100 extension capable NACF primer complexes per 100 microns. 2 Following hybridization, unbound NACFs be removed by washing. In this embodiment, a surface with a high density primer is preferred, for example, about 1,000,000 primer per lOOμm 2 or more as the desired density of NACF primer complexes is achieved faster higher, wherein the NACFs only bind to a part of the primer ,

In another embodiment, the NACFs are then incubated directly bonded to the surface (see above) and with primers under hybridization conditions. At a density of about 10 to 100 per NACFs lOOμm 2 they will try all available NACFs with a primer to provide and make available for the Sequenzierugnsreaktion. For example, this can be achieved, for example, 1 to 100 mmol / 1, by high primer concentration. At a higher density of the fixed NACFs on the surface, for example, 10,000 to 1,000,000 per lOOμm 2, the time required for the optical detection of the density NACF primer complexes can be achieved during the primer hybridization. The hybridization conditions (eg, temperature, time, buffer, primer concentration) must be selected so that the primers bind only to a portion of the immobilized NACFs. If the surface of a solid phase (for example, silicone or glass) is used for immobilization, preferably a blocking solution on the surface before step (a) placed in each cycle, the * is used to avoid a non-specific adsorption of NTs on the surface. These conditions for a blocking solution meets, for example, an albumin solution (BSA) with pH 8 to 10

4. Election of the polymerase

As polymerases in principle all DNA-dependent DNA polymerases without 3'-5 'exonuclease activity (DNA Replication "in 1992 Ed. A. Kornberg, Freeman and Company NY), for example modified T7 polymerase type" Sequenase are Version 2 "

(Amersham Pharmacia Biotech), 3 '-5' exonuclease free Klenow fragment of DNA polymerase I (Amersham Pharmacia Biotech), polymerase beta various origin (Animal Cell DNA polymerases ", 1983, M. Fry, CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (GibcoBRL), proHATM polymerase

(Euro GM).

Polymerases with 3'-5 'exonuclease activity can be used (eg, Klenow fragment of E. coli polymerase I), provided that reaction conditions are selected to suppress the existing 3' -5 'exonuclease activity, such as a low pH (pH 6.5) in the Klenow fragment (Lehman and Richardson, J. Biol. Chem. 1964 v.239 p.233) or adding NaF to the incorporation reaction. Another possibility consists in the use of NTs * with a phosphorothioate compound (Kunkel et al. PNAS 1981 V.78 S.6734). Here built NTs * from the 3'-5 'exonuclease activity of the polymerase are not attacked. In the following all these kinds polymerase called "polymerase". 4th 5 Chemistry

4.5.1 General NT structure

In the inventive method, different NT * s can be used (preferably 2 'deoxy nucleotide triphosphates), which at its 3' position of the ribose ring bear a substituent. This substituent can be used alone or merge with the fluorescent dye to Termiantion the incorporation reaction and can be cleaved from the nucleotide under mild Bedingngen. At these substituents for the respective NT * characteristic fluorescent dye is coupled, so that the substituent also assumes the role of a linker between the nucleotide and the fluorescent dye. The fluorescent dye is preferably coupled to these linkers by a cleavable under mild conditions bond.

^ Under mild conditions "is understood cleavage conditions that do not cause denaturation of the primer-nucleic acid complex, nor to the cleavage of its individual components.

Formulas (1-3) represent examples of the cleavable reversible terminators are:

1) NT-3 '-OS (l) -F

2) NT-3'-0-S (2) NF

3) NT-3 '-0-S (2) -NLF

NT-3'-0 - represents the 2 '-deoxy-nucleoside triphosphate moiety.

S (l) - represents a substituent (Formula 1), which can be cleaved under mild bidi impurities from NT *. In these substituents, a fluorescent dye (F) is coupled.

S (2) -N - represents a further substituent (Formula 2 and 3), which can be cleaved under mild bidi impurities from NT *. This substituent is a fluorescent dye (F) through a cleavable group under mild conditions (N). The fluorescent dye may be directly adjacent to the cleavable group (Formula 2) or by another linker (L) (formula 3) may be coupled.

Examples of NT * structures, NT * synthesis, the polymerase choice for Einbaureakiton, reaction conditions of the NT * - Einbaureakion and elimination reaction in (Kwiatkoxski WO Patent 01/25247, Kwiatkowski US Patent 6,255,475, Conard et al . U.S. Patent 6,001,566, Dower (U.S. Patent 5,547,839), Canard et al. (US Patent 5,798,210), Rasolonjatovo

(Nucleosides & Nucleotides 1999, v.18 S.1021), Metzker et al.

(NAR 1994, v.22, S.4259), Welch et al. described (Nucleosides & Nucleotides 1999, v.18, p.197).

4.5.2 Marker, fluorophores

Each nucleotide is a characteristic marker (F) marked. The marker is a fluorescent dye. The choice is not limited insofar as the dye satisfies the following requirements:

a) The detection apparatus used must this marker bound as a single molecule of DNA under mild conditions

identify (preferably reaction conditions). The dyes preferably have great photostability. Their fluorescence is quenched preferably not or only marginally from the DNA.

b) The dye bound to the NT may not cause irreversible disruption of the enzymatic reaction.

c) marked with the dye NTs * must be incorporated by the polymerase in the nucleic acid chain. d) In the case of a mark with different dyes, these dyes are said to have no substantial overlap in their emission spectra.

For example, some fluorophores useful in the present invention, assembled in "Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996 R.Haugland, Molecular Probes with structural formulas. According to the invention preferably have the following classes of dyes can be used as a marker: cyanine dyes and their derivatives (for example, Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Wagoner, U.S. Patent 5,268,486), rhodamines, and derivatives thereof (for example, TAMRA, TRITC, RG6, R110 , ROX, Molecular Probes, s. manual), xanthenes derivatives (for example, Alexa 568, Alexa 594, Molecular Probes, Mao et al., U.S. Patent 6,130,101) and porphyrins (porphyrin system, Germany). These dyes are commercially available.

Here you can select depending on the spectral characteristics and existing equipment appropriate dyes. The dyes are bound to the NT * via a cleavable linker. The dyes may be coupled to the linker via, for example, thiocyanate or ester bond ( "Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R.Haugland, Molecular Probes, Jameson et al. Methods in Enzymology 1997, v.278 S .363, Wagoner Methods in Enzymology 1995 v.246 S.362)

4.5.3 cleavable bond between the nucleotide and the substituents cleavage.

The leading to termination substituent is coupled to the NT by a cleavable under mild conditions bond.

Examples of these compounds are esters and acetals.

The cleavage of the ester is preferably carried out in a basic pH range (eg 9 to 11). The cleavage of acetals is carried out in the acidic range (for example between 3 and 4).

Esters can be enzymatically cleaved by polymerases or esterases.

In a preferred embodiment of the invention, the substituent is cleaved together with the fluorescent dye in one step.

4.5.4 cleavable bond between the substituent and the fluorescent dye cleavage.

In another preferred embodiment of the invention, the fluorescent dye of the substituent is coupled by a cleavable group under mild conditions.

Preferably, said group is one of chemically or enzymatically cleavable or photo labile compounds. Ester, thioester, disulfide compounds and photolabile compounds are particularly suitable as a cleavable bond between the substituent and the fluorescent dye.

As examples of chemically cleavable groups ester, thioester and disulfide compounds are preferred (^ Chemistry of protein conjugation and crosslinking "" Shan S. Wong 1993 CRC Press Inc., Herman et al. Method in Enzymology 1990 S. v.184 584, Lomant et al. J. Mol. Biol. 1976 v.104 243, "Chemistry of carboxylic acid and ester" S.Patai 1969 Interscience Publ.). Examples of photolabile compounds can be found in the following references: "Protective groups in organic synthesis" 1991 John Willey & Sons, Inc., V. Pillai Synthesis 1980 S, V. Pillai Org Photochem.Photobiol.. 1987 v.9 p.225, dissertation i ^ New caging groups for light-controlled oligonucleotide synthesis "" H. Giegrich, 1996, Constance, dissertation ξξNeue caging groups for light-controlled oligonucleotide synthesis "SM Buhler, 1999, Konstanz).

The cleavage step is present in each cycle and must proceed under mild conditions, so that the nucleic acids are not damaged or modified.

The cleavage occurs preferentially chemically (for example in mild acidic or basic environment for an ester compound, or by adding a reducing agent such as dithiothreitol or mercaptoethanol (Sigma) in the cleavage of a disulfide compound) or physically (for example by illuminating the surface with light a specific wavelength for the cleavage of a photolabile group, dissertation ξ§Neue photolabile protecting groups for oligonucleotide synthesis lichugesteuerte "" "H. Giegrich, 1996, Konstanz) from.

In this embodiment, the fluorescent dye is split off after the detection of first and then the coupled to the 3'-position, leading to the termination substituent.

4.5.5 Colored coding scheme, number of dyes Each NT * must be clearly marked with a distinctive dye. Preferably, you can have a cycle to perform with:

a) four differently labeled NT * sb) two differently labeled NT * SC) a labeled NT * d) two differently labeled NT * s and two unlabeled NTs

(Other combinations should an expert seem obvious) ie

a) One may select all 4 NTs with different dyes and all 4 insertion into the reaction at the same time. Here you reach the sequencing of a nucleic acid chain with a minimum number of cycles. However, this variant of the invention makes high demands on the detection system: 4 different dyes must be identified in each cycle.

b) To simplify the detection of a mark with two dyes may be selected. In this case, 2 pairs of NTs are * formed, which are each marked differently, for example, A and G carry the marking "X", C and U carry the label "Y". In the reaction in a cycle (n) 2 differently labeled NTs are used simultaneously *, U * and G *, for example, be C * added in combination with A *, and in the following cycle (n + 1) then.

c) One can use * and * use only one per cycle NT even a single dye for labeling all 4 NTs.

d) In a technically simplified embodiment be per cycle, two differently labeled NT used * s and two unlabeled NTs (absorbed. 2NT * s / 2NTs method). This embodiment can be used to identify variants (for example, mutations, or alternatively spliced ​​genes) of an already known sequence.

Under reaction conditions, the incorporation of NT * s is carried out in the NACFs preferably such that is installed at more than 50% of the NACFs involved in the sequencing reaction in a cycle, a labeled NT *, preferably to more than 90%. This is due to the fact that in some nucleic acid chains, the reaction proceeds very slowly. An installation of the NTs * at each complementary position in each cycle is desired, but not required, because only the successful incorporation reactions are detected and evaluated; a delayed reaction in the subsequent cycle does not lead to a sequencing error.

Preferably, * the same polymerase is used for all NTs. But it can also be different for different polymerases used NTs *.

4.6 detection apparatus

Individual molecules on a surface can be studied using different methods. Several methods are known: for example, atomic force Mikroscopie, electron microscopy, near-field fluorescence Mikroscopie, wide-field fluorescence

Microscopy, TIR microscopy, etc. (Science 1999 v.283 1667, Unger et al. BioTechniques 1999 V.27 S.1008, Ishijaima et al. Cell 1998 v.92 p.161, Dickson et al. Science 1996 v.274 S.966, Xie et al. Science 1994 v.265 p.361, Nie et al. Science 1994 v.266 S.1018, Betzig et al. Science 1993 v.262 S.1422).

According to the invention fluorescence signals of individual * is preferably in the nucleic acid chain with a built-NTs widefield fluorescence microscope (epifluorescence) or a laser scanning microscope (epifluorescence) or a TIRF Microscope (Total Internal Reflection Fluorescence Microscope) are.

There are different variants of the construction of such an apparatus possible (Weston et al. J.Chem.Phys. 1998 V.109 S.7474, Trabesinger et al., Anal. Chem. 1999 V.71 p.279, Adachi et al. Journal of Microscopy 1999 v.195 S.125, Unger et al. BioTechniques 1999 V.27 S.1008, Ishijaima et al. Cell 1998 v.92 p.161, Dickson et al. Science 1996 v.274 S.966, Tokunaga et al. Bichem.Biophys.Res.Com. 1997 v.235 p.47, "Confocal laser scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and Microspectroscopy '1991 Ed. R.Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J.Pawley plenum Press). Differences in their concrete structure resulting from the variation of their items. The apparatus for the excitation light can for example operate on the basis of a laser, a lamp or of diodes. For the detection device both CCD cameras as PMT also can serve. Other examples of technical details see ( "Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and Microspectroscopy '1991 Ed. R.Cherry CRC Press, Inc.," Fluorescence microscopy "1998 2. ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J.Pawley plenum Press). It is not the object of this invention to list all the possible technical variants of a detection device. The basic construction of a suitable apparatus is described in a schema Fig. 8. It consists of the following elements:

A light source for excitation of fluorescence (1)

Light-guiding member (2)

Scanning stage (3)

Device for selection of spectra (4)

Detection means (5)

Computer control and analysis functions (6)

These elements of the apparatus can be purchased commercially (Microscope Company: Zeiss, Leica, Nikon, Olympus.).

In the following, a suitable combination for the detection of individual molecules to be presented from these elements, for example:

Widefield fluorescence microscope Axioplan 2 (Zeiss) with

Mercury vapor lamp

NA 1.4 (Zeiss) Lens Planneofluar LooX,

Camera Photometrix or AxioCam (Zeiss)

Computer software for control and analysis

Hereinafter, the procedure will be explained in the detection. Note here the general rules of Fluoreszezmikroskopie ( "Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS 'Scientific Publishers, "New Techniques of optical microscopy and Microspectroscopy' 1991 Ed. R.Cherry CRC Press, Inc.," Fluorescence microscopy " 1998 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J.Pawley plenum Press).

The detection comprises the following phases:

1) Preparation for the detection

2) carrying out a detection step in each cycle, wherein each detection step proceeds as scanning and the following operations comprising: a) adjusting the position of the lens (X, Y axis), b) adjustment of the focal plane (z-axis), c) detecting the signals of individual molecules, assignment of the signal to NT * and assignment of the signal for each NACF, d) displacement of the next position on the surface.

The signals from the built-in NACFs NTs * are registered by scanning the surface. Scanning can be performed in various ways ( "Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and Microspectroscopy '1991 Ed. R.Cherry CRC Press, Inc.," Fluorescence microscopy "1998 2. ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J.Pawley plenum Press). For example, a batch scanning process is selected. In this case, the lens is gradually moved over the surface (Fig. 8a), so that from each surface position, a two-dimensional image (2D image) is formed (Figure 8b, c).

This 2D image can be created using different methods: for example, by the laser scan of a position of the microscope field (laser scanning microscopy copy) or by a camera recording at a position (see manuals of microscopy.). As an example, the detection of single molecules with a CCD camera will be described.

Detection is schematically illustrated by the example of the sequencing of a long DNA piece 1Mb:

1) Preparation for the detection of:

In the beginning, it is determined how many NACF sequences must be analyzed in order to reconstruct the original sequence. In case of reconstruction after Schrotschuß- method ( "Automated DNA sequencing and analysis" S. 231 ff genome. 1994 M. Adams et al., Academic Press, Huang et al. Res. 1999 v.9 S.868, Huang Genomics 1996 ... p.21 V.33, Bonfield et al NAR 1995 v.23 S.4992, Miller et al J. Comput .Biol 1994 vl p.257) play the following factors play a role: 1) each NACF is in sequencing defines a sequence of about 300-500 NTs. 2) The total length of the sequence to be analyzed is important. 3) In sequencing a certain amount of redundancy must be achieved in order to increase the accuracy and correct any errors. Overall, the original sequence which is about 10 to 100 times the amount of raw sequences necessary for the reconstruction of most, that is, in this example with a Mb, 10 to 100 Mb raw sequence data are needed. At an average sequence length of 400 bp per NACF is accordingly required 25,000 to 250,000 DNA fragments.

2) carrying out a detection step in each cycle,

To sequence the positions of NACFs must be determined so that there is a basis for the assignment of the signals. Knowledge of these positions allows a statement as to whether the signals of individual molecules of built NTs originate * or of randomly bound to the surface * NTs. These positions can be identified by different methods. In a preferred embodiment, the positions of bound NACF primer complexes during sequencing can be identified. The fact is utilized that the signals from the built-in into the nucleic acid chain NTs * always have the same coordinates. This is ensured by the fixation of the nucleic acid chains. The non-specifically bound NTs * bind randomly at different locations on the surface.

For identifying the positions of fixed NACFs the signals on match their coordinates of a plurality of successive cycles are checked. This can eg be done at the beginning of the sequencing. The matching coordinates are judged to be coordinates of the DNA fragments and stored.

The scanning system must be able to scan the surface for several cycles reproducible. X, Y and Z axes settings on each surface position can be controlled by a computer. Stability and reproducibility of the adjustment of lens positions in each scanning operation to decide on the quality of detection and hence on the identification of the signals of individual molecules.

a) adjusting the position of the lens (X, Y-axis)

The mechanical instability of the scan tables commercially available and the poor reproducibility of repeated setting of the same X, Y positions make an accurate analysis of the signals of individual molecules over multiple cycles difficult. There are many ways to improve a match of coordinates with repeated settings or control possible deviations. As an example, a control possibility is cited. After a rough mechanical adjustment of the lens position, a control image is made from a permanently connected to the surface pattern. Even if the mechanical adjustment does not exactly the same coordinate has (deviations of up to 10 microns are quite possible), one can make a correction by means of optical control. The control image of the pattern serving as a coordinate system for the image signals from the built NTs *. A prerequisite for such a correction that no further movements of the surface between these two pictures are taken. Signals from single molecules are set in relation to the pattern so that represents an X, Y deviation in the pattern position same X, Y deviation in the position of the signals of individual molecules. The control image of the pattern may occur before, during, or made after the detection of single molecules. Such a control image must be .gemacht accordance with any setting on a new surface position.

b) adjusting the focal plane (z-axis)

The surface is not perfectly flat and has various bumps on. Thus, the surface-objectivity tive distance changed when scanning neighboring places. These differences in distance can result in individual molecules leave the focal plane and thus escape detection.

For this reason, it is important that a reproducible adjustment of the focal plane is achieved at each lens position when scanning the surface.

There are several ways to adjust the focal plane reproducible. For example, the following method can be applied: As the excitation of individual molecules can lead to the extinction of their fluorescence, a marker is applied to the surface, serves for setting the focal plane. Thereafter, the detection of the signals of individual molecules takes place. The marker can be of any nature (eg dye or pattern), but must not interfere with the detection and reaction. c) detection of the signals of individual molecules, assignment of the signal to NT * and assignment of the signal for each NACF.

The two-dimensional image generated by the detection system of the reaction surface contains the signal information from the built-in NACFs NT * s. These need to be extracted by suitable methods prior to further processing from the total data amount of the image information. The necessary algorithms for scaling, transformation and filtering of the image information includes, for Standardrepertoir of digital image processing and pattern recognition (Haber fields P. "practice of digital image processing and pattern recognition" Hanser-Verlag, Munich, Vienna, 1995;. Galbiati LJ "Machine vision and digital image processing fundamentals ". Prentice Hall, Englewood Cliffs, NJ, 1990). The signal extraction is preferably carried out over a gray scale image, depicting the brightness distribution of the reaction surface for the respective fluorescence channel. If more nucleotides may be used with different fluorescent dyes in the sequencing reaction, (A, T, C, G or U) can first be a separate gray-value image are generated for each used fluorescently labeled nucleotide. For this, two methods can be applied in principle:

1. By using appropriate filters (Zeiss filter sets) a gray scale image is generated for each fluorescence channel.

2. From a recorded multi-color image, the relevant color channels are extracted and each processed individually as gray value image by means of a suitable algorithm by an image processing program. Channel extraction doing a specific channel for each color threshold algorithm is used. This results first of a multi-channel color image individual gray-scale images 1 to N. These pictures are defined as follows: GB N = (s (x, y)) single-channel gray-scale image N = {l, ..., number of fluorescence channels}.

M = {θ, 1, ..., 255} gray value amount

S = (s (x, y)) image matrix of the gray value image x = 0, 1, ..., L-1 image line y = 0, 1, ..., R-1 Columns

(X, y) spatial coordinates of an image point s (x, y) e M gray value of the pixel.

From this amount of data, the relevant image information is then extracted by a suitable program. Such a program should implement the following steps:

For GB X to GB N perform:

I. preprocessing of the image, for example, if appropriate, reduction of the resulting by digitizing the image information of image noise, such as gray-level smoothing.

II. Examining whether this point in connection with the surrounding immediate and far neighboring pixels satisfies each image point (x, y) of the gray scale image, the fluorescence properties of a point. These properties depend, among other things, from the detection equipment used and the resolution of the gray scale image. You can, for example, represent a typical distribution pattern of brightness intensity values ​​to a surrounding the pixel matrix. The usable to methods of image segmentation range from simple threshold procedure, and the use of neural networks.

Where a pixel (x, y) these requirements, then followed by a comparison of the coordinates of identified in previously conducted sequencing cycles NACFs. If a match is the assignment of the signal takes place with the emerging from each fluorescence channel to this nucleotide NACF. Signals not matching coordinates are evaluated as background signals and discarded. The analysis of the signals can be done in parallel with the scanning process.

In an exemplary embodiment, an 8-bit gray level image was used with a resolution of 1317 x 1035 pixels. In order to reduce the costs incurred by the digitization changes in the image, was initially a pre-processing of the whole picture: Each pixel of the average value of the brightness of his 8-neighbors has been assigned. At the selected resolution characterized typical of a fluorescent dot pattern of a central pixel having the largest brightness value and neighboring pixels with on all sides sloping brightness is created. Filled one pixel this evaluation Criteria and exceeded the centrifugal brightness decrease a certain threshold (for exclusion to weak fluorescence points), this central pixel is regarded as a coordinate of a point fluorescence.

d) displacement of the lens to the next position on the surface. After the detection of the signals of individual molecules the lens and another position of the surface is positioned.

A total of a series of shots with the control of the X, Y-position, the adjustment of the focal plane and with the detection of single molecules can for example be made for each new lens position. These steps can be controlled by a computer.

4.7 Timing of the method steps

The scanning process and the biochemical reaction take some time to complete. If one turns these operations sequentially, one can achieve optimal performance of the apparatus. In a preferred embodiment, the response to two separate surfaces is performed.

As an example, a surface having bound NACF primer complexes in 2 spatially isolated parts can be separated so that responses to these two parts can take place independently. In another example, NACFs may also be immobilized at the outset on 2 separate surfaces.

Thereafter, the reaction is started. The principle here is that, during running on a part of the surface of the reaction and washing steps, the second part is scanned. This makes it possible to achieve a continuous flow of analysis and increase the rate of sequencing.

The number of surfaces on which the reaction proceeds can also be greater than the second This then makes sense when the reaction occurs as a time-limiting step, ie the detection of the signals on the surface faster than the reaction and washing steps expires. To adjust the overall duration of the reaction to the detection period, each step of the reaction on a single surface with a time delay in comparison to the next surface to drain off.

The invention is illustrated below by way of examples.

Examples

Example 1:

Sequence analysis with four labeled NTs *

In a preferred embodiment of the invention all four NTs used in the reaction * with fluorescence dyes are marked.

1A. Reconstruction of the original sequences after the shotgun principle ( "Automated DNA sequencing and analysis" page 231 et seq. 1994 M. Adams et al., Academic Press, Huang et al. Genome Res. 1999 v.9 S.868, Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J. Comput .Biol. 1994 vl p.257). (This principle is particularly suitable in the analysis of new, unknown sequences.)

1A-1Sequenzierung of a long piece of DNA

In the following the sequencing to from the sequencing of a long DNA piece 1Mb schematically long nucleic acid chains are shown (Fig. 1). The sequencing is the shotgun underlying principle ( "Automated DNA sequencing and analysis" page 231 et seq. 1994 M. Adams et al., Academic Press, Huang et al. Genome Res. 1999 v.9 S.868, Huang Genomics 1996 v .33 S.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J.Comput .Biol. 1994 vl p.257). The material to be analyzed is prepared for the sequencing reaction by being broken into fragments of preferably 50 to 1000 bp in length. Each fragment is then provided with a primer binding site and a primer. This mixture of various DNA fragments is then fixed on a flat surface. The DNA unbound fragments are removed by a washing step. Thereafter, the sequencing reaction is performed on the entire reaction surface. In order to reconstruct a 1 Mb long DNA sequence, the sequences of NACFs should preferably be longer than 300 NTs, an average of about 400 bp. Since each cycle only one labeled NT * is incorporated, at least 400 cycles of sequencing is necessary.

A total of approximately 10 to 100 times the amount of raw sequences required for reconstruction of the original sequence, ie, 10 to 100 Mb. At an average sequence length of about 400 bp per NACF is required in accordance with 25,000 to 250,000 DNA fragments by more than cover 99.995% of the total sequence.

The determined NACF sequences represent a population of overlapping sub-sequences, which fall can be assembled using commercially available programs to the overall sequence of the NSK ( "Automated DNA sequencing and analysis" page 231 et seq. 1994 M. Adams et al., Academic Press, Huang et al. genome Res. 1999 v.9 S.868, Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J. Comput. Biol. 1994 vl S. 257).

cation A-2Sequenzierung the gene products using the example of the cDNA sequencing

In a preferred embodiment, multiple sequences can be analyzed in a batch rather than a sequence. The original sequences can be reconstructed from the raw data collected for example by the shotgun principle.

First NACFs be generated. Can be converted eg mRNA into a double-stranded cDNA fragment and this cDNA with ultrasound. Subsequently, this NACFs be provided with a primer binding site, denatured, immobilized and hybridized with a primer. It should be noted in this variant of sample preparation that the cDNA molecules may represent incomplete mRNA sequences (Method in Enzymology 1999, v.303, p.19, and other products in this volume, "cDNA library protocols" 1997 Humana Press).

Another possibility for the generation of single-stranded NACFs of mRNA is the reverse transcription of the mRNA with randomized primers. However, many relatively short antisense DNA fragments are formed (Zhang J, et al. Biochem. 1999 v.337 p.231, Ledbetter et al. J. Biol. 1994 v.269 S.31544, Rolls et al . Anal.Biochem 1999 V.27 S.962).. 1993 v.208 p.264, Decraene et al Biotechniques. These fragments can then be provided with a primer binding site (see above). Other steps are the same processes described above. With this method, complete mRNA sequences can be analyzed (from 5 'to 3' end) because bind randomized primer over the entire length of the mRNA.

Immobilized NACFs be analyzed by any of the above embodiments of the sequencing. Since mRNA sequences significantly less repetitive sequences as have, for example, genomic DNA, the number of the detected signals of the built NTs * be of NACF is less than 300 and is preferably between 20 and 1000. The number of NACFs that need to be analyzed calculated according to the same principles as for a shotgun reconstruction of a long sequence.

From NACF sequences, the original gene sequences are reconstructed according to the principles of the shotgun method.

This method allows the simultaneous sequencing of many mRNAs without cloning.

B. Analysis of sequence variants

The confirmation of an already known sequence or the detection of variants of this sequence is much lower demands on the length and redundancy of the determined NACF sequences. The sequence processing is easier in this case. The full sequence does not need to be completely reconstructed. The NACF sequences are rather allocated using a program commercially available the full sequence, and detects any differences. Such a program can, for example BLAST or FASTA algorithm underlying ( "Introduction to Computational Biology" 1995 MS Waterman Chapman & Hall).

The sequence to be analyzed is transferred with one of the above methods in NACFs. This NACFs be sequenced with the inventive method, wherein one occurring both a single primer and a primer binding site einheitlihe as well as different, sequence-specific primers and natural, to be examined in the overall sequence

may use Primerbindngsstellen. Subsequently, the determined sequences of NACFs are not zusammengestzt by the shotgun method, but compared with the reference sequence and assigned in this way, their positions in the full sequence. It may be genomic or cDNA sequences.

In contrast to a reconstruction after Schrotschuß- methods one needs much less raw sequence data for the analysis of a sequence variant. So the 5 may be sufficient for the restoration of a new variant of a full sequence to 10 times Rohsequenzmenge. With the shotgun method, a 10- to 100-fold amount of raw sequences Academic Press, Huang et al is for recovery 'needs ( "Automated DNA sequencing and analysis" page 231 et seq. 1994 M. Adams et al., Genome Res . 1999 v.9 S.868, Huang Genomics 1996 V.33 p.21, Bonfield et al. NAR 1995 v.23 S.4992, Miller et al. J. Comput .Biol. 1994 vl p.257).

The length of the determined NACF sequences should be sufficient for an unambiguous assignment to a particular position in the reference sequence, such as can already sequences with a length of 20 NTs (eg from non-repetitive sections in the human genome) are clearly identified. longer sequences are required for the comparative analysis of repetitive sections. The exact length of the sequences depends on the task. the length of the determined NACF sequences in the analysis of non-repetitive portions is preferably more than 20 NTs. For the analysis of the repetitive portions, it is preferably about 500 NTs.

The objectives in the sequencing of new variants of already known full sequence can be very different. Usually a comparison of the sequence newly determined with the known full sequence / reference sequence is sought. The two sequences of evolutionarily different widely separated species may be derived. Various parameters of the composition of these two sequences can be compared. serve as examples of such analysis: mutation or Polymorphismusanalysen and analysis of alternatively spliced ​​gene products.

Subsequently, a comparison of the sequence to be examined with a reference sequence without reconstruction of the sequence to be analyzed is to be viewed schematically and by way of example. Such a comparison can eg.'Example to mutation or SNP analysis used.

B-1

A long sequence to be analyzed, for example, 1 Mb, is divided into NACFs with one of the above-mentioned method. This NACFs be sequenced using primer uniform with the inventive method. The determined sequences of each NACF be directly compared with the reference sequence. The reference sequence serves as a basis for the assignment determined NSKF- sequences, so that the expensive reconstruction after the shotgun method is omitted. the length of the determined NACF sequences in the analysis of non-repetitive portions is preferably more than 20 NTs. For the analysis of the repetitive portions, it is preferably about 500 NTs. The number of the analyzed NACFs is guided by the total length of the sequence to be examined, the average length of NACF sequences and the necessary accuracy of the sequencing. With an average length of the determined NACF sequence of 100 NTs, a total length of the to be tested sequence of 1 Mb and an accuracy corresponding to the Rohsequenzermittlung (ie each digit is to be used only once sequenced as possible) is needed for example, the approximately 5-fold amount of raw sequences, ie 5 Mb, because the distribution of NACFs over the entire sequence is random. 50,000 NACFs must be analyzed in order to cover more than 99% of the total distance.

Subsequently, the determined NACF sequences are assigned using a program commercially available the full sequence, and detects any differences. Such a program can, for example BLAST or FASTA algorithm underlying ( "Introduction to Computational Biolögy" 1995 MS Waterman Chapman & Hall)

Example 2:

Sequence analysis with 2 labeled NTs * and 2 unmarked NTs (2NTs * / 2NTs method).

In another embodiment, modified NTs 2 * 2 and unmodified NTs are used for the analysis of the sequences.

This method is particularly suitable for the analysis of Seguenzva- variants (such as SNP or mutation analysis) and requires the knowledge of a reference sequence. The full sequence is not reconstructed, but the sequences determined are assigned with the aid of a program of the reference sequence, and registers any deviations. Such a program can, for example BLAST or FASTA algorithm underlying ( "Introduction to Computational Biology" 1995 MS Waterman Chapman & Hall).

This embodiment is based on the principle that a sequence of 2 signals (labeled NT * s) may include enough information to identify a sequence. The sequence determined is compared with the reference sequence and assigned to a particular position, including:

ACCAAAACACCC - sequence determined (* dCTP and dATP are marked *)

ATCATCGTTCGAAATATCGATCGCCTGATGCC - reference sequence

C AC AAA ACAC-CC (determined associated sequence)

ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence) is the unknown to be analyzed variant of the reference sequence as described above is prepared for sequencing (NSK is transferred to NACFs, they are ligated with PBS, then hybridized with a primer and immobilized on the reaction surface). In this way prepared NACFs be sequenced with 2NTs * / 2NTs method. Obtained NACF sequences, each NACF sequence represents a sequence of 2NTs *. To enable accurate correlation of the sequence determined to a known reference sequence, this sequence must be long enough. The length of the determined NACF sequences more than 40 NT Preferably * s. Since 2 NTs marked * represent only a part of the sequence, the total length of the synthesized complementary strand is about twice as long as the sequence of the detected NTs (is at 40 detected NTs * the total length z, B. Average 80 NTs) *.

For the synthesis of a complementary strand 4 nucleotides are required. Since the NTs labeled with a fluorescent dye * occur in the present invention as a semi terminators, that is, the termination occurs only when available modified NTs *, unmodified NTs have to be added in an additional step in each cycle in the reaction. The exact position of this step in the cycle can vary. It is important that the labeled NTs * and the unmodified NTs are used separately.

A cycle in this embodiment may look exemplified as follows:

a) adding a solution with modified NTs * and polymerases on the surface with the provided NACFs b) incubation of the immobilized nucleic acid chains with this solution, under conditions suitable for extension of the complementary strands to a NT c) washing d) detection of signals from individual, modified and in which the newly synthesized complementary strands NACFs built NTs * molecules e) removing the tag and the terminating group in the incorporated nucleotides f) washing g) addition of 2 NTs unmodified polymerases and h) washing.

This 2NT * s / 2NTs method is suitable for example for the SNP analysis of a genomic distance of a gene or for double-stranded cDNA analysis. Her on the following principles:

1) The genetic information in each of the two complementary DNA strands is identical, so that missing information can be vervollständingt in one strand by the information from the other strand.

2) * can be obtained with only two NTs * the complete information from a double-stranded DNA by certain pair combinations labeled NTs. Permitted combinations of NT * s in this embodiment are: A * C *; A * G *; C * T * / C * U *; G * T * / G * U *. The combination C * and U * is preferred.

3) an already known reference sequence serves as the basis of the analysis.

4) The NACFs originate from both strands of the analyzed NSK and • the determined NACF sequences cover the entire length of the sequence to be analyzed from.

NTs * is obtained, and how the differences from the original or non-mutated sequence (reference sequence / comparison sequence) can be found in the following example is explained, as the information of a double-stranded DNA fragment with only 2 labeled. Sequences (1) and (2) up to a point identical (underlined). A * and C * are marked. 1) to be tested sequence:

The sequence to be tested is sequenced with 2NT * s / 2NTs method, so that a population of NACF sequences (determined NACF sequences (n)) is produced. These determined NACF sequences contain information of each strand:

5'AC C-AAA-ACAC-CC3 '- determined NACF sequence (i)

5 'ATCGTTCGAAATATCGATCGCCTG3' 3 'TAGCAAGCTTTATAGCTAGCGGAC5' 3 'A-CAA-C --- --- AACAC C5' - determined NACF sequence (i + 1)

2) Comparison of sequence:

For analysis, a comparison sequence (reference sequence) is required:

5 'ATTGTTCGAAATATCGATCGCCTG3' 3 'TAACAAGCTTTATAGCTAGCGGAC5'

3) Comparison of sequence with adapted determined NACF sequences:

With the help of a program determined NACF sequences specific points are assigned in the comparison sequence and detects any differences:

5'AC C-AAA-ACAC-CC3 '- determined NACF sequence (i)

5 'ATTGTTCGAAATATCGATCGCCTG3' 3 'TAACAAGCTTTATAGCTAGCGGAC5' 3 'A-CAA-C AACAC --- C5' - determined NACF sequence (i + 1)

1t (Einzelnukleotidmutation)

With this embodiment, one can examine a double-stranded nucleic acid in SNP or mutations. The NACF determined sequences with a reference sequence are compared. The basic rules of comparison a partial sequence and a complete sequence in the analysis with just two labeled NTs do not differ in principle from those who marked when comparing the sequences using all 4 NTs * apply. For details, see. Sequence comparison and mutational analysis, SNP analysis with 4nts * (Example 1B).

Example 3: Analysis of gene expression

The basic principles of the sequencing reaction in gene expression analysis correspond to those of the sequencing reaction NACs long (Fig. 7). The basic principles for the implementation of a reaction cycle (the choice of NT * structure, the polymerase, the reaction conditions for the NT * -Einbaureaktion and the cleavage reaction), as well as for the detection of the signals from the built NT *, correspond to those in the method for sequencing long NACs. The main differences between the two procedures is the choice of material and - Preparation and processing of the data obtained.

Selection of the material:

Gene products can be derived from various biological specimens, such as single cells, cell populations, tissue, or of complete organisms. Biological fluids such as blood, sputum or cerebrospinal fluid can serve as a source of gene products. The methods for the recovery of the gene products from the various biological objects are shown as recordable following references: "Molecular cloning", 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" In 1999, V303, "cDNA library protocols" in 1997, Ed. IG Cowell, Humana Press Inc ..

It can either be the entirety of the isolated gene and an be used by a pre-selection of selected part of it in the sequencing reaction. By pre-selection can reduce the amount of the analyzed gene '. The pre-selection may, for example, by molecular biology techniques such as PCR amplification, gel separation or hybridization carried out with other nucleic acid chains ( "Molecular cloning", 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" In 1999, V303, "cDNA library protocols "in 1997, IG Ed. Cowell, Humana Press Inc.)

Preferably, the totality of the gene is chosen as a starting material.

Preparation of material:

The aim of the preparation of the material is to form bound from the starting material to the surface extension capable gene primer complexes. Which should not exceed bind only one primer per gene.

Primer binding site (PBS): Each gene product preferably has only a primer binding site.

A primer binding site is a sequence portion to allow selective binding of the primer to the gene product.

As a primer binding sites sections can be used in the nucleic acid sequence in the analyte sequences occur naturally (eg polyA stretches in mRNA). A primer binding site may also be introduced in addition to the gene product (Molecular cloning "1989, ed. Maniatis, Cold Spring Harbor Laboratory," Method in Enzymology "In 1999, V303," cDNA library protocols "in 1997, Ed. IG Cowell, Humana Press Inc. ).

For the sake of simplifying the analysis, it may be important that a uniform as possible primer binding site is present in all gene products. Then primer can be used with a uniform structure in the reaction. The composition of the primer binding site is does not restrict. Its length is preferably between 10 and 100 NTs. The primer binding site may carry a functional group, for example for binding of the gene product to the surface. This functional group may be for example a biotin or digoxigenin group.

As an example for the introduction of a primer binding site in the gene the nucleotide tailing is described by antisense cDNA fragments.

First single cDNAs of mRNAs are synthesized. The result is a population of cDNA molecules, which are a copy of the mRNA population, so-called antisense cDNA. (Molecular cloning "1989, ed. Maniatis, Cold Spring Harbor Laboratory," Method in Enzymology "In 1999, V303," cDNA library protocols "in 1997, Ed. IG Cowell, Humana Press Inc.). With a terminal deoxynucleotidyl can be more ( for example between 10 and 20) nucleoside monophosphates to the 3 'end of the antisense cDNA build, for example, mentioned several adenosine monophosphate ((dA) n-tail). the resulting fragment is used for binding of the primer, in this example a (dT ) n-primer used ( "Molecular cloning" 1989 J.Sambrook et al. Cold Spring Harbor Press laborotary, "Method in Enzymology" in 1999, v.303, p.37-38).

Primers for Secruenzierungsreaktion: This has the function to enable start at a single location of the gene product. Preferably, it binds to the primer binding site in the gene product. The composition and length of primer are not limited. Besides the start function, the primer can also perform other functions, such as creating, for example, a compound of the gene product primer Komlexe the reaction surface. Primers should be so adapted to the length and composition of the primer binding site that the primers allows the start of the sequencing reaction with the respective polymerase. Preferably, the length of the primer 6-100 NTs, optimally 15-30 NTs. The primer may carry a functional group, for example, is used for binding of the primer to the surface, for example, is one such functional group is a biotin group (see Fig. Portion immobilization). They should not interfere with the sequencing. The synthesis of such a primer may for example be carried out or can be created as custom synthesis at a commercial supplier, eg MWG-Biotech GmbH, Germany, with the DNA synthesizer 380A Applied Biosystems.

It can also be used different primers, a defined set of primers, or primer mixture.

The primer may be fixed prior to hybridization to the analyte fragments on the surface using different techniques or synthesized directly on the surface of US Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al, for example, by (McGall et al. U.S. Pat. 5981734, "microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 S.767, Timofeev et al. Nucleic Acids Research (NAR) in 1996 , v.24 S.3142, Ghosh et al. 1987 NAR v.15 S.5353, Gingeras et al. NAR 1987 v.15 S.5373, Maskos et al. NAR 1992 v.20 S.1679).

The primers are bound to the surface at a density between 10 to 100 microns per 100 2, 100 to 10,000 per 100 micron 2, 10,000 to 1,000,000 per lOOμm 2 or greater than 1,000,000 per 100 microns. 2

The primer or primer mixture is incubated with gene under hybridizing conditions which allow it to selectively bind to the primer binding site of each gene. This primer hybridization (annealing) can occur before (1), while (2) or after (3) the binding of the gene products to the surface. If Genprodükte exist as double-stranded nucleic acids, they are before hybridization denatured by heat ( "Molecular cloning" 1989 J.Sambrook et al. Cold Spring Harbor laborotary Press). The optimization of hybridization conditions will depend on the exact structure of the primer binding site and the primer and can be determined by Rychlik et al. (NAR 1990 v.18 S.6409) calculated. In the following these hybridization conditions are called standard hybridization conditions.

If the starting material is a poly-A-stretch or a poly dA track comprises (eg mRNA, cDNA sense or antisense cDNA with (dA) -tail n), one can use an oligo-dT primer. However, it may also be a primer mixture consisting of 12 different primers having the following general structure 5 are used '(K) n MN3'. Wherein (n) is between 10 and 50, preferably between 20 and 30. "K" stands for dT or dU, "M" and "N" are each dA, dT or dU, dC, dG (eg. B .5 "* -dTdTdTdTdTdTdTdTdTdT 10 dTdTdTdTdTdTdTdTdTdT 2Q DADG-3" *). Such a primer mix allows an exact start of the sequencing reaction at the end of the poly A segment, or poly-dA track (geankerter primer).

Fixation of gene primer complexes to the surface (binding or immobilization of gene products):

The aim of fixing (binding, immobilization) is to fix gene primer complexes on a suitable flat surface in a manner that a cyclic enzymatic sequencing reaction can proceed. This can be done to the surface, for example, by binding of the primer (see above) or the gene product.

The order of steps in the binding of gene product primer complexes can be variable:

4) The gene product can first primer complexes in a solution by hybridization (annealing) is formed and then bonded to the surface.

5) primer can first be bound to a surface and gene products are then hybridized to the bound primer, said gene product-primer complexes are formed (gene indirectly bound to the surface)

6) The gene products can be initially bonded to the surface (Gend products directly bonded to the surface), and the primers are hybridized to the bound gene products in the subsequent step, said gene product-primer complexes are formed.

The immobilization of the gene products to the surface can therefore be done by direct or indirect binding.

Surface and response surface are to be understood in this application as equivalent terms, unless it is explicitly stated on a different meaning. the surface of a solid phase of any material serving as a reaction surface. This material is preferably inert to enzymatic reactions and does not cause interference of the detection. Silicon, glass, ceramic, plastic (such as polycarbonate or polystyrene), metal (gold, silver, or aluminum), or any other material that meets these functional requirements may be used. Preferably, the surface is not deformed, because otherwise be expected with a distortion of the signals in the repeated detection.

If a gel-like solid phase (the surface of a gel) is used, this gel may be for example, an agarose or polyacrylamide gel. The gel is preferably to molecules having a molecular weight under 5000 Da freely passable (for example, a 1 to 2% agarose gel, or 5 to 15% polyacrylamide gel to be used). Such a gel surface has other solid surfaces against the advantage that there is a much lower non-specific binding of NT * s to the surface. The binding of the gene product primer complexes on the surface of the detection of the fluorescent signals of built NTs * is possible. The signals of free NTs * are not detected because they do not bind to the material of the gel and thus are not immobilized. The gel is preferably fixed on a solid support. This solid support may be silicone, glass, ceramics, be plastic (eg, polycarbonates or polystyrenes), metal (gold, silver, or aluminum), or any other material. The thickness of the gel is preferably not more than 0.1 mm. However, the gel thickness is preferably greater than the simple depth of focus of the objective, so that non-specifically bound to the solid support NTs * out of the focal plane and are detected thereby. If the depth of field is, for example 0.3 micron, the gel thickness is preferably between 1 .mu.m and 100 .mu.m. The surface can be prepared as a continuous surface or composite as discontinuous, made up of individual small components (for example, agarose beads) surface. The reaction surface must be large enough to bind the necessary number of gene products with appropriate density. The reaction surface should preferably be no greater than 20 cm 2.

The various cycle steps require an exchange of the different reaction solutions above the surface. The reaction surface is preferably part of a reaction vessel. The reaction vessel is again preferably a component of a reaction apparatus with flow-through device. The flow device allows replacement of the solutions in the reaction vessel. The exchange can with a controlled by a computer pumping device or manually. It is important that the surface does not dry out. Preferably, the volume of the reaction vessel is less than 50 ul. Ideally, its volume is less than 1 ul.

If the fixing of the gene product-primer complexes carried on the surface on the gene, this can be done, for example, by the binding of the gene products of one of the two chain ends. This can be achieved by appropriate covalent, affine or other bonds. There are many examples of immobilization of nucleic acids known (McGall et al. US Patent 5,412,087, Nikiforov et al. US Patent 5,610,287, Barrett et al. US Patent 5,482,867, Mirzabekov et al. US Patent 5,981,734, "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, p.138, Allemand et al. 1997 Biophysical Journal, V.73, S.2064, Trabesinger et al. Analytical Chemistry 1999, V.71, p.279, Osborne et al. Analytical Chemistry 2000, V.72, S.3678, Timofeev et al. Nucleic Acid Research (NAR) 1996 v.24 S.3142, Ghosh et al . NAR 1987 v.15 S.5353, Gingeras et al. NAR 1987 v.15 S.5373, Maskos et al. NAR 1992 v.20 S.1679). The fixing can be achieved on the flat surface by a non-specific binding, such as by drying the sample containing the gene products. The gene products are bound to the surface at a density between 10 and 100 microns per 100 2, 100 to 10,000 per 100 micron 2, 10,000 to 1000,000 per lOOμm. 2

The time required for the detection density of extension capable gene primer complexes is about 10 to 100 per 100 microns. 2 You can take place before, during or reached after hybridization of the primers to the gene products.

As examples, various methods of bonding are presented in more detail below:

In one embodiment, the binding of the gene product primer complexes via biotin-avidin or biotin-streptavidin binding is carried out. In this case, avidin or streptavidin on the surface is covalently bound to the 5 'end of the primer is modified with biotin. After hybridization of the modified primer with the gene products (in solution) they are fixed on the surface coated with avidin / streptavidin surface. The concentration of biotin-labeled gene-primer complexes, and the time of incubation of this solution with the surface is that a suitable density is achieved for the sequencing selected.

In another embodiment, suitable for the sequencing reaction primer before the sequencing reaction to be fixed on the surface by suitable methods (see above). The single gene products, each with a primer binding site per Genproduktmolekül are thus incubated (annealing) under hybridization conditions. They bind to the fixed primer and thereby bonded to the surface (indirect binding). The concentration of single-gene and hybridization parameters (eg, temperature, time, buffer) are chosen so that to reach a suitable density for the sequencing of approximately 10 to 100 extension capable gene primer complexes per 100 microns. 2 Following hybridization, unbound gene products are removed by washing. In this embodiment, a surface with a high density primer is preferred, for example, about 1,000,000 primer per lOOμm 2 or more as the desired density of gene primer complexes is achieved faster higher, wherein the gene products bind only to a portion of the primer ,

In another embodiment the gene products are then incubated directly bonded to the surface (see above) and with primers under hybridization conditions. At a density of about 10 to 100 per gene lOOμm 2 they will try all available gene products with a primer to provide and make available for the Sequenzierugnsreaktion. This can be achieved by high primer concentration, for example 1 to 100 mmol /. 1 At a higher density of the fixed gene products on the surface of, for example, 10,000 to 1,000,000 per lOOμm 2, the time required for the optical detection of the gene product density primer complexes can be achieved during the primer hybridization. The hybridization conditions (eg, temperature, time, buffers, Primerkonzentratin) are to be selected 'that the primers bind only to a portion of the immobilized gene products.

If the surface of a solid phase (for example, silicone or glass) is used for immobilization, preferably a blocking solution on the surface before step (a) placed in each cycle, the * is used to avoid a non-specific adsorption of NTs on the surface. These conditions for a blocking solution meets, for example, an albumin solution (BSA) with pH 8 to 10

Choice of polymerase:

In the choice of the type of polymerase used immobilized nucleic acid (RNA or DNA) plays a decisive role:

If RNA is used as a gene product (eg mRNA) in the sequencing reaction, commercial RNA-dependent DNA polymerases may be used, for example AMV reverse transcriptase (Sigma), M-MLV Reverse Transcriptase (Sigma), HIV reverse transcriptase without RNase Activity. All reverse transcriptases must be largely free of RNase activity ( "Molecular cloning" 1989, ed. Maniatis, Cold Spring Harbor Laboratory).

If DNA is used as a gene product (eg, cDNA), are in principle as polymerases all DNA-dependent DNA poly erasen without 3 "-5" exonuclease activity (DNA Replication "in 1992 Ed. A. Kornberg, Freeman and Company NY) , for example modified T7 polymerase of the type "Sequenase version 2" (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech), polymerase beta various origin (Animal Cell DNA polymerases "1983, Fry M., CRC Press Inc., commercially available thermostable Chimerx) polymerases such as Taq polymerase (Gibco BRL), proHA DNA polymerase (Eurogentec). detection:

As with the sequencing long NACs, the detection comprises the following phases:

1) Preparation for the detection

Carrying out a detection step in each cycle, wherein each detection step proceeds as scanning and the following operations comprising: a) adjusting the position of the lens (X, Y axis), b) adjustment of the focal plane (z-axis), c) detection of the signals of individual molecules assignment of the signal to NT * and assignment of the signal for each gene product, d) displacement of the next position on the surface.

The signals of the complementary strands of the gene products built NTs * are recorded by the scanning of the surface. The scanning process is performed as in the Sequenzieurng long NACs. In this case, the lens is moved step by step over the surface, so that from each surface position, a two-dimensional image (2D image) is formed.

Preparation to Detection:

In the beginning, determines how many copies of the gene for expression analysis are necessary. Several factors play a role. The exact number depends eg on the relative presence of the gene products from the start and on the desired accuracy of the analysis. The number of the analyzed gene products is preferably from 1000 to 10,000,000. For highly expressed genes, the number of analyzed gene products may be low, eg 1000 to 10,000. When analyzing weakly expressed genes must be increased, for example, 100,000 or even more.

There are analyzed recordable as 100,000 individual gene products simultaneously. Here, also weakly expressed genes are represented (for example, with approximately 100 mRNA molecules / cell, which corresponds to approximately 0.02% total mRNA) in the reaction with an average 20 identified gene products.

2) carrying out a detection step in each cycle is equal to the long in the sequencing NACs. Gene products are used in place of NACFs.

analysis:

The obtained data (short sequences) are compared using a program with known gene sequences. Such a program can, for example, a BLAST or FASTA algorithm underlying ( "Introduction to Computational Biology" 1995 MS Waterman Chapman & Hall).

By choosing the method of preparation material is determined among other things, in which portions of the gene sequences are determined and at which strand (sense or antisense) they belong to. For example be determined sequences from NTRs (non-translating-regions) in the use of polyA stretches as a primer binding site in the mRNA. When using the method with antisense cDNA as a template, the sequences determined, inter alia, from the protein-coding regions of the gene products originate.

In a preferred simple variant of the invention, the gene expression is determined only qualitatively. It is only the fact of the expression of certain genes is important.

In another preferred embodiment, a quantitative determination of the ratios between the individual gene products in the mixture of interest. It is known that the activity of a gene in a cell is represented by a population of identical mRNA molecules. In a cell, many genes are active and are thereby differentially expressed, resulting in the presence of many different varying degrees underrepresented mRNA populations. Reference is made in detail to the quantitative analysis of gene expression:

For quantitative analysis of gene expression abundances' individual gene products are determined in the sequencing reaction. The products of strongly expressed genes are represented in the sequencing reaction more often than the weakly expressed genes. After assigning the sequence at certain genes, the proportion of the determined sequences for each gene is of determination. Genes with high expression have a higher proportion of the total population of the gene products as genes with weak expression.

The number of the analyzed gene products is preferably from 1000 to 10,000,000. The exact number of the analyzed gene products depends on the task. For highly expressed genes, they may be low, eg 1000 to 10,000. When analyzing weakly expressed genes must be increased, for example, 100,000 or higher.

Be recordable as 100,000 individual gene products analyzed simultaneously, are also weakly expressed genes such as approximately 100 mRNA molecules / cell (which corresponds to approximately 0.02% total mRNA) represented in the reaction with an average of 20 identified gene products,

As an internal control hybridization, immobilization and the sequencing reaction, the following method can be used:

It can be used as a control, one or more nucleic acid chains with known sequences. The composition of these control sequences is not limited, provided they did not interfere with the identification of the gene products. In the sequence analysis of the mRNA samples used in the analysis of the cDNA samples corresponding to DNA control samples RNA control samples. These samples are preferably carried in all steps. They can be added, for example after mRNA isolation. In general, the control samples are prepared in the same manner for sequence analysis as the analyzed gene products.

The control sequences may be added in known, fixed concentrations to be analyzed gene products. Concentrations of the control samples can be different, preferably, these concentrations of between 0.01% and 10% of the total concentration of the sample to be analyzed (100%). The concentration of the mRNA, for example, long / .mu.l, then the concentrations of the control samples are from lpg / ul and lng / ul.

In the quantitative analysis of gene expression and the general metabolic activity of the cells must be taken into account, in particular if a comparison of the expression of certain genes is aimed at different external conditions.

The change in the level of expression of a particular gene may occur as a result of the change in the transcription rate of that gene or as a result of a global change in gene expression in the cell. To monitor the metabolic states in the cell can analyze the expression of the so-called "House-keeping genes". When lack of important metabolites, the general level of expression in the cell is low, for example, so that constitutively expressed genes have a low level of expression.

In principle, all constitutively expressed genes can serve as a "house-keeping genes". As examples, the transferrin receptor gene or the beta-actin gene may be mentioned. The expression of these House-keeping genes thus serves as

Reference for the analysis of the expression of other genes. The

Sequence determination and quantification of the expression of the

House-keeping genes is preferably an integral part of the analysis program for the gene expression.

As with the sequencing long NACs can be labeled sequencing reaction with 4 or labeled 2 and 2 unmarked NT perform *.

Sequence analysis with four labeled NTs * Sequenzanalvse with - 4 labeled NTs *

In a preferred embodiment of the invention all four NTs used in the reaction * with fluorescence dyes are marked.

Here, you use one of the color coding schemes mentioned above. The number of determined NTs for each sequence of a gene product is between 5 and 100, ideally between 20 and 50. These determined sequences are compared using a program with known sequences in gene databases and associated with the corresponding genes. Such a program can, for example BLAST or FASTA algorithm underlying ( "Introduction to Computational Biology" 1995 MS Waterman Chapman & Hall).

A cycle has the following steps: a) addition of a solution of labeled nucleotides (nts *) and polymerase to immobilized nucleic acid chains, b) incubation of the immobilized nucleic acid chains with this solution, under conditions suitable for extension of the complementary strands to a NT, c) washing d) detection of signals from individual molecules e) removing the tag from the unincorporated nucleotides and leading to the termination substituent, f) washing.

Sequence analysis with 2 labeled NTs * and 2 unmarked NTs (2NTs * / 2NTs method).

In another embodiment, modified NTs 2 * 2 and unmodified NTs are used for the analysis of the sequences.

This embodiment is based on the principle that a sequence of 2 signals (labeled NT * s) may include enough information to identify a sequence. The sequence determined is compared with the reference sequence and assigned to a particular position, including:

ACCAAAACACCC - sequence determined (* dCTP and dATP are marked *)

ATCATCGTTCGAAATATCGATCGCCTGATGCC - reference sequence

C AC AAA ACAC-CC (determined associated sequence)

ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence)

Preferably, the sequences determined is allocated using a program of the reference sequence. Such a program can, for example BLAST or FASTA algorithm underlying ( "Introduction to Computational Biology" 1995 MS Waterman Chapman & Hall).

The gene products as described above prepared for sequencing and sequenced with 2NTs * / 2NTs method. Is obtained from gene sequences sections, each sequence representing a sequence of 2NTs *. Known gene sequences serve as reference sequences. To enable accurate correlation of the sequence determined to a known reference sequence, this sequence must be long enough. The length of the determined sequences of more than 20 is preferably NT * s. Since NTs 2 marked * represent only a part of the sequence, the total length of the synthesized complementary strand is about twice as long as the sequence of the detected NTs (NTs detected at 20 * the total length of, for example, an average of 40 NTs) *.

For the synthesis of a complementary strand 4 nucleotides are required. Since the NTs labeled with a fluorescent dye * occur in the present invention as a semi terminators, that is, the termination occurs only when available modified NTs *, unmodified NTs have to be added in an additional step in each cycle in the reaction. The exact position of this step in the cycle can vary. It is important that the labeled NTs * and the unmodified NTs are used separately.

A cycle in this embodiment may look exemplified as follows:

a) adding a solution with modified NTs * and polymerases on the surface with the provided gene products b) incubation of the immobilized nucleic acid chains with this solution, under conditions suitable for extension of the complementary strands to a NT, c) washing d) detection of the signals of individual, modified and in the complementary strands of the newly synthesized gene products built NTs * molecules e) removing the tag and the terminating group in the incorporated nucleotides f) washing g) addition of 2 NTs unmodified polymerases and h) washing.

The concentration of the NTs is preferably less than 1 M, ideally less than 10 microns.

Example 4:

A particular embodiment of the method is the analysis of single nucleotide polymorphisms with sequence-specific primers.

In addition to Section 1 "Abbreviations and Definitions" following terms are defined for this example:

Primer - To clarify the he innovatory thought to be distinguished in this example the following terms: a) a §Primer "is presently generally understood a population of primer molecules having a uniform structure b) ^ more primers." Are "above the text as multiple populations of ., primer molecules understood that have different structure c) a §Primer-Molekül§ represents a single oligonucleotide molecule d) ^ several primer Moleküleξjξ several individual oligonucleotide molecules group; they may have uniform or different structure.

SNP site - a position in NSK, which is examined for the presence or absence of SNP.

Target sequence - part of an overall sequence which is sequenced by the use of a specific primer in the sequencing reaction / determined. A whole sequence can contain multiple target sequences. A target sequence is sufficiently long to ensure the positioning of this target sequence within the overall sequence likely. can target sequences, for example, contain one or more SNP sites.

Recognition sequence - part used for the allocation of these target sequence in the overall sequence of the target sequence.

In this embodiment, the SNP analysis several potential SNP positions are selected in the reference sequence, which are examined in an analyte NSK. These positions correspondingly different, sequence-specific primers are provided. These primers may form a standardized primer set for SNP analysis at a certain question and are uniformly used as a kit for the corresponding analyzes.

The preparation of the material to be analyzed (single on SNP to be investigated and double-stranded nucleic acid chains) has according to the invention the aim of one or more long nucleic acid chains (overall sequence) a population of relatively small, 30-2000 NT long, single-stranded nucleic acid chain fragments (NACFs) to form.

This NACF molecules are randomly on a flat surface with a density of between 10 and 100 microns 1,000,000 a 2, preferably 10 and 100 microns NACFs per 100 2, 100 to 10,000 per 100 microns 2 or 10,000 to 1,000,000 per lOOμm 2 immobilized. Primers are hybridized to the bound on the surface NACFs, so that the density of extension capable NSKF- primer complexes is about 10-100 per lOOμm. 2 Following hybridization, unbound primers are removed and started the sequencing reaction.

Through a selection of target sequences and the sequence-specific primers are only relevant

examined sections of the overall sequence, which reduces the amount of non-relevant information and shortens the analysis time.

This embodiment of the method of SNP analysis on the following principles:

There are selected in a reference sequence bodies in to be examined NACs (total sequence) on single nucleotide polymorphisms (SNPs) are to be checked.

1) specific primers are provided for the analysis of each selected SNP site so that each to be examined SNP site occupies either the next position in 3g direction from the primer or within 2 to 100, preferably 2 to 50, ideally 2 to 20 positions is 3§ direction from the primer. The SNP site is thus within the target sequence, which is determined during the sequencing reaction. several SNP sites are preferably analyzed simultaneously so that several specific primers must be used. The primers are preferably selected so that they have as uniform as possible annealing temperatures, ie differences between melting temperatures of single primer populations are, for example, within a range of about 4 degrees, more preferably within 2 degrees, more preferably within 1 degree.

2) Of the total sequence are short nucleic acid chain derived fragments (NACFs), said fragments are single stranded, and a length of 20 to 2000 NT, preferably of 30 to 500 NT.

3) NACF molecules are immobilized in a random arrangement on the surface.

4) After the hybridization (annealing) of sequence-specific primers to the immobilized on the surface NACFs performing a cycle sequencing reaction, wherein it is determined for each of the reaction NACF molecule involved in a target sequence. The sequencing reaction occurs simultaneously at many molecules.

5) The target sequences determined contain information about the membership to a specific section in the overall sequence and the SNP in this section in the sample to be examined. The length of the target sequences and thus the number of cycles must be selected so that an identification of the sequences can be ensured.

In an advantageous embodiment, the target sequences determined are compared with the reference sequence and assigned by sequence matching. In a sufficiently long identified target sequence can be assigned to a specific position in the reference sequence, they most likely. For example, a sequence of 10 NTs more than 10 ε form various combinations and are thus clearly identified with a high probability in a NSK of only 100,000 NT. After the allocation of the target sequence determined for the particular position within the reference sequence differences in the sequences, the SNPs are visible.

For the identification of the target sequences, both the already known number of the primers, their composition and an already known, subsequent to the primer binding site sequence segment of the reference sequence is used in another advantageous embodiment. Here, the target sequences obtained are analyzed according to their membership of the primers, wherein only the sequences located close to the primer binding site must be considered. For example, if 1000 primers are used, ranging less than 10 NTs of the target sequences obtained in order to allow an association with the corresponding primers.

The sample to be analyzed generally contains a plurality of identical overall sequence molecules, including multiple copies of genomic DNA from cells of a tissue or more identical mRNA populations from cells of a tissue.

a) selection of the SNP site

The inventive method can analyze both known SNP sites as identify new SNP sites. As potential SNP site each position in the NSK may occur. The selection depends on the question, for example, SNP analysis in genes whose products are associated with certain diseases, or SNP analysis in conserved coding regions of the genes which code for membrane receptors, or review of known SNP sites in the regulatory sequences of genes that are important for cell division.

An analyte SNP site within a target sequence that is determined during the sequencing reaction. One can identify several SNP sites within a target sequence. One the other hand also select multiple target sequences, for example, within a gene. It is important that the target sequences are present at a sufficient distance from each other in the overall sequence. This distance is necessary to allow only one sequence-specific primer per NACF hybridized, and it is dependent on the average NACF length: the shorter the target sequences may NACFs, the closer against one another. The SNP sites can be analyzed on both strands of a double stranded nucleic acid chain with adequate primer choice.

The method also offers the possibility, for example several SNP sites of many individuals to control simultaneously (as a sample of a population). Thus, the SNP profile of a population can be examined for example.

b) primers for the sequencing reaction

Sequencing reaction on a single molecule NACF is made possible by a primer molecule. A sequence-specific primers according to the invention is necessary to be able to perform the sequencing reaction in each case at a specific / specific target sequence within the overall sequence. The be used for the analysis of an SNP site, and a target sequence sequence-specific primers constitutes a population of primer molecules with identical structure. Several different primer populations are required for the analysis of several different target sequences.

By using sequence-specific primers only the relevant sequence segments, the target sequences are analyzed. In the inventive method to be sequenced length of the sequences is kept as low as possible, so that the speed of analysis increases.

A sequence-specific primer binds to a specific for him primer binding site in the sequence to be analyzed, PBS. The composition and length of primer are optimized for each potential SNP site or target sequence. Examples of optimization steps in Rychlik et al. NAR shown in 1990 v.18 S.6409. In the primer election or in the choice of PBS (primer binding site), the following aspects require special consideration:

1) to be analyzed SNP site should lie either just after the 3 'end of the primer, or within the next 2 to 50 NTs, preferably 2 to 20 NTs.

2) positioning (the choice of the sequence length and composition) of the PBS to SNP site should be such that the different PBS-sequences and the corresponding primer sequences have similar as possible §Annealing-Temperaturen§ to at as uniform as possible hybridization conditions tie. This can, for example, by changing the PBS-position with respect to the respective SNP site to be analyzed, or by the change in the primer sequence length done (Rychlik et al. NAR 1990 v.18 S.6409).

3) The minimum distance between primers that bind to the same strand in the overall sequence, the average NACF length should not be less.

It can be used for both strands of a double-stranded NSK primer. This allows, for example, close together lying SNP sites collect, or you can make a control of a SNP site in both strands.

Preferably, the length of the primer 6-100 NTs, optimally between 10-30 or 30-40 or 40-50. For different SNP sites or target sequences primers can be used with different length.

For the SNP analysis using sequence-specific primers are primers according to the invention in a hybridization solution to the immobilized on the reaction surface NACFs hybridized (annealing reaction).

c) Immobilization of NACFs

In this embodiment, the NSKF- primer complexes according to the invention exclusively by the NACFs to the surface bound (direct binding of NACFs to the surface), the provided NACF molecules are bonded to the planar surface in a random arrangement.

The immobilization of the NACFs preferably takes place at one of the two chain ends (see above). The immobilization can also be achieved by non-specific binding, such as by drying of the sample containing NACFs on the planar surface. The density of the immobilization can be between 10 and 100, 100 and 10,000, 10,000 and 1,000,000 NACFs per 100 microns. 2

d) Hybridization

The bound NACFs and the primers are incubated under stringent hybridization conditions which allow a highly selective binding (annealing) of the primers to the appropriate primer binding sites of the NACFs. Optimal hybridization conditions will depend on the exact structure of the primer binding sites and the respective primer structures and can be, for example, by Rychlik et al. calculate NAR 1990 v.18 S.6409.

The primers preferably provide a primer mixture. The concentrations of individual sequence-specific primers (individual concentrations of primer populations) are, for example pmol/l and lmmol / 1 between 10, preferably between 0.1μmol / l and 10μmol / l. The total concentration of primers in the primer mixture is preferably between lnmol / 1 and 10 mmol / l. The relationship between individual primer populations may vary. Primers may be added in significant excess over the immobilized NACFs, so that the hybridization time is low.

The time required for the detection density of extension capable NACF primer complexes is about 10 to 100 per 100 microns. 2 You can take place before, during or reached after hybridization of the primers. In a known NACF concentration, the immobilization can be chosen in one embodiment so that the NACFs are bound at a density of about 10 to 1000 molecules per lOOμm. 2 NACFs thus determine the density of NACF primer complexes.

In another embodiment, the density of the immobilized NACFs eg 1,000,000 lOOμm per 2 may be substantially higher than 1000 NACFs lOOμm per 2 lie. The time required for the optical detection of the density NACF primer complexes is achieved during the primer hybridization. The hybridization conditions (eg, temperature, time, buffer) are to be selected so that the primers bind only to a portion of the immobilized NACFs.

With unknown NACF concentration and corresponding unknown Immobilisationsdichte the hybridization (annealing) of primers can lead to the NACFs to a higher than optimal density of NACF primer complexes.

For this reason, in an advantageous embodiment, a part of the NACFs is containing sample for the determination of the optimum density is used. This part is immobilized on a reaction surface, the primers are hybridized to the NACFs and the resulting NACF primer complexes are marked * s NT transmitted by the incorporation of fluorescent dye (eg, Cy3-dCTP, Amersham Pharmacia Biotech). From the determined density can be on the one hand any necessary dilution or concentration of the original sample for the final sequencing approach calculate (The hybridization conditions maintained). On the other hand it necessary changes in the hybridization conditions can be calculated, for example, shortening the hybridization time, the NACF immobilization density remains constant. The quantity ratio of primer populations may be different or the same size. A higher primer concentrations certain example rarer sequences are more likely can be bound in a given period.

The great advantage of the process arrangement described with respect to a process arrangement having immobilized on a surface of sequence-specific primers and a subsequent hybridization of samples of these primers is the significant reduction in the time for the hybridization (annealing) between the sequence-specific primers and the samples to be analyzed on the reaction surface.

Legends to Figures 1 to 8

Key to FIG. 1

Schematic representation of the Sequenzierng a long nucleic acid chain

The sequencing and the reconstruction of long nucleic acid sequences (NACs) is based on the shotgun principle. The sequence of a long DNA piece is in this case determined by the sequencing of small fragments (NACFs) and subsequent reconstruction.

1) the starting material - to be analyzed long nucleic acid sequence, complete sequence

2) fragments from 50-1000 bp - the NACFs generated from the total sequence in the fragmentation step

3) fragments, each with a primer - NACF primer complexes

4) Immobilized fragments - bonded to the planar surface NACF primer complexes, in this embodiment, the bond at the 3 -end of the NACFs carried

5) adding a solution with polymerases and NT * s - the first step in one cycle of the sequencing reaction

6) washing step - after the installation step is washed, the surface

7) Detection - the signals of individual built-NT * s are detected

8) removing the tag and leading to the termination group

Legend to FIG. 2

Examples of general structure of NACF primer complexes

In this embodiment, a single primer binding site (PBS) to the 3 'end of NACFs and is coupled to this PBS binds a single primer.

Legend to Fig. 3

An example of the coupling of a single primer binding site (PBS), which carries a functional group for binding to the surface.

In this case, a double-stranded oligonucleotide complex (3a) having, for example, a modification on both strands (3b), to the double-stranded ligated NACFs (3c). After denaturation single NACFs arise with uniform PBS (3d). Legend to Fig. 4

Another example for the production of a single primer binding site (PBS).

In this case, NTs are coupled to the 3 'end of the single-NACFs (a so-called "tailing"). By Verwendng a single NT creates a uniform PBS.

Legend to FIG. 5

Example of the binding of NACFs to a gel-like reaction surface.

On a fixed base (1) adhered a layer of gel (2), eg a polyacrylamide gel (Fig. 5a), or adhere many gel beads (5), such as agarose beads (Fig. 5b). NACFs (4) are attached to the surface of the gel. The NACFs carry a functional group, such as biotin, and are bound to the gel via streptavidin or avidin (3).

Legend to Fig. 6

Example of a flow-through device

A gel-like reaction surface (1) is mounted on a permeable for the excitation and fluorescence light fixed base (2). Together, they form the lid of the Flow Cell. The fluids in the flow cell can be replaced controlled, the flow cell together with a storage reservoir (3), pump (4) and valve (5) form a flow-through device. On the reaction surface NACF primer complexes are bound (not shown here). The signals from the built-NT * s are detected with the detection apparatus (6).

Legend to Fig. 7

Schematic representation of the analysis of mRNA population

The analysis is based on the sequencing of short sections of mRNA.

1) mRNA - the analyzed mRNA population, in this example consisting of two different mRNA populations of molecules (thin and thick stripes represent mRNA molecules)

2) Immobilized mRNA - bonded to the planar surface mRNA primer complexes, in this example, is carried out, the binding by oligo-dT primer

3) adding a solution with polymerases and NT * s - the first step in one cycle of the sequencing reaction

4) washing step - after the installation step is washed, the surface

5) detection - the signals from individual built NT * s are detected

6) removing the tag and leading to the termination group

Legend to Fig. 8

Example of a detection system

It shows a wide-field optical detection system. After the incorporation of labeled NT * s, the surface (7) is scanned, wherein the fluorescent signals are detected by the individual, coupled to the NTs dye molecules.

FIG. 8a schematic representation of a portion of the reaction surface (gray), which is scanned. The circles respectively correspond to the recording of a 2D image and represent the areas from which the fluorescence signals are detected. A plurality of signals are registered (for example, 100 to 10,000) at the same time single molecule per receptacle. The reaction surface is scanned in each cycle, wherein a plurality of images of different points of the surface are made during the scanning operation. Here signals from incorporated NT * s can be taken up to several million. The high parallelism is the basis of the speed of the process.

FIG. 8B is a receiver (a 2D image) with signals from the individual, built-NT * s.

Fig. 8c cut 8b figure. The detail shows signals from four built-NT * s. Each signal has characteristic properties of the individual molecule signals (s. Description) and can be identified on the basis of these (preferably with the aid of a computer program). Each of the identified signals are the respective X, Y coordinates associated.

Claims

claims;
1. A method for parallel sequence analysis of nucleic acid sequences (nucleic acid chains, NACs), in which
Fragments (NACFs) single NACs with a length of about 50 to 1000 nucleotides generated which may represent overlapping part sequences of a complete sequence, one
The NACFs binds using a single or a plurality of different primer in the form of NACF primer complexes on a reaction surface in a random arrangement, one
a cyclic build-up reaction of the complementary strand of the NACFs using one or more polymerases is carried out by
a) the bound on the surface of NACF primer complexes adding a solution containing one or more polymerases and one (or four modified nucleotides NTs *) that are labeled with fluorescent dyes, the simultaneous use of at least two NTs * * located at each of the NTs fluorescent dyes are selected so that allow the NTs used * by measuring different fluorescence signals differ from each other, wherein the NTs * at the 3 '- modified position structurally such that the polymerase after incorporation of such NT * in a growing complementary strand is not able to another NT * installed in the same strand, wherein the for the termination leading substituent and the fluorescent dye is split off, to b) incubating the obtained in step a) the stationary phase under conditions suitable for extension of the complementary strands are suitable, the complementary strands jeweil s can be extended by one NT *, you
c) washing the obtained in step b) the stationary phase under conditions which are not suitable for removing a complementary strand in a built NTs *, one
d) * detects the individual, built-in complementary strands NTs by measuring the characteristic for each fluorescent dye signal, determining at the same time the relative position of the different fluorescent signals on the reaction surface, one
e) for producing unlabeled (or NTs) NACFs * cleaves leading to the termination substituents and the fluorescent dyes of the appended on the complementary strand NTs, one
f) washing the obtained in stage e) the stationary phase under conditions which are suitable for the removal of the fluorescent dyes and the ligand, one
the steps a) optionally repeated several times to f),
wherein one complexes on the reaction surface and the sequence of these NACFs determines the relative position of individual NACF primer by specific association of the detected in step d) in successive cycles at the respective positions fluorescence signals to the NTs.
2. The method according to claim 1, characterized in that the step a) is repeated several times to f) of the cyclical synthesis reaction, wherein one * used in each cycle only one labeled NT.
3. The method according to claim 1, characterized in that the step a) is repeated several times to f) of the cyclical synthesis reaction, wherein one * used in each cycle two differently labeled NTs respectively.
4. The method according to claim 1, characterized in that the step a) is repeated several times to f) of the cyclical synthesis reaction, wherein one * used in each cycle of four differently labeled NTs respectively.
5. The method according to claim 1, characterized in that the NACs variants of a known reference sequence and steps a) repeated several times to f) of the cyclical synthesis reaction, used alternately two differently labeled NTs respectively * and two unlabeled NTs in the cycles and it determines the total sequences by comparison with the reference sequence.
6. The method according to claims 1 to 5, characterized in that one introduces into the NACFs a primer binding site (PBS) to give in each case introducing a PBS at double NACs to two complementary single strands and the primer binding sites for all NACFs are identical or different have sequences.
7. The method according to claims 1 to 6, characterized in that bringing the NACFs with primers in a solution under conditions which tion for hybridization of the primers to the primer binding sites (PBSs) are capable of NACFs, wherein the primers each other have identical or different sequences, and is then binds the formed NACF primer complexes on the reaction surface.
8. The method according to claims 1 to 6, characterized in that first immobilized the NACFs on the reaction surface and only then brings with primers under conditions suitable for the hybridization of the primers to the primer binding sites (PBSs) of NACFs, wherein NACF ​​primer complexes are formed, wherein the primers to each other have identical or different sequences.
9. The method according to claims 1 to 6, characterized in that the first immobilized primers on the reaction surface and only then is brought into contact with NACFs under conditions for hybridisation of the primers to the primer binding sites
(PBSs) of NACFs, thereby NACFs be bound to the surface and formed NACF primer complexes, wherein the primers to each other have identical or different sequences.
10. The method according to claims 1 to 9, characterized in that the density of the extension capable
NACF primer complexes is between about 10 and 100 per lOOμm. 2
11. The method according to claim 1, characterized in that the nucleic acid sequences (NACs) sequence portions of an overall sequence, and the primers are sequence-specific primers, wherein one single-stranded NACFs with a length of about 30 to 1000 nucleotides provides, corresponding to overlapping partial sequences of the complete sequence, one
binds the NACF molecules directly to a flat surface in a random arrangement, one
performs one or more sequence-specific primers populations hybridization (annealing) to the immobilized NACFs, wherein the density of the individual extension capable NACF primer complexes between 10 and 100 per lOOμm 2 is, one
a cyclic structure of reaction of complementary strands to NACFs performing by
a) to the bound NACF primer complexes adding a solution containing one or more polymerases and one (or four modified nucleotides NTs *) that are labeled with fluorescent dyes, the simultaneous use of at least two NTs * respectively at the NTs * contained fluorescent dyes are selected so as to allow the NTs used * by measuring different fluorescent signals different from each other, wherein the NTs * are modified at the 3 'position structurally such that the polymerase after incorporation of such NT * into a growing complementary strand is not able to incorporate * NT another in the same strand, wherein the leading substituent for the termination and the fluorescent dye is split off, one
b) incubating the obtained in step a) the stationary phase under conditions suitable for extension of the complementary strands, wherein the complementary strands are extended by one NT * is c) washing the obtained in step b) the stationary phase under conditions which are not suitable for removal in a complementary strand built NTs *, you
e) the individual, built-in complementary strands NT * molecules detected by measuring the characteristic for each fluorescent dye signal, determining at the same time the relative position of the different fluorescent signals on the reaction surface, one
e) * cleaves leading to the termination substituents and the fluorescent dyes of the appended on the complementary strand NTs for generating unlabelled (or NTs) NACFs, one
f) washing the obtained in stage e) the stationary phase under conditions suitable to remove the lead to termination groups with the fluorescent dyes, one
the steps a) optionally repeated several times to f),
wherein one complexes on the reaction surface and the sequence of these NACFs determines the relative position of individual NACF primer by specific association of the detected in step d) in successive cycles at the respective positions fluorescence signals to the NTs.
12. A method for the highly parallel analysis of gene expression which comprises providing single-stranded gene products, one
the gene products of a single or a plurality of different primer in the form of gene product binds primer complexes using on a reaction surface in a random arrangement, one
a cyclic build-up reaction of the complementary strand of the gene products using one or more polymerases is carried out by
a) the bound on the surface gene product primer complexes adding a solution containing one or more polymerases and one (or four modified nucleotides NTs *) that are labeled with fluorescent dyes, the simultaneous use of at least two NTs * * located at each of the NTs fluorescent dyes are selected so that allow the NTs used * by measuring different fluorescent signals different from each other, wherein the NTs * at the 3 '- modified position structurally such that the polymerase after incorporation of such NT * in growing a complementary strand is not able to another NT * installed in the same strand, wherein the substituent for the termination and leading the fluorescent dye is split off, one
b) incubating the obtained in step a) the stationary phase under conditions suitable for extension of the complementary strands, wherein the complementary strands are extended by one NT *, one
c) washing the obtained in step b) the stationary phase under conditions which are not suitable for removing a complementary strand in a built NTs *, one
d) * detects the individual, built-in complementary strands NTs by measuring the characteristic for each fluorescent dye signal, determining at the same time the relative position of the different fluorescent signals on the reaction surface, one
e) for producing unlabeled, (NTs or) gene products that lead to termination substituents and the fluorescent dyes * cleaved by the appended on the complementary strand NTs, one
f) washing the obtained in stage e) the stationary phase under conditions which are suitable for the removal of the fluorescent dyes and the ligand, one
the steps a) optionally repeated several times to f),
wherein one determines the relative position of individual gene product primer complexes on the reaction surface and the sequence of these gene products by specific association of the detected in step d) in successive cycles at the respective positions fluorescence signals to the NTs and one from the determined partial sequences of the identity of the gene products certainly.
13. The method according to claim 12, characterized in that the steps a) are repeated several times to f) of the cyclical synthesis reaction, wherein one * used in each cycle only one labeled NT.
14. The method according to claim 12, characterized in that the step a) is repeated several times to f) of the cyclical synthesis reaction, wherein one * used in each cycle two differently labeled NTs respectively.
15. The method according to claim 12, characterized in that the step a) is repeated several times to f) of the cyclical synthesis reaction, wherein one * used in each cycle of four differently labeled NTs respectively.
16. The method according to claim 12, characterized in that already known genes serve as reference sequences and steps a) to f) of the cyclical synthesis reaction repeated several times to give alternately uses two differently labeled NTs respectively * and two unlabeled NTs in the cycles and one which determines the identity of the gene by comparison of the sequences obtained to the reference sequences.
17. The method according to claims 12 to 16, characterized in that one introduces into the gene products in each case a primer binding site (PBS), wherein the primer binding sites each have identical or different sequences for all gene products.
18. The method according to claims 12 to 17, characterized in that one brings the gene with primers in a solution under conditions suitable for the hybridization of the primers to the primer binding sites
(PBSs) of the gene products are suitable, with the primers to each other have identical or different sequences, and one complex then binds the gene formed-primer on the reaction surface.
19. The method according to claims 12 to 17, characterized in that first immobilized, the gene products to the reaction surface and only then is brought into contact with the primers under conditions for hybridisation of the primers to the primer binding sites (PBSs) of the gene products are suitable, with gene product primer complexes are formed, wherein the primers to each other have identical or different sequences.
20. The method according to claims 12 to 17, characterized in that the first immobilized primers on the reaction surface and only then is brought into contact with gene products under conditions for hybridisation of the primers to the primer binding site
(PBSs) of the gene products are capable of causing gene products bound to the surface and gene-primer complexes are formed, wherein the primers to each other have identical or different sequences.
21. The method according to claims 12 to 20, characterized in that the density of the gene product capable extension primer complexes between about 10 and 100 per lOOμm. 2
22. The method according to claims 1 to 21 characterized in that the fluorescent dye is split off together with the leading to the termination substituents.
23. The method according to claims 1 to 21 characterized in that initially the fluorescent dye is split off and is only thereafter is cleaved leading to termination substituent.
24. The method according to claims 1 to 21, characterized in that is used in the detection step (d) following detection modes: wide-field epifluorescence microscopy, laser scanning fluorescence microscopy, TIRF microscopy.
25. The method according to claims 1 or 11, characterized in that it is a method for SNP analysis and using a sequence-specific primers for identifying each SNP site in the overall sequence.
26. The method according to claim 25, characterized in that the number of parallel analyte SNP sites is greater than 2, and using a sequence-specific primers for each SNP site.
27. The method according to claims 1 to 26, characterized in that the reaction surface from the group consisting of silicone, glass, ceramics, plastics, gels is selected.
28. The method according to claim 27, characterized in that the plastics polycarbonates or polystyrenes or derivatives thereof.
29. The method according to claim 27, characterized in that the gels agarose or polyacrylamide or derivatives thereof.
30. The method according to claim 29, characterized in that the gels are 1 to 2% agarose gels, or 10 to 15% polyacrylamide gels.
31. The method according to claims 1 to 30, characterized in that the polymerase is a DNA polymerase which lacks 3 '-5' -Exonukleaseaktivität.
32. A method according to claim 31, characterized in that the polymerase from the group consisting of viral DNA polymerases from the Sequenase type bacterial thermolabile and thermostable DNA polymerases, DNA polymerases beta from eukaryotes and Reversen- is selected transcriptases.
33. The method according to claims 1 to 32, characterized in that the fluorescent dyes are selected from the group consisting selected from cyanine dyes, rhodamines, xanthenes, porphyrins and their derivatives.
34. carrier for implementing the method according to claims 1 to 33, characterized in that the nucleic acid chains or fragments thereof are immobilized in a random arrangement on its surface, wherein the density of the immobilized nucleic acid chain molecules or their fragments between 10 and 100 per lOOμm 2.
35. carrier for implementing the method according to claims 1 to 33, characterized in that on its surface the nucleic acid chains or fragments thereof are immobilized in a random arrangement, wherein the density of the immobilized nucleic acid chain molecules or fragments thereof 100-1000000 is per lOOμm second
36. Kit for performing the method according to claims 1 to 35, characterized in that it comprises a reaction surface (a solid support), for performing the process required for the reaction solutions, one or more polymerases, and nucleotides (nts), of which one to four labeled with fluorescent dyes, wherein the labeled NTs are further structurally modified (NT * or NTs *), that the polymerase after incorporation of such NT * is not in a position in a growing complementary strand, another NT * in the same incorporate strand, wherein the leading to the termination substituent with the fluorescent dye is cleavable
37. Kit according to claim 36, characterized in that it further contains ingredients:
a) for the production of single strands of double strands required reagents, b) nucleic acid molecules which are introduced as a PBS in the NACFs, c) oligonucleotide primers, d) for splitting off the substituent of the fluorescent dyes required reagents, e) washing solutions.
38. Kit according to claim 36 or 37, characterized in that the reaction surface from the group consisting of silicone, glass, ceramics, plastics, gels is selected.
39. Kit according to claim 38, characterized in that the gels are polyacrylamide gels.
40. A kit according to claim 39, characterized in that the gels are from 5 to 30% polyacrylamide gels.
41. Kit according to claims 36 to 40, characterized in that the DNA polymerase is a DNA polymerase without 3'-5 '-Endonukleaseaktivität.
42. Kit according to claims 36 to 41, characterized in that coupled to the nucleotides fluorescent dyes are selected from the group consisting selected from cya nin dyes, rhodamines, xanthenes, porphyrins and their derivatives.
PCT/EP2002/009614 2001-08-29 2002-08-28 Method for analyzing nucleic acid sequences and gene expression WO2003020968A3 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DE10142256.3 2001-08-29
DE10142256 2001-08-29

Publications (2)

Publication Number Publication Date
WO2003020968A2 true true WO2003020968A2 (en) 2003-03-13
WO2003020968A3 true WO2003020968A3 (en) 2003-12-31

Family

ID=7696956

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/009614 WO2003020968A3 (en) 2001-08-29 2002-08-28 Method for analyzing nucleic acid sequences and gene expression

Country Status (2)

Country Link
DE (1) DE10239504A1 (en)
WO (1) WO2003020968A3 (en)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005044836A2 (en) 2003-11-05 2005-05-19 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
WO2005080605A2 (en) * 2004-02-19 2005-09-01 Helicos Biosciences Corporation Methods and kits for analyzing polynucleotide sequences
WO2005116262A1 (en) * 2004-05-24 2005-12-08 Helicos Biosciences Corporation Methods and devices for sequencing nucleic acids
WO2006007207A2 (en) * 2004-05-25 2006-01-19 Helicos Biosciences Corporation Methods and devices for nucleic acid sequence determination
EP1692312A2 (en) * 2003-11-12 2006-08-23 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
EP1694859A2 (en) * 2003-10-29 2006-08-30 Bioarray Solutions Ltd Multiplexed nucleic acid analysis by fragmentation of double-stranded dna
WO2007100637A2 (en) * 2006-02-22 2007-09-07 Helicos Biosciences Corporation Methods for mutation detection
EP2366801A1 (en) 2006-06-14 2011-09-21 Verinata Health, Inc Methods for the diagnosis of fetal abnormalities
US8703652B2 (en) 2009-11-06 2014-04-22 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive diagnosis of graft rejection in organ transplant patients
US9035035B2 (en) 2004-11-05 2015-05-19 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
US9051612B2 (en) 2006-09-28 2015-06-09 Illumina, Inc. Compositions and methods for nucleotide sequencing
US9096898B2 (en) 1998-05-01 2015-08-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9411930B2 (en) 2013-02-01 2016-08-09 The Regents Of The University Of California Methods for genome assembly and haplotype phasing
US9605310B2 (en) 2001-12-04 2017-03-28 Illumina Cambridge Limited Labelled nucleotides
US9637777B2 (en) 2003-10-28 2017-05-02 Bioarray Solutions, Ltd. Optimization of gene expression analysis using immobilized capture probes
US9670539B2 (en) 2007-10-19 2017-06-06 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9689032B2 (en) 2011-04-01 2017-06-27 Centrillion Technology Holdings Corporation Methods and systems for sequencing long nucleic acids
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9715573B2 (en) 2015-02-17 2017-07-25 Dovetail Genomics, Llc Nucleic acid sequence assembly
US9718852B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9868978B2 (en) 2005-08-26 2018-01-16 Fluidigm Corporation Single molecule sequencing of captured nucleic acids
US10072287B2 (en) 2009-09-10 2018-09-11 Centrillion Technology Holdings Corporation Methods of targeted sequencing
US10089437B2 (en) 2013-02-01 2018-10-02 The Regents Of The University Of California Methods for genome assembly and haplotype phasing

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2255599C (en) 1996-04-25 2006-09-05 Bioarray Solutions, Llc Light-controlled electrokinetic assembly of particles near surfaces
US7262063B2 (en) 2001-06-21 2007-08-28 Bio Array Solutions, Ltd. Directed assembly of functional heterostructures
US7414116B2 (en) 2002-08-23 2008-08-19 Illumina Cambridge Limited Labelled nucleotides
WO2004018497A3 (en) 2002-08-23 2004-06-17 Colin Barnes Modified nucleotides for polynucleotide sequencing
US7526114B2 (en) 2002-11-15 2009-04-28 Bioarray Solutions Ltd. Analysis, secure access to, and transmission of array images
EP1664722B1 (en) 2003-09-22 2011-11-02 Bioarray Solutions Ltd Surface immobilized polyelectrolyte with multiple functional groups capable of covalently bonding to biomolecules
US7848889B2 (en) 2004-08-02 2010-12-07 Bioarray Solutions, Ltd. Automated analysis of multiplexed probe-target interaction patterns: pattern matching and allele identification
US7883869B2 (en) 2006-12-01 2011-02-08 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
EP2209911B1 (en) 2007-10-19 2013-10-16 The Trustees of Columbia University in the City of New York Dna sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators and a deoxyinosine analogue with a reversible terminator group

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993005183A1 (en) * 1991-09-09 1993-03-18 Baylor College Of Medicine Method and device for rapid dna or rna sequencing determination by a base addition sequencing scheme
WO1993021340A1 (en) * 1992-04-22 1993-10-28 Medical Research Council Dna sequencing method
US5302509A (en) * 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
WO2000006770A1 (en) * 1998-07-30 2000-02-10 Solexa Ltd. Arrayed biomolecules and their use in sequencing
WO2002061126A2 (en) * 2001-01-30 2002-08-08 Solexa Ltd. The preparation of polynucleotide arrays
WO2002088382A2 (en) * 2001-04-27 2002-11-07 Genovoxx Gmbh Method for analysing nucleic acid chains

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US5302509A (en) * 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
WO1993005183A1 (en) * 1991-09-09 1993-03-18 Baylor College Of Medicine Method and device for rapid dna or rna sequencing determination by a base addition sequencing scheme
WO1993021340A1 (en) * 1992-04-22 1993-10-28 Medical Research Council Dna sequencing method
WO2000006770A1 (en) * 1998-07-30 2000-02-10 Solexa Ltd. Arrayed biomolecules and their use in sequencing
WO2002061126A2 (en) * 2001-01-30 2002-08-08 Solexa Ltd. The preparation of polynucleotide arrays
WO2002061127A2 (en) * 2001-01-30 2002-08-08 Solexa Ltd. Arrayed polynucleotides and their use in genome analysis
WO2002088382A2 (en) * 2001-04-27 2002-11-07 Genovoxx Gmbh Method for analysing nucleic acid chains

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TONISSON N ET AL: "UNRAVELLING GENETIC DATA BY ARRAYED PRIMER EXTENSION" CLINICAL CHEMISTRY AND LABORATORY MEDICINE, WALTER DE GRUYTER UND CO, DE, Bd. 38, Nr. 2, 2000, Seiten 165-170, XP001023733 ISSN: 1434-6621 *

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9458500B2 (en) 1998-05-01 2016-10-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9957561B2 (en) 1998-05-01 2018-05-01 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9212393B2 (en) 1998-05-01 2015-12-15 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9096898B2 (en) 1998-05-01 2015-08-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9725764B2 (en) 1998-05-01 2017-08-08 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
US9868985B2 (en) 2000-10-06 2018-01-16 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9725480B2 (en) 2000-10-06 2017-08-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9718852B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9719139B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9605310B2 (en) 2001-12-04 2017-03-28 Illumina Cambridge Limited Labelled nucleotides
US9637777B2 (en) 2003-10-28 2017-05-02 Bioarray Solutions, Ltd. Optimization of gene expression analysis using immobilized capture probes
US7790380B2 (en) 2003-10-29 2010-09-07 Bioarray Solutions, Ltd. Kits for multiplexed nucleic acid analysis by capture of single-stranded DNA produced from double-stranded target fragments
JP2007509629A (en) * 2003-10-29 2007-04-19 バイオアレイ ソリューションズ リミテッド Complex nucleic acid analysis by cleavage of double-stranded dna
EP1694859A2 (en) * 2003-10-29 2006-08-30 Bioarray Solutions Ltd Multiplexed nucleic acid analysis by fragmentation of double-stranded dna
EP1694859A4 (en) * 2003-10-29 2007-08-08 Bioarray Solutions Ltd Multiplexed nucleic acid analysis by fragmentation of double-stranded dna
US8637650B2 (en) 2003-11-05 2014-01-28 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
WO2005044836A3 (en) * 2003-11-05 2007-07-19 Dmitry Cherkasov Macromolecular nucleotide compounds and methods for using the same
WO2005044836A2 (en) 2003-11-05 2005-05-19 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
EP1692312A4 (en) * 2003-11-12 2007-10-17 Helicos Biosciences Corp Short cycle methods for sequencing polynucleotides
US9012144B2 (en) 2003-11-12 2015-04-21 Fluidigm Corporation Short cycle methods for sequencing polynucleotides
EP1692312A2 (en) * 2003-11-12 2006-08-23 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
US9657344B2 (en) 2003-11-12 2017-05-23 Fluidigm Corporation Short cycle methods for sequencing polynucleotides
WO2005080605A2 (en) * 2004-02-19 2005-09-01 Helicos Biosciences Corporation Methods and kits for analyzing polynucleotide sequences
EP2248911A1 (en) * 2004-02-19 2010-11-10 Helicos Biosciences Corporation Methods and kits for analyzing polynucleotide sequences
WO2005080605A3 (en) * 2004-02-19 2005-11-03 Helicos Biosciences Corp Methods and kits for analyzing polynucleotide sequences
WO2005116262A1 (en) * 2004-05-24 2005-12-08 Helicos Biosciences Corporation Methods and devices for sequencing nucleic acids
WO2006007207A2 (en) * 2004-05-25 2006-01-19 Helicos Biosciences Corporation Methods and devices for nucleic acid sequence determination
WO2006007207A3 (en) * 2004-05-25 2007-02-22 Philip Richard Buzby Methods and devices for nucleic acid sequence determination
US9035035B2 (en) 2004-11-05 2015-05-19 Genovoxx Gmbh Macromolecular nucleotide compounds and methods for using the same
US9868978B2 (en) 2005-08-26 2018-01-16 Fluidigm Corporation Single molecule sequencing of captured nucleic acids
WO2007100637A2 (en) * 2006-02-22 2007-09-07 Helicos Biosciences Corporation Methods for mutation detection
WO2007100637A3 (en) * 2006-02-22 2007-11-15 Marie Sutherlin Causey Methods for mutation detection
EP2366801A1 (en) 2006-06-14 2011-09-21 Verinata Health, Inc Methods for the diagnosis of fetal abnormalities
US9051612B2 (en) 2006-09-28 2015-06-09 Illumina, Inc. Compositions and methods for nucleotide sequencing
US9670539B2 (en) 2007-10-19 2017-06-06 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US10072287B2 (en) 2009-09-10 2018-09-11 Centrillion Technology Holdings Corporation Methods of targeted sequencing
US8703652B2 (en) 2009-11-06 2014-04-22 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive diagnosis of graft rejection in organ transplant patients
US9845497B2 (en) 2009-11-06 2017-12-19 The Board Of Trustees Of The Leland Stanford Junior University Non-invasive diagnosis of graft rejection in organ transplant patients
US9689032B2 (en) 2011-04-01 2017-06-27 Centrillion Technology Holdings Corporation Methods and systems for sequencing long nucleic acids
US9411930B2 (en) 2013-02-01 2016-08-09 The Regents Of The University Of California Methods for genome assembly and haplotype phasing
US9910955B2 (en) 2013-02-01 2018-03-06 The Regents Of The University Of California Methods for genome assembly and haplotype phasing
US10089437B2 (en) 2013-02-01 2018-10-02 The Regents Of The University Of California Methods for genome assembly and haplotype phasing
US9715573B2 (en) 2015-02-17 2017-07-25 Dovetail Genomics, Llc Nucleic acid sequence assembly

Also Published As

Publication number Publication date Type
WO2003020968A3 (en) 2003-12-31 application
DE10239504A1 (en) 2003-04-24 application

Similar Documents

Publication Publication Date Title
US7115400B1 (en) Methods of nucleic acid amplification and sequencing
Ansorge Next-generation DNA sequencing techniques
US5427911A (en) Coupled amplification and sequencing of DNA
US5846729A (en) Assaying nucleotides in solution using a fluorescent intensity quenching effect
Graves Powerful tools for genetic analysis come of age
US7425431B2 (en) Polony fluorescent in situ sequencing beads
US6692915B1 (en) Sequencing a polynucleotide on a generic chip
US20060008824A1 (en) Methods and compositions for clonal amplification of nucleic acid
US7666593B2 (en) Single molecule sequencing of captured nucleic acids
US6833246B2 (en) Polynucleotide sequencing
Deyholos et al. High‐density microarrays for gene expression analysis
US20010026919A1 (en) Nucleic acid assays employing universal arrays
US20050100900A1 (en) Method of nucleic acid amplification
US5470707A (en) Hydrogen bond labeling and base sequence determination methods for DNA or RNA
US20120157322A1 (en) Direct Capture, Amplification and Sequencing of Target DNA Using Immobilized Primers
US6214556B1 (en) Method for producing complex DNA methylation fingerprints
US5851772A (en) Microchip method for the enrichment of specific DNA sequences
US20100092952A1 (en) Four-color dna sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US20020055100A1 (en) Method of nucleic acid sequencing
EP0665293A2 (en) Method of determining base sequence of nucleic acid
US6280954B1 (en) Arrayed primer extension technique for nucleic acid analysis
US20060194232A1 (en) Nucleotide compositions and uses thereof
US20030022207A1 (en) Arrayed polynucleotides and their use in genome analysis
US7011949B2 (en) Methods and compositions for producing labeled probe nucleic acids for use in array based comparative genomic hybridization applications
US20090018024A1 (en) Nanogrid rolling circle dna sequencing

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EE ES FI GB GD GE GH GM HU ID IL IN IS JP KE KG KP KR KZ LK LR LS LT LU LV MA MD MG MK MW MX MZ NO NZ PL PT RO RU SD SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
WWW Wipo information: withdrawn in national office

Country of ref document: JP

NENP Non-entry into the national phase in:

Ref country code: JP